SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-519c63a3/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-519c63a3/inputs/seq.fa: 1 curr_seq: _GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 111 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 560 n_atoms_counter: 560 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 2 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 3 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 4 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 7 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 8 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_WHc EntireStructure::rnaStruct limitingSphereRadius : 111.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 16000 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: 2255.823341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 2255.823341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.615392 (E_RNA) where: Base-Base interactions energy: -16.379 where: short stacking energy: -16.379 Base-Backbone interact. energy: -0.000 local terms energy: -432.236561 where: bonds (distance) C4'-P energy: -107.845 bonds (distance) P-C4' energy: -100.201 flat angles C4'-P-C4' energy: -81.499 flat angles P-C4'-P energy: -93.226 tors. eta vs tors. theta energy: -49.465 Dist. restrs. and SS energy: 2704.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.345500 Total energy: -238.382500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.382500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.212393 (E_RNA) where: Base-Base interactions energy: -126.310 where: short stacking energy: -117.784 Base-Backbone interact. energy: 2.279 local terms energy: -182.181471 where: bonds (distance) C4'-P energy: -56.534 bonds (distance) P-C4' energy: -63.898 flat angles C4'-P-C4' energy: -53.894 flat angles P-C4'-P energy: -2.496 tors. eta vs tors. theta energy: -5.358 Dist. restrs. and SS energy: 67.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.341000 Total energy: -242.284570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.284570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.523059 (E_RNA) where: Base-Base interactions energy: -90.455 where: short stacking energy: -85.044 Base-Backbone interact. energy: 1.886 local terms energy: -231.954519 where: bonds (distance) C4'-P energy: -70.043 bonds (distance) P-C4' energy: -71.448 flat angles C4'-P-C4' energy: -42.792 flat angles P-C4'-P energy: -39.111 tors. eta vs tors. theta energy: -8.560 Dist. restrs. and SS energy: 78.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.336500 Total energy: -225.067748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.067748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.608362 (E_RNA) where: Base-Base interactions energy: -104.246 where: short stacking energy: -91.863 Base-Backbone interact. energy: -1.063 local terms energy: -181.299646 where: bonds (distance) C4'-P energy: -55.282 bonds (distance) P-C4' energy: -59.244 flat angles C4'-P-C4' energy: -38.501 flat angles P-C4'-P energy: -41.086 tors. eta vs tors. theta energy: 12.813 Dist. restrs. and SS energy: 61.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.332000 Total energy: -244.436006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.436006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.723526 (E_RNA) where: Base-Base interactions energy: -129.494 where: short stacking energy: -78.373 Base-Backbone interact. energy: -0.364 local terms energy: -160.865287 where: bonds (distance) C4'-P energy: -62.541 bonds (distance) P-C4' energy: -43.671 flat angles C4'-P-C4' energy: -46.887 flat angles P-C4'-P energy: -25.073 tors. eta vs tors. theta energy: 17.306 Dist. restrs. and SS energy: 46.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.327500 Total energy: -253.819404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.819404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.364104 (E_RNA) where: Base-Base interactions energy: -118.587 where: short stacking energy: -111.719 Base-Backbone interact. energy: -0.789 local terms energy: -178.987397 where: bonds (distance) C4'-P energy: -61.228 bonds (distance) P-C4' energy: -67.221 flat angles C4'-P-C4' energy: -19.748 flat angles P-C4'-P energy: -24.379 tors. eta vs tors. theta energy: -6.411 Dist. restrs. and SS energy: 44.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.323000 Total energy: -306.242660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.242660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.738936 (E_RNA) where: Base-Base interactions energy: -148.114 where: short stacking energy: -105.487 Base-Backbone interact. energy: -1.966 local terms energy: -198.659409 where: bonds (distance) C4'-P energy: -54.606 bonds (distance) P-C4' energy: -56.473 flat angles C4'-P-C4' energy: -48.421 flat angles P-C4'-P energy: -34.211 tors. eta vs tors. theta energy: -4.948 Dist. restrs. and SS energy: 42.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.318500 Total energy: -272.320474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.320474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.649844 (E_RNA) where: Base-Base interactions energy: -156.576 where: short stacking energy: -110.633 Base-Backbone interact. energy: 0.469 local terms energy: -159.542970 where: bonds (distance) C4'-P energy: -45.193 bonds (distance) P-C4' energy: -57.376 flat angles C4'-P-C4' energy: -41.995 flat angles P-C4'-P energy: -23.904 tors. eta vs tors. theta energy: 8.925 Dist. restrs. and SS energy: 43.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.314000 Total energy: -296.523782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.523782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.222227 (E_RNA) where: Base-Base interactions energy: -141.137 where: short stacking energy: -130.580 Base-Backbone interact. energy: -0.551 local terms energy: -203.534820 where: bonds (distance) C4'-P energy: -48.133 bonds (distance) P-C4' energy: -55.711 flat angles C4'-P-C4' energy: -57.188 flat angles P-C4'-P energy: -33.629 tors. eta vs tors. theta energy: -8.874 Dist. restrs. and SS energy: 48.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.309500 Total energy: -303.227078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.227078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.707434 (E_RNA) where: Base-Base interactions energy: -145.528 where: short stacking energy: -123.804 Base-Backbone interact. energy: 1.352 local terms energy: -207.531888 where: bonds (distance) C4'-P energy: -60.912 bonds (distance) P-C4' energy: -60.996 flat angles C4'-P-C4' energy: -55.021 flat angles P-C4'-P energy: -22.075 tors. eta vs tors. theta energy: -8.527 Dist. restrs. and SS energy: 48.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.305000 Total energy: -282.208335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.208335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.585425 (E_RNA) where: Base-Base interactions energy: -147.266 where: short stacking energy: -106.591 Base-Backbone interact. energy: 0.124 local terms energy: -184.443520 where: bonds (distance) C4'-P energy: -57.910 bonds (distance) P-C4' energy: -47.339 flat angles C4'-P-C4' energy: -53.104 flat angles P-C4'-P energy: -30.601 tors. eta vs tors. theta energy: 4.510 Dist. restrs. and SS energy: 49.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.300500 Total energy: -354.468780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.468780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.367275 (E_RNA) where: Base-Base interactions energy: -188.860 where: short stacking energy: -136.925 Base-Backbone interact. energy: 0.546 local terms energy: -211.052998 where: bonds (distance) C4'-P energy: -50.461 bonds (distance) P-C4' energy: -66.518 flat angles C4'-P-C4' energy: -42.263 flat angles P-C4'-P energy: -39.640 tors. eta vs tors. theta energy: -12.171 Dist. restrs. and SS energy: 44.898 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.296000 Total energy: -366.729599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.729599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.746702 (E_RNA) where: Base-Base interactions energy: -203.690 where: short stacking energy: -132.561 Base-Backbone interact. energy: 2.784 local terms energy: -210.840288 where: bonds (distance) C4'-P energy: -63.786 bonds (distance) P-C4' energy: -60.309 flat angles C4'-P-C4' energy: -38.804 flat angles P-C4'-P energy: -34.990 tors. eta vs tors. theta energy: -12.951 Dist. restrs. and SS energy: 45.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.291500 Total energy: -390.803682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.803682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.373558 (E_RNA) where: Base-Base interactions energy: -207.099 where: short stacking energy: -138.111 Base-Backbone interact. energy: -1.805 local terms energy: -217.469933 where: bonds (distance) C4'-P energy: -44.923 bonds (distance) P-C4' energy: -67.318 flat angles C4'-P-C4' energy: -58.664 flat angles P-C4'-P energy: -38.884 tors. eta vs tors. theta energy: -7.681 Dist. restrs. and SS energy: 35.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.287000 Total energy: -394.604543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.604543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.438720 (E_RNA) where: Base-Base interactions energy: -234.875 where: short stacking energy: -130.442 Base-Backbone interact. energy: -1.568 local terms energy: -200.995230 where: bonds (distance) C4'-P energy: -62.288 bonds (distance) P-C4' energy: -65.009 flat angles C4'-P-C4' energy: -42.953 flat angles P-C4'-P energy: -29.925 tors. eta vs tors. theta energy: -0.820 Dist. restrs. and SS energy: 42.834 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.282500 Total energy: -417.295802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.295802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.729053 (E_RNA) where: Base-Base interactions energy: -255.952 where: short stacking energy: -135.835 Base-Backbone interact. energy: 1.396 local terms energy: -215.173568 where: bonds (distance) C4'-P energy: -46.215 bonds (distance) P-C4' energy: -64.531 flat angles C4'-P-C4' energy: -60.378 flat angles P-C4'-P energy: -31.731 tors. eta vs tors. theta energy: -12.318 Dist. restrs. and SS energy: 52.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.278000 Total energy: -453.232744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.232744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.829355 (E_RNA) where: Base-Base interactions energy: -290.152 where: short stacking energy: -167.272 Base-Backbone interact. energy: -1.722 local terms energy: -209.954721 where: bonds (distance) C4'-P energy: -52.393 bonds (distance) P-C4' energy: -50.248 flat angles C4'-P-C4' energy: -57.186 flat angles P-C4'-P energy: -36.554 tors. eta vs tors. theta energy: -13.574 Dist. restrs. and SS energy: 48.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.273500 Total energy: -467.980097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.980097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.613389 (E_RNA) where: Base-Base interactions energy: -280.676 where: short stacking energy: -156.059 Base-Backbone interact. energy: 1.124 local terms energy: -233.062044 where: bonds (distance) C4'-P energy: -56.461 bonds (distance) P-C4' energy: -70.887 flat angles C4'-P-C4' energy: -46.643 flat angles P-C4'-P energy: -42.049 tors. eta vs tors. theta energy: -17.022 Dist. restrs. and SS energy: 44.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.269000 Total energy: -487.514345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.514345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.223802 (E_RNA) where: Base-Base interactions energy: -309.801 where: short stacking energy: -170.154 Base-Backbone interact. energy: -0.863 local terms energy: -227.559654 where: bonds (distance) C4'-P energy: -65.059 bonds (distance) P-C4' energy: -53.408 flat angles C4'-P-C4' energy: -53.384 flat angles P-C4'-P energy: -23.333 tors. eta vs tors. theta energy: -32.376 Dist. restrs. and SS energy: 50.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.264500 Total energy: -523.581662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.581662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.037580 (E_RNA) where: Base-Base interactions energy: -329.420 where: short stacking energy: -176.339 Base-Backbone interact. energy: -1.506 local terms energy: -230.111498 where: bonds (distance) C4'-P energy: -66.835 bonds (distance) P-C4' energy: -49.496 flat angles C4'-P-C4' energy: -55.996 flat angles P-C4'-P energy: -29.829 tors. eta vs tors. theta energy: -27.955 Dist. restrs. and SS energy: 37.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.260000 Total energy: -575.709901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.709901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.379261 (E_RNA) where: Base-Base interactions energy: -366.494 where: short stacking energy: -203.522 Base-Backbone interact. energy: -1.400 local terms energy: -254.485595 where: bonds (distance) C4'-P energy: -60.893 bonds (distance) P-C4' energy: -62.340 flat angles C4'-P-C4' energy: -62.467 flat angles P-C4'-P energy: -30.423 tors. eta vs tors. theta energy: -38.363 Dist. restrs. and SS energy: 46.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.255500 Total energy: -583.444129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.444129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.796964 (E_RNA) where: Base-Base interactions energy: -393.127 where: short stacking energy: -191.877 Base-Backbone interact. energy: 0.958 local terms energy: -228.628014 where: bonds (distance) C4'-P energy: -65.376 bonds (distance) P-C4' energy: -59.371 flat angles C4'-P-C4' energy: -45.869 flat angles P-C4'-P energy: -31.302 tors. eta vs tors. theta energy: -26.710 Dist. restrs. and SS energy: 37.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.251000 Total energy: -636.130585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.130585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.173681 (E_RNA) where: Base-Base interactions energy: -431.198 where: short stacking energy: -208.297 Base-Backbone interact. energy: 0.224 local terms energy: -248.200062 where: bonds (distance) C4'-P energy: -59.907 bonds (distance) P-C4' energy: -61.160 flat angles C4'-P-C4' energy: -44.608 flat angles P-C4'-P energy: -44.556 tors. eta vs tors. theta energy: -37.970 Dist. restrs. and SS energy: 43.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.246500 Total energy: -686.432465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.432465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.237060 (E_RNA) where: Base-Base interactions energy: -477.249 where: short stacking energy: -220.304 Base-Backbone interact. energy: -3.868 local terms energy: -249.120204 where: bonds (distance) C4'-P energy: -59.587 bonds (distance) P-C4' energy: -47.953 flat angles C4'-P-C4' energy: -54.240 flat angles P-C4'-P energy: -40.896 tors. eta vs tors. theta energy: -46.444 Dist. restrs. and SS energy: 43.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.242000 Total energy: -726.306688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.306688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.537125 (E_RNA) where: Base-Base interactions energy: -496.079 where: short stacking energy: -220.473 Base-Backbone interact. energy: -0.476 local terms energy: -272.982069 where: bonds (distance) C4'-P energy: -59.580 bonds (distance) P-C4' energy: -60.067 flat angles C4'-P-C4' energy: -60.387 flat angles P-C4'-P energy: -42.945 tors. eta vs tors. theta energy: -50.003 Dist. restrs. and SS energy: 43.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.237500 Total energy: -726.567120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.567120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.822933 (E_RNA) where: Base-Base interactions energy: -513.464 where: short stacking energy: -246.836 Base-Backbone interact. energy: -1.179 local terms energy: -257.179690 where: bonds (distance) C4'-P energy: -55.410 bonds (distance) P-C4' energy: -57.635 flat angles C4'-P-C4' energy: -55.847 flat angles P-C4'-P energy: -35.465 tors. eta vs tors. theta energy: -52.822 Dist. restrs. and SS energy: 45.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.233000 Total energy: -755.990722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.990722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.129107 (E_RNA) where: Base-Base interactions energy: -528.861 where: short stacking energy: -236.565 Base-Backbone interact. energy: -0.838 local terms energy: -271.430035 where: bonds (distance) C4'-P energy: -58.240 bonds (distance) P-C4' energy: -59.277 flat angles C4'-P-C4' energy: -60.311 flat angles P-C4'-P energy: -42.671 tors. eta vs tors. theta energy: -50.931 Dist. restrs. and SS energy: 45.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.228500 Total energy: -795.428777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.428777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.403789 (E_RNA) where: Base-Base interactions energy: -520.263 where: short stacking energy: -236.887 Base-Backbone interact. energy: -1.761 local terms energy: -310.379316 where: bonds (distance) C4'-P energy: -65.186 bonds (distance) P-C4' energy: -64.444 flat angles C4'-P-C4' energy: -77.655 flat angles P-C4'-P energy: -51.538 tors. eta vs tors. theta energy: -51.556 Dist. restrs. and SS energy: 36.975 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.224000 Total energy: -762.050150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.050150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.797760 (E_RNA) where: Base-Base interactions energy: -525.205 where: short stacking energy: -252.531 Base-Backbone interact. energy: -0.567 local terms energy: -275.025743 where: bonds (distance) C4'-P energy: -61.448 bonds (distance) P-C4' energy: -52.807 flat angles C4'-P-C4' energy: -61.035 flat angles P-C4'-P energy: -40.544 tors. eta vs tors. theta energy: -59.192 Dist. restrs. and SS energy: 38.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.219500 Total energy: -773.064027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.064027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.652286 (E_RNA) where: Base-Base interactions energy: -549.834 where: short stacking energy: -251.898 Base-Backbone interact. energy: -1.492 local terms energy: -271.325614 where: bonds (distance) C4'-P energy: -55.031 bonds (distance) P-C4' energy: -55.765 flat angles C4'-P-C4' energy: -69.428 flat angles P-C4'-P energy: -43.310 tors. eta vs tors. theta energy: -47.791 Dist. restrs. and SS energy: 49.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.215000 Total energy: -775.427040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.427040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.415100 (E_RNA) where: Base-Base interactions energy: -515.832 where: short stacking energy: -237.051 Base-Backbone interact. energy: -0.046 local terms energy: -295.537619 where: bonds (distance) C4'-P energy: -69.902 bonds (distance) P-C4' energy: -61.117 flat angles C4'-P-C4' energy: -67.207 flat angles P-C4'-P energy: -36.183 tors. eta vs tors. theta energy: -61.129 Dist. restrs. and SS energy: 35.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.210500 Total energy: -808.994961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.994961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.342793 (E_RNA) where: Base-Base interactions energy: -567.765 where: short stacking energy: -258.689 Base-Backbone interact. energy: -2.038 local terms energy: -275.539764 where: bonds (distance) C4'-P energy: -46.669 bonds (distance) P-C4' energy: -58.505 flat angles C4'-P-C4' energy: -59.675 flat angles P-C4'-P energy: -37.700 tors. eta vs tors. theta energy: -72.990 Dist. restrs. and SS energy: 36.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.206000 Total energy: -834.155306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.155306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.591350 (E_RNA) where: Base-Base interactions energy: -607.098 where: short stacking energy: -265.413 Base-Backbone interact. energy: -1.363 local terms energy: -262.129916 where: bonds (distance) C4'-P energy: -62.563 bonds (distance) P-C4' energy: -47.662 flat angles C4'-P-C4' energy: -64.611 flat angles P-C4'-P energy: -28.757 tors. eta vs tors. theta energy: -58.536 Dist. restrs. and SS energy: 36.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.201500 Total energy: -805.625911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.625911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.170366 (E_RNA) where: Base-Base interactions energy: -572.526 where: short stacking energy: -261.949 Base-Backbone interact. energy: -3.261 local terms energy: -270.383759 where: bonds (distance) C4'-P energy: -64.128 bonds (distance) P-C4' energy: -49.644 flat angles C4'-P-C4' energy: -60.443 flat angles P-C4'-P energy: -37.362 tors. eta vs tors. theta energy: -58.808 Dist. restrs. and SS energy: 40.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.197000 Total energy: -815.786803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.786803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.785001 (E_RNA) where: Base-Base interactions energy: -577.241 where: short stacking energy: -263.141 Base-Backbone interact. energy: -1.028 local terms energy: -277.515975 where: bonds (distance) C4'-P energy: -49.107 bonds (distance) P-C4' energy: -63.913 flat angles C4'-P-C4' energy: -59.578 flat angles P-C4'-P energy: -34.700 tors. eta vs tors. theta energy: -70.218 Dist. restrs. and SS energy: 39.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.192500 Total energy: -861.125784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.125784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.124908 (E_RNA) where: Base-Base interactions energy: -590.098 where: short stacking energy: -277.467 Base-Backbone interact. energy: -0.684 local terms energy: -314.342549 where: bonds (distance) C4'-P energy: -67.288 bonds (distance) P-C4' energy: -51.871 flat angles C4'-P-C4' energy: -78.626 flat angles P-C4'-P energy: -46.737 tors. eta vs tors. theta energy: -69.820 Dist. restrs. and SS energy: 43.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.188000 Total energy: -835.790124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.790124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.819335 (E_RNA) where: Base-Base interactions energy: -598.124 where: short stacking energy: -277.128 Base-Backbone interact. energy: -3.673 local terms energy: -276.022509 where: bonds (distance) C4'-P energy: -53.474 bonds (distance) P-C4' energy: -54.973 flat angles C4'-P-C4' energy: -60.028 flat angles P-C4'-P energy: -39.885 tors. eta vs tors. theta energy: -67.663 Dist. restrs. and SS energy: 42.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.183500 Total energy: -816.207233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.207233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.118216 (E_RNA) where: Base-Base interactions energy: -571.106 where: short stacking energy: -260.382 Base-Backbone interact. energy: -1.065 local terms energy: -280.946960 where: bonds (distance) C4'-P energy: -46.951 bonds (distance) P-C4' energy: -62.942 flat angles C4'-P-C4' energy: -74.233 flat angles P-C4'-P energy: -45.690 tors. eta vs tors. theta energy: -51.131 Dist. restrs. and SS energy: 36.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.179000 Total energy: -856.582299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.582299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.772856 (E_RNA) where: Base-Base interactions energy: -603.677 where: short stacking energy: -273.489 Base-Backbone interact. energy: -0.677 local terms energy: -296.419212 where: bonds (distance) C4'-P energy: -47.027 bonds (distance) P-C4' energy: -67.033 flat angles C4'-P-C4' energy: -66.692 flat angles P-C4'-P energy: -46.549 tors. eta vs tors. theta energy: -69.118 Dist. restrs. and SS energy: 44.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.174500 Total energy: -875.381414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.381414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.697329 (E_RNA) where: Base-Base interactions energy: -608.610 where: short stacking energy: -281.378 Base-Backbone interact. energy: -0.996 local terms energy: -308.090873 where: bonds (distance) C4'-P energy: -72.310 bonds (distance) P-C4' energy: -54.180 flat angles C4'-P-C4' energy: -66.418 flat angles P-C4'-P energy: -43.909 tors. eta vs tors. theta energy: -71.274 Dist. restrs. and SS energy: 42.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.170000 Total energy: -896.550303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.550303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.172076 (E_RNA) where: Base-Base interactions energy: -619.080 where: short stacking energy: -293.764 Base-Backbone interact. energy: -0.762 local terms energy: -308.330616 where: bonds (distance) C4'-P energy: -58.758 bonds (distance) P-C4' energy: -60.213 flat angles C4'-P-C4' energy: -71.586 flat angles P-C4'-P energy: -42.447 tors. eta vs tors. theta energy: -75.327 Dist. restrs. and SS energy: 31.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.165500 Total energy: -905.293766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.293766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.854617 (E_RNA) where: Base-Base interactions energy: -636.069 where: short stacking energy: -310.693 Base-Backbone interact. energy: -0.251 local terms energy: -315.534768 where: bonds (distance) C4'-P energy: -63.207 bonds (distance) P-C4' energy: -65.008 flat angles C4'-P-C4' energy: -76.343 flat angles P-C4'-P energy: -31.510 tors. eta vs tors. theta energy: -79.466 Dist. restrs. and SS energy: 46.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.161000 Total energy: -927.678758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.678758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.457250 (E_RNA) where: Base-Base interactions energy: -635.804 where: short stacking energy: -286.825 Base-Backbone interact. energy: 0.019 local terms energy: -334.671383 where: bonds (distance) C4'-P energy: -51.396 bonds (distance) P-C4' energy: -72.291 flat angles C4'-P-C4' energy: -73.184 flat angles P-C4'-P energy: -54.530 tors. eta vs tors. theta energy: -83.270 Dist. restrs. and SS energy: 42.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.156500 Total energy: -927.109173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.109173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.889355 (E_RNA) where: Base-Base interactions energy: -643.776 where: short stacking energy: -287.140 Base-Backbone interact. energy: -1.993 local terms energy: -325.120941 where: bonds (distance) C4'-P energy: -66.921 bonds (distance) P-C4' energy: -71.851 flat angles C4'-P-C4' energy: -64.763 flat angles P-C4'-P energy: -44.481 tors. eta vs tors. theta energy: -77.105 Dist. restrs. and SS energy: 43.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.152000 Total energy: -917.227067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.227067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.041236 (E_RNA) where: Base-Base interactions energy: -649.634 where: short stacking energy: -312.455 Base-Backbone interact. energy: -0.221 local terms energy: -313.186581 where: bonds (distance) C4'-P energy: -60.511 bonds (distance) P-C4' energy: -59.886 flat angles C4'-P-C4' energy: -63.462 flat angles P-C4'-P energy: -41.978 tors. eta vs tors. theta energy: -87.350 Dist. restrs. and SS energy: 45.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.147500 Total energy: -920.669452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.669452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.187464 (E_RNA) where: Base-Base interactions energy: -668.380 where: short stacking energy: -313.490 Base-Backbone interact. energy: -2.536 local terms energy: -289.271402 where: bonds (distance) C4'-P energy: -56.232 bonds (distance) P-C4' energy: -54.129 flat angles C4'-P-C4' energy: -57.742 flat angles P-C4'-P energy: -39.617 tors. eta vs tors. theta energy: -81.550 Dist. restrs. and SS energy: 39.518 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.143000 Total energy: -894.064467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.064467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.535940 (E_RNA) where: Base-Base interactions energy: -634.793 where: short stacking energy: -296.181 Base-Backbone interact. energy: -0.695 local terms energy: -302.048629 where: bonds (distance) C4'-P energy: -67.144 bonds (distance) P-C4' energy: -51.990 flat angles C4'-P-C4' energy: -58.691 flat angles P-C4'-P energy: -47.700 tors. eta vs tors. theta energy: -76.524 Dist. restrs. and SS energy: 43.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.138500 Total energy: -923.749215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.749215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.157409 (E_RNA) where: Base-Base interactions energy: -646.207 where: short stacking energy: -289.617 Base-Backbone interact. energy: -1.365 local terms energy: -314.585931 where: bonds (distance) C4'-P energy: -60.569 bonds (distance) P-C4' energy: -61.945 flat angles C4'-P-C4' energy: -73.630 flat angles P-C4'-P energy: -40.807 tors. eta vs tors. theta energy: -77.635 Dist. restrs. and SS energy: 38.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.134000 Total energy: -937.703922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.703922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.774809 (E_RNA) where: Base-Base interactions energy: -653.891 where: short stacking energy: -298.726 Base-Backbone interact. energy: -1.628 local terms energy: -326.255737 where: bonds (distance) C4'-P energy: -60.863 bonds (distance) P-C4' energy: -63.085 flat angles C4'-P-C4' energy: -68.258 flat angles P-C4'-P energy: -53.105 tors. eta vs tors. theta energy: -80.944 Dist. restrs. and SS energy: 44.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.129500 Total energy: -936.720926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.720926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.302914 (E_RNA) where: Base-Base interactions energy: -652.917 where: short stacking energy: -310.500 Base-Backbone interact. energy: -1.805 local terms energy: -322.581754 where: bonds (distance) C4'-P energy: -56.687 bonds (distance) P-C4' energy: -55.029 flat angles C4'-P-C4' energy: -78.948 flat angles P-C4'-P energy: -44.392 tors. eta vs tors. theta energy: -87.527 Dist. restrs. and SS energy: 40.582 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.125000 Total energy: -869.812814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.812814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.049883 (E_RNA) where: Base-Base interactions energy: -597.989 where: short stacking energy: -277.175 Base-Backbone interact. energy: -1.546 local terms energy: -305.515077 where: bonds (distance) C4'-P energy: -59.494 bonds (distance) P-C4' energy: -61.638 flat angles C4'-P-C4' energy: -66.853 flat angles P-C4'-P energy: -44.818 tors. eta vs tors. theta energy: -72.713 Dist. restrs. and SS energy: 35.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.120500 Total energy: -884.048468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.048468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.215410 (E_RNA) where: Base-Base interactions energy: -641.389 where: short stacking energy: -298.254 Base-Backbone interact. energy: -0.320 local terms energy: -278.506420 where: bonds (distance) C4'-P energy: -58.312 bonds (distance) P-C4' energy: -52.020 flat angles C4'-P-C4' energy: -51.438 flat angles P-C4'-P energy: -46.354 tors. eta vs tors. theta energy: -70.383 Dist. restrs. and SS energy: 36.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.116000 Total energy: -880.534532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.534532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.540192 (E_RNA) where: Base-Base interactions energy: -595.754 where: short stacking energy: -276.980 Base-Backbone interact. energy: 0.738 local terms energy: -321.524953 where: bonds (distance) C4'-P energy: -67.759 bonds (distance) P-C4' energy: -67.279 flat angles C4'-P-C4' energy: -68.054 flat angles P-C4'-P energy: -54.776 tors. eta vs tors. theta energy: -63.656 Dist. restrs. and SS energy: 36.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.111500 Total energy: -916.650299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.650299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.044325 (E_RNA) where: Base-Base interactions energy: -645.774 where: short stacking energy: -294.110 Base-Backbone interact. energy: -3.895 local terms energy: -303.375177 where: bonds (distance) C4'-P energy: -46.466 bonds (distance) P-C4' energy: -61.324 flat angles C4'-P-C4' energy: -65.146 flat angles P-C4'-P energy: -51.096 tors. eta vs tors. theta energy: -79.344 Dist. restrs. and SS energy: 36.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.107000 Total energy: -939.311085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.311085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.521233 (E_RNA) where: Base-Base interactions energy: -671.506 where: short stacking energy: -313.877 Base-Backbone interact. energy: -0.676 local terms energy: -308.339416 where: bonds (distance) C4'-P energy: -46.113 bonds (distance) P-C4' energy: -69.131 flat angles C4'-P-C4' energy: -63.515 flat angles P-C4'-P energy: -55.890 tors. eta vs tors. theta energy: -73.691 Dist. restrs. and SS energy: 41.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.102500 Total energy: -982.217388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.217388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.550948 (E_RNA) where: Base-Base interactions energy: -699.096 where: short stacking energy: -300.868 Base-Backbone interact. energy: -0.258 local terms energy: -326.196574 where: bonds (distance) C4'-P energy: -44.603 bonds (distance) P-C4' energy: -68.868 flat angles C4'-P-C4' energy: -72.178 flat angles P-C4'-P energy: -53.366 tors. eta vs tors. theta energy: -87.181 Dist. restrs. and SS energy: 43.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.098000 Total energy: -967.249925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.249925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.781829 (E_RNA) where: Base-Base interactions energy: -672.859 where: short stacking energy: -294.204 Base-Backbone interact. energy: 1.153 local terms energy: -339.076109 where: bonds (distance) C4'-P energy: -69.157 bonds (distance) P-C4' energy: -62.567 flat angles C4'-P-C4' energy: -76.169 flat angles P-C4'-P energy: -53.120 tors. eta vs tors. theta energy: -78.062 Dist. restrs. and SS energy: 43.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.093500 Total energy: -965.116214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.116214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.595192 (E_RNA) where: Base-Base interactions energy: -672.546 where: short stacking energy: -302.082 Base-Backbone interact. energy: 0.429 local terms energy: -326.478178 where: bonds (distance) C4'-P energy: -60.078 bonds (distance) P-C4' energy: -67.918 flat angles C4'-P-C4' energy: -72.765 flat angles P-C4'-P energy: -42.392 tors. eta vs tors. theta energy: -83.325 Dist. restrs. and SS energy: 33.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.089000 Total energy: -1005.621087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.621087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.052437 (E_RNA) where: Base-Base interactions energy: -701.243 where: short stacking energy: -325.070 Base-Backbone interact. energy: -2.367 local terms energy: -343.442522 where: bonds (distance) C4'-P energy: -64.196 bonds (distance) P-C4' energy: -70.687 flat angles C4'-P-C4' energy: -72.988 flat angles P-C4'-P energy: -52.155 tors. eta vs tors. theta energy: -83.417 Dist. restrs. and SS energy: 41.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.084500 Total energy: -984.549395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.549395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.732332 (E_RNA) where: Base-Base interactions energy: -692.190 where: short stacking energy: -315.938 Base-Backbone interact. energy: 5.707 local terms energy: -332.249313 where: bonds (distance) C4'-P energy: -63.087 bonds (distance) P-C4' energy: -59.693 flat angles C4'-P-C4' energy: -75.250 flat angles P-C4'-P energy: -49.357 tors. eta vs tors. theta energy: -84.861 Dist. restrs. and SS energy: 34.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.080000 Total energy: -967.995082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.995082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.525799 (E_RNA) where: Base-Base interactions energy: -685.970 where: short stacking energy: -308.919 Base-Backbone interact. energy: -0.765 local terms energy: -319.791100 where: bonds (distance) C4'-P energy: -58.178 bonds (distance) P-C4' energy: -63.302 flat angles C4'-P-C4' energy: -75.169 flat angles P-C4'-P energy: -44.922 tors. eta vs tors. theta energy: -78.220 Dist. restrs. and SS energy: 38.531 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.075500 Total energy: -973.649759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.649759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.661719 (E_RNA) where: Base-Base interactions energy: -691.336 where: short stacking energy: -305.475 Base-Backbone interact. energy: -1.205 local terms energy: -317.121013 where: bonds (distance) C4'-P energy: -59.768 bonds (distance) P-C4' energy: -63.684 flat angles C4'-P-C4' energy: -70.267 flat angles P-C4'-P energy: -46.786 tors. eta vs tors. theta energy: -76.616 Dist. restrs. and SS energy: 36.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.071000 Total energy: -990.016616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.016616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.348972 (E_RNA) where: Base-Base interactions energy: -705.083 where: short stacking energy: -317.530 Base-Backbone interact. energy: -1.731 local terms energy: -322.534889 where: bonds (distance) C4'-P energy: -56.136 bonds (distance) P-C4' energy: -59.683 flat angles C4'-P-C4' energy: -69.288 flat angles P-C4'-P energy: -47.834 tors. eta vs tors. theta energy: -89.593 Dist. restrs. and SS energy: 39.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.066500 Total energy: -999.481403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.481403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.081564 (E_RNA) where: Base-Base interactions energy: -697.486 where: short stacking energy: -313.320 Base-Backbone interact. energy: -1.332 local terms energy: -339.263490 where: bonds (distance) C4'-P energy: -68.130 bonds (distance) P-C4' energy: -60.094 flat angles C4'-P-C4' energy: -70.941 flat angles P-C4'-P energy: -51.998 tors. eta vs tors. theta energy: -88.101 Dist. restrs. and SS energy: 38.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.062000 Total energy: -982.745959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.745959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.865256 (E_RNA) where: Base-Base interactions energy: -708.529 where: short stacking energy: -311.625 Base-Backbone interact. energy: -0.040 local terms energy: -312.296269 where: bonds (distance) C4'-P energy: -53.170 bonds (distance) P-C4' energy: -53.259 flat angles C4'-P-C4' energy: -75.292 flat angles P-C4'-P energy: -51.220 tors. eta vs tors. theta energy: -79.355 Dist. restrs. and SS energy: 38.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.057500 Total energy: -1017.887899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.887899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.433700 (E_RNA) where: Base-Base interactions energy: -708.700 where: short stacking energy: -316.697 Base-Backbone interact. energy: 0.838 local terms energy: -346.571971 where: bonds (distance) C4'-P energy: -67.962 bonds (distance) P-C4' energy: -70.948 flat angles C4'-P-C4' energy: -68.968 flat angles P-C4'-P energy: -53.947 tors. eta vs tors. theta energy: -84.747 Dist. restrs. and SS energy: 36.546 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.053000 Total energy: -980.146449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.146449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.420308 (E_RNA) where: Base-Base interactions energy: -692.984 where: short stacking energy: -312.652 Base-Backbone interact. energy: 4.067 local terms energy: -331.503532 where: bonds (distance) C4'-P energy: -63.086 bonds (distance) P-C4' energy: -73.220 flat angles C4'-P-C4' energy: -75.584 flat angles P-C4'-P energy: -40.225 tors. eta vs tors. theta energy: -79.389 Dist. restrs. and SS energy: 40.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.048500 Total energy: -981.790411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.790411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.371327 (E_RNA) where: Base-Base interactions energy: -676.908 where: short stacking energy: -299.999 Base-Backbone interact. energy: -0.608 local terms energy: -335.855347 where: bonds (distance) C4'-P energy: -67.336 bonds (distance) P-C4' energy: -67.730 flat angles C4'-P-C4' energy: -71.406 flat angles P-C4'-P energy: -48.612 tors. eta vs tors. theta energy: -80.771 Dist. restrs. and SS energy: 31.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.044000 Total energy: -992.481662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.481662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.660733 (E_RNA) where: Base-Base interactions energy: -710.448 where: short stacking energy: -310.506 Base-Backbone interact. energy: -1.790 local terms energy: -317.422040 where: bonds (distance) C4'-P energy: -60.500 bonds (distance) P-C4' energy: -58.725 flat angles C4'-P-C4' energy: -73.501 flat angles P-C4'-P energy: -40.785 tors. eta vs tors. theta energy: -83.912 Dist. restrs. and SS energy: 37.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.039500 Total energy: -987.865835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.865835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.862872 (E_RNA) where: Base-Base interactions energy: -728.974 where: short stacking energy: -320.780 Base-Backbone interact. energy: 1.444 local terms energy: -307.333636 where: bonds (distance) C4'-P energy: -57.815 bonds (distance) P-C4' energy: -59.927 flat angles C4'-P-C4' energy: -76.714 flat angles P-C4'-P energy: -23.288 tors. eta vs tors. theta energy: -89.589 Dist. restrs. and SS energy: 46.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.035000 Total energy: -992.453927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.453927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.663545 (E_RNA) where: Base-Base interactions energy: -691.624 where: short stacking energy: -319.820 Base-Backbone interact. energy: -0.031 local terms energy: -337.008661 where: bonds (distance) C4'-P energy: -67.040 bonds (distance) P-C4' energy: -61.648 flat angles C4'-P-C4' energy: -73.552 flat angles P-C4'-P energy: -47.206 tors. eta vs tors. theta energy: -87.563 Dist. restrs. and SS energy: 36.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.030500 Total energy: -986.123929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.123929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.488391 (E_RNA) where: Base-Base interactions energy: -679.335 where: short stacking energy: -307.685 Base-Backbone interact. energy: -1.126 local terms energy: -340.027890 where: bonds (distance) C4'-P energy: -68.139 bonds (distance) P-C4' energy: -69.499 flat angles C4'-P-C4' energy: -70.539 flat angles P-C4'-P energy: -46.331 tors. eta vs tors. theta energy: -85.521 Dist. restrs. and SS energy: 34.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.026000 Total energy: -996.221898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.221898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.333103 (E_RNA) where: Base-Base interactions energy: -710.999 where: short stacking energy: -312.809 Base-Backbone interact. energy: -1.061 local terms energy: -321.272342 where: bonds (distance) C4'-P energy: -65.835 bonds (distance) P-C4' energy: -64.819 flat angles C4'-P-C4' energy: -63.332 flat angles P-C4'-P energy: -46.710 tors. eta vs tors. theta energy: -80.576 Dist. restrs. and SS energy: 37.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.021500 Total energy: -1004.314868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.314868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.334082 (E_RNA) where: Base-Base interactions energy: -711.379 where: short stacking energy: -318.162 Base-Backbone interact. energy: -0.101 local terms energy: -328.853937 where: bonds (distance) C4'-P energy: -65.933 bonds (distance) P-C4' energy: -56.400 flat angles C4'-P-C4' energy: -77.000 flat angles P-C4'-P energy: -48.065 tors. eta vs tors. theta energy: -81.457 Dist. restrs. and SS energy: 36.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.017000 Total energy: -996.241820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.241820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.836134 (E_RNA) where: Base-Base interactions energy: -726.296 where: short stacking energy: -319.187 Base-Backbone interact. energy: -1.995 local terms energy: -306.545053 where: bonds (distance) C4'-P energy: -55.180 bonds (distance) P-C4' energy: -61.160 flat angles C4'-P-C4' energy: -67.893 flat angles P-C4'-P energy: -50.481 tors. eta vs tors. theta energy: -71.832 Dist. restrs. and SS energy: 38.594 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.012500 Total energy: -1027.176731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.176731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.789281 (E_RNA) where: Base-Base interactions energy: -725.386 where: short stacking energy: -325.188 Base-Backbone interact. energy: 0.765 local terms energy: -339.168288 where: bonds (distance) C4'-P energy: -59.887 bonds (distance) P-C4' energy: -70.509 flat angles C4'-P-C4' energy: -77.336 flat angles P-C4'-P energy: -47.925 tors. eta vs tors. theta energy: -83.511 Dist. restrs. and SS energy: 36.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.008000 Total energy: -1007.690218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.690218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.913206 (E_RNA) where: Base-Base interactions energy: -717.192 where: short stacking energy: -304.846 Base-Backbone interact. energy: -1.088 local terms energy: -328.633035 where: bonds (distance) C4'-P energy: -55.751 bonds (distance) P-C4' energy: -67.380 flat angles C4'-P-C4' energy: -79.261 flat angles P-C4'-P energy: -46.615 tors. eta vs tors. theta energy: -79.625 Dist. restrs. and SS energy: 39.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.003500 Total energy: -1016.371363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.371363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.446468 (E_RNA) where: Base-Base interactions energy: -719.063 where: short stacking energy: -323.663 Base-Backbone interact. energy: -1.905 local terms energy: -332.477750 where: bonds (distance) C4'-P energy: -56.112 bonds (distance) P-C4' energy: -67.706 flat angles C4'-P-C4' energy: -73.606 flat angles P-C4'-P energy: -50.421 tors. eta vs tors. theta energy: -84.633 Dist. restrs. and SS energy: 37.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 0.999000 Total energy: -1024.610289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.610289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.763481 (E_RNA) where: Base-Base interactions energy: -735.291 where: short stacking energy: -323.535 Base-Backbone interact. energy: -1.564 local terms energy: -322.909032 where: bonds (distance) C4'-P energy: -53.924 bonds (distance) P-C4' energy: -68.625 flat angles C4'-P-C4' energy: -79.476 flat angles P-C4'-P energy: -42.786 tors. eta vs tors. theta energy: -78.098 Dist. restrs. and SS energy: 35.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 0.994500 Total energy: -1034.949149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.949149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.168577 (E_RNA) where: Base-Base interactions energy: -734.880 where: short stacking energy: -313.715 Base-Backbone interact. energy: -1.957 local terms energy: -336.331683 where: bonds (distance) C4'-P energy: -62.834 bonds (distance) P-C4' energy: -61.429 flat angles C4'-P-C4' energy: -78.564 flat angles P-C4'-P energy: -48.495 tors. eta vs tors. theta energy: -85.010 Dist. restrs. and SS energy: 38.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 0.990000 Total energy: -1039.677237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.677237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.208799 (E_RNA) where: Base-Base interactions energy: -722.780 where: short stacking energy: -332.886 Base-Backbone interact. energy: 2.450 local terms energy: -356.879089 where: bonds (distance) C4'-P energy: -65.025 bonds (distance) P-C4' energy: -75.427 flat angles C4'-P-C4' energy: -74.362 flat angles P-C4'-P energy: -56.563 tors. eta vs tors. theta energy: -85.502 Dist. restrs. and SS energy: 37.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 0.985500 Total energy: -1030.464592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.464592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.477557 (E_RNA) where: Base-Base interactions energy: -725.794 where: short stacking energy: -316.192 Base-Backbone interact. energy: -2.527 local terms energy: -349.156907 where: bonds (distance) C4'-P energy: -69.644 bonds (distance) P-C4' energy: -76.091 flat angles C4'-P-C4' energy: -73.326 flat angles P-C4'-P energy: -49.067 tors. eta vs tors. theta energy: -81.029 Dist. restrs. and SS energy: 47.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 0.981000 Total energy: -1033.036560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.036560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.256002 (E_RNA) where: Base-Base interactions energy: -712.745 where: short stacking energy: -334.824 Base-Backbone interact. energy: 0.214 local terms energy: -361.724759 where: bonds (distance) C4'-P energy: -66.922 bonds (distance) P-C4' energy: -71.902 flat angles C4'-P-C4' energy: -77.326 flat angles P-C4'-P energy: -58.044 tors. eta vs tors. theta energy: -87.531 Dist. restrs. and SS energy: 41.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 0.976500 Total energy: -1049.011323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.011323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.718785 (E_RNA) where: Base-Base interactions energy: -744.513 where: short stacking energy: -331.543 Base-Backbone interact. energy: -1.056 local terms energy: -340.149795 where: bonds (distance) C4'-P energy: -54.203 bonds (distance) P-C4' energy: -62.882 flat angles C4'-P-C4' energy: -81.149 flat angles P-C4'-P energy: -58.905 tors. eta vs tors. theta energy: -83.011 Dist. restrs. and SS energy: 36.707 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 0.972000 Total energy: -1032.635790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.635790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.979448 (E_RNA) where: Base-Base interactions energy: -704.896 where: short stacking energy: -328.719 Base-Backbone interact. energy: -0.573 local terms energy: -367.510995 where: bonds (distance) C4'-P energy: -68.991 bonds (distance) P-C4' energy: -82.360 flat angles C4'-P-C4' energy: -73.636 flat angles P-C4'-P energy: -52.181 tors. eta vs tors. theta energy: -90.343 Dist. restrs. and SS energy: 40.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 0.967500 Total energy: -1042.499112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.499112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.222065 (E_RNA) where: Base-Base interactions energy: -734.423 where: short stacking energy: -334.652 Base-Backbone interact. energy: -0.354 local terms energy: -346.444595 where: bonds (distance) C4'-P energy: -52.337 bonds (distance) P-C4' energy: -71.453 flat angles C4'-P-C4' energy: -78.270 flat angles P-C4'-P energy: -53.950 tors. eta vs tors. theta energy: -90.435 Dist. restrs. and SS energy: 38.723 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 0.963000 Total energy: -1052.278977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.278977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.012323 (E_RNA) where: Base-Base interactions energy: -731.325 where: short stacking energy: -340.991 Base-Backbone interact. energy: -1.320 local terms energy: -354.366856 where: bonds (distance) C4'-P energy: -64.755 bonds (distance) P-C4' energy: -72.028 flat angles C4'-P-C4' energy: -69.825 flat angles P-C4'-P energy: -59.584 tors. eta vs tors. theta energy: -88.175 Dist. restrs. and SS energy: 34.733 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 0.958500 Total energy: -1039.253848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.253848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.499892 (E_RNA) where: Base-Base interactions energy: -722.357 where: short stacking energy: -330.264 Base-Backbone interact. energy: -2.695 local terms energy: -354.447419 where: bonds (distance) C4'-P energy: -69.461 bonds (distance) P-C4' energy: -75.357 flat angles C4'-P-C4' energy: -73.198 flat angles P-C4'-P energy: -50.231 tors. eta vs tors. theta energy: -86.201 Dist. restrs. and SS energy: 40.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 0.954000 Total energy: -1051.187904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.187904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.019545 (E_RNA) where: Base-Base interactions energy: -739.732 where: short stacking energy: -325.175 Base-Backbone interact. energy: 0.010 local terms energy: -350.298036 where: bonds (distance) C4'-P energy: -65.964 bonds (distance) P-C4' energy: -69.613 flat angles C4'-P-C4' energy: -80.073 flat angles P-C4'-P energy: -50.867 tors. eta vs tors. theta energy: -83.781 Dist. restrs. and SS energy: 38.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 0.949500 Total energy: -1062.900721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.900721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.134898 (E_RNA) where: Base-Base interactions energy: -749.945 where: short stacking energy: -338.406 Base-Backbone interact. energy: -1.968 local terms energy: -347.222386 where: bonds (distance) C4'-P energy: -64.189 bonds (distance) P-C4' energy: -71.904 flat angles C4'-P-C4' energy: -70.818 flat angles P-C4'-P energy: -48.998 tors. eta vs tors. theta energy: -91.313 Dist. restrs. and SS energy: 36.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 0.945000 Total energy: -1078.262208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.262208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.195181 (E_RNA) where: Base-Base interactions energy: -772.346 where: short stacking energy: -337.319 Base-Backbone interact. energy: -2.473 local terms energy: -344.376082 where: bonds (distance) C4'-P energy: -57.649 bonds (distance) P-C4' energy: -77.887 flat angles C4'-P-C4' energy: -71.857 flat angles P-C4'-P energy: -45.867 tors. eta vs tors. theta energy: -91.116 Dist. restrs. and SS energy: 40.933 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 0.940500 Total energy: -1066.518373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.518373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.808831 (E_RNA) where: Base-Base interactions energy: -746.272 where: short stacking energy: -318.221 Base-Backbone interact. energy: -0.329 local terms energy: -361.208708 where: bonds (distance) C4'-P energy: -66.845 bonds (distance) P-C4' energy: -76.937 flat angles C4'-P-C4' energy: -75.955 flat angles P-C4'-P energy: -54.390 tors. eta vs tors. theta energy: -87.082 Dist. restrs. and SS energy: 41.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 0.936000 Total energy: -1064.234181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.234181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.692296 (E_RNA) where: Base-Base interactions energy: -751.275 where: short stacking energy: -315.637 Base-Backbone interact. energy: -1.892 local terms energy: -350.526021 where: bonds (distance) C4'-P energy: -67.366 bonds (distance) P-C4' energy: -70.440 flat angles C4'-P-C4' energy: -72.772 flat angles P-C4'-P energy: -54.722 tors. eta vs tors. theta energy: -85.226 Dist. restrs. and SS energy: 39.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 0.931500 Total energy: -1082.494574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.494574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.607507 (E_RNA) where: Base-Base interactions energy: -767.653 where: short stacking energy: -347.778 Base-Backbone interact. energy: -0.193 local terms energy: -357.760967 where: bonds (distance) C4'-P energy: -61.533 bonds (distance) P-C4' energy: -58.079 flat angles C4'-P-C4' energy: -80.757 flat angles P-C4'-P energy: -61.049 tors. eta vs tors. theta energy: -96.343 Dist. restrs. and SS energy: 43.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 0.927000 Total energy: -1080.028931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.028931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.719530 (E_RNA) where: Base-Base interactions energy: -743.328 where: short stacking energy: -342.860 Base-Backbone interact. energy: 1.126 local terms energy: -378.517329 where: bonds (distance) C4'-P energy: -71.653 bonds (distance) P-C4' energy: -78.660 flat angles C4'-P-C4' energy: -82.463 flat angles P-C4'-P energy: -56.592 tors. eta vs tors. theta energy: -89.149 Dist. restrs. and SS energy: 40.691 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 0.922500 Total energy: -1065.128470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.128470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.137519 (E_RNA) where: Base-Base interactions energy: -744.388 where: short stacking energy: -331.341 Base-Backbone interact. energy: -1.506 local terms energy: -356.243874 where: bonds (distance) C4'-P energy: -55.921 bonds (distance) P-C4' energy: -77.241 flat angles C4'-P-C4' energy: -76.138 flat angles P-C4'-P energy: -53.564 tors. eta vs tors. theta energy: -93.379 Dist. restrs. and SS energy: 37.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 0.918000 Total energy: -1096.378279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.378279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.069653 (E_RNA) where: Base-Base interactions energy: -760.300 where: short stacking energy: -336.268 Base-Backbone interact. energy: -0.643 local terms energy: -369.126693 where: bonds (distance) C4'-P energy: -63.901 bonds (distance) P-C4' energy: -79.006 flat angles C4'-P-C4' energy: -77.377 flat angles P-C4'-P energy: -54.977 tors. eta vs tors. theta energy: -93.865 Dist. restrs. and SS energy: 33.691 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 0.913500 Total energy: -1083.617528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.617528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.590813 (E_RNA) where: Base-Base interactions energy: -759.699 where: short stacking energy: -338.093 Base-Backbone interact. energy: -2.141 local terms energy: -360.750570 where: bonds (distance) C4'-P energy: -77.185 bonds (distance) P-C4' energy: -69.429 flat angles C4'-P-C4' energy: -69.399 flat angles P-C4'-P energy: -53.285 tors. eta vs tors. theta energy: -91.453 Dist. restrs. and SS energy: 38.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 0.909000 Total energy: -1098.548088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.548088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.495586 (E_RNA) where: Base-Base interactions energy: -754.654 where: short stacking energy: -342.856 Base-Backbone interact. energy: -0.642 local terms energy: -382.198918 where: bonds (distance) C4'-P energy: -74.102 bonds (distance) P-C4' energy: -77.495 flat angles C4'-P-C4' energy: -77.773 flat angles P-C4'-P energy: -56.456 tors. eta vs tors. theta energy: -96.372 Dist. restrs. and SS energy: 38.947 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 0.904500 Total energy: -1095.457869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.457869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.925935 (E_RNA) where: Base-Base interactions energy: -785.984 where: short stacking energy: -351.853 Base-Backbone interact. energy: 1.129 local terms energy: -353.070953 where: bonds (distance) C4'-P energy: -59.439 bonds (distance) P-C4' energy: -73.439 flat angles C4'-P-C4' energy: -75.692 flat angles P-C4'-P energy: -48.421 tors. eta vs tors. theta energy: -96.080 Dist. restrs. and SS energy: 42.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1109.005795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.005795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.260928 (E_RNA) where: Base-Base interactions energy: -756.956 where: short stacking energy: -353.959 Base-Backbone interact. energy: 0.289 local terms energy: -386.593429 where: bonds (distance) C4'-P energy: -77.859 bonds (distance) P-C4' energy: -74.921 flat angles C4'-P-C4' energy: -79.448 flat angles P-C4'-P energy: -57.452 tors. eta vs tors. theta energy: -96.913 Dist. restrs. and SS energy: 34.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -1043.239955 recalc. total energy: -1043.239955 numberOfNucleotides: 111 initial temperature kT: 1.350000 moves confirmed at first: 14459658 moves confirmed later: 16772647 all moves confirmed: 31232305 percent of confirmed moves: 19.520191 out arg RESULTS//1/G-quadruplex-519c63a3_01 nucl1: 0, chain1: A, <---> nucl2: 2, chain2: A type of interaction: GA_SHt nucl1: 0, chain1: A, <---> nucl2: 3, chain2: A type of interaction: GG_WHc nucl1: 0, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_HWc nucl1: 1, chain1: A, <---> nucl2: 4, chain2: A type of interaction: GG_WHc nucl1: 1, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_HWc nucl1: 3, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GG_WHc nucl1: 4, chain1: A, <---> nucl2: 7, chain2: A type of interaction: GG_WHc nucl1: 6, chain1: A, <---> nucl2: 8, chain2: A type of interaction: GA_SHt nucl1: 6, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_WHc nucl1: 7, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_WHc Time of doing 1600000 iterations: 1673.408 seconds