SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_simRNA-b94678c7/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_simRNA-b94678c7/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 16000 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: -131.331510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.331510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.345500 Total energy: -130.915963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.915963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.915963 (E_RNA) where: Base-Base interactions energy: -1.856 where: short stacking energy: -1.856 Base-Backbone interact. energy: -0.000 local terms energy: -129.060108 where: bonds (distance) C4'-P energy: -33.773 bonds (distance) P-C4' energy: -32.197 flat angles C4'-P-C4' energy: -24.918 flat angles P-C4'-P energy: -29.236 tors. eta vs tors. theta energy: -8.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.341000 Total energy: -113.040138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -113.040138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.040138 (E_RNA) where: Base-Base interactions energy: -43.115 where: short stacking energy: -43.115 Base-Backbone interact. energy: 0.023 local terms energy: -69.947509 where: bonds (distance) C4'-P energy: -16.156 bonds (distance) P-C4' energy: -28.017 flat angles C4'-P-C4' energy: -18.929 flat angles P-C4'-P energy: -11.613 tors. eta vs tors. theta energy: 4.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.336500 Total energy: -127.730172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.730172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.730172 (E_RNA) where: Base-Base interactions energy: -52.441 where: short stacking energy: -48.126 Base-Backbone interact. energy: -0.478 local terms energy: -74.810377 where: bonds (distance) C4'-P energy: -20.620 bonds (distance) P-C4' energy: -22.638 flat angles C4'-P-C4' energy: -12.327 flat angles P-C4'-P energy: -9.823 tors. eta vs tors. theta energy: -9.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.332000 Total energy: -123.332505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.332505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.332505 (E_RNA) where: Base-Base interactions energy: -44.478 where: short stacking energy: -45.821 Base-Backbone interact. energy: 0.348 local terms energy: -79.202255 where: bonds (distance) C4'-P energy: -25.821 bonds (distance) P-C4' energy: -22.326 flat angles C4'-P-C4' energy: -14.174 flat angles P-C4'-P energy: -12.813 tors. eta vs tors. theta energy: -4.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.327500 Total energy: -118.410358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -118.410358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -118.410358 (E_RNA) where: Base-Base interactions energy: -46.429 where: short stacking energy: -30.462 Base-Backbone interact. energy: 0.062 local terms energy: -72.043836 where: bonds (distance) C4'-P energy: -21.313 bonds (distance) P-C4' energy: -27.735 flat angles C4'-P-C4' energy: -11.160 flat angles P-C4'-P energy: -9.342 tors. eta vs tors. theta energy: -2.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.323000 Total energy: -145.896469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.896469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.896469 (E_RNA) where: Base-Base interactions energy: -56.632 where: short stacking energy: -56.276 Base-Backbone interact. energy: -0.004 local terms energy: -89.260196 where: bonds (distance) C4'-P energy: -22.840 bonds (distance) P-C4' energy: -21.949 flat angles C4'-P-C4' energy: -16.901 flat angles P-C4'-P energy: -10.480 tors. eta vs tors. theta energy: -17.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.318500 Total energy: -123.870384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.870384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.870384 (E_RNA) where: Base-Base interactions energy: -38.757 where: short stacking energy: -36.447 Base-Backbone interact. energy: 1.214 local terms energy: -86.327443 where: bonds (distance) C4'-P energy: -22.515 bonds (distance) P-C4' energy: -24.439 flat angles C4'-P-C4' energy: -21.872 flat angles P-C4'-P energy: -19.350 tors. eta vs tors. theta energy: 1.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.314000 Total energy: -129.930315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.930315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.930315 (E_RNA) where: Base-Base interactions energy: -52.288 where: short stacking energy: -45.120 Base-Backbone interact. energy: -0.928 local terms energy: -76.714349 where: bonds (distance) C4'-P energy: -22.947 bonds (distance) P-C4' energy: -19.552 flat angles C4'-P-C4' energy: -22.743 flat angles P-C4'-P energy: -6.207 tors. eta vs tors. theta energy: -5.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.309500 Total energy: -123.081860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.081860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.081860 (E_RNA) where: Base-Base interactions energy: -52.753 where: short stacking energy: -52.286 Base-Backbone interact. energy: -0.469 local terms energy: -69.859956 where: bonds (distance) C4'-P energy: -20.596 bonds (distance) P-C4' energy: -22.548 flat angles C4'-P-C4' energy: -13.343 flat angles P-C4'-P energy: -10.018 tors. eta vs tors. theta energy: -3.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.305000 Total energy: -132.515708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.515708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.515708 (E_RNA) where: Base-Base interactions energy: -44.464 where: short stacking energy: -44.282 Base-Backbone interact. energy: 0.451 local terms energy: -88.502346 where: bonds (distance) C4'-P energy: -22.492 bonds (distance) P-C4' energy: -23.951 flat angles C4'-P-C4' energy: -24.773 flat angles P-C4'-P energy: -17.953 tors. eta vs tors. theta energy: 0.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.300500 Total energy: -148.950638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.950638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.950638 (E_RNA) where: Base-Base interactions energy: -83.452 where: short stacking energy: -60.355 Base-Backbone interact. energy: -0.654 local terms energy: -64.843782 where: bonds (distance) C4'-P energy: -16.672 bonds (distance) P-C4' energy: -22.614 flat angles C4'-P-C4' energy: -11.754 flat angles P-C4'-P energy: -3.102 tors. eta vs tors. theta energy: -10.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.296000 Total energy: -142.918151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.918151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.918151 (E_RNA) where: Base-Base interactions energy: -59.005 where: short stacking energy: -58.503 Base-Backbone interact. energy: -0.065 local terms energy: -83.848556 where: bonds (distance) C4'-P energy: -16.452 bonds (distance) P-C4' energy: -20.132 flat angles C4'-P-C4' energy: -24.057 flat angles P-C4'-P energy: -12.235 tors. eta vs tors. theta energy: -10.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.291500 Total energy: -139.509934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.509934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.509934 (E_RNA) where: Base-Base interactions energy: -55.688 where: short stacking energy: -53.182 Base-Backbone interact. energy: 0.315 local terms energy: -84.137137 where: bonds (distance) C4'-P energy: -23.329 bonds (distance) P-C4' energy: -21.792 flat angles C4'-P-C4' energy: -18.496 flat angles P-C4'-P energy: -14.424 tors. eta vs tors. theta energy: -6.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.287000 Total energy: -144.912465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.912465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.912465 (E_RNA) where: Base-Base interactions energy: -52.382 where: short stacking energy: -49.552 Base-Backbone interact. energy: -1.129 local terms energy: -91.401561 where: bonds (distance) C4'-P energy: -23.856 bonds (distance) P-C4' energy: -17.533 flat angles C4'-P-C4' energy: -20.214 flat angles P-C4'-P energy: -20.624 tors. eta vs tors. theta energy: -9.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.282500 Total energy: -119.984171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.984171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.984171 (E_RNA) where: Base-Base interactions energy: -49.368 where: short stacking energy: -48.623 Base-Backbone interact. energy: -0.256 local terms energy: -70.360273 where: bonds (distance) C4'-P energy: -19.760 bonds (distance) P-C4' energy: -23.973 flat angles C4'-P-C4' energy: -12.878 flat angles P-C4'-P energy: -5.119 tors. eta vs tors. theta energy: -8.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.278000 Total energy: -139.758339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.758339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.758339 (E_RNA) where: Base-Base interactions energy: -49.432 where: short stacking energy: -49.280 Base-Backbone interact. energy: 0.463 local terms energy: -90.789949 where: bonds (distance) C4'-P energy: -18.804 bonds (distance) P-C4' energy: -27.439 flat angles C4'-P-C4' energy: -24.798 flat angles P-C4'-P energy: -9.938 tors. eta vs tors. theta energy: -9.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.273500 Total energy: -124.549823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.549823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.549823 (E_RNA) where: Base-Base interactions energy: -42.412 where: short stacking energy: -38.234 Base-Backbone interact. energy: -0.688 local terms energy: -81.449958 where: bonds (distance) C4'-P energy: -22.754 bonds (distance) P-C4' energy: -23.773 flat angles C4'-P-C4' energy: -19.708 flat angles P-C4'-P energy: -14.020 tors. eta vs tors. theta energy: -1.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.269000 Total energy: -139.771057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.771057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.771057 (E_RNA) where: Base-Base interactions energy: -51.704 where: short stacking energy: -50.176 Base-Backbone interact. energy: 0.266 local terms energy: -88.332500 where: bonds (distance) C4'-P energy: -23.832 bonds (distance) P-C4' energy: -26.203 flat angles C4'-P-C4' energy: -26.649 flat angles P-C4'-P energy: 0.553 tors. eta vs tors. theta energy: -12.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.264500 Total energy: -143.120707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.120707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.120707 (E_RNA) where: Base-Base interactions energy: -63.315 where: short stacking energy: -48.798 Base-Backbone interact. energy: -0.173 local terms energy: -79.632455 where: bonds (distance) C4'-P energy: -22.792 bonds (distance) P-C4' energy: -26.925 flat angles C4'-P-C4' energy: -19.153 flat angles P-C4'-P energy: -12.062 tors. eta vs tors. theta energy: 1.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.260000 Total energy: -137.524624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.524624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.524624 (E_RNA) where: Base-Base interactions energy: -65.863 where: short stacking energy: -65.863 Base-Backbone interact. energy: -0.121 local terms energy: -71.541314 where: bonds (distance) C4'-P energy: -16.856 bonds (distance) P-C4' energy: -21.483 flat angles C4'-P-C4' energy: -21.865 flat angles P-C4'-P energy: -6.749 tors. eta vs tors. theta energy: -4.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.255500 Total energy: -136.454490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.454490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.454490 (E_RNA) where: Base-Base interactions energy: -57.842 where: short stacking energy: -56.894 Base-Backbone interact. energy: -1.392 local terms energy: -77.220287 where: bonds (distance) C4'-P energy: -17.142 bonds (distance) P-C4' energy: -22.897 flat angles C4'-P-C4' energy: -20.150 flat angles P-C4'-P energy: -13.343 tors. eta vs tors. theta energy: -3.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.251000 Total energy: -131.068038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.068038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.068038 (E_RNA) where: Base-Base interactions energy: -61.380 where: short stacking energy: -61.380 Base-Backbone interact. energy: -0.167 local terms energy: -69.521185 where: bonds (distance) C4'-P energy: -14.445 bonds (distance) P-C4' energy: -16.596 flat angles C4'-P-C4' energy: -19.544 flat angles P-C4'-P energy: -10.639 tors. eta vs tors. theta energy: -8.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.246500 Total energy: -137.347020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.347020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.347020 (E_RNA) where: Base-Base interactions energy: -56.987 where: short stacking energy: -55.485 Base-Backbone interact. energy: 0.597 local terms energy: -80.956931 where: bonds (distance) C4'-P energy: -21.007 bonds (distance) P-C4' energy: -21.126 flat angles C4'-P-C4' energy: -23.365 flat angles P-C4'-P energy: -6.116 tors. eta vs tors. theta energy: -9.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.242000 Total energy: -126.293271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.293271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.293271 (E_RNA) where: Base-Base interactions energy: -43.413 where: short stacking energy: -40.786 Base-Backbone interact. energy: -1.736 local terms energy: -81.143856 where: bonds (distance) C4'-P energy: -15.485 bonds (distance) P-C4' energy: -21.829 flat angles C4'-P-C4' energy: -23.185 flat angles P-C4'-P energy: -13.800 tors. eta vs tors. theta energy: -6.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.237500 Total energy: -152.555524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.555524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.555524 (E_RNA) where: Base-Base interactions energy: -63.284 where: short stacking energy: -54.749 Base-Backbone interact. energy: -0.242 local terms energy: -89.029461 where: bonds (distance) C4'-P energy: -20.284 bonds (distance) P-C4' energy: -21.661 flat angles C4'-P-C4' energy: -25.400 flat angles P-C4'-P energy: -14.622 tors. eta vs tors. theta energy: -7.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.233000 Total energy: -146.314867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.314867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.314867 (E_RNA) where: Base-Base interactions energy: -58.945 where: short stacking energy: -51.309 Base-Backbone interact. energy: -1.662 local terms energy: -85.707373 where: bonds (distance) C4'-P energy: -21.210 bonds (distance) P-C4' energy: -24.243 flat angles C4'-P-C4' energy: -23.252 flat angles P-C4'-P energy: -10.646 tors. eta vs tors. theta energy: -6.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.228500 Total energy: -171.456511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.456511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.456511 (E_RNA) where: Base-Base interactions energy: -94.831 where: short stacking energy: -54.272 Base-Backbone interact. energy: -1.700 local terms energy: -74.925589 where: bonds (distance) C4'-P energy: -27.108 bonds (distance) P-C4' energy: -16.850 flat angles C4'-P-C4' energy: -16.684 flat angles P-C4'-P energy: -10.868 tors. eta vs tors. theta energy: -3.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.224000 Total energy: -181.024158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.024158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.024158 (E_RNA) where: Base-Base interactions energy: -91.492 where: short stacking energy: -50.927 Base-Backbone interact. energy: -0.726 local terms energy: -88.806770 where: bonds (distance) C4'-P energy: -16.925 bonds (distance) P-C4' energy: -23.881 flat angles C4'-P-C4' energy: -22.581 flat angles P-C4'-P energy: -15.969 tors. eta vs tors. theta energy: -9.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.219500 Total energy: -239.934752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.934752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.934752 (E_RNA) where: Base-Base interactions energy: -163.747 where: short stacking energy: -75.267 Base-Backbone interact. energy: -0.379 local terms energy: -75.808622 where: bonds (distance) C4'-P energy: -19.479 bonds (distance) P-C4' energy: -16.425 flat angles C4'-P-C4' energy: -17.557 flat angles P-C4'-P energy: -11.332 tors. eta vs tors. theta energy: -11.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.215000 Total energy: -271.259411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.259411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.259411 (E_RNA) where: Base-Base interactions energy: -160.101 where: short stacking energy: -91.744 Base-Backbone interact. energy: -0.224 local terms energy: -110.934625 where: bonds (distance) C4'-P energy: -20.381 bonds (distance) P-C4' energy: -26.259 flat angles C4'-P-C4' energy: -22.575 flat angles P-C4'-P energy: -15.024 tors. eta vs tors. theta energy: -26.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.210500 Total energy: -260.851462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.851462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.851462 (E_RNA) where: Base-Base interactions energy: -168.687 where: short stacking energy: -81.919 Base-Backbone interact. energy: -0.415 local terms energy: -91.749990 where: bonds (distance) C4'-P energy: -16.607 bonds (distance) P-C4' energy: -24.704 flat angles C4'-P-C4' energy: -21.199 flat angles P-C4'-P energy: -12.415 tors. eta vs tors. theta energy: -16.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.206000 Total energy: -272.284796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.284796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.284796 (E_RNA) where: Base-Base interactions energy: -170.872 where: short stacking energy: -74.454 Base-Backbone interact. energy: -0.029 local terms energy: -101.383740 where: bonds (distance) C4'-P energy: -21.734 bonds (distance) P-C4' energy: -26.008 flat angles C4'-P-C4' energy: -22.379 flat angles P-C4'-P energy: -13.464 tors. eta vs tors. theta energy: -17.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.201500 Total energy: -304.832375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.832375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.832375 (E_RNA) where: Base-Base interactions energy: -193.635 where: short stacking energy: -100.109 Base-Backbone interact. energy: -0.053 local terms energy: -111.144001 where: bonds (distance) C4'-P energy: -22.890 bonds (distance) P-C4' energy: -24.009 flat angles C4'-P-C4' energy: -20.683 flat angles P-C4'-P energy: -14.833 tors. eta vs tors. theta energy: -28.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.197000 Total energy: -256.025752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.025752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.025752 (E_RNA) where: Base-Base interactions energy: -154.996 where: short stacking energy: -89.088 Base-Backbone interact. energy: -0.197 local terms energy: -100.832992 where: bonds (distance) C4'-P energy: -24.248 bonds (distance) P-C4' energy: -17.916 flat angles C4'-P-C4' energy: -24.113 flat angles P-C4'-P energy: -7.039 tors. eta vs tors. theta energy: -27.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.192500 Total energy: -258.798891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.798891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.798891 (E_RNA) where: Base-Base interactions energy: -152.326 where: short stacking energy: -79.751 Base-Backbone interact. energy: 0.373 local terms energy: -106.846298 where: bonds (distance) C4'-P energy: -25.229 bonds (distance) P-C4' energy: -28.086 flat angles C4'-P-C4' energy: -22.305 flat angles P-C4'-P energy: -11.963 tors. eta vs tors. theta energy: -19.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.188000 Total energy: -297.419988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.419988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.419988 (E_RNA) where: Base-Base interactions energy: -188.677 where: short stacking energy: -93.698 Base-Backbone interact. energy: -0.007 local terms energy: -108.735683 where: bonds (distance) C4'-P energy: -22.017 bonds (distance) P-C4' energy: -22.605 flat angles C4'-P-C4' energy: -18.202 flat angles P-C4'-P energy: -18.061 tors. eta vs tors. theta energy: -27.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.183500 Total energy: -292.146572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.146572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.146572 (E_RNA) where: Base-Base interactions energy: -180.888 where: short stacking energy: -79.450 Base-Backbone interact. energy: 2.805 local terms energy: -114.063629 where: bonds (distance) C4'-P energy: -27.709 bonds (distance) P-C4' energy: -23.371 flat angles C4'-P-C4' energy: -22.766 flat angles P-C4'-P energy: -16.729 tors. eta vs tors. theta energy: -23.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.179000 Total energy: -273.156299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.156299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.156299 (E_RNA) where: Base-Base interactions energy: -180.282 where: short stacking energy: -87.587 Base-Backbone interact. energy: -2.240 local terms energy: -90.634989 where: bonds (distance) C4'-P energy: -15.039 bonds (distance) P-C4' energy: -22.295 flat angles C4'-P-C4' energy: -17.861 flat angles P-C4'-P energy: -12.525 tors. eta vs tors. theta energy: -22.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.174500 Total energy: -275.905483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.905483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.905483 (E_RNA) where: Base-Base interactions energy: -177.118 where: short stacking energy: -89.182 Base-Backbone interact. energy: -0.084 local terms energy: -98.702724 where: bonds (distance) C4'-P energy: -22.323 bonds (distance) P-C4' energy: -20.894 flat angles C4'-P-C4' energy: -19.928 flat angles P-C4'-P energy: -13.137 tors. eta vs tors. theta energy: -22.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.170000 Total energy: -291.122224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.122224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.122224 (E_RNA) where: Base-Base interactions energy: -190.467 where: short stacking energy: -87.576 Base-Backbone interact. energy: -0.936 local terms energy: -99.719504 where: bonds (distance) C4'-P energy: -18.364 bonds (distance) P-C4' energy: -20.431 flat angles C4'-P-C4' energy: -22.299 flat angles P-C4'-P energy: -17.559 tors. eta vs tors. theta energy: -21.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.165500 Total energy: -300.723278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.723278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.723278 (E_RNA) where: Base-Base interactions energy: -182.928 where: short stacking energy: -84.046 Base-Backbone interact. energy: -1.006 local terms energy: -116.788959 where: bonds (distance) C4'-P energy: -19.269 bonds (distance) P-C4' energy: -25.882 flat angles C4'-P-C4' energy: -25.207 flat angles P-C4'-P energy: -19.727 tors. eta vs tors. theta energy: -26.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.161000 Total energy: -311.845590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.845590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.845590 (E_RNA) where: Base-Base interactions energy: -209.125 where: short stacking energy: -104.387 Base-Backbone interact. energy: 1.632 local terms energy: -104.352751 where: bonds (distance) C4'-P energy: -19.848 bonds (distance) P-C4' energy: -18.119 flat angles C4'-P-C4' energy: -26.032 flat angles P-C4'-P energy: -12.043 tors. eta vs tors. theta energy: -28.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.156500 Total energy: -304.330532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.330532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.330532 (E_RNA) where: Base-Base interactions energy: -195.480 where: short stacking energy: -86.697 Base-Backbone interact. energy: -0.078 local terms energy: -108.772750 where: bonds (distance) C4'-P energy: -23.955 bonds (distance) P-C4' energy: -22.175 flat angles C4'-P-C4' energy: -28.325 flat angles P-C4'-P energy: -16.087 tors. eta vs tors. theta energy: -18.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.152000 Total energy: -313.355433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.355433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.355433 (E_RNA) where: Base-Base interactions energy: -201.854 where: short stacking energy: -99.630 Base-Backbone interact. energy: -0.139 local terms energy: -111.362171 where: bonds (distance) C4'-P energy: -17.899 bonds (distance) P-C4' energy: -27.619 flat angles C4'-P-C4' energy: -20.530 flat angles P-C4'-P energy: -18.863 tors. eta vs tors. theta energy: -26.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.147500 Total energy: -338.736131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.736131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.736131 (E_RNA) where: Base-Base interactions energy: -218.385 where: short stacking energy: -106.938 Base-Backbone interact. energy: -0.088 local terms energy: -120.263110 where: bonds (distance) C4'-P energy: -22.074 bonds (distance) P-C4' energy: -26.625 flat angles C4'-P-C4' energy: -21.948 flat angles P-C4'-P energy: -18.035 tors. eta vs tors. theta energy: -31.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.143000 Total energy: -342.656019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.656019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.656019 (E_RNA) where: Base-Base interactions energy: -224.509 where: short stacking energy: -107.575 Base-Backbone interact. energy: -0.096 local terms energy: -118.050989 where: bonds (distance) C4'-P energy: -21.888 bonds (distance) P-C4' energy: -21.825 flat angles C4'-P-C4' energy: -19.728 flat angles P-C4'-P energy: -17.681 tors. eta vs tors. theta energy: -36.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.138500 Total energy: -299.038122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.038122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.038122 (E_RNA) where: Base-Base interactions energy: -190.115 where: short stacking energy: -89.179 Base-Backbone interact. energy: 1.264 local terms energy: -110.186981 where: bonds (distance) C4'-P energy: -18.193 bonds (distance) P-C4' energy: -27.471 flat angles C4'-P-C4' energy: -24.104 flat angles P-C4'-P energy: -17.474 tors. eta vs tors. theta energy: -22.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.134000 Total energy: -295.152932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.152932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.152932 (E_RNA) where: Base-Base interactions energy: -194.697 where: short stacking energy: -92.577 Base-Backbone interact. energy: -0.226 local terms energy: -100.230105 where: bonds (distance) C4'-P energy: -18.196 bonds (distance) P-C4' energy: -21.940 flat angles C4'-P-C4' energy: -24.781 flat angles P-C4'-P energy: -7.939 tors. eta vs tors. theta energy: -27.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.129500 Total energy: -319.838160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.838160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.838160 (E_RNA) where: Base-Base interactions energy: -213.705 where: short stacking energy: -102.719 Base-Backbone interact. energy: -0.763 local terms energy: -105.370377 where: bonds (distance) C4'-P energy: -19.734 bonds (distance) P-C4' energy: -24.499 flat angles C4'-P-C4' energy: -22.079 flat angles P-C4'-P energy: -16.316 tors. eta vs tors. theta energy: -22.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.125000 Total energy: -304.396626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.396626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.396626 (E_RNA) where: Base-Base interactions energy: -185.194 where: short stacking energy: -100.073 Base-Backbone interact. energy: -0.827 local terms energy: -118.375766 where: bonds (distance) C4'-P energy: -16.597 bonds (distance) P-C4' energy: -23.172 flat angles C4'-P-C4' energy: -28.042 flat angles P-C4'-P energy: -21.171 tors. eta vs tors. theta energy: -29.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.120500 Total energy: -329.618615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.618615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.618615 (E_RNA) where: Base-Base interactions energy: -209.433 where: short stacking energy: -116.638 Base-Backbone interact. energy: -0.426 local terms energy: -119.760290 where: bonds (distance) C4'-P energy: -15.974 bonds (distance) P-C4' energy: -26.672 flat angles C4'-P-C4' energy: -26.437 flat angles P-C4'-P energy: -19.237 tors. eta vs tors. theta energy: -31.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.116000 Total energy: -317.223918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.223918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.223918 (E_RNA) where: Base-Base interactions energy: -198.071 where: short stacking energy: -114.057 Base-Backbone interact. energy: -0.311 local terms energy: -118.842668 where: bonds (distance) C4'-P energy: -24.072 bonds (distance) P-C4' energy: -19.323 flat angles C4'-P-C4' energy: -28.833 flat angles P-C4'-P energy: -13.142 tors. eta vs tors. theta energy: -33.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.111500 Total energy: -312.899527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.899527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.899527 (E_RNA) where: Base-Base interactions energy: -215.904 where: short stacking energy: -100.765 Base-Backbone interact. energy: -0.536 local terms energy: -96.459502 where: bonds (distance) C4'-P energy: -18.491 bonds (distance) P-C4' energy: -12.645 flat angles C4'-P-C4' energy: -25.422 flat angles P-C4'-P energy: -13.587 tors. eta vs tors. theta energy: -26.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.107000 Total energy: -309.156494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.156494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.156494 (E_RNA) where: Base-Base interactions energy: -201.181 where: short stacking energy: -89.608 Base-Backbone interact. energy: -0.284 local terms energy: -107.691552 where: bonds (distance) C4'-P energy: -25.374 bonds (distance) P-C4' energy: -20.003 flat angles C4'-P-C4' energy: -22.310 flat angles P-C4'-P energy: -15.381 tors. eta vs tors. theta energy: -24.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.102500 Total energy: -296.335870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.335870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.335870 (E_RNA) where: Base-Base interactions energy: -190.204 where: short stacking energy: -97.616 Base-Backbone interact. energy: 0.138 local terms energy: -106.269239 where: bonds (distance) C4'-P energy: -22.177 bonds (distance) P-C4' energy: -23.905 flat angles C4'-P-C4' energy: -24.336 flat angles P-C4'-P energy: -13.807 tors. eta vs tors. theta energy: -22.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.098000 Total energy: -318.909175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.909175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.909175 (E_RNA) where: Base-Base interactions energy: -212.715 where: short stacking energy: -99.512 Base-Backbone interact. energy: 2.933 local terms energy: -109.127671 where: bonds (distance) C4'-P energy: -24.368 bonds (distance) P-C4' energy: -24.010 flat angles C4'-P-C4' energy: -18.014 flat angles P-C4'-P energy: -17.217 tors. eta vs tors. theta energy: -25.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.093500 Total energy: -329.891879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.891879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.891879 (E_RNA) where: Base-Base interactions energy: -219.693 where: short stacking energy: -101.605 Base-Backbone interact. energy: -0.411 local terms energy: -109.787957 where: bonds (distance) C4'-P energy: -24.336 bonds (distance) P-C4' energy: -18.084 flat angles C4'-P-C4' energy: -26.320 flat angles P-C4'-P energy: -16.026 tors. eta vs tors. theta energy: -25.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.089000 Total energy: -344.757847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.757847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.757847 (E_RNA) where: Base-Base interactions energy: -224.608 where: short stacking energy: -102.543 Base-Backbone interact. energy: -0.106 local terms energy: -120.043595 where: bonds (distance) C4'-P energy: -25.541 bonds (distance) P-C4' energy: -22.576 flat angles C4'-P-C4' energy: -21.422 flat angles P-C4'-P energy: -19.202 tors. eta vs tors. theta energy: -31.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.084500 Total energy: -336.967287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.967287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.967287 (E_RNA) where: Base-Base interactions energy: -216.510 where: short stacking energy: -110.893 Base-Backbone interact. energy: -0.160 local terms energy: -120.296726 where: bonds (distance) C4'-P energy: -22.075 bonds (distance) P-C4' energy: -24.011 flat angles C4'-P-C4' energy: -25.486 flat angles P-C4'-P energy: -18.713 tors. eta vs tors. theta energy: -30.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.080000 Total energy: -350.787843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.787843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.787843 (E_RNA) where: Base-Base interactions energy: -234.330 where: short stacking energy: -119.991 Base-Backbone interact. energy: -0.529 local terms energy: -115.928631 where: bonds (distance) C4'-P energy: -23.213 bonds (distance) P-C4' energy: -18.415 flat angles C4'-P-C4' energy: -20.978 flat angles P-C4'-P energy: -14.848 tors. eta vs tors. theta energy: -38.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.075500 Total energy: -339.505246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.505246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.505246 (E_RNA) where: Base-Base interactions energy: -220.649 where: short stacking energy: -112.265 Base-Backbone interact. energy: -0.005 local terms energy: -118.851416 where: bonds (distance) C4'-P energy: -18.362 bonds (distance) P-C4' energy: -21.978 flat angles C4'-P-C4' energy: -28.934 flat angles P-C4'-P energy: -16.941 tors. eta vs tors. theta energy: -32.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.071000 Total energy: -337.209532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.209532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.209532 (E_RNA) where: Base-Base interactions energy: -220.164 where: short stacking energy: -121.468 Base-Backbone interact. energy: -0.916 local terms energy: -116.130015 where: bonds (distance) C4'-P energy: -23.590 bonds (distance) P-C4' energy: -25.569 flat angles C4'-P-C4' energy: -21.162 flat angles P-C4'-P energy: -12.262 tors. eta vs tors. theta energy: -33.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.066500 Total energy: -333.002766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.002766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.002766 (E_RNA) where: Base-Base interactions energy: -213.800 where: short stacking energy: -103.287 Base-Backbone interact. energy: -0.244 local terms energy: -118.958585 where: bonds (distance) C4'-P energy: -22.634 bonds (distance) P-C4' energy: -24.102 flat angles C4'-P-C4' energy: -25.428 flat angles P-C4'-P energy: -20.650 tors. eta vs tors. theta energy: -26.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.062000 Total energy: -347.958138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.958138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.958138 (E_RNA) where: Base-Base interactions energy: -225.612 where: short stacking energy: -110.238 Base-Backbone interact. energy: -0.632 local terms energy: -121.714811 where: bonds (distance) C4'-P energy: -24.005 bonds (distance) P-C4' energy: -18.960 flat angles C4'-P-C4' energy: -27.541 flat angles P-C4'-P energy: -17.140 tors. eta vs tors. theta energy: -34.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.057500 Total energy: -360.127989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.127989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.127989 (E_RNA) where: Base-Base interactions energy: -236.294 where: short stacking energy: -117.316 Base-Backbone interact. energy: -1.323 local terms energy: -122.511464 where: bonds (distance) C4'-P energy: -21.254 bonds (distance) P-C4' energy: -24.522 flat angles C4'-P-C4' energy: -28.196 flat angles P-C4'-P energy: -13.632 tors. eta vs tors. theta energy: -34.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.053000 Total energy: -352.419221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.419221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.419221 (E_RNA) where: Base-Base interactions energy: -229.192 where: short stacking energy: -110.394 Base-Backbone interact. energy: -1.391 local terms energy: -121.836025 where: bonds (distance) C4'-P energy: -25.221 bonds (distance) P-C4' energy: -24.571 flat angles C4'-P-C4' energy: -20.894 flat angles P-C4'-P energy: -19.763 tors. eta vs tors. theta energy: -31.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.048500 Total energy: -357.047574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.047574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.047574 (E_RNA) where: Base-Base interactions energy: -240.723 where: short stacking energy: -122.837 Base-Backbone interact. energy: -0.388 local terms energy: -115.936522 where: bonds (distance) C4'-P energy: -18.061 bonds (distance) P-C4' energy: -25.139 flat angles C4'-P-C4' energy: -26.790 flat angles P-C4'-P energy: -14.944 tors. eta vs tors. theta energy: -31.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.044000 Total energy: -349.256444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.256444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.256444 (E_RNA) where: Base-Base interactions energy: -230.049 where: short stacking energy: -118.123 Base-Backbone interact. energy: 0.498 local terms energy: -119.705428 where: bonds (distance) C4'-P energy: -16.547 bonds (distance) P-C4' energy: -21.840 flat angles C4'-P-C4' energy: -26.410 flat angles P-C4'-P energy: -21.397 tors. eta vs tors. theta energy: -33.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.039500 Total energy: -363.034852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.034852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.034852 (E_RNA) where: Base-Base interactions energy: -238.029 where: short stacking energy: -108.469 Base-Backbone interact. energy: -0.004 local terms energy: -125.001702 where: bonds (distance) C4'-P energy: -23.309 bonds (distance) P-C4' energy: -23.619 flat angles C4'-P-C4' energy: -24.153 flat angles P-C4'-P energy: -17.264 tors. eta vs tors. theta energy: -36.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.035000 Total energy: -369.754578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.754578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.754578 (E_RNA) where: Base-Base interactions energy: -240.787 where: short stacking energy: -118.094 Base-Backbone interact. energy: 0.223 local terms energy: -129.190966 where: bonds (distance) C4'-P energy: -25.126 bonds (distance) P-C4' energy: -21.762 flat angles C4'-P-C4' energy: -27.025 flat angles P-C4'-P energy: -17.474 tors. eta vs tors. theta energy: -37.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.030500 Total energy: -350.682325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.682325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.682325 (E_RNA) where: Base-Base interactions energy: -235.127 where: short stacking energy: -116.621 Base-Backbone interact. energy: -0.352 local terms energy: -115.203192 where: bonds (distance) C4'-P energy: -17.232 bonds (distance) P-C4' energy: -20.030 flat angles C4'-P-C4' energy: -27.197 flat angles P-C4'-P energy: -14.751 tors. eta vs tors. theta energy: -35.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.026000 Total energy: -360.014749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.014749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.014749 (E_RNA) where: Base-Base interactions energy: -239.933 where: short stacking energy: -117.669 Base-Backbone interact. energy: -0.700 local terms energy: -119.381343 where: bonds (distance) C4'-P energy: -24.438 bonds (distance) P-C4' energy: -21.619 flat angles C4'-P-C4' energy: -26.802 flat angles P-C4'-P energy: -14.659 tors. eta vs tors. theta energy: -31.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.021500 Total energy: -357.060555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.060555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.060555 (E_RNA) where: Base-Base interactions energy: -240.871 where: short stacking energy: -120.819 Base-Backbone interact. energy: -0.036 local terms energy: -116.153317 where: bonds (distance) C4'-P energy: -22.615 bonds (distance) P-C4' energy: -25.479 flat angles C4'-P-C4' energy: -20.807 flat angles P-C4'-P energy: -11.075 tors. eta vs tors. theta energy: -36.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.017000 Total energy: -362.357630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.357630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.357630 (E_RNA) where: Base-Base interactions energy: -245.104 where: short stacking energy: -119.309 Base-Backbone interact. energy: -0.375 local terms energy: -116.878224 where: bonds (distance) C4'-P energy: -23.820 bonds (distance) P-C4' energy: -22.518 flat angles C4'-P-C4' energy: -20.639 flat angles P-C4'-P energy: -12.833 tors. eta vs tors. theta energy: -37.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.012500 Total energy: -363.118961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.118961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.118961 (E_RNA) where: Base-Base interactions energy: -232.811 where: short stacking energy: -117.621 Base-Backbone interact. energy: -0.001 local terms energy: -130.307542 where: bonds (distance) C4'-P energy: -26.104 bonds (distance) P-C4' energy: -25.755 flat angles C4'-P-C4' energy: -28.296 flat angles P-C4'-P energy: -16.299 tors. eta vs tors. theta energy: -33.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.008000 Total energy: -359.725807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.725807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.725807 (E_RNA) where: Base-Base interactions energy: -234.082 where: short stacking energy: -115.686 Base-Backbone interact. energy: -0.003 local terms energy: -125.639969 where: bonds (distance) C4'-P energy: -27.934 bonds (distance) P-C4' energy: -22.282 flat angles C4'-P-C4' energy: -24.191 flat angles P-C4'-P energy: -14.918 tors. eta vs tors. theta energy: -36.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.003500 Total energy: -350.134522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.134522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.134522 (E_RNA) where: Base-Base interactions energy: -238.999 where: short stacking energy: -104.788 Base-Backbone interact. energy: -1.446 local terms energy: -109.689154 where: bonds (distance) C4'-P energy: -22.309 bonds (distance) P-C4' energy: -19.852 flat angles C4'-P-C4' energy: -23.362 flat angles P-C4'-P energy: -11.141 tors. eta vs tors. theta energy: -33.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 0.999000 Total energy: -365.130084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.130084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.130084 (E_RNA) where: Base-Base interactions energy: -236.860 where: short stacking energy: -117.706 Base-Backbone interact. energy: -0.381 local terms energy: -127.889174 where: bonds (distance) C4'-P energy: -22.617 bonds (distance) P-C4' energy: -26.830 flat angles C4'-P-C4' energy: -25.306 flat angles P-C4'-P energy: -20.092 tors. eta vs tors. theta energy: -33.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 0.994500 Total energy: -364.206892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.206892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.206892 (E_RNA) where: Base-Base interactions energy: -238.806 where: short stacking energy: -123.163 Base-Backbone interact. energy: -0.087 local terms energy: -125.314011 where: bonds (distance) C4'-P energy: -23.859 bonds (distance) P-C4' energy: -24.437 flat angles C4'-P-C4' energy: -22.744 flat angles P-C4'-P energy: -17.561 tors. eta vs tors. theta energy: -36.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 0.990000 Total energy: -359.790843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.790843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.790843 (E_RNA) where: Base-Base interactions energy: -240.202 where: short stacking energy: -114.305 Base-Backbone interact. energy: -0.103 local terms energy: -119.485956 where: bonds (distance) C4'-P energy: -15.083 bonds (distance) P-C4' energy: -27.551 flat angles C4'-P-C4' energy: -26.293 flat angles P-C4'-P energy: -18.853 tors. eta vs tors. theta energy: -31.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 0.985500 Total energy: -356.345079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.345079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.345079 (E_RNA) where: Base-Base interactions energy: -229.587 where: short stacking energy: -115.254 Base-Backbone interact. energy: -0.212 local terms energy: -126.545714 where: bonds (distance) C4'-P energy: -24.847 bonds (distance) P-C4' energy: -27.653 flat angles C4'-P-C4' energy: -25.222 flat angles P-C4'-P energy: -17.255 tors. eta vs tors. theta energy: -31.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 0.981000 Total energy: -354.245599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.245599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.245599 (E_RNA) where: Base-Base interactions energy: -235.851 where: short stacking energy: -106.341 Base-Backbone interact. energy: -0.132 local terms energy: -118.262864 where: bonds (distance) C4'-P energy: -20.765 bonds (distance) P-C4' energy: -19.673 flat angles C4'-P-C4' energy: -27.436 flat angles P-C4'-P energy: -16.726 tors. eta vs tors. theta energy: -33.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 0.976500 Total energy: -370.275320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.275320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.275320 (E_RNA) where: Base-Base interactions energy: -246.163 where: short stacking energy: -121.334 Base-Backbone interact. energy: -0.361 local terms energy: -123.750947 where: bonds (distance) C4'-P energy: -22.036 bonds (distance) P-C4' energy: -19.699 flat angles C4'-P-C4' energy: -26.547 flat angles P-C4'-P energy: -19.568 tors. eta vs tors. theta energy: -35.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 0.972000 Total energy: -370.804933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.804933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.804933 (E_RNA) where: Base-Base interactions energy: -242.736 where: short stacking energy: -115.792 Base-Backbone interact. energy: -0.742 local terms energy: -127.326679 where: bonds (distance) C4'-P energy: -22.359 bonds (distance) P-C4' energy: -25.595 flat angles C4'-P-C4' energy: -22.142 flat angles P-C4'-P energy: -21.472 tors. eta vs tors. theta energy: -35.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 0.967500 Total energy: -379.981763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.981763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.981763 (E_RNA) where: Base-Base interactions energy: -255.180 where: short stacking energy: -123.653 Base-Backbone interact. energy: -0.011 local terms energy: -124.791042 where: bonds (distance) C4'-P energy: -24.783 bonds (distance) P-C4' energy: -26.982 flat angles C4'-P-C4' energy: -21.389 flat angles P-C4'-P energy: -13.986 tors. eta vs tors. theta energy: -37.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 0.963000 Total energy: -376.784859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.784859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.784859 (E_RNA) where: Base-Base interactions energy: -251.787 where: short stacking energy: -125.382 Base-Backbone interact. energy: -0.768 local terms energy: -124.229493 where: bonds (distance) C4'-P energy: -20.754 bonds (distance) P-C4' energy: -21.660 flat angles C4'-P-C4' energy: -27.308 flat angles P-C4'-P energy: -16.639 tors. eta vs tors. theta energy: -37.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 0.958500 Total energy: -362.382726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.382726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.382726 (E_RNA) where: Base-Base interactions energy: -242.047 where: short stacking energy: -130.278 Base-Backbone interact. energy: -0.664 local terms energy: -119.671651 where: bonds (distance) C4'-P energy: -18.487 bonds (distance) P-C4' energy: -24.159 flat angles C4'-P-C4' energy: -24.865 flat angles P-C4'-P energy: -17.097 tors. eta vs tors. theta energy: -35.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 0.954000 Total energy: -365.545292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.545292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.545292 (E_RNA) where: Base-Base interactions energy: -250.703 where: short stacking energy: -120.036 Base-Backbone interact. energy: -0.154 local terms energy: -114.688244 where: bonds (distance) C4'-P energy: -20.034 bonds (distance) P-C4' energy: -21.760 flat angles C4'-P-C4' energy: -25.011 flat angles P-C4'-P energy: -15.514 tors. eta vs tors. theta energy: -32.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 0.949500 Total energy: -369.757205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.757205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.757205 (E_RNA) where: Base-Base interactions energy: -245.029 where: short stacking energy: -127.695 Base-Backbone interact. energy: -1.538 local terms energy: -123.190093 where: bonds (distance) C4'-P energy: -18.627 bonds (distance) P-C4' energy: -25.889 flat angles C4'-P-C4' energy: -27.985 flat angles P-C4'-P energy: -16.549 tors. eta vs tors. theta energy: -34.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 0.945000 Total energy: -367.031891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.031891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.031891 (E_RNA) where: Base-Base interactions energy: -252.503 where: short stacking energy: -125.737 Base-Backbone interact. energy: -0.598 local terms energy: -113.931727 where: bonds (distance) C4'-P energy: -24.099 bonds (distance) P-C4' energy: -19.056 flat angles C4'-P-C4' energy: -20.619 flat angles P-C4'-P energy: -13.524 tors. eta vs tors. theta energy: -36.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 0.940500 Total energy: -369.593416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.593416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.593416 (E_RNA) where: Base-Base interactions energy: -244.730 where: short stacking energy: -110.052 Base-Backbone interact. energy: -0.108 local terms energy: -124.755601 where: bonds (distance) C4'-P energy: -26.455 bonds (distance) P-C4' energy: -24.946 flat angles C4'-P-C4' energy: -22.024 flat angles P-C4'-P energy: -21.838 tors. eta vs tors. theta energy: -29.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 0.936000 Total energy: -381.659185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.659185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.659185 (E_RNA) where: Base-Base interactions energy: -255.131 where: short stacking energy: -132.030 Base-Backbone interact. energy: -0.692 local terms energy: -125.836166 where: bonds (distance) C4'-P energy: -23.501 bonds (distance) P-C4' energy: -23.163 flat angles C4'-P-C4' energy: -24.101 flat angles P-C4'-P energy: -20.129 tors. eta vs tors. theta energy: -34.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 0.931500 Total energy: -369.523961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.523961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.523961 (E_RNA) where: Base-Base interactions energy: -243.086 where: short stacking energy: -120.357 Base-Backbone interact. energy: -0.531 local terms energy: -125.907086 where: bonds (distance) C4'-P energy: -24.976 bonds (distance) P-C4' energy: -20.283 flat angles C4'-P-C4' energy: -24.711 flat angles P-C4'-P energy: -21.109 tors. eta vs tors. theta energy: -34.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 0.927000 Total energy: -375.375416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.375416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.375416 (E_RNA) where: Base-Base interactions energy: -247.354 where: short stacking energy: -128.175 Base-Backbone interact. energy: -0.128 local terms energy: -127.893414 where: bonds (distance) C4'-P energy: -23.370 bonds (distance) P-C4' energy: -22.428 flat angles C4'-P-C4' energy: -22.770 flat angles P-C4'-P energy: -18.212 tors. eta vs tors. theta energy: -41.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 0.922500 Total energy: -378.102747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.102747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.102747 (E_RNA) where: Base-Base interactions energy: -244.715 where: short stacking energy: -128.814 Base-Backbone interact. energy: -0.783 local terms energy: -132.604464 where: bonds (distance) C4'-P energy: -23.214 bonds (distance) P-C4' energy: -25.683 flat angles C4'-P-C4' energy: -27.502 flat angles P-C4'-P energy: -18.108 tors. eta vs tors. theta energy: -38.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 0.918000 Total energy: -371.457132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.457132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.457132 (E_RNA) where: Base-Base interactions energy: -247.325 where: short stacking energy: -124.660 Base-Backbone interact. energy: 0.198 local terms energy: -124.329531 where: bonds (distance) C4'-P energy: -22.516 bonds (distance) P-C4' energy: -24.698 flat angles C4'-P-C4' energy: -26.474 flat angles P-C4'-P energy: -20.887 tors. eta vs tors. theta energy: -29.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 0.913500 Total energy: -370.478142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.478142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.478142 (E_RNA) where: Base-Base interactions energy: -240.481 where: short stacking energy: -123.642 Base-Backbone interact. energy: -0.307 local terms energy: -129.690141 where: bonds (distance) C4'-P energy: -26.243 bonds (distance) P-C4' energy: -22.404 flat angles C4'-P-C4' energy: -23.335 flat angles P-C4'-P energy: -22.476 tors. eta vs tors. theta energy: -35.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 0.909000 Total energy: -369.828002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.828002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.828002 (E_RNA) where: Base-Base interactions energy: -240.251 where: short stacking energy: -120.587 Base-Backbone interact. energy: 0.051 local terms energy: -129.628695 where: bonds (distance) C4'-P energy: -27.060 bonds (distance) P-C4' energy: -19.709 flat angles C4'-P-C4' energy: -27.729 flat angles P-C4'-P energy: -16.605 tors. eta vs tors. theta energy: -38.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 0.904500 Total energy: -370.275283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.275283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.275283 (E_RNA) where: Base-Base interactions energy: -239.297 where: short stacking energy: -115.675 Base-Backbone interact. energy: -0.619 local terms energy: -130.359743 where: bonds (distance) C4'-P energy: -28.132 bonds (distance) P-C4' energy: -22.822 flat angles C4'-P-C4' energy: -26.228 flat angles P-C4'-P energy: -17.129 tors. eta vs tors. theta energy: -36.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 0.900000 Total energy: -376.252102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.252102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.252102 (E_RNA) where: Base-Base interactions energy: -247.641 where: short stacking energy: -117.191 Base-Backbone interact. energy: -0.140 local terms energy: -128.470995 where: bonds (distance) C4'-P energy: -22.387 bonds (distance) P-C4' energy: -25.280 flat angles C4'-P-C4' energy: -28.561 flat angles P-C4'-P energy: -13.748 tors. eta vs tors. theta energy: -38.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -354.393609 recalc. total energy: -354.393609 numberOfNucleotides: 35 initial temperature kT: 1.350000 moves confirmed at first: 5297118 moves confirmed later: 6181208 all moves confirmed: 11478326 percent of confirmed moves: 7.173954 out arg RESULTS//1/B23_35_simRNA-b94678c7_01 Time of doing 1600000 iterations: 664.263 seconds