SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-b1e1e4c7/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-b1e1e4c7/inputs/seq.fa: 1 curr_seq: _UUCGCUUGGCCCACAAGCUCACGGGCCUACGAAGGAGGGGGGAUUUAGUGAGGCCCACUGGGCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUCGCUUGGCCCACAAGCUCACGGGCCUACGAAGGAGGGGGGAUUUAGUGAGGCCCACUGGGCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 65 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 330 n_atoms_counter: 330 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 2 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 3 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 4 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 7 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 8 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_WHc EntireStructure::rnaStruct limitingSphereRadius : 65.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 16000 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: 2546.824722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 2546.824722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.914364 (E_RNA) where: Base-Base interactions energy: -9.618 where: short stacking energy: -9.618 Base-Backbone interact. energy: -0.000 local terms energy: -253.295900 where: bonds (distance) C4'-P energy: -63.153 bonds (distance) P-C4' energy: -59.047 flat angles C4'-P-C4' energy: -47.725 flat angles P-C4'-P energy: -54.592 tors. eta vs tors. theta energy: -28.780 Dist. restrs. and SS energy: 2809.739 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.345500 Total energy: -157.205529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.205529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.018860 (E_RNA) where: Base-Base interactions energy: -100.490 where: short stacking energy: -69.007 Base-Backbone interact. energy: -0.615 local terms energy: -137.913772 where: bonds (distance) C4'-P energy: -41.355 bonds (distance) P-C4' energy: -46.450 flat angles C4'-P-C4' energy: -28.646 flat angles P-C4'-P energy: -20.316 tors. eta vs tors. theta energy: -1.148 Dist. restrs. and SS energy: 81.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.341000 Total energy: -133.264495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.264495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.410299 (E_RNA) where: Base-Base interactions energy: -84.186 where: short stacking energy: -73.862 Base-Backbone interact. energy: 0.485 local terms energy: -131.709202 where: bonds (distance) C4'-P energy: -36.670 bonds (distance) P-C4' energy: -45.394 flat angles C4'-P-C4' energy: -28.546 flat angles P-C4'-P energy: -17.482 tors. eta vs tors. theta energy: -3.617 Dist. restrs. and SS energy: 82.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.336500 Total energy: -130.202064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.202064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.263574 (E_RNA) where: Base-Base interactions energy: -86.793 where: short stacking energy: -73.109 Base-Backbone interact. energy: -0.698 local terms energy: -116.772020 where: bonds (distance) C4'-P energy: -29.670 bonds (distance) P-C4' energy: -35.905 flat angles C4'-P-C4' energy: -28.727 flat angles P-C4'-P energy: -17.299 tors. eta vs tors. theta energy: -5.171 Dist. restrs. and SS energy: 74.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.332000 Total energy: -147.000425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.000425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.376926 (E_RNA) where: Base-Base interactions energy: -108.010 where: short stacking energy: -80.548 Base-Backbone interact. energy: 1.881 local terms energy: -116.247580 where: bonds (distance) C4'-P energy: -35.271 bonds (distance) P-C4' energy: -34.079 flat angles C4'-P-C4' energy: -23.653 flat angles P-C4'-P energy: -13.938 tors. eta vs tors. theta energy: -9.306 Dist. restrs. and SS energy: 75.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.327500 Total energy: -137.179100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.179100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.909640 (E_RNA) where: Base-Base interactions energy: -99.163 where: short stacking energy: -66.742 Base-Backbone interact. energy: -0.501 local terms energy: -113.246522 where: bonds (distance) C4'-P energy: -37.993 bonds (distance) P-C4' energy: -39.302 flat angles C4'-P-C4' energy: -22.415 flat angles P-C4'-P energy: -9.052 tors. eta vs tors. theta energy: -4.485 Dist. restrs. and SS energy: 75.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.323000 Total energy: -164.708941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.708941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.268033 (E_RNA) where: Base-Base interactions energy: -117.536 where: short stacking energy: -90.670 Base-Backbone interact. energy: 1.884 local terms energy: -122.616346 where: bonds (distance) C4'-P energy: -33.434 bonds (distance) P-C4' energy: -30.500 flat angles C4'-P-C4' energy: -31.343 flat angles P-C4'-P energy: -20.867 tors. eta vs tors. theta energy: -6.473 Dist. restrs. and SS energy: 73.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.318500 Total energy: -138.320237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.320237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.008108 (E_RNA) where: Base-Base interactions energy: -90.157 where: short stacking energy: -54.980 Base-Backbone interact. energy: -0.373 local terms energy: -123.478554 where: bonds (distance) C4'-P energy: -21.560 bonds (distance) P-C4' energy: -48.340 flat angles C4'-P-C4' energy: -21.708 flat angles P-C4'-P energy: -23.347 tors. eta vs tors. theta energy: -8.523 Dist. restrs. and SS energy: 75.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.314000 Total energy: -136.148225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.148225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.983885 (E_RNA) where: Base-Base interactions energy: -83.716 where: short stacking energy: -62.960 Base-Backbone interact. energy: -0.398 local terms energy: -124.870265 where: bonds (distance) C4'-P energy: -31.730 bonds (distance) P-C4' energy: -44.610 flat angles C4'-P-C4' energy: -27.928 flat angles P-C4'-P energy: -17.254 tors. eta vs tors. theta energy: -3.348 Dist. restrs. and SS energy: 72.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.309500 Total energy: -149.594040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.594040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.027879 (E_RNA) where: Base-Base interactions energy: -96.071 where: short stacking energy: -82.010 Base-Backbone interact. energy: 0.140 local terms energy: -134.097630 where: bonds (distance) C4'-P energy: -31.821 bonds (distance) P-C4' energy: -38.821 flat angles C4'-P-C4' energy: -29.924 flat angles P-C4'-P energy: -20.759 tors. eta vs tors. theta energy: -12.772 Dist. restrs. and SS energy: 80.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.305000 Total energy: -143.024810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.024810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.069232 (E_RNA) where: Base-Base interactions energy: -89.914 where: short stacking energy: -71.385 Base-Backbone interact. energy: 6.590 local terms energy: -135.745906 where: bonds (distance) C4'-P energy: -28.321 bonds (distance) P-C4' energy: -50.463 flat angles C4'-P-C4' energy: -27.868 flat angles P-C4'-P energy: -20.895 tors. eta vs tors. theta energy: -8.200 Dist. restrs. and SS energy: 76.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.300500 Total energy: -181.272873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.272873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.765431 (E_RNA) where: Base-Base interactions energy: -110.642 where: short stacking energy: -58.996 Base-Backbone interact. energy: -0.655 local terms energy: -144.468184 where: bonds (distance) C4'-P energy: -36.895 bonds (distance) P-C4' energy: -44.714 flat angles C4'-P-C4' energy: -32.469 flat angles P-C4'-P energy: -21.116 tors. eta vs tors. theta energy: -9.273 Dist. restrs. and SS energy: 74.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.296000 Total energy: -178.000316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.000316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.999511 (E_RNA) where: Base-Base interactions energy: -134.741 where: short stacking energy: -75.228 Base-Backbone interact. energy: -0.696 local terms energy: -115.562889 where: bonds (distance) C4'-P energy: -25.022 bonds (distance) P-C4' energy: -40.347 flat angles C4'-P-C4' energy: -30.998 flat angles P-C4'-P energy: -18.104 tors. eta vs tors. theta energy: -1.092 Dist. restrs. and SS energy: 72.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.291500 Total energy: -209.441256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.441256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.015884 (E_RNA) where: Base-Base interactions energy: -156.311 where: short stacking energy: -93.095 Base-Backbone interact. energy: -0.753 local terms energy: -129.952495 where: bonds (distance) C4'-P energy: -32.976 bonds (distance) P-C4' energy: -37.637 flat angles C4'-P-C4' energy: -28.946 flat angles P-C4'-P energy: -25.848 tors. eta vs tors. theta energy: -4.544 Dist. restrs. and SS energy: 77.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.287000 Total energy: -208.923325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.923325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.687594 (E_RNA) where: Base-Base interactions energy: -141.694 where: short stacking energy: -85.022 Base-Backbone interact. energy: 0.004 local terms energy: -141.997096 where: bonds (distance) C4'-P energy: -36.814 bonds (distance) P-C4' energy: -47.947 flat angles C4'-P-C4' energy: -30.924 flat angles P-C4'-P energy: -13.116 tors. eta vs tors. theta energy: -13.197 Dist. restrs. and SS energy: 74.764 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.282500 Total energy: -243.203726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.203726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.280739 (E_RNA) where: Base-Base interactions energy: -171.774 where: short stacking energy: -105.714 Base-Backbone interact. energy: 0.282 local terms energy: -133.788007 where: bonds (distance) C4'-P energy: -26.721 bonds (distance) P-C4' energy: -37.317 flat angles C4'-P-C4' energy: -27.829 flat angles P-C4'-P energy: -26.283 tors. eta vs tors. theta energy: -15.638 Dist. restrs. and SS energy: 62.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.278000 Total energy: -322.887863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.887863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.146929 (E_RNA) where: Base-Base interactions energy: -253.305 where: short stacking energy: -124.661 Base-Backbone interact. energy: 0.594 local terms energy: -140.436084 where: bonds (distance) C4'-P energy: -24.040 bonds (distance) P-C4' energy: -45.050 flat angles C4'-P-C4' energy: -29.533 flat angles P-C4'-P energy: -19.454 tors. eta vs tors. theta energy: -22.360 Dist. restrs. and SS energy: 70.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.273500 Total energy: -339.506331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.506331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.821884 (E_RNA) where: Base-Base interactions energy: -248.310 where: short stacking energy: -123.845 Base-Backbone interact. energy: -0.639 local terms energy: -156.872568 where: bonds (distance) C4'-P energy: -35.826 bonds (distance) P-C4' energy: -35.763 flat angles C4'-P-C4' energy: -34.229 flat angles P-C4'-P energy: -28.786 tors. eta vs tors. theta energy: -22.269 Dist. restrs. and SS energy: 66.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.269000 Total energy: -339.538363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.538363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.067001 (E_RNA) where: Base-Base interactions energy: -250.155 where: short stacking energy: -135.949 Base-Backbone interact. energy: 1.312 local terms energy: -167.224247 where: bonds (distance) C4'-P energy: -29.750 bonds (distance) P-C4' energy: -44.860 flat angles C4'-P-C4' energy: -34.938 flat angles P-C4'-P energy: -28.532 tors. eta vs tors. theta energy: -29.144 Dist. restrs. and SS energy: 76.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.264500 Total energy: -330.884621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.884621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.599399 (E_RNA) where: Base-Base interactions energy: -260.597 where: short stacking energy: -119.556 Base-Backbone interact. energy: 4.933 local terms energy: -135.935393 where: bonds (distance) C4'-P energy: -30.872 bonds (distance) P-C4' energy: -35.456 flat angles C4'-P-C4' energy: -33.408 flat angles P-C4'-P energy: -19.584 tors. eta vs tors. theta energy: -16.616 Dist. restrs. and SS energy: 60.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.260000 Total energy: -354.784048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.784048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.654743 (E_RNA) where: Base-Base interactions energy: -263.977 where: short stacking energy: -121.285 Base-Backbone interact. energy: -1.477 local terms energy: -150.201474 where: bonds (distance) C4'-P energy: -45.105 bonds (distance) P-C4' energy: -43.748 flat angles C4'-P-C4' energy: -29.612 flat angles P-C4'-P energy: -16.086 tors. eta vs tors. theta energy: -15.651 Dist. restrs. and SS energy: 60.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.255500 Total energy: -325.931128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.931128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.915216 (E_RNA) where: Base-Base interactions energy: -258.620 where: short stacking energy: -129.502 Base-Backbone interact. energy: 0.392 local terms energy: -130.687162 where: bonds (distance) C4'-P energy: -21.858 bonds (distance) P-C4' energy: -36.848 flat angles C4'-P-C4' energy: -39.013 flat angles P-C4'-P energy: -12.445 tors. eta vs tors. theta energy: -20.524 Dist. restrs. and SS energy: 62.984 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.251000 Total energy: -322.848550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.848550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.479278 (E_RNA) where: Base-Base interactions energy: -260.998 where: short stacking energy: -110.973 Base-Backbone interact. energy: -0.616 local terms energy: -128.864691 where: bonds (distance) C4'-P energy: -35.650 bonds (distance) P-C4' energy: -32.268 flat angles C4'-P-C4' energy: -37.338 flat angles P-C4'-P energy: -18.673 tors. eta vs tors. theta energy: -4.936 Dist. restrs. and SS energy: 67.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.246500 Total energy: -319.581408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.581408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.302816 (E_RNA) where: Base-Base interactions energy: -238.482 where: short stacking energy: -114.516 Base-Backbone interact. energy: -0.895 local terms energy: -144.925851 where: bonds (distance) C4'-P energy: -31.938 bonds (distance) P-C4' energy: -37.381 flat angles C4'-P-C4' energy: -39.350 flat angles P-C4'-P energy: -20.573 tors. eta vs tors. theta energy: -15.684 Dist. restrs. and SS energy: 64.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.242000 Total energy: -331.812867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.812867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.707522 (E_RNA) where: Base-Base interactions energy: -251.148 where: short stacking energy: -118.459 Base-Backbone interact. energy: -1.240 local terms energy: -140.319952 where: bonds (distance) C4'-P energy: -36.403 bonds (distance) P-C4' energy: -33.098 flat angles C4'-P-C4' energy: -30.024 flat angles P-C4'-P energy: -17.751 tors. eta vs tors. theta energy: -23.044 Dist. restrs. and SS energy: 60.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.237500 Total energy: -373.371715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.371715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.627294 (E_RNA) where: Base-Base interactions energy: -280.982 where: short stacking energy: -135.713 Base-Backbone interact. energy: -0.419 local terms energy: -155.226652 where: bonds (distance) C4'-P energy: -37.676 bonds (distance) P-C4' energy: -43.254 flat angles C4'-P-C4' energy: -27.181 flat angles P-C4'-P energy: -24.674 tors. eta vs tors. theta energy: -22.441 Dist. restrs. and SS energy: 63.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.233000 Total energy: -373.836303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.836303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.580895 (E_RNA) where: Base-Base interactions energy: -268.783 where: short stacking energy: -132.629 Base-Backbone interact. energy: 1.131 local terms energy: -164.928808 where: bonds (distance) C4'-P energy: -41.354 bonds (distance) P-C4' energy: -37.823 flat angles C4'-P-C4' energy: -42.001 flat angles P-C4'-P energy: -19.545 tors. eta vs tors. theta energy: -24.207 Dist. restrs. and SS energy: 58.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.228500 Total energy: -378.871325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.871325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.628740 (E_RNA) where: Base-Base interactions energy: -296.271 where: short stacking energy: -145.353 Base-Backbone interact. energy: -1.574 local terms energy: -148.783841 where: bonds (distance) C4'-P energy: -28.753 bonds (distance) P-C4' energy: -34.196 flat angles C4'-P-C4' energy: -38.923 flat angles P-C4'-P energy: -23.077 tors. eta vs tors. theta energy: -23.835 Dist. restrs. and SS energy: 67.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.224000 Total energy: -372.797136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.797136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.358736 (E_RNA) where: Base-Base interactions energy: -262.256 where: short stacking energy: -129.236 Base-Backbone interact. energy: -0.736 local terms energy: -168.366915 where: bonds (distance) C4'-P energy: -39.922 bonds (distance) P-C4' energy: -38.115 flat angles C4'-P-C4' energy: -35.418 flat angles P-C4'-P energy: -24.169 tors. eta vs tors. theta energy: -30.742 Dist. restrs. and SS energy: 58.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.219500 Total energy: -350.743032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.743032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.284276 (E_RNA) where: Base-Base interactions energy: -266.476 where: short stacking energy: -131.254 Base-Backbone interact. energy: -2.001 local terms energy: -142.807425 where: bonds (distance) C4'-P energy: -23.919 bonds (distance) P-C4' energy: -39.654 flat angles C4'-P-C4' energy: -32.287 flat angles P-C4'-P energy: -27.581 tors. eta vs tors. theta energy: -19.367 Dist. restrs. and SS energy: 60.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.215000 Total energy: -340.199005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.199005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.484154 (E_RNA) where: Base-Base interactions energy: -258.005 where: short stacking energy: -128.243 Base-Backbone interact. energy: -0.818 local terms energy: -148.661193 where: bonds (distance) C4'-P energy: -31.735 bonds (distance) P-C4' energy: -33.430 flat angles C4'-P-C4' energy: -28.017 flat angles P-C4'-P energy: -22.560 tors. eta vs tors. theta energy: -32.921 Dist. restrs. and SS energy: 67.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.210500 Total energy: -347.856294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.856294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.607348 (E_RNA) where: Base-Base interactions energy: -267.059 where: short stacking energy: -119.590 Base-Backbone interact. energy: -0.544 local terms energy: -144.004122 where: bonds (distance) C4'-P energy: -34.895 bonds (distance) P-C4' energy: -34.216 flat angles C4'-P-C4' energy: -43.638 flat angles P-C4'-P energy: -6.281 tors. eta vs tors. theta energy: -24.974 Dist. restrs. and SS energy: 63.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.206000 Total energy: -322.422031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.422031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.369954 (E_RNA) where: Base-Base interactions energy: -230.151 where: short stacking energy: -99.121 Base-Backbone interact. energy: -0.655 local terms energy: -151.563670 where: bonds (distance) C4'-P energy: -35.937 bonds (distance) P-C4' energy: -41.603 flat angles C4'-P-C4' energy: -36.137 flat angles P-C4'-P energy: -22.978 tors. eta vs tors. theta energy: -14.909 Dist. restrs. and SS energy: 59.948 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.201500 Total energy: -423.735999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.735999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.082816 (E_RNA) where: Base-Base interactions energy: -312.058 where: short stacking energy: -150.549 Base-Backbone interact. energy: -1.977 local terms energy: -172.048369 where: bonds (distance) C4'-P energy: -33.507 bonds (distance) P-C4' energy: -28.700 flat angles C4'-P-C4' energy: -39.754 flat angles P-C4'-P energy: -26.048 tors. eta vs tors. theta energy: -44.039 Dist. restrs. and SS energy: 62.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.197000 Total energy: -377.803676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.803676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.268216 (E_RNA) where: Base-Base interactions energy: -267.371 where: short stacking energy: -141.560 Base-Backbone interact. energy: -0.703 local terms energy: -178.193850 where: bonds (distance) C4'-P energy: -37.729 bonds (distance) P-C4' energy: -34.413 flat angles C4'-P-C4' energy: -43.245 flat angles P-C4'-P energy: -30.134 tors. eta vs tors. theta energy: -32.672 Dist. restrs. and SS energy: 68.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.192500 Total energy: -377.126767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.126767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.159928 (E_RNA) where: Base-Base interactions energy: -277.975 where: short stacking energy: -147.254 Base-Backbone interact. energy: 1.676 local terms energy: -159.860825 where: bonds (distance) C4'-P energy: -30.453 bonds (distance) P-C4' energy: -38.172 flat angles C4'-P-C4' energy: -41.638 flat angles P-C4'-P energy: -20.757 tors. eta vs tors. theta energy: -28.840 Dist. restrs. and SS energy: 59.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.188000 Total energy: -358.059236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.059236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.847730 (E_RNA) where: Base-Base interactions energy: -262.728 where: short stacking energy: -130.846 Base-Backbone interact. energy: -0.606 local terms energy: -161.513662 where: bonds (distance) C4'-P energy: -30.601 bonds (distance) P-C4' energy: -40.701 flat angles C4'-P-C4' energy: -36.564 flat angles P-C4'-P energy: -16.094 tors. eta vs tors. theta energy: -37.553 Dist. restrs. and SS energy: 66.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.183500 Total energy: -374.648513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.648513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.356902 (E_RNA) where: Base-Base interactions energy: -278.273 where: short stacking energy: -138.751 Base-Backbone interact. energy: -0.580 local terms energy: -162.503872 where: bonds (distance) C4'-P energy: -30.871 bonds (distance) P-C4' energy: -44.968 flat angles C4'-P-C4' energy: -31.752 flat angles P-C4'-P energy: -26.553 tors. eta vs tors. theta energy: -28.359 Dist. restrs. and SS energy: 66.708 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.179000 Total energy: -374.358031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.358031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.208518 (E_RNA) where: Base-Base interactions energy: -274.158 where: short stacking energy: -121.314 Base-Backbone interact. energy: 0.998 local terms energy: -161.048308 where: bonds (distance) C4'-P energy: -37.276 bonds (distance) P-C4' energy: -37.427 flat angles C4'-P-C4' energy: -30.785 flat angles P-C4'-P energy: -24.780 tors. eta vs tors. theta energy: -30.781 Dist. restrs. and SS energy: 59.850 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.174500 Total energy: -376.394685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.394685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.307017 (E_RNA) where: Base-Base interactions energy: -279.827 where: short stacking energy: -128.703 Base-Backbone interact. energy: -0.196 local terms energy: -161.284682 where: bonds (distance) C4'-P energy: -36.759 bonds (distance) P-C4' energy: -43.747 flat angles C4'-P-C4' energy: -37.949 flat angles P-C4'-P energy: -18.173 tors. eta vs tors. theta energy: -24.656 Dist. restrs. and SS energy: 64.912 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.170000 Total energy: -391.423340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.423340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.930323 (E_RNA) where: Base-Base interactions energy: -281.287 where: short stacking energy: -141.414 Base-Backbone interact. energy: 0.389 local terms energy: -175.032534 where: bonds (distance) C4'-P energy: -39.509 bonds (distance) P-C4' energy: -45.425 flat angles C4'-P-C4' energy: -37.012 flat angles P-C4'-P energy: -26.292 tors. eta vs tors. theta energy: -26.795 Dist. restrs. and SS energy: 64.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.165500 Total energy: -399.070772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.070772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.077354 (E_RNA) where: Base-Base interactions energy: -286.241 where: short stacking energy: -130.464 Base-Backbone interact. energy: 0.863 local terms energy: -171.699026 where: bonds (distance) C4'-P energy: -43.935 bonds (distance) P-C4' energy: -34.726 flat angles C4'-P-C4' energy: -41.378 flat angles P-C4'-P energy: -20.500 tors. eta vs tors. theta energy: -31.161 Dist. restrs. and SS energy: 58.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.161000 Total energy: -439.835604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.835604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.835247 (E_RNA) where: Base-Base interactions energy: -337.609 where: short stacking energy: -166.277 Base-Backbone interact. energy: -0.394 local terms energy: -165.832237 where: bonds (distance) C4'-P energy: -35.429 bonds (distance) P-C4' energy: -35.128 flat angles C4'-P-C4' energy: -35.770 flat angles P-C4'-P energy: -27.099 tors. eta vs tors. theta energy: -32.407 Dist. restrs. and SS energy: 64.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.156500 Total energy: -412.458348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.458348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.494476 (E_RNA) where: Base-Base interactions energy: -311.294 where: short stacking energy: -149.637 Base-Backbone interact. energy: -0.514 local terms energy: -172.686204 where: bonds (distance) C4'-P energy: -29.600 bonds (distance) P-C4' energy: -39.140 flat angles C4'-P-C4' energy: -41.428 flat angles P-C4'-P energy: -17.499 tors. eta vs tors. theta energy: -45.019 Dist. restrs. and SS energy: 72.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.152000 Total energy: -441.598823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.598823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.144771 (E_RNA) where: Base-Base interactions energy: -324.525 where: short stacking energy: -134.016 Base-Backbone interact. energy: 0.743 local terms energy: -180.362429 where: bonds (distance) C4'-P energy: -44.937 bonds (distance) P-C4' energy: -45.192 flat angles C4'-P-C4' energy: -36.120 flat angles P-C4'-P energy: -26.861 tors. eta vs tors. theta energy: -27.252 Dist. restrs. and SS energy: 62.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.147500 Total energy: -397.138614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.138614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.815461 (E_RNA) where: Base-Base interactions energy: -316.959 where: short stacking energy: -149.450 Base-Backbone interact. energy: -0.775 local terms energy: -142.081642 where: bonds (distance) C4'-P energy: -29.317 bonds (distance) P-C4' energy: -34.386 flat angles C4'-P-C4' energy: -31.392 flat angles P-C4'-P energy: -22.340 tors. eta vs tors. theta energy: -24.647 Dist. restrs. and SS energy: 62.677 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.143000 Total energy: -385.371688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.371688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.551201 (E_RNA) where: Base-Base interactions energy: -273.044 where: short stacking energy: -129.134 Base-Backbone interact. energy: 2.906 local terms energy: -176.412665 where: bonds (distance) C4'-P energy: -37.073 bonds (distance) P-C4' energy: -41.620 flat angles C4'-P-C4' energy: -40.159 flat angles P-C4'-P energy: -26.748 tors. eta vs tors. theta energy: -30.812 Dist. restrs. and SS energy: 61.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.138500 Total energy: -423.011529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.011529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.779343 (E_RNA) where: Base-Base interactions energy: -333.059 where: short stacking energy: -137.032 Base-Backbone interact. energy: -0.651 local terms energy: -153.069367 where: bonds (distance) C4'-P energy: -33.715 bonds (distance) P-C4' energy: -29.099 flat angles C4'-P-C4' energy: -39.227 flat angles P-C4'-P energy: -15.552 tors. eta vs tors. theta energy: -35.476 Dist. restrs. and SS energy: 63.768 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.134000 Total energy: -440.137322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.137322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.821403 (E_RNA) where: Base-Base interactions energy: -332.247 where: short stacking energy: -151.061 Base-Backbone interact. energy: -1.402 local terms energy: -172.173046 where: bonds (distance) C4'-P energy: -32.835 bonds (distance) P-C4' energy: -45.755 flat angles C4'-P-C4' energy: -29.285 flat angles P-C4'-P energy: -25.854 tors. eta vs tors. theta energy: -38.444 Dist. restrs. and SS energy: 65.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.129500 Total energy: -433.539343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.539343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.951673 (E_RNA) where: Base-Base interactions energy: -341.581 where: short stacking energy: -161.425 Base-Backbone interact. energy: -0.664 local terms energy: -154.706295 where: bonds (distance) C4'-P energy: -33.721 bonds (distance) P-C4' energy: -31.869 flat angles C4'-P-C4' energy: -29.383 flat angles P-C4'-P energy: -26.556 tors. eta vs tors. theta energy: -33.178 Dist. restrs. and SS energy: 63.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.125000 Total energy: -431.769848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.769848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.901960 (E_RNA) where: Base-Base interactions energy: -322.203 where: short stacking energy: -147.428 Base-Backbone interact. energy: 3.651 local terms energy: -178.349902 where: bonds (distance) C4'-P energy: -37.627 bonds (distance) P-C4' energy: -32.472 flat angles C4'-P-C4' energy: -49.032 flat angles P-C4'-P energy: -27.195 tors. eta vs tors. theta energy: -32.024 Dist. restrs. and SS energy: 65.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.120500 Total energy: -434.175452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.175452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.239090 (E_RNA) where: Base-Base interactions energy: -317.928 where: short stacking energy: -150.760 Base-Backbone interact. energy: -0.728 local terms energy: -174.582799 where: bonds (distance) C4'-P energy: -33.760 bonds (distance) P-C4' energy: -42.278 flat angles C4'-P-C4' energy: -41.459 flat angles P-C4'-P energy: -23.115 tors. eta vs tors. theta energy: -33.971 Dist. restrs. and SS energy: 59.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.116000 Total energy: -420.672673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.672673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.054583 (E_RNA) where: Base-Base interactions energy: -315.638 where: short stacking energy: -131.942 Base-Backbone interact. energy: -1.056 local terms energy: -166.360371 where: bonds (distance) C4'-P energy: -42.808 bonds (distance) P-C4' energy: -48.631 flat angles C4'-P-C4' energy: -31.455 flat angles P-C4'-P energy: -21.691 tors. eta vs tors. theta energy: -21.775 Dist. restrs. and SS energy: 62.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.111500 Total energy: -444.629551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.629551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.525603 (E_RNA) where: Base-Base interactions energy: -337.267 where: short stacking energy: -152.535 Base-Backbone interact. energy: -0.481 local terms energy: -169.778442 where: bonds (distance) C4'-P energy: -37.377 bonds (distance) P-C4' energy: -41.755 flat angles C4'-P-C4' energy: -36.318 flat angles P-C4'-P energy: -21.979 tors. eta vs tors. theta energy: -32.349 Dist. restrs. and SS energy: 62.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.107000 Total energy: -464.910687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.910687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.981253 (E_RNA) where: Base-Base interactions energy: -335.315 where: short stacking energy: -158.624 Base-Backbone interact. energy: -1.706 local terms energy: -191.960428 where: bonds (distance) C4'-P energy: -41.177 bonds (distance) P-C4' energy: -39.184 flat angles C4'-P-C4' energy: -42.013 flat angles P-C4'-P energy: -32.835 tors. eta vs tors. theta energy: -36.752 Dist. restrs. and SS energy: 64.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.102500 Total energy: -439.638162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.638162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.148306 (E_RNA) where: Base-Base interactions energy: -320.115 where: short stacking energy: -147.718 Base-Backbone interact. energy: -0.654 local terms energy: -184.379556 where: bonds (distance) C4'-P energy: -43.170 bonds (distance) P-C4' energy: -44.597 flat angles C4'-P-C4' energy: -34.295 flat angles P-C4'-P energy: -27.719 tors. eta vs tors. theta energy: -34.598 Dist. restrs. and SS energy: 65.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.098000 Total energy: -497.106665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.106665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.735476 (E_RNA) where: Base-Base interactions energy: -383.452 where: short stacking energy: -166.155 Base-Backbone interact. energy: 3.570 local terms energy: -188.853044 where: bonds (distance) C4'-P energy: -38.198 bonds (distance) P-C4' energy: -42.644 flat angles C4'-P-C4' energy: -45.752 flat angles P-C4'-P energy: -24.935 tors. eta vs tors. theta energy: -37.324 Dist. restrs. and SS energy: 71.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.093500 Total energy: -496.108656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.108656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.549136 (E_RNA) where: Base-Base interactions energy: -370.500 where: short stacking energy: -153.554 Base-Backbone interact. energy: 0.677 local terms energy: -184.726757 where: bonds (distance) C4'-P energy: -38.762 bonds (distance) P-C4' energy: -43.496 flat angles C4'-P-C4' energy: -45.237 flat angles P-C4'-P energy: -19.167 tors. eta vs tors. theta energy: -38.065 Dist. restrs. and SS energy: 58.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.089000 Total energy: -528.539055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.539055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.587008 (E_RNA) where: Base-Base interactions energy: -409.508 where: short stacking energy: -183.160 Base-Backbone interact. energy: -1.003 local terms energy: -185.076518 where: bonds (distance) C4'-P energy: -35.416 bonds (distance) P-C4' energy: -43.866 flat angles C4'-P-C4' energy: -37.800 flat angles P-C4'-P energy: -24.501 tors. eta vs tors. theta energy: -43.494 Dist. restrs. and SS energy: 67.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.084500 Total energy: -492.490081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.490081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.208492 (E_RNA) where: Base-Base interactions energy: -372.754 where: short stacking energy: -180.194 Base-Backbone interact. energy: -0.501 local terms energy: -186.952670 where: bonds (distance) C4'-P energy: -31.769 bonds (distance) P-C4' energy: -37.855 flat angles C4'-P-C4' energy: -42.845 flat angles P-C4'-P energy: -26.284 tors. eta vs tors. theta energy: -48.199 Dist. restrs. and SS energy: 67.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.080000 Total energy: -488.582272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.582272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.881586 (E_RNA) where: Base-Base interactions energy: -348.077 where: short stacking energy: -163.394 Base-Backbone interact. energy: -0.068 local terms energy: -199.737227 where: bonds (distance) C4'-P energy: -43.622 bonds (distance) P-C4' energy: -41.169 flat angles C4'-P-C4' energy: -41.640 flat angles P-C4'-P energy: -30.468 tors. eta vs tors. theta energy: -42.840 Dist. restrs. and SS energy: 59.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.075500 Total energy: -483.796037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.796037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.345222 (E_RNA) where: Base-Base interactions energy: -359.513 where: short stacking energy: -173.852 Base-Backbone interact. energy: -0.588 local terms energy: -185.245041 where: bonds (distance) C4'-P energy: -33.334 bonds (distance) P-C4' energy: -39.554 flat angles C4'-P-C4' energy: -43.206 flat angles P-C4'-P energy: -32.739 tors. eta vs tors. theta energy: -36.412 Dist. restrs. and SS energy: 61.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.071000 Total energy: -475.075047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.075047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.710859 (E_RNA) where: Base-Base interactions energy: -355.080 where: short stacking energy: -168.562 Base-Backbone interact. energy: 0.273 local terms energy: -178.904235 where: bonds (distance) C4'-P energy: -39.191 bonds (distance) P-C4' energy: -37.497 flat angles C4'-P-C4' energy: -39.016 flat angles P-C4'-P energy: -25.947 tors. eta vs tors. theta energy: -37.254 Dist. restrs. and SS energy: 58.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.066500 Total energy: -469.803779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.803779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.974804 (E_RNA) where: Base-Base interactions energy: -348.225 where: short stacking energy: -165.310 Base-Backbone interact. energy: -0.297 local terms energy: -185.452204 where: bonds (distance) C4'-P energy: -30.942 bonds (distance) P-C4' energy: -46.290 flat angles C4'-P-C4' energy: -37.941 flat angles P-C4'-P energy: -34.381 tors. eta vs tors. theta energy: -35.899 Dist. restrs. and SS energy: 64.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.062000 Total energy: -517.210179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.210179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.868829 (E_RNA) where: Base-Base interactions energy: -386.190 where: short stacking energy: -176.253 Base-Backbone interact. energy: -2.359 local terms energy: -191.319993 where: bonds (distance) C4'-P energy: -46.006 bonds (distance) P-C4' energy: -42.450 flat angles C4'-P-C4' energy: -38.709 flat angles P-C4'-P energy: -30.983 tors. eta vs tors. theta energy: -33.172 Dist. restrs. and SS energy: 62.659 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.057500 Total energy: -529.051125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.051125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.036773 (E_RNA) where: Base-Base interactions energy: -419.862 where: short stacking energy: -179.613 Base-Backbone interact. energy: 0.428 local terms energy: -174.601879 where: bonds (distance) C4'-P energy: -32.031 bonds (distance) P-C4' energy: -37.211 flat angles C4'-P-C4' energy: -38.150 flat angles P-C4'-P energy: -22.676 tors. eta vs tors. theta energy: -44.535 Dist. restrs. and SS energy: 64.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.053000 Total energy: -530.586411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.586411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.663672 (E_RNA) where: Base-Base interactions energy: -410.093 where: short stacking energy: -170.824 Base-Backbone interact. energy: -0.316 local terms energy: -180.254666 where: bonds (distance) C4'-P energy: -35.190 bonds (distance) P-C4' energy: -38.447 flat angles C4'-P-C4' energy: -39.438 flat angles P-C4'-P energy: -28.701 tors. eta vs tors. theta energy: -38.479 Dist. restrs. and SS energy: 60.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.048500 Total energy: -543.051825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.051825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.903794 (E_RNA) where: Base-Base interactions energy: -421.483 where: short stacking energy: -179.597 Base-Backbone interact. energy: -0.224 local terms energy: -186.196075 where: bonds (distance) C4'-P energy: -37.188 bonds (distance) P-C4' energy: -43.003 flat angles C4'-P-C4' energy: -41.112 flat angles P-C4'-P energy: -24.592 tors. eta vs tors. theta energy: -40.301 Dist. restrs. and SS energy: 64.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.044000 Total energy: -526.319915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.319915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.806165 (E_RNA) where: Base-Base interactions energy: -394.177 where: short stacking energy: -174.836 Base-Backbone interact. energy: 2.161 local terms energy: -197.790666 where: bonds (distance) C4'-P energy: -43.153 bonds (distance) P-C4' energy: -41.028 flat angles C4'-P-C4' energy: -43.790 flat angles P-C4'-P energy: -26.817 tors. eta vs tors. theta energy: -43.003 Dist. restrs. and SS energy: 63.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.039500 Total energy: -513.021184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.021184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.964850 (E_RNA) where: Base-Base interactions energy: -401.587 where: short stacking energy: -173.027 Base-Backbone interact. energy: 2.255 local terms energy: -174.632535 where: bonds (distance) C4'-P energy: -35.930 bonds (distance) P-C4' energy: -31.772 flat angles C4'-P-C4' energy: -37.068 flat angles P-C4'-P energy: -31.069 tors. eta vs tors. theta energy: -38.793 Dist. restrs. and SS energy: 60.944 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.035000 Total energy: -514.299193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.299193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.658195 (E_RNA) where: Base-Base interactions energy: -400.850 where: short stacking energy: -169.377 Base-Backbone interact. energy: 0.665 local terms energy: -176.472894 where: bonds (distance) C4'-P energy: -39.785 bonds (distance) P-C4' energy: -44.016 flat angles C4'-P-C4' energy: -35.790 flat angles P-C4'-P energy: -24.009 tors. eta vs tors. theta energy: -32.872 Dist. restrs. and SS energy: 62.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.030500 Total energy: -505.841362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.841362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.997440 (E_RNA) where: Base-Base interactions energy: -392.830 where: short stacking energy: -164.114 Base-Backbone interact. energy: 0.080 local terms energy: -177.247442 where: bonds (distance) C4'-P energy: -29.166 bonds (distance) P-C4' energy: -40.289 flat angles C4'-P-C4' energy: -44.201 flat angles P-C4'-P energy: -27.657 tors. eta vs tors. theta energy: -35.936 Dist. restrs. and SS energy: 64.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.026000 Total energy: -514.147113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.147113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.715286 (E_RNA) where: Base-Base interactions energy: -381.784 where: short stacking energy: -184.470 Base-Backbone interact. energy: -1.351 local terms energy: -189.579849 where: bonds (distance) C4'-P energy: -39.140 bonds (distance) P-C4' energy: -42.362 flat angles C4'-P-C4' energy: -38.178 flat angles P-C4'-P energy: -30.819 tors. eta vs tors. theta energy: -39.080 Dist. restrs. and SS energy: 58.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.021500 Total energy: -511.442883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.442883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.028745 (E_RNA) where: Base-Base interactions energy: -373.723 where: short stacking energy: -177.161 Base-Backbone interact. energy: -1.126 local terms energy: -201.179713 where: bonds (distance) C4'-P energy: -37.277 bonds (distance) P-C4' energy: -45.616 flat angles C4'-P-C4' energy: -49.208 flat angles P-C4'-P energy: -24.547 tors. eta vs tors. theta energy: -44.532 Dist. restrs. and SS energy: 64.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.017000 Total energy: -532.003900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.003900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.698368 (E_RNA) where: Base-Base interactions energy: -391.301 where: short stacking energy: -178.148 Base-Backbone interact. energy: -0.924 local terms energy: -206.473005 where: bonds (distance) C4'-P energy: -47.119 bonds (distance) P-C4' energy: -41.237 flat angles C4'-P-C4' energy: -46.356 flat angles P-C4'-P energy: -28.069 tors. eta vs tors. theta energy: -43.691 Dist. restrs. and SS energy: 66.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.012500 Total energy: -524.156154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.156154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.578869 (E_RNA) where: Base-Base interactions energy: -392.619 where: short stacking energy: -180.077 Base-Backbone interact. energy: -1.273 local terms energy: -189.686364 where: bonds (distance) C4'-P energy: -39.265 bonds (distance) P-C4' energy: -40.169 flat angles C4'-P-C4' energy: -41.011 flat angles P-C4'-P energy: -21.776 tors. eta vs tors. theta energy: -47.464 Dist. restrs. and SS energy: 59.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.008000 Total energy: -513.793854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.793854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.586194 (E_RNA) where: Base-Base interactions energy: -386.085 where: short stacking energy: -178.949 Base-Backbone interact. energy: 0.282 local terms energy: -200.782401 where: bonds (distance) C4'-P energy: -43.746 bonds (distance) P-C4' energy: -48.023 flat angles C4'-P-C4' energy: -38.272 flat angles P-C4'-P energy: -32.789 tors. eta vs tors. theta energy: -37.952 Dist. restrs. and SS energy: 72.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.003500 Total energy: -516.281709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.281709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.175862 (E_RNA) where: Base-Base interactions energy: -392.703 where: short stacking energy: -173.705 Base-Backbone interact. energy: 3.215 local terms energy: -186.687553 where: bonds (distance) C4'-P energy: -35.193 bonds (distance) P-C4' energy: -46.690 flat angles C4'-P-C4' energy: -41.437 flat angles P-C4'-P energy: -24.518 tors. eta vs tors. theta energy: -38.849 Dist. restrs. and SS energy: 59.894 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 0.999000 Total energy: -525.425356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.425356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.513497 (E_RNA) where: Base-Base interactions energy: -397.219 where: short stacking energy: -180.908 Base-Backbone interact. energy: -1.487 local terms energy: -194.807428 where: bonds (distance) C4'-P energy: -40.390 bonds (distance) P-C4' energy: -43.693 flat angles C4'-P-C4' energy: -38.350 flat angles P-C4'-P energy: -32.091 tors. eta vs tors. theta energy: -40.283 Dist. restrs. and SS energy: 68.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 0.994500 Total energy: -523.546856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.546856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.966816 (E_RNA) where: Base-Base interactions energy: -383.548 where: short stacking energy: -173.140 Base-Backbone interact. energy: -0.734 local terms energy: -202.684678 where: bonds (distance) C4'-P energy: -40.985 bonds (distance) P-C4' energy: -39.579 flat angles C4'-P-C4' energy: -42.677 flat angles P-C4'-P energy: -37.788 tors. eta vs tors. theta energy: -41.656 Dist. restrs. and SS energy: 63.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 0.990000 Total energy: -528.220449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.220449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.904243 (E_RNA) where: Base-Base interactions energy: -395.013 where: short stacking energy: -182.224 Base-Backbone interact. energy: 1.226 local terms energy: -196.117259 where: bonds (distance) C4'-P energy: -42.786 bonds (distance) P-C4' energy: -34.454 flat angles C4'-P-C4' energy: -45.117 flat angles P-C4'-P energy: -22.324 tors. eta vs tors. theta energy: -51.436 Dist. restrs. and SS energy: 61.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 0.985500 Total energy: -540.008025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.008025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.464268 (E_RNA) where: Base-Base interactions energy: -400.391 where: short stacking energy: -184.097 Base-Backbone interact. energy: -0.139 local terms energy: -205.934550 where: bonds (distance) C4'-P energy: -40.972 bonds (distance) P-C4' energy: -48.239 flat angles C4'-P-C4' energy: -37.450 flat angles P-C4'-P energy: -31.334 tors. eta vs tors. theta energy: -47.939 Dist. restrs. and SS energy: 66.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 0.981000 Total energy: -519.829506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.829506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.336742 (E_RNA) where: Base-Base interactions energy: -395.797 where: short stacking energy: -181.915 Base-Backbone interact. energy: 0.944 local terms energy: -189.483928 where: bonds (distance) C4'-P energy: -41.555 bonds (distance) P-C4' energy: -38.894 flat angles C4'-P-C4' energy: -34.170 flat angles P-C4'-P energy: -32.377 tors. eta vs tors. theta energy: -42.488 Dist. restrs. and SS energy: 64.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 0.976500 Total energy: -531.418497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.418497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.553748 (E_RNA) where: Base-Base interactions energy: -399.794 where: short stacking energy: -173.315 Base-Backbone interact. energy: -0.942 local terms energy: -190.817725 where: bonds (distance) C4'-P energy: -38.367 bonds (distance) P-C4' energy: -50.550 flat angles C4'-P-C4' energy: -42.527 flat angles P-C4'-P energy: -23.881 tors. eta vs tors. theta energy: -35.493 Dist. restrs. and SS energy: 60.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 0.972000 Total energy: -529.675044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.675044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.420340 (E_RNA) where: Base-Base interactions energy: -399.204 where: short stacking energy: -187.714 Base-Backbone interact. energy: -0.582 local terms energy: -187.634145 where: bonds (distance) C4'-P energy: -31.813 bonds (distance) P-C4' energy: -42.568 flat angles C4'-P-C4' energy: -44.140 flat angles P-C4'-P energy: -22.952 tors. eta vs tors. theta energy: -46.162 Dist. restrs. and SS energy: 57.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 0.967500 Total energy: -542.934852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.934852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.876996 (E_RNA) where: Base-Base interactions energy: -410.029 where: short stacking energy: -182.408 Base-Backbone interact. energy: -0.654 local terms energy: -194.193350 where: bonds (distance) C4'-P energy: -39.879 bonds (distance) P-C4' energy: -37.395 flat angles C4'-P-C4' energy: -46.575 flat angles P-C4'-P energy: -24.998 tors. eta vs tors. theta energy: -45.347 Dist. restrs. and SS energy: 61.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 0.963000 Total energy: -551.745086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.745086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.392720 (E_RNA) where: Base-Base interactions energy: -410.356 where: short stacking energy: -177.958 Base-Backbone interact. energy: -0.372 local terms energy: -209.664757 where: bonds (distance) C4'-P energy: -41.048 bonds (distance) P-C4' energy: -45.513 flat angles C4'-P-C4' energy: -41.523 flat angles P-C4'-P energy: -34.673 tors. eta vs tors. theta energy: -46.908 Dist. restrs. and SS energy: 68.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 0.958500 Total energy: -541.947193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.947193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.854533 (E_RNA) where: Base-Base interactions energy: -403.903 where: short stacking energy: -187.221 Base-Backbone interact. energy: -1.143 local terms energy: -197.807867 where: bonds (distance) C4'-P energy: -46.151 bonds (distance) P-C4' energy: -41.467 flat angles C4'-P-C4' energy: -44.803 flat angles P-C4'-P energy: -19.520 tors. eta vs tors. theta energy: -45.867 Dist. restrs. and SS energy: 60.907 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 0.954000 Total energy: -542.279733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.279733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.646092 (E_RNA) where: Base-Base interactions energy: -412.844 where: short stacking energy: -180.977 Base-Backbone interact. energy: -1.409 local terms energy: -186.393196 where: bonds (distance) C4'-P energy: -38.828 bonds (distance) P-C4' energy: -39.490 flat angles C4'-P-C4' energy: -38.285 flat angles P-C4'-P energy: -21.969 tors. eta vs tors. theta energy: -47.821 Dist. restrs. and SS energy: 58.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 0.949500 Total energy: -549.636217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.636217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.609963 (E_RNA) where: Base-Base interactions energy: -414.866 where: short stacking energy: -186.271 Base-Backbone interact. energy: -0.476 local terms energy: -203.267784 where: bonds (distance) C4'-P energy: -46.468 bonds (distance) P-C4' energy: -43.196 flat angles C4'-P-C4' energy: -36.943 flat angles P-C4'-P energy: -26.277 tors. eta vs tors. theta energy: -50.384 Dist. restrs. and SS energy: 68.974 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 0.945000 Total energy: -554.931790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.931790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.756326 (E_RNA) where: Base-Base interactions energy: -419.121 where: short stacking energy: -181.702 Base-Backbone interact. energy: -0.400 local terms energy: -196.235749 where: bonds (distance) C4'-P energy: -39.176 bonds (distance) P-C4' energy: -48.719 flat angles C4'-P-C4' energy: -40.785 flat angles P-C4'-P energy: -21.710 tors. eta vs tors. theta energy: -45.846 Dist. restrs. and SS energy: 60.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 0.940500 Total energy: -579.737227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.737227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.170810 (E_RNA) where: Base-Base interactions energy: -439.236 where: short stacking energy: -185.496 Base-Backbone interact. energy: -0.768 local terms energy: -199.166897 where: bonds (distance) C4'-P energy: -40.864 bonds (distance) P-C4' energy: -37.611 flat angles C4'-P-C4' energy: -48.126 flat angles P-C4'-P energy: -29.257 tors. eta vs tors. theta energy: -43.309 Dist. restrs. and SS energy: 59.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 0.936000 Total energy: -568.763259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.763259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.935576 (E_RNA) where: Base-Base interactions energy: -432.454 where: short stacking energy: -177.893 Base-Backbone interact. energy: -0.949 local terms energy: -199.532052 where: bonds (distance) C4'-P energy: -37.931 bonds (distance) P-C4' energy: -43.068 flat angles C4'-P-C4' energy: -49.823 flat angles P-C4'-P energy: -26.636 tors. eta vs tors. theta energy: -42.074 Dist. restrs. and SS energy: 64.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 0.931500 Total energy: -567.551084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.551084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.044691 (E_RNA) where: Base-Base interactions energy: -427.990 where: short stacking energy: -186.241 Base-Backbone interact. energy: -0.561 local terms energy: -203.493913 where: bonds (distance) C4'-P energy: -40.426 bonds (distance) P-C4' energy: -44.433 flat angles C4'-P-C4' energy: -44.689 flat angles P-C4'-P energy: -28.885 tors. eta vs tors. theta energy: -45.060 Dist. restrs. and SS energy: 64.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 0.927000 Total energy: -557.017834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.017834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.559022 (E_RNA) where: Base-Base interactions energy: -427.241 where: short stacking energy: -205.330 Base-Backbone interact. energy: -0.531 local terms energy: -201.787466 where: bonds (distance) C4'-P energy: -45.749 bonds (distance) P-C4' energy: -40.910 flat angles C4'-P-C4' energy: -44.026 flat angles P-C4'-P energy: -26.053 tors. eta vs tors. theta energy: -45.050 Dist. restrs. and SS energy: 72.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 0.922500 Total energy: -566.152131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.152131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.751599 (E_RNA) where: Base-Base interactions energy: -426.103 where: short stacking energy: -200.196 Base-Backbone interact. energy: -0.711 local terms energy: -202.937577 where: bonds (distance) C4'-P energy: -37.306 bonds (distance) P-C4' energy: -42.528 flat angles C4'-P-C4' energy: -46.237 flat angles P-C4'-P energy: -26.278 tors. eta vs tors. theta energy: -50.587 Dist. restrs. and SS energy: 63.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 0.918000 Total energy: -563.296227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.296227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.901883 (E_RNA) where: Base-Base interactions energy: -413.018 where: short stacking energy: -189.569 Base-Backbone interact. energy: -0.937 local terms energy: -211.946586 where: bonds (distance) C4'-P energy: -45.796 bonds (distance) P-C4' energy: -48.585 flat angles C4'-P-C4' energy: -46.179 flat angles P-C4'-P energy: -26.518 tors. eta vs tors. theta energy: -44.868 Dist. restrs. and SS energy: 62.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 0.913500 Total energy: -567.638533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.638533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.224953 (E_RNA) where: Base-Base interactions energy: -422.568 where: short stacking energy: -186.946 Base-Backbone interact. energy: -0.725 local terms energy: -206.931461 where: bonds (distance) C4'-P energy: -33.026 bonds (distance) P-C4' energy: -46.078 flat angles C4'-P-C4' energy: -45.577 flat angles P-C4'-P energy: -32.724 tors. eta vs tors. theta energy: -49.526 Dist. restrs. and SS energy: 62.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 0.909000 Total energy: -560.551075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.551075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.696169 (E_RNA) where: Base-Base interactions energy: -416.973 where: short stacking energy: -190.749 Base-Backbone interact. energy: -1.989 local terms energy: -204.734245 where: bonds (distance) C4'-P energy: -44.219 bonds (distance) P-C4' energy: -45.377 flat angles C4'-P-C4' energy: -40.452 flat angles P-C4'-P energy: -25.711 tors. eta vs tors. theta energy: -48.975 Dist. restrs. and SS energy: 63.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 0.904500 Total energy: -565.483174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.483174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.067726 (E_RNA) where: Base-Base interactions energy: -414.138 where: short stacking energy: -182.310 Base-Backbone interact. energy: -0.432 local terms energy: -209.497910 where: bonds (distance) C4'-P energy: -46.335 bonds (distance) P-C4' energy: -47.753 flat angles C4'-P-C4' energy: -43.456 flat angles P-C4'-P energy: -28.091 tors. eta vs tors. theta energy: -43.862 Dist. restrs. and SS energy: 58.585 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 0.900000 Total energy: -588.875696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.875696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.826596 (E_RNA) where: Base-Base interactions energy: -445.757 where: short stacking energy: -203.504 Base-Backbone interact. energy: -2.394 local terms energy: -206.675691 where: bonds (distance) C4'-P energy: -42.996 bonds (distance) P-C4' energy: -38.516 flat angles C4'-P-C4' energy: -49.182 flat angles P-C4'-P energy: -27.154 tors. eta vs tors. theta energy: -48.828 Dist. restrs. and SS energy: 65.951 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -567.870801 recalc. total energy: -567.870801 numberOfNucleotides: 65 initial temperature kT: 1.350000 moves confirmed at first: 8660094 moves confirmed later: 10038857 all moves confirmed: 18698951 percent of confirmed moves: 11.686844 out arg RESULTS//1/G-quadruplex-b1e1e4c7_01 nucl1: 0, chain1: A, <---> nucl2: 2, chain2: A type of interaction: GA_SHt nucl1: 0, chain1: A, <---> nucl2: 3, chain2: A type of interaction: GG_WHc nucl1: 0, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_HWc nucl1: 1, chain1: A, <---> nucl2: 4, chain2: A type of interaction: GG_WHc nucl1: 1, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_HWc nucl1: 3, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GG_WHc nucl1: 4, chain1: A, <---> nucl2: 7, chain2: A type of interaction: GG_WHc nucl1: 6, chain1: A, <---> nucl2: 8, chain2: A type of interaction: GA_SHt nucl1: 6, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_WHc nucl1: 7, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_WHc Time of doing 1600000 iterations: 934.507 seconds