SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold5-9c26bad6/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................((((.....))))._ nucl1: 24, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 23, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 22, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 21, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 21, chainIndex_2: 0, nuclIndex_2: 33 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -10.581822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -10.581822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 120.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -243.628836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.628836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.729111 (E_RNA) where: Base-Base interactions energy: -131.196 where: short stacking energy: -89.099 Base-Backbone interact. energy: -0.136 local terms energy: -116.397289 where: bonds (distance) C4'-P energy: -27.370 bonds (distance) P-C4' energy: -24.618 flat angles C4'-P-C4' energy: -24.522 flat angles P-C4'-P energy: -21.300 tors. eta vs tors. theta energy: -18.587 Dist. restrs. and SS energy: 4.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -213.954009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.954009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.637125 (E_RNA) where: Base-Base interactions energy: -119.271 where: short stacking energy: -84.549 Base-Backbone interact. energy: -0.088 local terms energy: -100.277413 where: bonds (distance) C4'-P energy: -19.016 bonds (distance) P-C4' energy: -22.476 flat angles C4'-P-C4' energy: -22.579 flat angles P-C4'-P energy: -15.968 tors. eta vs tors. theta energy: -20.238 Dist. restrs. and SS energy: 5.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -206.677514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.677514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.132937 (E_RNA) where: Base-Base interactions energy: -117.545 where: short stacking energy: -69.990 Base-Backbone interact. energy: -0.474 local terms energy: -92.113805 where: bonds (distance) C4'-P energy: -15.633 bonds (distance) P-C4' energy: -24.450 flat angles C4'-P-C4' energy: -25.191 flat angles P-C4'-P energy: -18.525 tors. eta vs tors. theta energy: -8.315 Dist. restrs. and SS energy: 3.455 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -230.329650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.329650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.374088 (E_RNA) where: Base-Base interactions energy: -132.225 where: short stacking energy: -85.210 Base-Backbone interact. energy: -0.187 local terms energy: -97.962805 where: bonds (distance) C4'-P energy: -19.732 bonds (distance) P-C4' energy: -26.611 flat angles C4'-P-C4' energy: -22.985 flat angles P-C4'-P energy: -12.367 tors. eta vs tors. theta energy: -16.267 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -226.797887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.797887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.831542 (E_RNA) where: Base-Base interactions energy: -136.662 where: short stacking energy: -84.801 Base-Backbone interact. energy: -0.763 local terms energy: -89.406503 where: bonds (distance) C4'-P energy: -19.346 bonds (distance) P-C4' energy: -24.340 flat angles C4'-P-C4' energy: -21.833 flat angles P-C4'-P energy: -13.387 tors. eta vs tors. theta energy: -10.500 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -189.892236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.892236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.170888 (E_RNA) where: Base-Base interactions energy: -99.060 where: short stacking energy: -62.123 Base-Backbone interact. energy: -0.336 local terms energy: -93.775119 where: bonds (distance) C4'-P energy: -22.459 bonds (distance) P-C4' energy: -24.449 flat angles C4'-P-C4' energy: -20.346 flat angles P-C4'-P energy: -16.312 tors. eta vs tors. theta energy: -10.209 Dist. restrs. and SS energy: 3.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -204.472895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.472895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.536808 (E_RNA) where: Base-Base interactions energy: -133.687 where: short stacking energy: -62.301 Base-Backbone interact. energy: -0.135 local terms energy: -70.714341 where: bonds (distance) C4'-P energy: -18.579 bonds (distance) P-C4' energy: -14.697 flat angles C4'-P-C4' energy: -17.376 flat angles P-C4'-P energy: -12.460 tors. eta vs tors. theta energy: -7.603 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -202.191712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.191712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.229508 (E_RNA) where: Base-Base interactions energy: -108.648 where: short stacking energy: -50.536 Base-Backbone interact. energy: -0.207 local terms energy: -93.375307 where: bonds (distance) C4'-P energy: -20.742 bonds (distance) P-C4' energy: -28.894 flat angles C4'-P-C4' energy: -23.911 flat angles P-C4'-P energy: -13.819 tors. eta vs tors. theta energy: -6.011 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -153.229879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.229879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.846632 (E_RNA) where: Base-Base interactions energy: -73.009 where: short stacking energy: -50.885 Base-Backbone interact. energy: 0.704 local terms energy: -85.541638 where: bonds (distance) C4'-P energy: -14.287 bonds (distance) P-C4' energy: -25.329 flat angles C4'-P-C4' energy: -19.317 flat angles P-C4'-P energy: -16.353 tors. eta vs tors. theta energy: -10.256 Dist. restrs. and SS energy: 4.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -169.640603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.640603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.953333 (E_RNA) where: Base-Base interactions energy: -97.761 where: short stacking energy: -49.439 Base-Backbone interact. energy: 1.703 local terms energy: -75.895537 where: bonds (distance) C4'-P energy: -17.670 bonds (distance) P-C4' energy: -17.717 flat angles C4'-P-C4' energy: -26.105 flat angles P-C4'-P energy: -10.204 tors. eta vs tors. theta energy: -4.198 Dist. restrs. and SS energy: 2.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -237.480349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.480349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.951675 (E_RNA) where: Base-Base interactions energy: -129.147 where: short stacking energy: -87.929 Base-Backbone interact. energy: 0.566 local terms energy: -112.370956 where: bonds (distance) C4'-P energy: -24.173 bonds (distance) P-C4' energy: -28.031 flat angles C4'-P-C4' energy: -23.414 flat angles P-C4'-P energy: -17.191 tors. eta vs tors. theta energy: -19.562 Dist. restrs. and SS energy: 3.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -266.260711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.260711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.396955 (E_RNA) where: Base-Base interactions energy: -157.558 where: short stacking energy: -103.841 Base-Backbone interact. energy: -0.341 local terms energy: -108.497964 where: bonds (distance) C4'-P energy: -20.787 bonds (distance) P-C4' energy: -24.853 flat angles C4'-P-C4' energy: -22.794 flat angles P-C4'-P energy: -15.376 tors. eta vs tors. theta energy: -24.690 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -241.272561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.272561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.858081 (E_RNA) where: Base-Base interactions energy: -141.847 where: short stacking energy: -90.313 Base-Backbone interact. energy: -0.460 local terms energy: -101.551583 where: bonds (distance) C4'-P energy: -22.154 bonds (distance) P-C4' energy: -19.612 flat angles C4'-P-C4' energy: -21.564 flat angles P-C4'-P energy: -17.933 tors. eta vs tors. theta energy: -20.288 Dist. restrs. and SS energy: 2.586 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -233.636872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.636872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.925794 (E_RNA) where: Base-Base interactions energy: -129.712 where: short stacking energy: -76.644 Base-Backbone interact. energy: -0.238 local terms energy: -103.976532 where: bonds (distance) C4'-P energy: -27.978 bonds (distance) P-C4' energy: -21.538 flat angles C4'-P-C4' energy: -24.179 flat angles P-C4'-P energy: -13.545 tors. eta vs tors. theta energy: -16.737 Dist. restrs. and SS energy: 0.289 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -228.663706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.663706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.116470 (E_RNA) where: Base-Base interactions energy: -127.900 where: short stacking energy: -77.210 Base-Backbone interact. energy: -0.372 local terms energy: -100.844561 where: bonds (distance) C4'-P energy: -26.224 bonds (distance) P-C4' energy: -26.798 flat angles C4'-P-C4' energy: -21.500 flat angles P-C4'-P energy: -12.107 tors. eta vs tors. theta energy: -14.216 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -263.331117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.331117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.331117 (E_RNA) where: Base-Base interactions energy: -165.388 where: short stacking energy: -95.175 Base-Backbone interact. energy: -0.440 local terms energy: -97.502934 where: bonds (distance) C4'-P energy: -10.857 bonds (distance) P-C4' energy: -24.168 flat angles C4'-P-C4' energy: -21.677 flat angles P-C4'-P energy: -15.676 tors. eta vs tors. theta energy: -25.125 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -160.960519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.960519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.578184 (E_RNA) where: Base-Base interactions energy: -79.216 where: short stacking energy: -55.521 Base-Backbone interact. energy: -0.268 local terms energy: -85.094107 where: bonds (distance) C4'-P energy: -20.872 bonds (distance) P-C4' energy: -24.381 flat angles C4'-P-C4' energy: -15.902 flat angles P-C4'-P energy: -12.598 tors. eta vs tors. theta energy: -11.342 Dist. restrs. and SS energy: 3.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -219.914566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.914566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.145562 (E_RNA) where: Base-Base interactions energy: -128.457 where: short stacking energy: -74.155 Base-Backbone interact. energy: -1.116 local terms energy: -90.572077 where: bonds (distance) C4'-P energy: -19.191 bonds (distance) P-C4' energy: -21.310 flat angles C4'-P-C4' energy: -16.578 flat angles P-C4'-P energy: -17.837 tors. eta vs tors. theta energy: -15.657 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -213.200941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.200941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.200941 (E_RNA) where: Base-Base interactions energy: -133.690 where: short stacking energy: -62.505 Base-Backbone interact. energy: -1.021 local terms energy: -78.490434 where: bonds (distance) C4'-P energy: -13.116 bonds (distance) P-C4' energy: -20.288 flat angles C4'-P-C4' energy: -20.935 flat angles P-C4'-P energy: -13.680 tors. eta vs tors. theta energy: -10.472 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -184.105508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.105508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.417000 (E_RNA) where: Base-Base interactions energy: -95.003 where: short stacking energy: -55.252 Base-Backbone interact. energy: 2.128 local terms energy: -91.541750 where: bonds (distance) C4'-P energy: -20.444 bonds (distance) P-C4' energy: -26.062 flat angles C4'-P-C4' energy: -24.408 flat angles P-C4'-P energy: -11.792 tors. eta vs tors. theta energy: -8.835 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -297.628812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.628812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.655080 (E_RNA) where: Base-Base interactions energy: -180.543 where: short stacking energy: -112.332 Base-Backbone interact. energy: -0.224 local terms energy: -116.888215 where: bonds (distance) C4'-P energy: -25.275 bonds (distance) P-C4' energy: -18.382 flat angles C4'-P-C4' energy: -24.277 flat angles P-C4'-P energy: -18.208 tors. eta vs tors. theta energy: -30.746 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -235.628187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.628187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.461134 (E_RNA) where: Base-Base interactions energy: -146.915 where: short stacking energy: -76.355 Base-Backbone interact. energy: 1.827 local terms energy: -95.373242 where: bonds (distance) C4'-P energy: -26.744 bonds (distance) P-C4' energy: -16.198 flat angles C4'-P-C4' energy: -19.806 flat angles P-C4'-P energy: -20.058 tors. eta vs tors. theta energy: -12.568 Dist. restrs. and SS energy: 4.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -246.920624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.920624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.995311 (E_RNA) where: Base-Base interactions energy: -148.450 where: short stacking energy: -84.185 Base-Backbone interact. energy: -1.616 local terms energy: -96.929286 where: bonds (distance) C4'-P energy: -20.341 bonds (distance) P-C4' energy: -27.483 flat angles C4'-P-C4' energy: -21.064 flat angles P-C4'-P energy: -13.885 tors. eta vs tors. theta energy: -14.157 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -266.213933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.213933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.267676 (E_RNA) where: Base-Base interactions energy: -161.161 where: short stacking energy: -86.239 Base-Backbone interact. energy: -1.776 local terms energy: -103.331245 where: bonds (distance) C4'-P energy: -21.089 bonds (distance) P-C4' energy: -24.209 flat angles C4'-P-C4' energy: -20.210 flat angles P-C4'-P energy: -16.371 tors. eta vs tors. theta energy: -21.452 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -256.749399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.749399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.857560 (E_RNA) where: Base-Base interactions energy: -152.534 where: short stacking energy: -91.708 Base-Backbone interact. energy: -0.570 local terms energy: -103.753881 where: bonds (distance) C4'-P energy: -20.298 bonds (distance) P-C4' energy: -20.062 flat angles C4'-P-C4' energy: -27.851 flat angles P-C4'-P energy: -13.333 tors. eta vs tors. theta energy: -22.211 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -242.781242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.781242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.931953 (E_RNA) where: Base-Base interactions energy: -148.857 where: short stacking energy: -88.890 Base-Backbone interact. energy: -0.512 local terms energy: -93.563813 where: bonds (distance) C4'-P energy: -17.196 bonds (distance) P-C4' energy: -22.050 flat angles C4'-P-C4' energy: -22.493 flat angles P-C4'-P energy: -11.941 tors. eta vs tors. theta energy: -19.884 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -218.515436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.515436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.831363 (E_RNA) where: Base-Base interactions energy: -129.662 where: short stacking energy: -71.485 Base-Backbone interact. energy: -0.134 local terms energy: -89.035188 where: bonds (distance) C4'-P energy: -21.865 bonds (distance) P-C4' energy: -22.861 flat angles C4'-P-C4' energy: -20.877 flat angles P-C4'-P energy: -15.604 tors. eta vs tors. theta energy: -7.829 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -154.024191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.024191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.136634 (E_RNA) where: Base-Base interactions energy: -84.509 where: short stacking energy: -40.852 Base-Backbone interact. energy: -1.736 local terms energy: -69.891469 where: bonds (distance) C4'-P energy: -21.259 bonds (distance) P-C4' energy: -15.946 flat angles C4'-P-C4' energy: -16.400 flat angles P-C4'-P energy: -15.347 tors. eta vs tors. theta energy: -0.940 Dist. restrs. and SS energy: 2.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -226.801409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.801409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.860034 (E_RNA) where: Base-Base interactions energy: -143.813 where: short stacking energy: -64.570 Base-Backbone interact. energy: -1.307 local terms energy: -81.740311 where: bonds (distance) C4'-P energy: -17.241 bonds (distance) P-C4' energy: -19.376 flat angles C4'-P-C4' energy: -20.187 flat angles P-C4'-P energy: -14.912 tors. eta vs tors. theta energy: -10.024 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -208.736456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.736456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.858003 (E_RNA) where: Base-Base interactions energy: -119.073 where: short stacking energy: -70.053 Base-Backbone interact. energy: -0.740 local terms energy: -89.044684 where: bonds (distance) C4'-P energy: -18.930 bonds (distance) P-C4' energy: -21.804 flat angles C4'-P-C4' energy: -23.279 flat angles P-C4'-P energy: -6.638 tors. eta vs tors. theta energy: -18.395 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -322.318015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.318015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.318015 (E_RNA) where: Base-Base interactions energy: -207.664 where: short stacking energy: -116.268 Base-Backbone interact. energy: 0.013 local terms energy: -114.667221 where: bonds (distance) C4'-P energy: -19.434 bonds (distance) P-C4' energy: -24.186 flat angles C4'-P-C4' energy: -24.916 flat angles P-C4'-P energy: -19.970 tors. eta vs tors. theta energy: -26.162 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -269.112716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.112716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.112716 (E_RNA) where: Base-Base interactions energy: -158.152 where: short stacking energy: -90.567 Base-Backbone interact. energy: -0.366 local terms energy: -110.595292 where: bonds (distance) C4'-P energy: -27.746 bonds (distance) P-C4' energy: -24.401 flat angles C4'-P-C4' energy: -23.734 flat angles P-C4'-P energy: -14.710 tors. eta vs tors. theta energy: -20.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -270.222835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.222835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.061853 (E_RNA) where: Base-Base interactions energy: -161.172 where: short stacking energy: -87.029 Base-Backbone interact. energy: -0.348 local terms energy: -110.541686 where: bonds (distance) C4'-P energy: -26.008 bonds (distance) P-C4' energy: -28.542 flat angles C4'-P-C4' energy: -25.333 flat angles P-C4'-P energy: -10.804 tors. eta vs tors. theta energy: -19.856 Dist. restrs. and SS energy: 1.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -265.206698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.206698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.249173 (E_RNA) where: Base-Base interactions energy: -171.338 where: short stacking energy: -98.373 Base-Backbone interact. energy: -0.073 local terms energy: -93.837969 where: bonds (distance) C4'-P energy: -22.026 bonds (distance) P-C4' energy: -19.259 flat angles C4'-P-C4' energy: -14.949 flat angles P-C4'-P energy: -14.251 tors. eta vs tors. theta energy: -23.353 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -274.753071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.753071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.763696 (E_RNA) where: Base-Base interactions energy: -169.527 where: short stacking energy: -99.483 Base-Backbone interact. energy: -0.329 local terms energy: -104.907076 where: bonds (distance) C4'-P energy: -18.737 bonds (distance) P-C4' energy: -23.201 flat angles C4'-P-C4' energy: -19.797 flat angles P-C4'-P energy: -14.344 tors. eta vs tors. theta energy: -28.828 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -223.205684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.205684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.400163 (E_RNA) where: Base-Base interactions energy: -139.701 where: short stacking energy: -74.638 Base-Backbone interact. energy: -0.814 local terms energy: -82.885077 where: bonds (distance) C4'-P energy: -20.674 bonds (distance) P-C4' energy: -20.795 flat angles C4'-P-C4' energy: -18.917 flat angles P-C4'-P energy: -13.945 tors. eta vs tors. theta energy: -8.553 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -242.806195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.806195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.888876 (E_RNA) where: Base-Base interactions energy: -147.542 where: short stacking energy: -90.310 Base-Backbone interact. energy: -0.196 local terms energy: -95.150611 where: bonds (distance) C4'-P energy: -16.318 bonds (distance) P-C4' energy: -18.979 flat angles C4'-P-C4' energy: -25.401 flat angles P-C4'-P energy: -12.040 tors. eta vs tors. theta energy: -22.413 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -227.174130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.174130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.330553 (E_RNA) where: Base-Base interactions energy: -135.725 where: short stacking energy: -72.888 Base-Backbone interact. energy: 4.276 local terms energy: -95.881578 where: bonds (distance) C4'-P energy: -20.862 bonds (distance) P-C4' energy: -22.259 flat angles C4'-P-C4' energy: -21.001 flat angles P-C4'-P energy: -15.780 tors. eta vs tors. theta energy: -15.980 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -194.357474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.357474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.590352 (E_RNA) where: Base-Base interactions energy: -115.454 where: short stacking energy: -71.969 Base-Backbone interact. energy: -0.327 local terms energy: -78.809096 where: bonds (distance) C4'-P energy: -20.692 bonds (distance) P-C4' energy: -15.124 flat angles C4'-P-C4' energy: -25.079 flat angles P-C4'-P energy: -8.566 tors. eta vs tors. theta energy: -9.348 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -209.716974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.716974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.745651 (E_RNA) where: Base-Base interactions energy: -124.559 where: short stacking energy: -67.392 Base-Backbone interact. energy: 1.155 local terms energy: -86.342018 where: bonds (distance) C4'-P energy: -20.210 bonds (distance) P-C4' energy: -24.801 flat angles C4'-P-C4' energy: -17.831 flat angles P-C4'-P energy: -12.648 tors. eta vs tors. theta energy: -10.851 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -309.610278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.610278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.623948 (E_RNA) where: Base-Base interactions energy: -194.932 where: short stacking energy: -113.173 Base-Backbone interact. energy: -1.200 local terms energy: -113.491379 where: bonds (distance) C4'-P energy: -22.361 bonds (distance) P-C4' energy: -20.872 flat angles C4'-P-C4' energy: -27.966 flat angles P-C4'-P energy: -15.356 tors. eta vs tors. theta energy: -26.936 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -318.384438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.384438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.412647 (E_RNA) where: Base-Base interactions energy: -197.166 where: short stacking energy: -108.451 Base-Backbone interact. energy: -0.359 local terms energy: -120.887608 where: bonds (distance) C4'-P energy: -24.377 bonds (distance) P-C4' energy: -25.686 flat angles C4'-P-C4' energy: -26.215 flat angles P-C4'-P energy: -17.583 tors. eta vs tors. theta energy: -27.026 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -293.488071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.488071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.488071 (E_RNA) where: Base-Base interactions energy: -177.217 where: short stacking energy: -94.497 Base-Backbone interact. energy: -1.185 local terms energy: -115.085139 where: bonds (distance) C4'-P energy: -27.824 bonds (distance) P-C4' energy: -24.893 flat angles C4'-P-C4' energy: -26.958 flat angles P-C4'-P energy: -18.691 tors. eta vs tors. theta energy: -16.719 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -268.731247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.731247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.731247 (E_RNA) where: Base-Base interactions energy: -151.318 where: short stacking energy: -89.355 Base-Backbone interact. energy: -5.051 local terms energy: -112.362496 where: bonds (distance) C4'-P energy: -26.196 bonds (distance) P-C4' energy: -27.846 flat angles C4'-P-C4' energy: -19.468 flat angles P-C4'-P energy: -16.308 tors. eta vs tors. theta energy: -22.543 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -259.282180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.282180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.282180 (E_RNA) where: Base-Base interactions energy: -157.956 where: short stacking energy: -91.918 Base-Backbone interact. energy: -0.679 local terms energy: -100.647348 where: bonds (distance) C4'-P energy: -20.351 bonds (distance) P-C4' energy: -25.552 flat angles C4'-P-C4' energy: -22.025 flat angles P-C4'-P energy: -11.404 tors. eta vs tors. theta energy: -21.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -233.893854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.893854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.005997 (E_RNA) where: Base-Base interactions energy: -130.556 where: short stacking energy: -73.776 Base-Backbone interact. energy: -1.502 local terms energy: -101.947433 where: bonds (distance) C4'-P energy: -20.435 bonds (distance) P-C4' energy: -24.763 flat angles C4'-P-C4' energy: -23.555 flat angles P-C4'-P energy: -17.187 tors. eta vs tors. theta energy: -16.007 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -245.577239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.577239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.577239 (E_RNA) where: Base-Base interactions energy: -151.408 where: short stacking energy: -74.633 Base-Backbone interact. energy: -0.391 local terms energy: -93.778468 where: bonds (distance) C4'-P energy: -15.983 bonds (distance) P-C4' energy: -20.489 flat angles C4'-P-C4' energy: -25.780 flat angles P-C4'-P energy: -16.851 tors. eta vs tors. theta energy: -14.676 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -238.376962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.376962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.442801 (E_RNA) where: Base-Base interactions energy: -143.615 where: short stacking energy: -85.297 Base-Backbone interact. energy: -0.938 local terms energy: -93.889812 where: bonds (distance) C4'-P energy: -18.647 bonds (distance) P-C4' energy: -25.599 flat angles C4'-P-C4' energy: -21.782 flat angles P-C4'-P energy: -11.253 tors. eta vs tors. theta energy: -16.610 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -195.601035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.601035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.983830 (E_RNA) where: Base-Base interactions energy: -112.294 where: short stacking energy: -70.060 Base-Backbone interact. energy: -0.324 local terms energy: -83.366675 where: bonds (distance) C4'-P energy: -17.509 bonds (distance) P-C4' energy: -21.555 flat angles C4'-P-C4' energy: -17.625 flat angles P-C4'-P energy: -13.561 tors. eta vs tors. theta energy: -13.117 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -189.008072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.008072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.099490 (E_RNA) where: Base-Base interactions energy: -109.045 where: short stacking energy: -63.309 Base-Backbone interact. energy: 1.362 local terms energy: -81.416585 where: bonds (distance) C4'-P energy: -20.576 bonds (distance) P-C4' energy: -24.914 flat angles C4'-P-C4' energy: -17.162 flat angles P-C4'-P energy: -14.426 tors. eta vs tors. theta energy: -4.338 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -309.356540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.356540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.381467 (E_RNA) where: Base-Base interactions energy: -193.160 where: short stacking energy: -111.319 Base-Backbone interact. energy: -0.736 local terms energy: -115.485390 where: bonds (distance) C4'-P energy: -24.094 bonds (distance) P-C4' energy: -24.514 flat angles C4'-P-C4' energy: -22.818 flat angles P-C4'-P energy: -13.929 tors. eta vs tors. theta energy: -30.129 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -316.742406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.742406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.753412 (E_RNA) where: Base-Base interactions energy: -198.566 where: short stacking energy: -104.855 Base-Backbone interact. energy: -0.183 local terms energy: -118.004011 where: bonds (distance) C4'-P energy: -23.623 bonds (distance) P-C4' energy: -23.168 flat angles C4'-P-C4' energy: -26.145 flat angles P-C4'-P energy: -20.734 tors. eta vs tors. theta energy: -24.335 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -296.871016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.871016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.871016 (E_RNA) where: Base-Base interactions energy: -193.102 where: short stacking energy: -99.379 Base-Backbone interact. energy: -0.383 local terms energy: -103.386254 where: bonds (distance) C4'-P energy: -18.322 bonds (distance) P-C4' energy: -21.057 flat angles C4'-P-C4' energy: -21.500 flat angles P-C4'-P energy: -18.997 tors. eta vs tors. theta energy: -23.510 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -339.942123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.942123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.942123 (E_RNA) where: Base-Base interactions energy: -224.187 where: short stacking energy: -113.217 Base-Backbone interact. energy: -1.358 local terms energy: -114.397637 where: bonds (distance) C4'-P energy: -20.428 bonds (distance) P-C4' energy: -19.171 flat angles C4'-P-C4' energy: -26.130 flat angles P-C4'-P energy: -16.830 tors. eta vs tors. theta energy: -31.838 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -260.172668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.172668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.179752 (E_RNA) where: Base-Base interactions energy: -155.477 where: short stacking energy: -101.861 Base-Backbone interact. energy: 2.144 local terms energy: -106.846821 where: bonds (distance) C4'-P energy: -21.483 bonds (distance) P-C4' energy: -19.659 flat angles C4'-P-C4' energy: -27.416 flat angles P-C4'-P energy: -15.826 tors. eta vs tors. theta energy: -22.462 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -249.897877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.897877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.987907 (E_RNA) where: Base-Base interactions energy: -144.365 where: short stacking energy: -88.830 Base-Backbone interact. energy: -0.524 local terms energy: -105.098455 where: bonds (distance) C4'-P energy: -23.264 bonds (distance) P-C4' energy: -21.071 flat angles C4'-P-C4' energy: -22.216 flat angles P-C4'-P energy: -18.315 tors. eta vs tors. theta energy: -20.233 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -228.189365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.189365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.210643 (E_RNA) where: Base-Base interactions energy: -125.434 where: short stacking energy: -70.817 Base-Backbone interact. energy: -0.667 local terms energy: -102.110332 where: bonds (distance) C4'-P energy: -24.582 bonds (distance) P-C4' energy: -19.728 flat angles C4'-P-C4' energy: -23.210 flat angles P-C4'-P energy: -19.351 tors. eta vs tors. theta energy: -15.240 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -215.911622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.911622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.911622 (E_RNA) where: Base-Base interactions energy: -137.338 where: short stacking energy: -76.714 Base-Backbone interact. energy: 1.147 local terms energy: -79.720278 where: bonds (distance) C4'-P energy: -19.476 bonds (distance) P-C4' energy: -16.185 flat angles C4'-P-C4' energy: -20.203 flat angles P-C4'-P energy: -13.155 tors. eta vs tors. theta energy: -10.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -217.524226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.524226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.045922 (E_RNA) where: Base-Base interactions energy: -126.551 where: short stacking energy: -73.392 Base-Backbone interact. energy: -0.591 local terms energy: -90.904332 where: bonds (distance) C4'-P energy: -17.153 bonds (distance) P-C4' energy: -24.126 flat angles C4'-P-C4' energy: -24.590 flat angles P-C4'-P energy: -5.919 tors. eta vs tors. theta energy: -19.116 Dist. restrs. and SS energy: 0.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -193.679104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.679104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.685842 (E_RNA) where: Base-Base interactions energy: -115.389 where: short stacking energy: -60.684 Base-Backbone interact. energy: 3.442 local terms energy: -81.738270 where: bonds (distance) C4'-P energy: -20.411 bonds (distance) P-C4' energy: -15.207 flat angles C4'-P-C4' energy: -17.907 flat angles P-C4'-P energy: -15.663 tors. eta vs tors. theta energy: -12.550 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -316.668168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.668168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.668168 (E_RNA) where: Base-Base interactions energy: -191.423 where: short stacking energy: -99.326 Base-Backbone interact. energy: -0.846 local terms energy: -124.399494 where: bonds (distance) C4'-P energy: -19.872 bonds (distance) P-C4' energy: -29.171 flat angles C4'-P-C4' energy: -27.664 flat angles P-C4'-P energy: -20.574 tors. eta vs tors. theta energy: -27.119 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -300.497884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.497884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.597176 (E_RNA) where: Base-Base interactions energy: -191.061 where: short stacking energy: -98.385 Base-Backbone interact. energy: -0.956 local terms energy: -108.580061 where: bonds (distance) C4'-P energy: -25.333 bonds (distance) P-C4' energy: -22.892 flat angles C4'-P-C4' energy: -28.054 flat angles P-C4'-P energy: -8.858 tors. eta vs tors. theta energy: -23.444 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -349.172956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.172956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.199874 (E_RNA) where: Base-Base interactions energy: -217.121 where: short stacking energy: -112.249 Base-Backbone interact. energy: -0.973 local terms energy: -131.106258 where: bonds (distance) C4'-P energy: -24.364 bonds (distance) P-C4' energy: -28.001 flat angles C4'-P-C4' energy: -28.197 flat angles P-C4'-P energy: -19.420 tors. eta vs tors. theta energy: -31.125 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -290.665656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.665656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.665656 (E_RNA) where: Base-Base interactions energy: -180.926 where: short stacking energy: -92.605 Base-Backbone interact. energy: -0.298 local terms energy: -109.441635 where: bonds (distance) C4'-P energy: -21.069 bonds (distance) P-C4' energy: -24.950 flat angles C4'-P-C4' energy: -21.375 flat angles P-C4'-P energy: -16.304 tors. eta vs tors. theta energy: -25.744 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -247.784018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.784018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.877150 (E_RNA) where: Base-Base interactions energy: -145.247 where: short stacking energy: -96.664 Base-Backbone interact. energy: -0.548 local terms energy: -102.081604 where: bonds (distance) C4'-P energy: -19.057 bonds (distance) P-C4' energy: -23.668 flat angles C4'-P-C4' energy: -23.228 flat angles P-C4'-P energy: -18.836 tors. eta vs tors. theta energy: -17.292 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -254.189683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.189683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.372897 (E_RNA) where: Base-Base interactions energy: -158.137 where: short stacking energy: -89.437 Base-Backbone interact. energy: -0.045 local terms energy: -96.190971 where: bonds (distance) C4'-P energy: -17.343 bonds (distance) P-C4' energy: -18.897 flat angles C4'-P-C4' energy: -26.375 flat angles P-C4'-P energy: -14.245 tors. eta vs tors. theta energy: -19.331 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -237.096951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.096951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.403853 (E_RNA) where: Base-Base interactions energy: -152.747 where: short stacking energy: -73.299 Base-Backbone interact. energy: 2.254 local terms energy: -86.910300 where: bonds (distance) C4'-P energy: -21.569 bonds (distance) P-C4' energy: -19.408 flat angles C4'-P-C4' energy: -18.405 flat angles P-C4'-P energy: -11.244 tors. eta vs tors. theta energy: -16.284 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -213.572121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.572121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.780952 (E_RNA) where: Base-Base interactions energy: -119.026 where: short stacking energy: -67.477 Base-Backbone interact. energy: -0.862 local terms energy: -93.892696 where: bonds (distance) C4'-P energy: -23.655 bonds (distance) P-C4' energy: -19.590 flat angles C4'-P-C4' energy: -21.963 flat angles P-C4'-P energy: -15.760 tors. eta vs tors. theta energy: -12.925 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -213.417157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.417157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.532684 (E_RNA) where: Base-Base interactions energy: -122.733 where: short stacking energy: -63.894 Base-Backbone interact. energy: -0.844 local terms energy: -89.955837 where: bonds (distance) C4'-P energy: -20.703 bonds (distance) P-C4' energy: -19.409 flat angles C4'-P-C4' energy: -24.030 flat angles P-C4'-P energy: -18.239 tors. eta vs tors. theta energy: -7.575 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -215.976327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.976327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.016957 (E_RNA) where: Base-Base interactions energy: -140.328 where: short stacking energy: -87.500 Base-Backbone interact. energy: -1.381 local terms energy: -74.308323 where: bonds (distance) C4'-P energy: -17.671 bonds (distance) P-C4' energy: -19.481 flat angles C4'-P-C4' energy: -24.549 flat angles P-C4'-P energy: -3.430 tors. eta vs tors. theta energy: -9.178 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -323.400350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.400350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.473829 (E_RNA) where: Base-Base interactions energy: -202.823 where: short stacking energy: -105.051 Base-Backbone interact. energy: -0.963 local terms energy: -119.687020 where: bonds (distance) C4'-P energy: -26.012 bonds (distance) P-C4' energy: -26.270 flat angles C4'-P-C4' energy: -24.716 flat angles P-C4'-P energy: -12.845 tors. eta vs tors. theta energy: -29.845 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -343.073671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.073671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.119047 (E_RNA) where: Base-Base interactions energy: -228.593 where: short stacking energy: -106.412 Base-Backbone interact. energy: -0.072 local terms energy: -114.454902 where: bonds (distance) C4'-P energy: -26.090 bonds (distance) P-C4' energy: -24.235 flat angles C4'-P-C4' energy: -23.176 flat angles P-C4'-P energy: -18.435 tors. eta vs tors. theta energy: -22.518 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -274.845336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.845336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.019208 (E_RNA) where: Base-Base interactions energy: -165.229 where: short stacking energy: -91.600 Base-Backbone interact. energy: -0.327 local terms energy: -109.463435 where: bonds (distance) C4'-P energy: -23.687 bonds (distance) P-C4' energy: -23.605 flat angles C4'-P-C4' energy: -22.089 flat angles P-C4'-P energy: -17.953 tors. eta vs tors. theta energy: -22.130 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -312.080944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.080944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.200058 (E_RNA) where: Base-Base interactions energy: -192.618 where: short stacking energy: -103.028 Base-Backbone interact. energy: -0.618 local terms energy: -118.963955 where: bonds (distance) C4'-P energy: -20.780 bonds (distance) P-C4' energy: -22.288 flat angles C4'-P-C4' energy: -24.991 flat angles P-C4'-P energy: -20.741 tors. eta vs tors. theta energy: -30.165 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -267.833924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.833924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.132702 (E_RNA) where: Base-Base interactions energy: -171.067 where: short stacking energy: -85.982 Base-Backbone interact. energy: -0.735 local terms energy: -96.330488 where: bonds (distance) C4'-P energy: -20.261 bonds (distance) P-C4' energy: -22.600 flat angles C4'-P-C4' energy: -21.342 flat angles P-C4'-P energy: -16.073 tors. eta vs tors. theta energy: -16.053 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -251.060667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.060667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.264914 (E_RNA) where: Base-Base interactions energy: -157.031 where: short stacking energy: -84.885 Base-Backbone interact. energy: -0.015 local terms energy: -94.218342 where: bonds (distance) C4'-P energy: -23.884 bonds (distance) P-C4' energy: -22.566 flat angles C4'-P-C4' energy: -17.466 flat angles P-C4'-P energy: -13.296 tors. eta vs tors. theta energy: -17.006 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -229.509859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.509859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.550879 (E_RNA) where: Base-Base interactions energy: -134.527 where: short stacking energy: -74.258 Base-Backbone interact. energy: -0.111 local terms energy: -94.912540 where: bonds (distance) C4'-P energy: -23.561 bonds (distance) P-C4' energy: -25.030 flat angles C4'-P-C4' energy: -22.439 flat angles P-C4'-P energy: -7.024 tors. eta vs tors. theta energy: -16.858 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -230.748777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.748777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.779244 (E_RNA) where: Base-Base interactions energy: -129.871 where: short stacking energy: -71.127 Base-Backbone interact. energy: -0.632 local terms energy: -100.275554 where: bonds (distance) C4'-P energy: -26.544 bonds (distance) P-C4' energy: -25.326 flat angles C4'-P-C4' energy: -23.877 flat angles P-C4'-P energy: -14.781 tors. eta vs tors. theta energy: -9.748 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -230.507258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.507258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.635798 (E_RNA) where: Base-Base interactions energy: -134.779 where: short stacking energy: -63.694 Base-Backbone interact. energy: -0.162 local terms energy: -95.695375 where: bonds (distance) C4'-P energy: -21.925 bonds (distance) P-C4' energy: -23.803 flat angles C4'-P-C4' energy: -21.689 flat angles P-C4'-P energy: -13.361 tors. eta vs tors. theta energy: -14.918 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -206.640464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.640464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.733760 (E_RNA) where: Base-Base interactions energy: -117.805 where: short stacking energy: -64.395 Base-Backbone interact. energy: -1.311 local terms energy: -87.618366 where: bonds (distance) C4'-P energy: -17.034 bonds (distance) P-C4' energy: -26.535 flat angles C4'-P-C4' energy: -14.992 flat angles P-C4'-P energy: -16.289 tors. eta vs tors. theta energy: -12.769 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -341.454391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.454391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.491234 (E_RNA) where: Base-Base interactions energy: -229.049 where: short stacking energy: -95.995 Base-Backbone interact. energy: -0.773 local terms energy: -111.669312 where: bonds (distance) C4'-P energy: -24.208 bonds (distance) P-C4' energy: -25.490 flat angles C4'-P-C4' energy: -22.010 flat angles P-C4'-P energy: -15.376 tors. eta vs tors. theta energy: -24.586 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -317.631846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.631846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.640671 (E_RNA) where: Base-Base interactions energy: -195.305 where: short stacking energy: -95.169 Base-Backbone interact. energy: -0.388 local terms energy: -121.947356 where: bonds (distance) C4'-P energy: -24.347 bonds (distance) P-C4' energy: -28.358 flat angles C4'-P-C4' energy: -26.882 flat angles P-C4'-P energy: -18.432 tors. eta vs tors. theta energy: -23.928 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -282.920033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.920033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.933474 (E_RNA) where: Base-Base interactions energy: -165.980 where: short stacking energy: -103.098 Base-Backbone interact. energy: -0.577 local terms energy: -116.376413 where: bonds (distance) C4'-P energy: -21.512 bonds (distance) P-C4' energy: -24.428 flat angles C4'-P-C4' energy: -26.484 flat angles P-C4'-P energy: -17.792 tors. eta vs tors. theta energy: -26.161 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -281.157615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.157615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.227794 (E_RNA) where: Base-Base interactions energy: -188.023 where: short stacking energy: -84.358 Base-Backbone interact. energy: -0.949 local terms energy: -92.255282 where: bonds (distance) C4'-P energy: -16.958 bonds (distance) P-C4' energy: -25.051 flat angles C4'-P-C4' energy: -23.322 flat angles P-C4'-P energy: -10.254 tors. eta vs tors. theta energy: -16.670 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -297.621722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.621722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.645528 (E_RNA) where: Base-Base interactions energy: -187.992 where: short stacking energy: -98.252 Base-Backbone interact. energy: 0.714 local terms energy: -110.366917 where: bonds (distance) C4'-P energy: -20.563 bonds (distance) P-C4' energy: -24.358 flat angles C4'-P-C4' energy: -26.836 flat angles P-C4'-P energy: -17.809 tors. eta vs tors. theta energy: -20.802 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -231.315022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.315022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.347815 (E_RNA) where: Base-Base interactions energy: -139.345 where: short stacking energy: -81.248 Base-Backbone interact. energy: -0.186 local terms energy: -91.816312 where: bonds (distance) C4'-P energy: -15.729 bonds (distance) P-C4' energy: -22.240 flat angles C4'-P-C4' energy: -20.010 flat angles P-C4'-P energy: -18.663 tors. eta vs tors. theta energy: -15.176 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -239.027354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.027354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.091268 (E_RNA) where: Base-Base interactions energy: -140.729 where: short stacking energy: -81.214 Base-Backbone interact. energy: -0.332 local terms energy: -98.030723 where: bonds (distance) C4'-P energy: -20.911 bonds (distance) P-C4' energy: -23.182 flat angles C4'-P-C4' energy: -17.973 flat angles P-C4'-P energy: -18.268 tors. eta vs tors. theta energy: -17.697 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -226.148165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.148165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.262945 (E_RNA) where: Base-Base interactions energy: -120.161 where: short stacking energy: -71.041 Base-Backbone interact. energy: -0.350 local terms energy: -105.751368 where: bonds (distance) C4'-P energy: -25.060 bonds (distance) P-C4' energy: -24.323 flat angles C4'-P-C4' energy: -25.688 flat angles P-C4'-P energy: -15.040 tors. eta vs tors. theta energy: -15.640 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -205.677547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.677547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.771423 (E_RNA) where: Base-Base interactions energy: -109.883 where: short stacking energy: -65.009 Base-Backbone interact. energy: -0.976 local terms energy: -94.912215 where: bonds (distance) C4'-P energy: -18.884 bonds (distance) P-C4' energy: -27.274 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -14.731 tors. eta vs tors. theta energy: -10.563 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -203.178253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.178253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.213907 (E_RNA) where: Base-Base interactions energy: -116.818 where: short stacking energy: -61.792 Base-Backbone interact. energy: -0.089 local terms energy: -86.306485 where: bonds (distance) C4'-P energy: -26.630 bonds (distance) P-C4' energy: -21.418 flat angles C4'-P-C4' energy: -25.322 flat angles P-C4'-P energy: -10.207 tors. eta vs tors. theta energy: -2.730 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -357.213924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.213924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.334205 (E_RNA) where: Base-Base interactions energy: -231.987 where: short stacking energy: -119.423 Base-Backbone interact. energy: -0.468 local terms energy: -124.879480 where: bonds (distance) C4'-P energy: -26.451 bonds (distance) P-C4' energy: -21.135 flat angles C4'-P-C4' energy: -25.945 flat angles P-C4'-P energy: -17.842 tors. eta vs tors. theta energy: -33.505 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -327.920908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.920908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.920908 (E_RNA) where: Base-Base interactions energy: -203.817 where: short stacking energy: -110.030 Base-Backbone interact. energy: 0.804 local terms energy: -124.907654 where: bonds (distance) C4'-P energy: -25.340 bonds (distance) P-C4' energy: -26.193 flat angles C4'-P-C4' energy: -25.423 flat angles P-C4'-P energy: -16.584 tors. eta vs tors. theta energy: -31.368 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -269.398912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.398912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.398912 (E_RNA) where: Base-Base interactions energy: -169.363 where: short stacking energy: -99.411 Base-Backbone interact. energy: -0.221 local terms energy: -99.815344 where: bonds (distance) C4'-P energy: -22.057 bonds (distance) P-C4' energy: -24.492 flat angles C4'-P-C4' energy: -24.481 flat angles P-C4'-P energy: -6.239 tors. eta vs tors. theta energy: -22.546 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -296.427663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.427663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.891941 (E_RNA) where: Base-Base interactions energy: -189.424 where: short stacking energy: -90.194 Base-Backbone interact. energy: -1.004 local terms energy: -106.463541 where: bonds (distance) C4'-P energy: -21.588 bonds (distance) P-C4' energy: -22.521 flat angles C4'-P-C4' energy: -27.298 flat angles P-C4'-P energy: -13.218 tors. eta vs tors. theta energy: -21.838 Dist. restrs. and SS energy: 0.464 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -259.723088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.723088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.723088 (E_RNA) where: Base-Base interactions energy: -171.403 where: short stacking energy: -99.870 Base-Backbone interact. energy: -1.051 local terms energy: -87.269345 where: bonds (distance) C4'-P energy: -23.581 bonds (distance) P-C4' energy: -13.998 flat angles C4'-P-C4' energy: -13.249 flat angles P-C4'-P energy: -18.216 tors. eta vs tors. theta energy: -18.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -235.601157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.601157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.830978 (E_RNA) where: Base-Base interactions energy: -134.207 where: short stacking energy: -78.785 Base-Backbone interact. energy: -0.078 local terms energy: -101.545978 where: bonds (distance) C4'-P energy: -23.523 bonds (distance) P-C4' energy: -25.444 flat angles C4'-P-C4' energy: -21.260 flat angles P-C4'-P energy: -13.108 tors. eta vs tors. theta energy: -18.211 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -264.802426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.802426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.961760 (E_RNA) where: Base-Base interactions energy: -160.518 where: short stacking energy: -95.633 Base-Backbone interact. energy: -1.339 local terms energy: -103.104835 where: bonds (distance) C4'-P energy: -19.816 bonds (distance) P-C4' energy: -17.711 flat angles C4'-P-C4' energy: -22.751 flat angles P-C4'-P energy: -19.839 tors. eta vs tors. theta energy: -22.988 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -234.859862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.859862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.859862 (E_RNA) where: Base-Base interactions energy: -139.304 where: short stacking energy: -73.088 Base-Backbone interact. energy: -0.526 local terms energy: -95.029888 where: bonds (distance) C4'-P energy: -17.362 bonds (distance) P-C4' energy: -25.983 flat angles C4'-P-C4' energy: -19.038 flat angles P-C4'-P energy: -16.918 tors. eta vs tors. theta energy: -15.728 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -201.239928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.239928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.368226 (E_RNA) where: Base-Base interactions energy: -125.831 where: short stacking energy: -70.937 Base-Backbone interact. energy: -0.513 local terms energy: -75.023857 where: bonds (distance) C4'-P energy: -19.690 bonds (distance) P-C4' energy: -19.505 flat angles C4'-P-C4' energy: -20.670 flat angles P-C4'-P energy: -8.059 tors. eta vs tors. theta energy: -7.100 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -207.197200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.197200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.510252 (E_RNA) where: Base-Base interactions energy: -114.038 where: short stacking energy: -64.926 Base-Backbone interact. energy: -0.676 local terms energy: -92.795886 where: bonds (distance) C4'-P energy: -22.666 bonds (distance) P-C4' energy: -17.421 flat angles C4'-P-C4' energy: -25.054 flat angles P-C4'-P energy: -11.914 tors. eta vs tors. theta energy: -15.742 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -355.144556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.144556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.144556 (E_RNA) where: Base-Base interactions energy: -228.484 where: short stacking energy: -110.489 Base-Backbone interact. energy: -0.751 local terms energy: -125.908997 where: bonds (distance) C4'-P energy: -25.035 bonds (distance) P-C4' energy: -25.747 flat angles C4'-P-C4' energy: -26.314 flat angles P-C4'-P energy: -18.795 tors. eta vs tors. theta energy: -30.016 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -316.168033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.168033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.168033 (E_RNA) where: Base-Base interactions energy: -204.525 where: short stacking energy: -110.279 Base-Backbone interact. energy: -0.813 local terms energy: -110.829851 where: bonds (distance) C4'-P energy: -24.199 bonds (distance) P-C4' energy: -21.862 flat angles C4'-P-C4' energy: -28.002 flat angles P-C4'-P energy: -15.472 tors. eta vs tors. theta energy: -21.294 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -298.001946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.001946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.001946 (E_RNA) where: Base-Base interactions energy: -188.601 where: short stacking energy: -108.212 Base-Backbone interact. energy: 1.155 local terms energy: -110.555968 where: bonds (distance) C4'-P energy: -19.541 bonds (distance) P-C4' energy: -24.740 flat angles C4'-P-C4' energy: -28.624 flat angles P-C4'-P energy: -17.202 tors. eta vs tors. theta energy: -20.449 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -290.523196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.523196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.539063 (E_RNA) where: Base-Base interactions energy: -186.814 where: short stacking energy: -93.951 Base-Backbone interact. energy: -1.557 local terms energy: -102.167749 where: bonds (distance) C4'-P energy: -19.382 bonds (distance) P-C4' energy: -21.944 flat angles C4'-P-C4' energy: -22.983 flat angles P-C4'-P energy: -19.068 tors. eta vs tors. theta energy: -18.790 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -245.825743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.825743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.884754 (E_RNA) where: Base-Base interactions energy: -140.654 where: short stacking energy: -88.001 Base-Backbone interact. energy: -0.338 local terms energy: -104.893058 where: bonds (distance) C4'-P energy: -22.135 bonds (distance) P-C4' energy: -19.279 flat angles C4'-P-C4' energy: -28.011 flat angles P-C4'-P energy: -18.265 tors. eta vs tors. theta energy: -17.203 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -243.496335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.496335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.610313 (E_RNA) where: Base-Base interactions energy: -150.506 where: short stacking energy: -81.455 Base-Backbone interact. energy: -0.081 local terms energy: -93.023345 where: bonds (distance) C4'-P energy: -26.701 bonds (distance) P-C4' energy: -18.103 flat angles C4'-P-C4' energy: -21.216 flat angles P-C4'-P energy: -11.115 tors. eta vs tors. theta energy: -15.890 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -222.363463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.363463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.548580 (E_RNA) where: Base-Base interactions energy: -128.965 where: short stacking energy: -78.401 Base-Backbone interact. energy: -0.757 local terms energy: -92.826461 where: bonds (distance) C4'-P energy: -24.368 bonds (distance) P-C4' energy: -26.549 flat angles C4'-P-C4' energy: -18.401 flat angles P-C4'-P energy: -12.810 tors. eta vs tors. theta energy: -10.698 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -265.761080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.761080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.775514 (E_RNA) where: Base-Base interactions energy: -168.724 where: short stacking energy: -88.808 Base-Backbone interact. energy: -0.107 local terms energy: -96.944776 where: bonds (distance) C4'-P energy: -17.652 bonds (distance) P-C4' energy: -21.113 flat angles C4'-P-C4' energy: -21.808 flat angles P-C4'-P energy: -13.384 tors. eta vs tors. theta energy: -22.988 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -202.707622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.707622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.789947 (E_RNA) where: Base-Base interactions energy: -119.551 where: short stacking energy: -63.959 Base-Backbone interact. energy: 1.374 local terms energy: -84.613096 where: bonds (distance) C4'-P energy: -18.920 bonds (distance) P-C4' energy: -20.479 flat angles C4'-P-C4' energy: -19.527 flat angles P-C4'-P energy: -18.501 tors. eta vs tors. theta energy: -7.186 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -187.027573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.027573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.037335 (E_RNA) where: Base-Base interactions energy: -110.254 where: short stacking energy: -57.376 Base-Backbone interact. energy: -0.648 local terms energy: -76.135770 where: bonds (distance) C4'-P energy: -20.312 bonds (distance) P-C4' energy: -20.749 flat angles C4'-P-C4' energy: -19.616 flat angles P-C4'-P energy: -10.569 tors. eta vs tors. theta energy: -4.890 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -354.364395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.364395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.364395 (E_RNA) where: Base-Base interactions energy: -232.569 where: short stacking energy: -118.308 Base-Backbone interact. energy: -0.210 local terms energy: -121.585313 where: bonds (distance) C4'-P energy: -22.482 bonds (distance) P-C4' energy: -22.482 flat angles C4'-P-C4' energy: -26.623 flat angles P-C4'-P energy: -19.377 tors. eta vs tors. theta energy: -30.622 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -328.721631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.721631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.784210 (E_RNA) where: Base-Base interactions energy: -205.055 where: short stacking energy: -111.119 Base-Backbone interact. energy: -0.126 local terms energy: -123.602620 where: bonds (distance) C4'-P energy: -23.727 bonds (distance) P-C4' energy: -27.806 flat angles C4'-P-C4' energy: -26.420 flat angles P-C4'-P energy: -17.234 tors. eta vs tors. theta energy: -28.416 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -318.848851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.848851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.869482 (E_RNA) where: Base-Base interactions energy: -207.677 where: short stacking energy: -99.860 Base-Backbone interact. energy: -0.515 local terms energy: -110.677227 where: bonds (distance) C4'-P energy: -20.879 bonds (distance) P-C4' energy: -24.272 flat angles C4'-P-C4' energy: -23.848 flat angles P-C4'-P energy: -14.818 tors. eta vs tors. theta energy: -26.860 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -286.432988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.432988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.492122 (E_RNA) where: Base-Base interactions energy: -187.524 where: short stacking energy: -85.253 Base-Backbone interact. energy: -0.634 local terms energy: -98.334346 where: bonds (distance) C4'-P energy: -13.448 bonds (distance) P-C4' energy: -25.603 flat angles C4'-P-C4' energy: -18.752 flat angles P-C4'-P energy: -20.168 tors. eta vs tors. theta energy: -20.362 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -246.997961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.997961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.997961 (E_RNA) where: Base-Base interactions energy: -157.881 where: short stacking energy: -89.409 Base-Backbone interact. energy: -0.159 local terms energy: -88.957977 where: bonds (distance) C4'-P energy: -12.790 bonds (distance) P-C4' energy: -26.689 flat angles C4'-P-C4' energy: -17.805 flat angles P-C4'-P energy: -15.262 tors. eta vs tors. theta energy: -16.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -234.359383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.359383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.502383 (E_RNA) where: Base-Base interactions energy: -137.966 where: short stacking energy: -84.602 Base-Backbone interact. energy: 0.087 local terms energy: -96.623020 where: bonds (distance) C4'-P energy: -21.615 bonds (distance) P-C4' energy: -26.637 flat angles C4'-P-C4' energy: -18.974 flat angles P-C4'-P energy: -12.485 tors. eta vs tors. theta energy: -16.912 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -236.471416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.471416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.471416 (E_RNA) where: Base-Base interactions energy: -140.900 where: short stacking energy: -80.836 Base-Backbone interact. energy: -0.850 local terms energy: -94.721274 where: bonds (distance) C4'-P energy: -19.807 bonds (distance) P-C4' energy: -22.543 flat angles C4'-P-C4' energy: -20.016 flat angles P-C4'-P energy: -16.798 tors. eta vs tors. theta energy: -15.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -263.573721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.573721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.713708 (E_RNA) where: Base-Base interactions energy: -167.791 where: short stacking energy: -87.377 Base-Backbone interact. energy: -0.582 local terms energy: -95.341080 where: bonds (distance) C4'-P energy: -18.481 bonds (distance) P-C4' energy: -19.308 flat angles C4'-P-C4' energy: -17.806 flat angles P-C4'-P energy: -12.251 tors. eta vs tors. theta energy: -27.495 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -215.316758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.316758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.507569 (E_RNA) where: Base-Base interactions energy: -123.398 where: short stacking energy: -71.463 Base-Backbone interact. energy: -0.900 local terms energy: -91.209901 where: bonds (distance) C4'-P energy: -21.561 bonds (distance) P-C4' energy: -24.631 flat angles C4'-P-C4' energy: -15.830 flat angles P-C4'-P energy: -12.020 tors. eta vs tors. theta energy: -17.168 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -174.846297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.846297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.869086 (E_RNA) where: Base-Base interactions energy: -103.307 where: short stacking energy: -45.922 Base-Backbone interact. energy: -0.666 local terms energy: -70.896274 where: bonds (distance) C4'-P energy: -19.250 bonds (distance) P-C4' energy: -11.466 flat angles C4'-P-C4' energy: -19.889 flat angles P-C4'-P energy: -16.394 tors. eta vs tors. theta energy: -3.897 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -364.714675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.714675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.738894 (E_RNA) where: Base-Base interactions energy: -238.165 where: short stacking energy: -119.192 Base-Backbone interact. energy: 0.181 local terms energy: -126.755798 where: bonds (distance) C4'-P energy: -26.546 bonds (distance) P-C4' energy: -23.818 flat angles C4'-P-C4' energy: -26.768 flat angles P-C4'-P energy: -16.967 tors. eta vs tors. theta energy: -32.657 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -317.711869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.711869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.733483 (E_RNA) where: Base-Base interactions energy: -203.542 where: short stacking energy: -111.490 Base-Backbone interact. energy: -0.301 local terms energy: -113.890033 where: bonds (distance) C4'-P energy: -18.089 bonds (distance) P-C4' energy: -22.559 flat angles C4'-P-C4' energy: -27.904 flat angles P-C4'-P energy: -14.694 tors. eta vs tors. theta energy: -30.643 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -308.498155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.498155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.994297 (E_RNA) where: Base-Base interactions energy: -195.439 where: short stacking energy: -99.695 Base-Backbone interact. energy: -0.972 local terms energy: -112.583597 where: bonds (distance) C4'-P energy: -22.443 bonds (distance) P-C4' energy: -22.666 flat angles C4'-P-C4' energy: -20.652 flat angles P-C4'-P energy: -19.462 tors. eta vs tors. theta energy: -27.360 Dist. restrs. and SS energy: 0.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -314.835999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.835999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.836353 (E_RNA) where: Base-Base interactions energy: -192.673 where: short stacking energy: -95.026 Base-Backbone interact. energy: -1.963 local terms energy: -120.201066 where: bonds (distance) C4'-P energy: -25.921 bonds (distance) P-C4' energy: -17.651 flat angles C4'-P-C4' energy: -28.693 flat angles P-C4'-P energy: -19.442 tors. eta vs tors. theta energy: -28.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -254.959236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.959236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.959236 (E_RNA) where: Base-Base interactions energy: -149.589 where: short stacking energy: -90.432 Base-Backbone interact. energy: -0.832 local terms energy: -104.538106 where: bonds (distance) C4'-P energy: -25.206 bonds (distance) P-C4' energy: -21.597 flat angles C4'-P-C4' energy: -25.027 flat angles P-C4'-P energy: -13.372 tors. eta vs tors. theta energy: -19.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -230.620160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.620160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.719729 (E_RNA) where: Base-Base interactions energy: -131.652 where: short stacking energy: -75.499 Base-Backbone interact. energy: -0.420 local terms energy: -98.648050 where: bonds (distance) C4'-P energy: -24.982 bonds (distance) P-C4' energy: -17.850 flat angles C4'-P-C4' energy: -24.836 flat angles P-C4'-P energy: -17.155 tors. eta vs tors. theta energy: -13.826 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -297.427162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.427162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.572180 (E_RNA) where: Base-Base interactions energy: -192.067 where: short stacking energy: -88.910 Base-Backbone interact. energy: -1.543 local terms energy: -103.962369 where: bonds (distance) C4'-P energy: -20.444 bonds (distance) P-C4' energy: -22.527 flat angles C4'-P-C4' energy: -19.374 flat angles P-C4'-P energy: -18.269 tors. eta vs tors. theta energy: -23.349 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -237.161583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.161583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.221183 (E_RNA) where: Base-Base interactions energy: -151.231 where: short stacking energy: -78.262 Base-Backbone interact. energy: -0.674 local terms energy: -85.316375 where: bonds (distance) C4'-P energy: -16.814 bonds (distance) P-C4' energy: -23.374 flat angles C4'-P-C4' energy: -22.170 flat angles P-C4'-P energy: -7.295 tors. eta vs tors. theta energy: -15.663 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -194.264417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.264417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.492409 (E_RNA) where: Base-Base interactions energy: -101.718 where: short stacking energy: -59.919 Base-Backbone interact. energy: -0.137 local terms energy: -92.638008 where: bonds (distance) C4'-P energy: -25.464 bonds (distance) P-C4' energy: -18.661 flat angles C4'-P-C4' energy: -20.985 flat angles P-C4'-P energy: -16.320 tors. eta vs tors. theta energy: -11.208 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -190.890571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.890571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.139659 (E_RNA) where: Base-Base interactions energy: -112.733 where: short stacking energy: -53.910 Base-Backbone interact. energy: 1.737 local terms energy: -80.143647 where: bonds (distance) C4'-P energy: -21.520 bonds (distance) P-C4' energy: -19.401 flat angles C4'-P-C4' energy: -19.875 flat angles P-C4'-P energy: -11.030 tors. eta vs tors. theta energy: -8.318 Dist. restrs. and SS energy: 0.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -362.246308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.246308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.250422 (E_RNA) where: Base-Base interactions energy: -237.135 where: short stacking energy: -125.270 Base-Backbone interact. energy: -2.667 local terms energy: -122.448955 where: bonds (distance) C4'-P energy: -21.372 bonds (distance) P-C4' energy: -26.597 flat angles C4'-P-C4' energy: -26.342 flat angles P-C4'-P energy: -17.127 tors. eta vs tors. theta energy: -31.012 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -322.683420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.683420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.739224 (E_RNA) where: Base-Base interactions energy: -205.190 where: short stacking energy: -114.162 Base-Backbone interact. energy: -0.017 local terms energy: -117.531751 where: bonds (distance) C4'-P energy: -22.737 bonds (distance) P-C4' energy: -22.786 flat angles C4'-P-C4' energy: -24.715 flat angles P-C4'-P energy: -19.698 tors. eta vs tors. theta energy: -27.595 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -333.776862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.776862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.776862 (E_RNA) where: Base-Base interactions energy: -219.696 where: short stacking energy: -100.460 Base-Backbone interact. energy: -0.177 local terms energy: -113.904667 where: bonds (distance) C4'-P energy: -21.724 bonds (distance) P-C4' energy: -18.588 flat angles C4'-P-C4' energy: -29.444 flat angles P-C4'-P energy: -17.001 tors. eta vs tors. theta energy: -27.147 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -252.026073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.026073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.061135 (E_RNA) where: Base-Base interactions energy: -146.457 where: short stacking energy: -83.635 Base-Backbone interact. energy: -0.553 local terms energy: -105.051669 where: bonds (distance) C4'-P energy: -26.867 bonds (distance) P-C4' energy: -24.879 flat angles C4'-P-C4' energy: -26.129 flat angles P-C4'-P energy: -11.331 tors. eta vs tors. theta energy: -15.846 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -322.076543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.076543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.140643 (E_RNA) where: Base-Base interactions energy: -202.692 where: short stacking energy: -102.115 Base-Backbone interact. energy: -0.667 local terms energy: -118.781894 where: bonds (distance) C4'-P energy: -22.183 bonds (distance) P-C4' energy: -24.547 flat angles C4'-P-C4' energy: -24.999 flat angles P-C4'-P energy: -18.367 tors. eta vs tors. theta energy: -28.686 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -283.993008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.993008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.993008 (E_RNA) where: Base-Base interactions energy: -191.244 where: short stacking energy: -96.810 Base-Backbone interact. energy: -0.684 local terms energy: -92.065061 where: bonds (distance) C4'-P energy: -22.025 bonds (distance) P-C4' energy: -19.997 flat angles C4'-P-C4' energy: -15.962 flat angles P-C4'-P energy: -11.022 tors. eta vs tors. theta energy: -23.059 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -229.729008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.729008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.729008 (E_RNA) where: Base-Base interactions energy: -133.986 where: short stacking energy: -76.502 Base-Backbone interact. energy: 0.392 local terms energy: -96.135207 where: bonds (distance) C4'-P energy: -21.748 bonds (distance) P-C4' energy: -23.157 flat angles C4'-P-C4' energy: -18.802 flat angles P-C4'-P energy: -16.435 tors. eta vs tors. theta energy: -15.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -210.999195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.999195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.999584 (E_RNA) where: Base-Base interactions energy: -115.357 where: short stacking energy: -61.633 Base-Backbone interact. energy: -0.422 local terms energy: -95.220255 where: bonds (distance) C4'-P energy: -21.731 bonds (distance) P-C4' energy: -26.615 flat angles C4'-P-C4' energy: -19.961 flat angles P-C4'-P energy: -17.018 tors. eta vs tors. theta energy: -9.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -204.193848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.193848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.219621 (E_RNA) where: Base-Base interactions energy: -126.322 where: short stacking energy: -72.743 Base-Backbone interact. energy: -0.406 local terms energy: -77.491339 where: bonds (distance) C4'-P energy: -13.679 bonds (distance) P-C4' energy: -18.618 flat angles C4'-P-C4' energy: -21.084 flat angles P-C4'-P energy: -14.599 tors. eta vs tors. theta energy: -9.511 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -182.817344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.817344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.138492 (E_RNA) where: Base-Base interactions energy: -93.715 where: short stacking energy: -53.320 Base-Backbone interact. energy: -0.057 local terms energy: -89.366121 where: bonds (distance) C4'-P energy: -18.476 bonds (distance) P-C4' energy: -25.749 flat angles C4'-P-C4' energy: -21.593 flat angles P-C4'-P energy: -14.911 tors. eta vs tors. theta energy: -8.637 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -361.280802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.280802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.359704 (E_RNA) where: Base-Base interactions energy: -229.523 where: short stacking energy: -117.920 Base-Backbone interact. energy: -4.173 local terms energy: -127.663559 where: bonds (distance) C4'-P energy: -29.890 bonds (distance) P-C4' energy: -22.292 flat angles C4'-P-C4' energy: -22.852 flat angles P-C4'-P energy: -19.496 tors. eta vs tors. theta energy: -33.135 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -308.287659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.287659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.407441 (E_RNA) where: Base-Base interactions energy: -187.538 where: short stacking energy: -108.900 Base-Backbone interact. energy: -1.491 local terms energy: -119.378397 where: bonds (distance) C4'-P energy: -23.315 bonds (distance) P-C4' energy: -24.747 flat angles C4'-P-C4' energy: -26.574 flat angles P-C4'-P energy: -15.747 tors. eta vs tors. theta energy: -28.995 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -329.404048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.404048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.404048 (E_RNA) where: Base-Base interactions energy: -212.367 where: short stacking energy: -102.840 Base-Backbone interact. energy: -0.659 local terms energy: -116.377536 where: bonds (distance) C4'-P energy: -23.295 bonds (distance) P-C4' energy: -24.821 flat angles C4'-P-C4' energy: -21.700 flat angles P-C4'-P energy: -20.460 tors. eta vs tors. theta energy: -26.101 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -253.153751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.153751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.254188 (E_RNA) where: Base-Base interactions energy: -147.897 where: short stacking energy: -90.700 Base-Backbone interact. energy: -0.291 local terms energy: -105.066494 where: bonds (distance) C4'-P energy: -21.250 bonds (distance) P-C4' energy: -28.142 flat angles C4'-P-C4' energy: -21.002 flat angles P-C4'-P energy: -14.861 tors. eta vs tors. theta energy: -19.811 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -261.290326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.290326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.329186 (E_RNA) where: Base-Base interactions energy: -155.786 where: short stacking energy: -85.311 Base-Backbone interact. energy: -0.336 local terms energy: -105.206871 where: bonds (distance) C4'-P energy: -21.782 bonds (distance) P-C4' energy: -22.379 flat angles C4'-P-C4' energy: -28.373 flat angles P-C4'-P energy: -12.440 tors. eta vs tors. theta energy: -20.232 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -265.670792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.670792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.703353 (E_RNA) where: Base-Base interactions energy: -169.000 where: short stacking energy: -73.853 Base-Backbone interact. energy: -0.773 local terms energy: -95.930316 where: bonds (distance) C4'-P energy: -21.326 bonds (distance) P-C4' energy: -25.472 flat angles C4'-P-C4' energy: -22.187 flat angles P-C4'-P energy: -8.548 tors. eta vs tors. theta energy: -18.397 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -237.685239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.685239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.758260 (E_RNA) where: Base-Base interactions energy: -142.533 where: short stacking energy: -85.924 Base-Backbone interact. energy: -1.219 local terms energy: -94.006244 where: bonds (distance) C4'-P energy: -17.004 bonds (distance) P-C4' energy: -23.940 flat angles C4'-P-C4' energy: -19.865 flat angles P-C4'-P energy: -18.240 tors. eta vs tors. theta energy: -14.956 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -230.027636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.027636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.157639 (E_RNA) where: Base-Base interactions energy: -127.506 where: short stacking energy: -74.097 Base-Backbone interact. energy: -1.736 local terms energy: -100.916167 where: bonds (distance) C4'-P energy: -23.292 bonds (distance) P-C4' energy: -25.586 flat angles C4'-P-C4' energy: -21.907 flat angles P-C4'-P energy: -13.754 tors. eta vs tors. theta energy: -16.377 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -213.020295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.020295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.110266 (E_RNA) where: Base-Base interactions energy: -132.927 where: short stacking energy: -75.331 Base-Backbone interact. energy: -0.393 local terms energy: -79.789466 where: bonds (distance) C4'-P energy: -17.894 bonds (distance) P-C4' energy: -20.470 flat angles C4'-P-C4' energy: -18.984 flat angles P-C4'-P energy: -14.174 tors. eta vs tors. theta energy: -8.267 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -200.914835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.914835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.950473 (E_RNA) where: Base-Base interactions energy: -128.809 where: short stacking energy: -70.703 Base-Backbone interact. energy: -0.218 local terms energy: -71.923860 where: bonds (distance) C4'-P energy: -18.969 bonds (distance) P-C4' energy: -16.733 flat angles C4'-P-C4' energy: -16.602 flat angles P-C4'-P energy: -7.097 tors. eta vs tors. theta energy: -12.523 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -368.542642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.542642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.596033 (E_RNA) where: Base-Base interactions energy: -263.158 where: short stacking energy: -105.993 Base-Backbone interact. energy: -0.400 local terms energy: -105.037165 where: bonds (distance) C4'-P energy: -19.228 bonds (distance) P-C4' energy: -18.882 flat angles C4'-P-C4' energy: -23.254 flat angles P-C4'-P energy: -15.658 tors. eta vs tors. theta energy: -28.014 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -335.946978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.946978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.946978 (E_RNA) where: Base-Base interactions energy: -216.067 where: short stacking energy: -111.477 Base-Backbone interact. energy: -1.009 local terms energy: -118.870669 where: bonds (distance) C4'-P energy: -27.734 bonds (distance) P-C4' energy: -22.280 flat angles C4'-P-C4' energy: -25.637 flat angles P-C4'-P energy: -16.110 tors. eta vs tors. theta energy: -27.109 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -314.794196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.794196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.794196 (E_RNA) where: Base-Base interactions energy: -198.252 where: short stacking energy: -100.230 Base-Backbone interact. energy: -2.886 local terms energy: -113.656221 where: bonds (distance) C4'-P energy: -24.682 bonds (distance) P-C4' energy: -27.019 flat angles C4'-P-C4' energy: -26.374 flat angles P-C4'-P energy: -14.188 tors. eta vs tors. theta energy: -21.393 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -257.603022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.603022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.748119 (E_RNA) where: Base-Base interactions energy: -155.931 where: short stacking energy: -89.226 Base-Backbone interact. energy: -0.846 local terms energy: -100.970813 where: bonds (distance) C4'-P energy: -25.783 bonds (distance) P-C4' energy: -23.878 flat angles C4'-P-C4' energy: -24.009 flat angles P-C4'-P energy: -13.663 tors. eta vs tors. theta energy: -13.637 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -233.111183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.111183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.246369 (E_RNA) where: Base-Base interactions energy: -135.580 where: short stacking energy: -83.116 Base-Backbone interact. energy: 0.596 local terms energy: -98.261527 where: bonds (distance) C4'-P energy: -21.177 bonds (distance) P-C4' energy: -26.730 flat angles C4'-P-C4' energy: -18.410 flat angles P-C4'-P energy: -13.028 tors. eta vs tors. theta energy: -18.917 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -279.275333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.275333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.306600 (E_RNA) where: Base-Base interactions energy: -173.639 where: short stacking energy: -99.160 Base-Backbone interact. energy: -0.765 local terms energy: -104.902591 where: bonds (distance) C4'-P energy: -24.356 bonds (distance) P-C4' energy: -21.146 flat angles C4'-P-C4' energy: -23.037 flat angles P-C4'-P energy: -16.041 tors. eta vs tors. theta energy: -20.323 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -242.252058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.252058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.323706 (E_RNA) where: Base-Base interactions energy: -141.231 where: short stacking energy: -87.578 Base-Backbone interact. energy: -0.128 local terms energy: -100.964993 where: bonds (distance) C4'-P energy: -20.902 bonds (distance) P-C4' energy: -24.913 flat angles C4'-P-C4' energy: -20.559 flat angles P-C4'-P energy: -16.686 tors. eta vs tors. theta energy: -17.905 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -219.853558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.853558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.853558 (E_RNA) where: Base-Base interactions energy: -126.681 where: short stacking energy: -63.921 Base-Backbone interact. energy: -0.664 local terms energy: -92.508216 where: bonds (distance) C4'-P energy: -18.448 bonds (distance) P-C4' energy: -25.777 flat angles C4'-P-C4' energy: -19.909 flat angles P-C4'-P energy: -13.962 tors. eta vs tors. theta energy: -14.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -206.788980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.788980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.911670 (E_RNA) where: Base-Base interactions energy: -121.600 where: short stacking energy: -59.480 Base-Backbone interact. energy: -0.751 local terms energy: -84.560681 where: bonds (distance) C4'-P energy: -22.387 bonds (distance) P-C4' energy: -20.929 flat angles C4'-P-C4' energy: -16.385 flat angles P-C4'-P energy: -17.707 tors. eta vs tors. theta energy: -7.152 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -231.394867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.394867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.410071 (E_RNA) where: Base-Base interactions energy: -135.980 where: short stacking energy: -68.053 Base-Backbone interact. energy: 0.060 local terms energy: -95.490677 where: bonds (distance) C4'-P energy: -20.265 bonds (distance) P-C4' energy: -23.411 flat angles C4'-P-C4' energy: -25.321 flat angles P-C4'-P energy: -16.274 tors. eta vs tors. theta energy: -10.221 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -366.854636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.854636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.867050 (E_RNA) where: Base-Base interactions energy: -248.934 where: short stacking energy: -101.492 Base-Backbone interact. energy: -0.496 local terms energy: -117.437319 where: bonds (distance) C4'-P energy: -25.320 bonds (distance) P-C4' energy: -22.003 flat angles C4'-P-C4' energy: -25.906 flat angles P-C4'-P energy: -18.772 tors. eta vs tors. theta energy: -25.437 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -331.494559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.494559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.515440 (E_RNA) where: Base-Base interactions energy: -211.342 where: short stacking energy: -100.997 Base-Backbone interact. energy: -2.359 local terms energy: -117.815330 where: bonds (distance) C4'-P energy: -25.392 bonds (distance) P-C4' energy: -29.728 flat angles C4'-P-C4' energy: -23.305 flat angles P-C4'-P energy: -12.618 tors. eta vs tors. theta energy: -26.772 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -343.743151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.743151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.752852 (E_RNA) where: Base-Base interactions energy: -223.962 where: short stacking energy: -111.330 Base-Backbone interact. energy: -1.239 local terms energy: -118.551978 where: bonds (distance) C4'-P energy: -25.420 bonds (distance) P-C4' energy: -23.172 flat angles C4'-P-C4' energy: -26.166 flat angles P-C4'-P energy: -18.518 tors. eta vs tors. theta energy: -25.275 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -246.039403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.039403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.114528 (E_RNA) where: Base-Base interactions energy: -149.377 where: short stacking energy: -83.910 Base-Backbone interact. energy: -0.544 local terms energy: -96.193904 where: bonds (distance) C4'-P energy: -21.473 bonds (distance) P-C4' energy: -21.636 flat angles C4'-P-C4' energy: -22.990 flat angles P-C4'-P energy: -13.803 tors. eta vs tors. theta energy: -16.292 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -277.631296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.631296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.631296 (E_RNA) where: Base-Base interactions energy: -187.317 where: short stacking energy: -85.437 Base-Backbone interact. energy: -1.328 local terms energy: -88.986614 where: bonds (distance) C4'-P energy: -16.705 bonds (distance) P-C4' energy: -21.176 flat angles C4'-P-C4' energy: -20.594 flat angles P-C4'-P energy: -13.363 tors. eta vs tors. theta energy: -17.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -243.298993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.298993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.356450 (E_RNA) where: Base-Base interactions energy: -153.397 where: short stacking energy: -94.031 Base-Backbone interact. energy: -0.574 local terms energy: -89.386144 where: bonds (distance) C4'-P energy: -21.469 bonds (distance) P-C4' energy: -18.016 flat angles C4'-P-C4' energy: -20.927 flat angles P-C4'-P energy: -15.308 tors. eta vs tors. theta energy: -13.666 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -237.897689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.897689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.051492 (E_RNA) where: Base-Base interactions energy: -134.753 where: short stacking energy: -83.387 Base-Backbone interact. energy: -0.058 local terms energy: -103.240957 where: bonds (distance) C4'-P energy: -23.135 bonds (distance) P-C4' energy: -22.045 flat angles C4'-P-C4' energy: -23.487 flat angles P-C4'-P energy: -10.364 tors. eta vs tors. theta energy: -24.211 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -224.060083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.060083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.077329 (E_RNA) where: Base-Base interactions energy: -126.816 where: short stacking energy: -73.202 Base-Backbone interact. energy: 1.147 local terms energy: -98.408348 where: bonds (distance) C4'-P energy: -18.986 bonds (distance) P-C4' energy: -24.856 flat angles C4'-P-C4' energy: -24.519 flat angles P-C4'-P energy: -16.222 tors. eta vs tors. theta energy: -13.825 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -221.760037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.760037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.899945 (E_RNA) where: Base-Base interactions energy: -124.793 where: short stacking energy: -72.408 Base-Backbone interact. energy: -0.715 local terms energy: -96.391937 where: bonds (distance) C4'-P energy: -22.309 bonds (distance) P-C4' energy: -19.811 flat angles C4'-P-C4' energy: -25.875 flat angles P-C4'-P energy: -19.157 tors. eta vs tors. theta energy: -9.240 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -198.110195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.110195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.352330 (E_RNA) where: Base-Base interactions energy: -105.217 where: short stacking energy: -61.482 Base-Backbone interact. energy: -0.113 local terms energy: -93.022104 where: bonds (distance) C4'-P energy: -16.831 bonds (distance) P-C4' energy: -26.240 flat angles C4'-P-C4' energy: -24.401 flat angles P-C4'-P energy: -13.304 tors. eta vs tors. theta energy: -12.246 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -378.963931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.963931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.997199 (E_RNA) where: Base-Base interactions energy: -262.288 where: short stacking energy: -118.797 Base-Backbone interact. energy: -0.262 local terms energy: -116.447078 where: bonds (distance) C4'-P energy: -24.078 bonds (distance) P-C4' energy: -21.883 flat angles C4'-P-C4' energy: -26.517 flat angles P-C4'-P energy: -12.842 tors. eta vs tors. theta energy: -31.126 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -338.974473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.974473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.136762 (E_RNA) where: Base-Base interactions energy: -217.463 where: short stacking energy: -104.104 Base-Backbone interact. energy: -0.907 local terms energy: -120.766878 where: bonds (distance) C4'-P energy: -22.912 bonds (distance) P-C4' energy: -28.200 flat angles C4'-P-C4' energy: -26.993 flat angles P-C4'-P energy: -17.205 tors. eta vs tors. theta energy: -25.456 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -343.658914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.658914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.670975 (E_RNA) where: Base-Base interactions energy: -234.263 where: short stacking energy: -109.263 Base-Backbone interact. energy: -1.330 local terms energy: -108.078480 where: bonds (distance) C4'-P energy: -22.238 bonds (distance) P-C4' energy: -17.770 flat angles C4'-P-C4' energy: -30.590 flat angles P-C4'-P energy: -15.529 tors. eta vs tors. theta energy: -21.952 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -294.325351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.325351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.423919 (E_RNA) where: Base-Base interactions energy: -178.395 where: short stacking energy: -95.164 Base-Backbone interact. energy: -0.793 local terms energy: -115.236120 where: bonds (distance) C4'-P energy: -24.538 bonds (distance) P-C4' energy: -26.603 flat angles C4'-P-C4' energy: -23.646 flat angles P-C4'-P energy: -13.928 tors. eta vs tors. theta energy: -26.521 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -244.282616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.282616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.309374 (E_RNA) where: Base-Base interactions energy: -137.868 where: short stacking energy: -74.800 Base-Backbone interact. energy: 0.171 local terms energy: -106.612890 where: bonds (distance) C4'-P energy: -24.815 bonds (distance) P-C4' energy: -24.941 flat angles C4'-P-C4' energy: -25.314 flat angles P-C4'-P energy: -12.317 tors. eta vs tors. theta energy: -19.226 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -255.679712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.679712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.679712 (E_RNA) where: Base-Base interactions energy: -153.312 where: short stacking energy: -82.283 Base-Backbone interact. energy: -0.983 local terms energy: -101.384744 where: bonds (distance) C4'-P energy: -19.458 bonds (distance) P-C4' energy: -25.924 flat angles C4'-P-C4' energy: -21.838 flat angles P-C4'-P energy: -14.808 tors. eta vs tors. theta energy: -19.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -231.096073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.096073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.174990 (E_RNA) where: Base-Base interactions energy: -135.302 where: short stacking energy: -74.805 Base-Backbone interact. energy: -0.722 local terms energy: -95.150910 where: bonds (distance) C4'-P energy: -20.105 bonds (distance) P-C4' energy: -20.964 flat angles C4'-P-C4' energy: -25.153 flat angles P-C4'-P energy: -17.308 tors. eta vs tors. theta energy: -11.621 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -222.531266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.531266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.009047 (E_RNA) where: Base-Base interactions energy: -141.890 where: short stacking energy: -85.290 Base-Backbone interact. energy: 0.055 local terms energy: -81.173720 where: bonds (distance) C4'-P energy: -15.197 bonds (distance) P-C4' energy: -21.625 flat angles C4'-P-C4' energy: -9.804 flat angles P-C4'-P energy: -17.842 tors. eta vs tors. theta energy: -16.706 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -211.280698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.280698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.472198 (E_RNA) where: Base-Base interactions energy: -123.795 where: short stacking energy: -69.157 Base-Backbone interact. energy: -0.132 local terms energy: -87.545279 where: bonds (distance) C4'-P energy: -18.124 bonds (distance) P-C4' energy: -24.918 flat angles C4'-P-C4' energy: -20.349 flat angles P-C4'-P energy: -11.247 tors. eta vs tors. theta energy: -12.908 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -194.443248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.443248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.702786 (E_RNA) where: Base-Base interactions energy: -112.533 where: short stacking energy: -61.482 Base-Backbone interact. energy: 2.703 local terms energy: -84.873025 where: bonds (distance) C4'-P energy: -23.949 bonds (distance) P-C4' energy: -20.094 flat angles C4'-P-C4' energy: -17.435 flat angles P-C4'-P energy: -17.531 tors. eta vs tors. theta energy: -5.864 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -381.733622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.733622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.734997 (E_RNA) where: Base-Base interactions energy: -261.959 where: short stacking energy: -123.125 Base-Backbone interact. energy: -0.310 local terms energy: -119.465274 where: bonds (distance) C4'-P energy: -18.572 bonds (distance) P-C4' energy: -26.220 flat angles C4'-P-C4' energy: -26.007 flat angles P-C4'-P energy: -18.713 tors. eta vs tors. theta energy: -29.953 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -347.477287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.477287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.508653 (E_RNA) where: Base-Base interactions energy: -229.736 where: short stacking energy: -120.964 Base-Backbone interact. energy: -0.152 local terms energy: -117.621091 where: bonds (distance) C4'-P energy: -23.119 bonds (distance) P-C4' energy: -20.211 flat angles C4'-P-C4' energy: -23.975 flat angles P-C4'-P energy: -19.159 tors. eta vs tors. theta energy: -31.156 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -334.411644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.411644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.435975 (E_RNA) where: Base-Base interactions energy: -222.050 where: short stacking energy: -107.764 Base-Backbone interact. energy: -0.704 local terms energy: -111.681840 where: bonds (distance) C4'-P energy: -25.002 bonds (distance) P-C4' energy: -22.556 flat angles C4'-P-C4' energy: -22.101 flat angles P-C4'-P energy: -16.017 tors. eta vs tors. theta energy: -26.006 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -315.055770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.055770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.055770 (E_RNA) where: Base-Base interactions energy: -210.508 where: short stacking energy: -105.006 Base-Backbone interact. energy: -0.237 local terms energy: -104.311126 where: bonds (distance) C4'-P energy: -24.088 bonds (distance) P-C4' energy: -15.356 flat angles C4'-P-C4' energy: -27.748 flat angles P-C4'-P energy: -13.462 tors. eta vs tors. theta energy: -23.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -235.677971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.677971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.704387 (E_RNA) where: Base-Base interactions energy: -144.603 where: short stacking energy: -91.777 Base-Backbone interact. energy: -0.095 local terms energy: -91.006360 where: bonds (distance) C4'-P energy: -19.598 bonds (distance) P-C4' energy: -19.333 flat angles C4'-P-C4' energy: -21.429 flat angles P-C4'-P energy: -10.992 tors. eta vs tors. theta energy: -19.655 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -236.529561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.529561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.635092 (E_RNA) where: Base-Base interactions energy: -135.702 where: short stacking energy: -65.404 Base-Backbone interact. energy: -1.009 local terms energy: -99.923264 where: bonds (distance) C4'-P energy: -21.180 bonds (distance) P-C4' energy: -25.401 flat angles C4'-P-C4' energy: -23.647 flat angles P-C4'-P energy: -14.290 tors. eta vs tors. theta energy: -15.405 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -238.004218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.004218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.018046 (E_RNA) where: Base-Base interactions energy: -151.845 where: short stacking energy: -86.963 Base-Backbone interact. energy: -0.640 local terms energy: -85.532523 where: bonds (distance) C4'-P energy: -9.893 bonds (distance) P-C4' energy: -18.655 flat angles C4'-P-C4' energy: -23.444 flat angles P-C4'-P energy: -14.724 tors. eta vs tors. theta energy: -18.816 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -221.027393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.027393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.041264 (E_RNA) where: Base-Base interactions energy: -140.538 where: short stacking energy: -73.551 Base-Backbone interact. energy: -0.203 local terms energy: -80.299571 where: bonds (distance) C4'-P energy: -12.359 bonds (distance) P-C4' energy: -20.579 flat angles C4'-P-C4' energy: -22.316 flat angles P-C4'-P energy: -14.340 tors. eta vs tors. theta energy: -10.705 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -187.621890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.621890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.621890 (E_RNA) where: Base-Base interactions energy: -112.160 where: short stacking energy: -52.665 Base-Backbone interact. energy: -0.256 local terms energy: -75.205932 where: bonds (distance) C4'-P energy: -21.740 bonds (distance) P-C4' energy: -26.294 flat angles C4'-P-C4' energy: -16.202 flat angles P-C4'-P energy: -8.390 tors. eta vs tors. theta energy: -2.580 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -215.967425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.967425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.005098 (E_RNA) where: Base-Base interactions energy: -127.873 where: short stacking energy: -66.189 Base-Backbone interact. energy: -0.249 local terms energy: -87.883451 where: bonds (distance) C4'-P energy: -23.789 bonds (distance) P-C4' energy: -21.894 flat angles C4'-P-C4' energy: -11.874 flat angles P-C4'-P energy: -14.121 tors. eta vs tors. theta energy: -16.204 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -378.187801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.187801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.324715 (E_RNA) where: Base-Base interactions energy: -254.292 where: short stacking energy: -117.234 Base-Backbone interact. energy: -1.395 local terms energy: -122.637315 where: bonds (distance) C4'-P energy: -22.071 bonds (distance) P-C4' energy: -24.688 flat angles C4'-P-C4' energy: -23.777 flat angles P-C4'-P energy: -17.593 tors. eta vs tors. theta energy: -34.508 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -345.376293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.376293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.376293 (E_RNA) where: Base-Base interactions energy: -220.213 where: short stacking energy: -100.774 Base-Backbone interact. energy: -0.087 local terms energy: -125.077212 where: bonds (distance) C4'-P energy: -25.999 bonds (distance) P-C4' energy: -28.517 flat angles C4'-P-C4' energy: -22.379 flat angles P-C4'-P energy: -21.236 tors. eta vs tors. theta energy: -26.946 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -346.112162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.112162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.116000 (E_RNA) where: Base-Base interactions energy: -226.710 where: short stacking energy: -116.521 Base-Backbone interact. energy: -0.219 local terms energy: -119.186853 where: bonds (distance) C4'-P energy: -22.004 bonds (distance) P-C4' energy: -24.587 flat angles C4'-P-C4' energy: -21.896 flat angles P-C4'-P energy: -19.022 tors. eta vs tors. theta energy: -31.677 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -316.164187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.164187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.197450 (E_RNA) where: Base-Base interactions energy: -205.996 where: short stacking energy: -107.540 Base-Backbone interact. energy: -0.194 local terms energy: -110.008024 where: bonds (distance) C4'-P energy: -18.498 bonds (distance) P-C4' energy: -23.296 flat angles C4'-P-C4' energy: -23.772 flat angles P-C4'-P energy: -16.341 tors. eta vs tors. theta energy: -28.101 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -250.511051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.511051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.527139 (E_RNA) where: Base-Base interactions energy: -149.454 where: short stacking energy: -84.091 Base-Backbone interact. energy: 0.620 local terms energy: -101.693397 where: bonds (distance) C4'-P energy: -22.136 bonds (distance) P-C4' energy: -21.753 flat angles C4'-P-C4' energy: -22.343 flat angles P-C4'-P energy: -11.175 tors. eta vs tors. theta energy: -24.286 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -247.168394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.168394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.201391 (E_RNA) where: Base-Base interactions energy: -151.081 where: short stacking energy: -83.578 Base-Backbone interact. energy: 0.208 local terms energy: -96.328802 where: bonds (distance) C4'-P energy: -22.852 bonds (distance) P-C4' energy: -19.595 flat angles C4'-P-C4' energy: -20.496 flat angles P-C4'-P energy: -14.953 tors. eta vs tors. theta energy: -18.432 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -236.396904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.396904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.543859 (E_RNA) where: Base-Base interactions energy: -137.209 where: short stacking energy: -71.877 Base-Backbone interact. energy: -1.931 local terms energy: -97.404271 where: bonds (distance) C4'-P energy: -24.148 bonds (distance) P-C4' energy: -21.040 flat angles C4'-P-C4' energy: -22.932 flat angles P-C4'-P energy: -15.934 tors. eta vs tors. theta energy: -13.351 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -219.661995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.661995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.699109 (E_RNA) where: Base-Base interactions energy: -129.763 where: short stacking energy: -77.155 Base-Backbone interact. energy: -0.780 local terms energy: -89.156880 where: bonds (distance) C4'-P energy: -19.869 bonds (distance) P-C4' energy: -20.486 flat angles C4'-P-C4' energy: -24.223 flat angles P-C4'-P energy: -12.638 tors. eta vs tors. theta energy: -11.941 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -206.666570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.666570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.725711 (E_RNA) where: Base-Base interactions energy: -127.473 where: short stacking energy: -75.006 Base-Backbone interact. energy: 0.388 local terms energy: -79.640352 where: bonds (distance) C4'-P energy: -14.449 bonds (distance) P-C4' energy: -22.289 flat angles C4'-P-C4' energy: -19.309 flat angles P-C4'-P energy: -15.669 tors. eta vs tors. theta energy: -7.925 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -196.998233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.998233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.532719 (E_RNA) where: Base-Base interactions energy: -109.421 where: short stacking energy: -70.132 Base-Backbone interact. energy: -1.011 local terms energy: -88.101005 where: bonds (distance) C4'-P energy: -17.277 bonds (distance) P-C4' energy: -20.852 flat angles C4'-P-C4' energy: -27.336 flat angles P-C4'-P energy: -16.230 tors. eta vs tors. theta energy: -6.406 Dist. restrs. and SS energy: 1.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -373.759328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.759328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.809771 (E_RNA) where: Base-Base interactions energy: -249.084 where: short stacking energy: -113.105 Base-Backbone interact. energy: -0.625 local terms energy: -124.100347 where: bonds (distance) C4'-P energy: -26.741 bonds (distance) P-C4' energy: -22.177 flat angles C4'-P-C4' energy: -24.903 flat angles P-C4'-P energy: -17.942 tors. eta vs tors. theta energy: -32.338 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -349.550244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.550244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.569975 (E_RNA) where: Base-Base interactions energy: -226.919 where: short stacking energy: -113.943 Base-Backbone interact. energy: -1.687 local terms energy: -120.963731 where: bonds (distance) C4'-P energy: -21.589 bonds (distance) P-C4' energy: -22.328 flat angles C4'-P-C4' energy: -28.124 flat angles P-C4'-P energy: -18.965 tors. eta vs tors. theta energy: -29.957 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -346.923669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.923669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.923669 (E_RNA) where: Base-Base interactions energy: -219.905 where: short stacking energy: -117.910 Base-Backbone interact. energy: -0.297 local terms energy: -126.720828 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -24.301 flat angles C4'-P-C4' energy: -26.961 flat angles P-C4'-P energy: -20.810 tors. eta vs tors. theta energy: -30.185 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -320.588542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.588542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.637475 (E_RNA) where: Base-Base interactions energy: -208.210 where: short stacking energy: -101.457 Base-Backbone interact. energy: -1.016 local terms energy: -111.411957 where: bonds (distance) C4'-P energy: -24.006 bonds (distance) P-C4' energy: -18.320 flat angles C4'-P-C4' energy: -26.400 flat angles P-C4'-P energy: -17.614 tors. eta vs tors. theta energy: -25.072 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -244.824791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.824791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.859290 (E_RNA) where: Base-Base interactions energy: -148.051 where: short stacking energy: -79.892 Base-Backbone interact. energy: -0.139 local terms energy: -96.668862 where: bonds (distance) C4'-P energy: -22.200 bonds (distance) P-C4' energy: -22.073 flat angles C4'-P-C4' energy: -24.521 flat angles P-C4'-P energy: -9.318 tors. eta vs tors. theta energy: -18.557 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -236.339142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.339142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.511834 (E_RNA) where: Base-Base interactions energy: -151.497 where: short stacking energy: -88.930 Base-Backbone interact. energy: -0.719 local terms energy: -84.296155 where: bonds (distance) C4'-P energy: -14.936 bonds (distance) P-C4' energy: -20.976 flat angles C4'-P-C4' energy: -23.015 flat angles P-C4'-P energy: -7.766 tors. eta vs tors. theta energy: -17.604 Dist. restrs. and SS energy: 0.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -236.202422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.202422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.202422 (E_RNA) where: Base-Base interactions energy: -139.560 where: short stacking energy: -81.487 Base-Backbone interact. energy: -0.663 local terms energy: -95.979198 where: bonds (distance) C4'-P energy: -20.878 bonds (distance) P-C4' energy: -19.337 flat angles C4'-P-C4' energy: -23.693 flat angles P-C4'-P energy: -17.859 tors. eta vs tors. theta energy: -14.212 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -206.677254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.677254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.701771 (E_RNA) where: Base-Base interactions energy: -120.367 where: short stacking energy: -67.532 Base-Backbone interact. energy: -1.045 local terms energy: -85.289867 where: bonds (distance) C4'-P energy: -24.479 bonds (distance) P-C4' energy: -14.754 flat angles C4'-P-C4' energy: -21.967 flat angles P-C4'-P energy: -10.376 tors. eta vs tors. theta energy: -13.715 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -207.310555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.310555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.335500 (E_RNA) where: Base-Base interactions energy: -123.910 where: short stacking energy: -64.979 Base-Backbone interact. energy: -0.467 local terms energy: -82.957840 where: bonds (distance) C4'-P energy: -13.491 bonds (distance) P-C4' energy: -18.836 flat angles C4'-P-C4' energy: -24.463 flat angles P-C4'-P energy: -13.724 tors. eta vs tors. theta energy: -12.444 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -199.493552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.493552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.604926 (E_RNA) where: Base-Base interactions energy: -113.401 where: short stacking energy: -65.402 Base-Backbone interact. energy: -0.844 local terms energy: -85.359711 where: bonds (distance) C4'-P energy: -20.887 bonds (distance) P-C4' energy: -18.476 flat angles C4'-P-C4' energy: -23.684 flat angles P-C4'-P energy: -7.208 tors. eta vs tors. theta energy: -15.105 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -375.768368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.768368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.784601 (E_RNA) where: Base-Base interactions energy: -259.567 where: short stacking energy: -118.944 Base-Backbone interact. energy: -0.822 local terms energy: -115.395115 where: bonds (distance) C4'-P energy: -20.907 bonds (distance) P-C4' energy: -21.787 flat angles C4'-P-C4' energy: -24.180 flat angles P-C4'-P energy: -16.591 tors. eta vs tors. theta energy: -31.931 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -354.241783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.241783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.425174 (E_RNA) where: Base-Base interactions energy: -224.016 where: short stacking energy: -116.679 Base-Backbone interact. energy: -0.469 local terms energy: -129.939696 where: bonds (distance) C4'-P energy: -22.949 bonds (distance) P-C4' energy: -26.622 flat angles C4'-P-C4' energy: -30.344 flat angles P-C4'-P energy: -20.509 tors. eta vs tors. theta energy: -29.516 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -339.974659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.974659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.004055 (E_RNA) where: Base-Base interactions energy: -219.241 where: short stacking energy: -119.314 Base-Backbone interact. energy: -0.158 local terms energy: -120.605658 where: bonds (distance) C4'-P energy: -27.630 bonds (distance) P-C4' energy: -27.379 flat angles C4'-P-C4' energy: -24.583 flat angles P-C4'-P energy: -14.543 tors. eta vs tors. theta energy: -26.471 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -335.323635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.323635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.352097 (E_RNA) where: Base-Base interactions energy: -218.901 where: short stacking energy: -114.535 Base-Backbone interact. energy: -0.610 local terms energy: -115.841259 where: bonds (distance) C4'-P energy: -22.831 bonds (distance) P-C4' energy: -23.834 flat angles C4'-P-C4' energy: -28.558 flat angles P-C4'-P energy: -15.715 tors. eta vs tors. theta energy: -24.902 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -262.535528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.535528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.661383 (E_RNA) where: Base-Base interactions energy: -158.972 where: short stacking energy: -86.836 Base-Backbone interact. energy: -0.554 local terms energy: -103.135025 where: bonds (distance) C4'-P energy: -18.254 bonds (distance) P-C4' energy: -22.890 flat angles C4'-P-C4' energy: -23.002 flat angles P-C4'-P energy: -16.257 tors. eta vs tors. theta energy: -22.732 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -238.204172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.204172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.331561 (E_RNA) where: Base-Base interactions energy: -146.805 where: short stacking energy: -81.095 Base-Backbone interact. energy: -0.240 local terms energy: -91.286668 where: bonds (distance) C4'-P energy: -17.616 bonds (distance) P-C4' energy: -16.836 flat angles C4'-P-C4' energy: -26.624 flat angles P-C4'-P energy: -7.866 tors. eta vs tors. theta energy: -22.345 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -229.690636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.690636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.744990 (E_RNA) where: Base-Base interactions energy: -136.302 where: short stacking energy: -76.416 Base-Backbone interact. energy: -0.228 local terms energy: -93.215223 where: bonds (distance) C4'-P energy: -18.094 bonds (distance) P-C4' energy: -24.707 flat angles C4'-P-C4' energy: -20.732 flat angles P-C4'-P energy: -13.527 tors. eta vs tors. theta energy: -16.155 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -222.755190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.755190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.105146 (E_RNA) where: Base-Base interactions energy: -134.010 where: short stacking energy: -85.311 Base-Backbone interact. energy: -0.119 local terms energy: -88.975557 where: bonds (distance) C4'-P energy: -16.776 bonds (distance) P-C4' energy: -23.058 flat angles C4'-P-C4' energy: -19.200 flat angles P-C4'-P energy: -11.495 tors. eta vs tors. theta energy: -18.447 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -207.459440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.459440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.197223 (E_RNA) where: Base-Base interactions energy: -131.238 where: short stacking energy: -71.125 Base-Backbone interact. energy: -0.265 local terms energy: -76.694473 where: bonds (distance) C4'-P energy: -9.410 bonds (distance) P-C4' energy: -20.017 flat angles C4'-P-C4' energy: -22.147 flat angles P-C4'-P energy: -10.414 tors. eta vs tors. theta energy: -14.706 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -194.676910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.676910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.711589 (E_RNA) where: Base-Base interactions energy: -110.353 where: short stacking energy: -58.726 Base-Backbone interact. energy: -0.584 local terms energy: -83.774811 where: bonds (distance) C4'-P energy: -22.749 bonds (distance) P-C4' energy: -22.078 flat angles C4'-P-C4' energy: -17.894 flat angles P-C4'-P energy: -14.952 tors. eta vs tors. theta energy: -6.102 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -373.615514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.615514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.661658 (E_RNA) where: Base-Base interactions energy: -247.552 where: short stacking energy: -106.768 Base-Backbone interact. energy: -0.305 local terms energy: -125.804689 where: bonds (distance) C4'-P energy: -22.058 bonds (distance) P-C4' energy: -25.775 flat angles C4'-P-C4' energy: -26.383 flat angles P-C4'-P energy: -20.169 tors. eta vs tors. theta energy: -31.419 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -345.810494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.810494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.817798 (E_RNA) where: Base-Base interactions energy: -226.303 where: short stacking energy: -117.878 Base-Backbone interact. energy: -1.091 local terms energy: -118.423799 where: bonds (distance) C4'-P energy: -24.243 bonds (distance) P-C4' energy: -26.199 flat angles C4'-P-C4' energy: -27.492 flat angles P-C4'-P energy: -14.504 tors. eta vs tors. theta energy: -25.986 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -342.399232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.399232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.424681 (E_RNA) where: Base-Base interactions energy: -221.681 where: short stacking energy: -118.996 Base-Backbone interact. energy: -0.735 local terms energy: -120.008222 where: bonds (distance) C4'-P energy: -20.961 bonds (distance) P-C4' energy: -25.295 flat angles C4'-P-C4' energy: -25.965 flat angles P-C4'-P energy: -15.506 tors. eta vs tors. theta energy: -32.283 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -330.172899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.172899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.262636 (E_RNA) where: Base-Base interactions energy: -208.512 where: short stacking energy: -107.650 Base-Backbone interact. energy: -0.161 local terms energy: -121.590052 where: bonds (distance) C4'-P energy: -23.488 bonds (distance) P-C4' energy: -24.323 flat angles C4'-P-C4' energy: -27.335 flat angles P-C4'-P energy: -14.108 tors. eta vs tors. theta energy: -32.336 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -248.422238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.422238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.493702 (E_RNA) where: Base-Base interactions energy: -147.381 where: short stacking energy: -86.127 Base-Backbone interact. energy: -0.253 local terms energy: -100.859597 where: bonds (distance) C4'-P energy: -18.903 bonds (distance) P-C4' energy: -23.890 flat angles C4'-P-C4' energy: -16.965 flat angles P-C4'-P energy: -17.416 tors. eta vs tors. theta energy: -23.687 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -238.631052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.631052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.633282 (E_RNA) where: Base-Base interactions energy: -138.135 where: short stacking energy: -85.324 Base-Backbone interact. energy: 0.335 local terms energy: -100.833161 where: bonds (distance) C4'-P energy: -24.936 bonds (distance) P-C4' energy: -23.642 flat angles C4'-P-C4' energy: -20.219 flat angles P-C4'-P energy: -11.300 tors. eta vs tors. theta energy: -20.737 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -234.534076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.534076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.905166 (E_RNA) where: Base-Base interactions energy: -136.248 where: short stacking energy: -86.364 Base-Backbone interact. energy: -0.615 local terms energy: -98.043040 where: bonds (distance) C4'-P energy: -18.190 bonds (distance) P-C4' energy: -23.622 flat angles C4'-P-C4' energy: -23.859 flat angles P-C4'-P energy: -16.095 tors. eta vs tors. theta energy: -16.276 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -226.783391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.783391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.783391 (E_RNA) where: Base-Base interactions energy: -131.024 where: short stacking energy: -68.970 Base-Backbone interact. energy: -0.243 local terms energy: -95.515936 where: bonds (distance) C4'-P energy: -22.489 bonds (distance) P-C4' energy: -23.813 flat angles C4'-P-C4' energy: -22.568 flat angles P-C4'-P energy: -11.509 tors. eta vs tors. theta energy: -15.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -214.790443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.790443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.832889 (E_RNA) where: Base-Base interactions energy: -126.520 where: short stacking energy: -62.127 Base-Backbone interact. energy: 1.947 local terms energy: -90.259913 where: bonds (distance) C4'-P energy: -24.191 bonds (distance) P-C4' energy: -24.190 flat angles C4'-P-C4' energy: -20.841 flat angles P-C4'-P energy: -12.635 tors. eta vs tors. theta energy: -8.403 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -207.525605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.525605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.525605 (E_RNA) where: Base-Base interactions energy: -123.969 where: short stacking energy: -56.231 Base-Backbone interact. energy: -0.984 local terms energy: -82.572583 where: bonds (distance) C4'-P energy: -17.690 bonds (distance) P-C4' energy: -23.626 flat angles C4'-P-C4' energy: -17.296 flat angles P-C4'-P energy: -20.721 tors. eta vs tors. theta energy: -3.240 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -382.487624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.487624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.603085 (E_RNA) where: Base-Base interactions energy: -260.200 where: short stacking energy: -117.755 Base-Backbone interact. energy: -0.454 local terms energy: -121.949325 where: bonds (distance) C4'-P energy: -22.612 bonds (distance) P-C4' energy: -22.694 flat angles C4'-P-C4' energy: -28.562 flat angles P-C4'-P energy: -16.213 tors. eta vs tors. theta energy: -31.869 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -339.948764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.948764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.951812 (E_RNA) where: Base-Base interactions energy: -222.951 where: short stacking energy: -112.155 Base-Backbone interact. energy: -0.420 local terms energy: -116.580999 where: bonds (distance) C4'-P energy: -21.829 bonds (distance) P-C4' energy: -24.345 flat angles C4'-P-C4' energy: -24.982 flat angles P-C4'-P energy: -16.520 tors. eta vs tors. theta energy: -28.906 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -342.992706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.992706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.001179 (E_RNA) where: Base-Base interactions energy: -229.655 where: short stacking energy: -113.488 Base-Backbone interact. energy: -1.296 local terms energy: -112.050547 where: bonds (distance) C4'-P energy: -15.596 bonds (distance) P-C4' energy: -22.517 flat angles C4'-P-C4' energy: -24.584 flat angles P-C4'-P energy: -20.395 tors. eta vs tors. theta energy: -28.958 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -270.494895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.494895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.506132 (E_RNA) where: Base-Base interactions energy: -163.452 where: short stacking energy: -95.772 Base-Backbone interact. energy: -1.161 local terms energy: -105.893501 where: bonds (distance) C4'-P energy: -20.224 bonds (distance) P-C4' energy: -23.162 flat angles C4'-P-C4' energy: -25.402 flat angles P-C4'-P energy: -13.223 tors. eta vs tors. theta energy: -23.883 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -308.413388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.413388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.536565 (E_RNA) where: Base-Base interactions energy: -205.269 where: short stacking energy: -98.483 Base-Backbone interact. energy: -0.020 local terms energy: -103.248054 where: bonds (distance) C4'-P energy: -24.541 bonds (distance) P-C4' energy: -19.469 flat angles C4'-P-C4' energy: -21.830 flat angles P-C4'-P energy: -14.254 tors. eta vs tors. theta energy: -23.154 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -232.970100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.970100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.144333 (E_RNA) where: Base-Base interactions energy: -130.870 where: short stacking energy: -81.940 Base-Backbone interact. energy: -0.173 local terms energy: -102.101205 where: bonds (distance) C4'-P energy: -23.242 bonds (distance) P-C4' energy: -24.294 flat angles C4'-P-C4' energy: -17.806 flat angles P-C4'-P energy: -16.564 tors. eta vs tors. theta energy: -20.195 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -223.297946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.297946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.297946 (E_RNA) where: Base-Base interactions energy: -147.818 where: short stacking energy: -89.075 Base-Backbone interact. energy: -0.211 local terms energy: -75.269441 where: bonds (distance) C4'-P energy: -6.503 bonds (distance) P-C4' energy: -18.496 flat angles C4'-P-C4' energy: -21.279 flat angles P-C4'-P energy: -14.064 tors. eta vs tors. theta energy: -14.927 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -230.574204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.574204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.709465 (E_RNA) where: Base-Base interactions energy: -146.305 where: short stacking energy: -61.566 Base-Backbone interact. energy: -0.994 local terms energy: -83.410386 where: bonds (distance) C4'-P energy: -18.206 bonds (distance) P-C4' energy: -18.781 flat angles C4'-P-C4' energy: -18.390 flat angles P-C4'-P energy: -11.453 tors. eta vs tors. theta energy: -16.579 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -216.067912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.067912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.157861 (E_RNA) where: Base-Base interactions energy: -123.846 where: short stacking energy: -70.253 Base-Backbone interact. energy: -0.776 local terms energy: -91.535853 where: bonds (distance) C4'-P energy: -17.023 bonds (distance) P-C4' energy: -25.923 flat angles C4'-P-C4' energy: -20.290 flat angles P-C4'-P energy: -12.697 tors. eta vs tors. theta energy: -15.601 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -192.569072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.569072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.763542 (E_RNA) where: Base-Base interactions energy: -115.507 where: short stacking energy: -57.030 Base-Backbone interact. energy: -0.261 local terms energy: -76.995315 where: bonds (distance) C4'-P energy: -17.277 bonds (distance) P-C4' energy: -20.669 flat angles C4'-P-C4' energy: -23.777 flat angles P-C4'-P energy: -11.073 tors. eta vs tors. theta energy: -4.200 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -365.991918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.991918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.008319 (E_RNA) where: Base-Base interactions energy: -252.237 where: short stacking energy: -106.049 Base-Backbone interact. energy: -0.376 local terms energy: -113.396156 where: bonds (distance) C4'-P energy: -23.896 bonds (distance) P-C4' energy: -25.152 flat angles C4'-P-C4' energy: -21.860 flat angles P-C4'-P energy: -12.000 tors. eta vs tors. theta energy: -30.487 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -346.707127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.707127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.707127 (E_RNA) where: Base-Base interactions energy: -222.664 where: short stacking energy: -120.037 Base-Backbone interact. energy: -0.004 local terms energy: -124.039284 where: bonds (distance) C4'-P energy: -26.909 bonds (distance) P-C4' energy: -23.814 flat angles C4'-P-C4' energy: -27.719 flat angles P-C4'-P energy: -12.513 tors. eta vs tors. theta energy: -33.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -338.858592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.858592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.904093 (E_RNA) where: Base-Base interactions energy: -223.800 where: short stacking energy: -100.469 Base-Backbone interact. energy: -1.489 local terms energy: -113.614592 where: bonds (distance) C4'-P energy: -21.359 bonds (distance) P-C4' energy: -21.242 flat angles C4'-P-C4' energy: -23.973 flat angles P-C4'-P energy: -20.192 tors. eta vs tors. theta energy: -26.849 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -265.383823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.383823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.404554 (E_RNA) where: Base-Base interactions energy: -151.166 where: short stacking energy: -95.847 Base-Backbone interact. energy: -0.240 local terms energy: -113.997953 where: bonds (distance) C4'-P energy: -23.958 bonds (distance) P-C4' energy: -22.084 flat angles C4'-P-C4' energy: -25.943 flat angles P-C4'-P energy: -19.541 tors. eta vs tors. theta energy: -22.472 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -314.058018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.058018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.064429 (E_RNA) where: Base-Base interactions energy: -214.530 where: short stacking energy: -92.226 Base-Backbone interact. energy: -0.269 local terms energy: -99.264633 where: bonds (distance) C4'-P energy: -12.242 bonds (distance) P-C4' energy: -23.245 flat angles C4'-P-C4' energy: -19.933 flat angles P-C4'-P energy: -14.870 tors. eta vs tors. theta energy: -28.975 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -231.556460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.556460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.642444 (E_RNA) where: Base-Base interactions energy: -134.932 where: short stacking energy: -71.845 Base-Backbone interact. energy: -0.605 local terms energy: -96.105659 where: bonds (distance) C4'-P energy: -24.707 bonds (distance) P-C4' energy: -26.730 flat angles C4'-P-C4' energy: -22.657 flat angles P-C4'-P energy: -16.492 tors. eta vs tors. theta energy: -5.520 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -269.031854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.031854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.042389 (E_RNA) where: Base-Base interactions energy: -166.098 where: short stacking energy: -79.331 Base-Backbone interact. energy: 0.514 local terms energy: -103.458360 where: bonds (distance) C4'-P energy: -22.052 bonds (distance) P-C4' energy: -24.426 flat angles C4'-P-C4' energy: -25.343 flat angles P-C4'-P energy: -16.376 tors. eta vs tors. theta energy: -15.261 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -224.685484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.685484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.770220 (E_RNA) where: Base-Base interactions energy: -133.911 where: short stacking energy: -77.600 Base-Backbone interact. energy: -0.383 local terms energy: -90.475766 where: bonds (distance) C4'-P energy: -12.268 bonds (distance) P-C4' energy: -25.385 flat angles C4'-P-C4' energy: -26.461 flat angles P-C4'-P energy: -16.593 tors. eta vs tors. theta energy: -9.769 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -204.115979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.115979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.115979 (E_RNA) where: Base-Base interactions energy: -119.060 where: short stacking energy: -61.616 Base-Backbone interact. energy: -0.812 local terms energy: -84.244409 where: bonds (distance) C4'-P energy: -23.165 bonds (distance) P-C4' energy: -22.787 flat angles C4'-P-C4' energy: -18.329 flat angles P-C4'-P energy: -15.124 tors. eta vs tors. theta energy: -4.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -212.836903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.836903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.865097 (E_RNA) where: Base-Base interactions energy: -124.737 where: short stacking energy: -72.157 Base-Backbone interact. energy: -0.742 local terms energy: -87.385580 where: bonds (distance) C4'-P energy: -21.503 bonds (distance) P-C4' energy: -13.428 flat angles C4'-P-C4' energy: -18.131 flat angles P-C4'-P energy: -16.452 tors. eta vs tors. theta energy: -17.871 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -368.200011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.200011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.365765 (E_RNA) where: Base-Base interactions energy: -248.843 where: short stacking energy: -117.839 Base-Backbone interact. energy: -0.615 local terms energy: -118.907705 where: bonds (distance) C4'-P energy: -24.318 bonds (distance) P-C4' energy: -19.490 flat angles C4'-P-C4' energy: -27.241 flat angles P-C4'-P energy: -19.192 tors. eta vs tors. theta energy: -28.667 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -342.136316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.136316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.256848 (E_RNA) where: Base-Base interactions energy: -218.226 where: short stacking energy: -108.151 Base-Backbone interact. energy: -1.737 local terms energy: -122.294477 where: bonds (distance) C4'-P energy: -23.684 bonds (distance) P-C4' energy: -24.871 flat angles C4'-P-C4' energy: -22.678 flat angles P-C4'-P energy: -21.657 tors. eta vs tors. theta energy: -29.405 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -335.850075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.850075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.889351 (E_RNA) where: Base-Base interactions energy: -210.475 where: short stacking energy: -110.101 Base-Backbone interact. energy: -0.684 local terms energy: -124.730208 where: bonds (distance) C4'-P energy: -24.485 bonds (distance) P-C4' energy: -22.886 flat angles C4'-P-C4' energy: -24.137 flat angles P-C4'-P energy: -17.986 tors. eta vs tors. theta energy: -35.237 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -318.875453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.875453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.892494 (E_RNA) where: Base-Base interactions energy: -199.477 where: short stacking energy: -102.597 Base-Backbone interact. energy: -0.311 local terms energy: -119.105082 where: bonds (distance) C4'-P energy: -24.382 bonds (distance) P-C4' energy: -25.186 flat angles C4'-P-C4' energy: -23.406 flat angles P-C4'-P energy: -17.424 tors. eta vs tors. theta energy: -28.706 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -253.332346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.332346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.436084 (E_RNA) where: Base-Base interactions energy: -152.750 where: short stacking energy: -89.146 Base-Backbone interact. energy: -0.653 local terms energy: -100.033087 where: bonds (distance) C4'-P energy: -22.443 bonds (distance) P-C4' energy: -27.127 flat angles C4'-P-C4' energy: -15.035 flat angles P-C4'-P energy: -14.031 tors. eta vs tors. theta energy: -21.397 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -232.504993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.504993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.504993 (E_RNA) where: Base-Base interactions energy: -137.571 where: short stacking energy: -90.735 Base-Backbone interact. energy: 0.319 local terms energy: -95.253605 where: bonds (distance) C4'-P energy: -20.161 bonds (distance) P-C4' energy: -22.588 flat angles C4'-P-C4' energy: -22.722 flat angles P-C4'-P energy: -9.909 tors. eta vs tors. theta energy: -19.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -228.433300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.433300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.487663 (E_RNA) where: Base-Base interactions energy: -133.532 where: short stacking energy: -73.827 Base-Backbone interact. energy: -1.231 local terms energy: -93.723878 where: bonds (distance) C4'-P energy: -19.827 bonds (distance) P-C4' energy: -19.047 flat angles C4'-P-C4' energy: -26.397 flat angles P-C4'-P energy: -14.125 tors. eta vs tors. theta energy: -14.327 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -208.500661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.500661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.704847 (E_RNA) where: Base-Base interactions energy: -127.425 where: short stacking energy: -60.514 Base-Backbone interact. energy: 0.672 local terms energy: -81.952494 where: bonds (distance) C4'-P energy: -14.524 bonds (distance) P-C4' energy: -24.642 flat angles C4'-P-C4' energy: -18.596 flat angles P-C4'-P energy: -11.160 tors. eta vs tors. theta energy: -13.031 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -210.825370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.825370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.982019 (E_RNA) where: Base-Base interactions energy: -113.903 where: short stacking energy: -54.942 Base-Backbone interact. energy: -0.308 local terms energy: -96.771252 where: bonds (distance) C4'-P energy: -24.127 bonds (distance) P-C4' energy: -23.348 flat angles C4'-P-C4' energy: -17.258 flat angles P-C4'-P energy: -15.358 tors. eta vs tors. theta energy: -16.679 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -195.783397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.783397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.809313 (E_RNA) where: Base-Base interactions energy: -112.003 where: short stacking energy: -55.718 Base-Backbone interact. energy: -0.215 local terms energy: -83.591105 where: bonds (distance) C4'-P energy: -20.771 bonds (distance) P-C4' energy: -22.445 flat angles C4'-P-C4' energy: -18.567 flat angles P-C4'-P energy: -13.534 tors. eta vs tors. theta energy: -8.275 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -368.643135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.643135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.704598 (E_RNA) where: Base-Base interactions energy: -250.009 where: short stacking energy: -112.059 Base-Backbone interact. energy: -0.590 local terms energy: -118.105600 where: bonds (distance) C4'-P energy: -22.655 bonds (distance) P-C4' energy: -22.781 flat angles C4'-P-C4' energy: -27.894 flat angles P-C4'-P energy: -18.512 tors. eta vs tors. theta energy: -26.264 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -350.244627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.244627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.257223 (E_RNA) where: Base-Base interactions energy: -237.633 where: short stacking energy: -117.349 Base-Backbone interact. energy: -0.020 local terms energy: -112.604275 where: bonds (distance) C4'-P energy: -21.810 bonds (distance) P-C4' energy: -24.072 flat angles C4'-P-C4' energy: -24.860 flat angles P-C4'-P energy: -15.833 tors. eta vs tors. theta energy: -26.029 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -328.191132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.191132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.214360 (E_RNA) where: Base-Base interactions energy: -218.357 where: short stacking energy: -103.583 Base-Backbone interact. energy: -0.502 local terms energy: -109.355293 where: bonds (distance) C4'-P energy: -24.852 bonds (distance) P-C4' energy: -25.014 flat angles C4'-P-C4' energy: -21.256 flat angles P-C4'-P energy: -12.368 tors. eta vs tors. theta energy: -25.865 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -305.165837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.165837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.219921 (E_RNA) where: Base-Base interactions energy: -190.313 where: short stacking energy: -91.521 Base-Backbone interact. energy: -1.767 local terms energy: -113.140426 where: bonds (distance) C4'-P energy: -28.532 bonds (distance) P-C4' energy: -23.346 flat angles C4'-P-C4' energy: -18.101 flat angles P-C4'-P energy: -13.617 tors. eta vs tors. theta energy: -29.545 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -246.734674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.734674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.737137 (E_RNA) where: Base-Base interactions energy: -149.145 where: short stacking energy: -87.892 Base-Backbone interact. energy: -1.564 local terms energy: -96.028342 where: bonds (distance) C4'-P energy: -24.505 bonds (distance) P-C4' energy: -25.877 flat angles C4'-P-C4' energy: -20.894 flat angles P-C4'-P energy: -10.538 tors. eta vs tors. theta energy: -14.215 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -245.596712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.596712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.596712 (E_RNA) where: Base-Base interactions energy: -154.343 where: short stacking energy: -78.057 Base-Backbone interact. energy: -0.276 local terms energy: -90.977989 where: bonds (distance) C4'-P energy: -18.989 bonds (distance) P-C4' energy: -21.096 flat angles C4'-P-C4' energy: -23.288 flat angles P-C4'-P energy: -14.813 tors. eta vs tors. theta energy: -12.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -222.281354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.281354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.388942 (E_RNA) where: Base-Base interactions energy: -116.445 where: short stacking energy: -65.724 Base-Backbone interact. energy: -0.188 local terms energy: -105.756769 where: bonds (distance) C4'-P energy: -24.457 bonds (distance) P-C4' energy: -24.840 flat angles C4'-P-C4' energy: -24.136 flat angles P-C4'-P energy: -19.875 tors. eta vs tors. theta energy: -12.449 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -214.966177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.966177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.966177 (E_RNA) where: Base-Base interactions energy: -125.521 where: short stacking energy: -63.882 Base-Backbone interact. energy: -1.526 local terms energy: -87.918987 where: bonds (distance) C4'-P energy: -23.010 bonds (distance) P-C4' energy: -22.561 flat angles C4'-P-C4' energy: -14.942 flat angles P-C4'-P energy: -18.919 tors. eta vs tors. theta energy: -8.486 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -204.632954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.632954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.620436 (E_RNA) where: Base-Base interactions energy: -120.362 where: short stacking energy: -59.463 Base-Backbone interact. energy: -0.353 local terms energy: -85.905402 where: bonds (distance) C4'-P energy: -21.922 bonds (distance) P-C4' energy: -23.393 flat angles C4'-P-C4' energy: -13.890 flat angles P-C4'-P energy: -14.182 tors. eta vs tors. theta energy: -12.518 Dist. restrs. and SS energy: 1.987 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -210.229360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.229360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.249916 (E_RNA) where: Base-Base interactions energy: -115.372 where: short stacking energy: -66.467 Base-Backbone interact. energy: -0.225 local terms energy: -94.652661 where: bonds (distance) C4'-P energy: -24.030 bonds (distance) P-C4' energy: -20.998 flat angles C4'-P-C4' energy: -19.001 flat angles P-C4'-P energy: -18.081 tors. eta vs tors. theta energy: -12.542 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -363.151666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.151666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.151666 (E_RNA) where: Base-Base interactions energy: -243.295 where: short stacking energy: -106.282 Base-Backbone interact. energy: -0.590 local terms energy: -119.266445 where: bonds (distance) C4'-P energy: -24.802 bonds (distance) P-C4' energy: -26.285 flat angles C4'-P-C4' energy: -24.038 flat angles P-C4'-P energy: -16.821 tors. eta vs tors. theta energy: -27.321 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -339.953693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.953693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.953693 (E_RNA) where: Base-Base interactions energy: -226.818 where: short stacking energy: -109.870 Base-Backbone interact. energy: 0.839 local terms energy: -113.974753 where: bonds (distance) C4'-P energy: -20.140 bonds (distance) P-C4' energy: -22.057 flat angles C4'-P-C4' energy: -27.627 flat angles P-C4'-P energy: -19.308 tors. eta vs tors. theta energy: -24.844 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -336.563128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.563128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.678094 (E_RNA) where: Base-Base interactions energy: -220.099 where: short stacking energy: -107.902 Base-Backbone interact. energy: -0.406 local terms energy: -116.172691 where: bonds (distance) C4'-P energy: -23.376 bonds (distance) P-C4' energy: -23.370 flat angles C4'-P-C4' energy: -21.809 flat angles P-C4'-P energy: -18.330 tors. eta vs tors. theta energy: -29.288 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -316.363642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.363642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.394950 (E_RNA) where: Base-Base interactions energy: -195.142 where: short stacking energy: -91.118 Base-Backbone interact. energy: 0.770 local terms energy: -122.023269 where: bonds (distance) C4'-P energy: -27.783 bonds (distance) P-C4' energy: -24.135 flat angles C4'-P-C4' energy: -27.492 flat angles P-C4'-P energy: -18.988 tors. eta vs tors. theta energy: -23.626 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -256.571472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.571472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.684026 (E_RNA) where: Base-Base interactions energy: -156.414 where: short stacking energy: -78.098 Base-Backbone interact. energy: -0.598 local terms energy: -99.672379 where: bonds (distance) C4'-P energy: -18.501 bonds (distance) P-C4' energy: -26.940 flat angles C4'-P-C4' energy: -25.442 flat angles P-C4'-P energy: -14.320 tors. eta vs tors. theta energy: -14.470 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -243.293478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.293478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.293478 (E_RNA) where: Base-Base interactions energy: -147.099 where: short stacking energy: -74.486 Base-Backbone interact. energy: -0.590 local terms energy: -95.603703 where: bonds (distance) C4'-P energy: -20.629 bonds (distance) P-C4' energy: -17.875 flat angles C4'-P-C4' energy: -28.098 flat angles P-C4'-P energy: -16.541 tors. eta vs tors. theta energy: -12.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -217.765489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.765489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.881724 (E_RNA) where: Base-Base interactions energy: -131.181 where: short stacking energy: -80.776 Base-Backbone interact. energy: 2.595 local terms energy: -89.296258 where: bonds (distance) C4'-P energy: -21.709 bonds (distance) P-C4' energy: -18.926 flat angles C4'-P-C4' energy: -24.332 flat angles P-C4'-P energy: -13.588 tors. eta vs tors. theta energy: -10.742 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -231.603598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.603598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.672868 (E_RNA) where: Base-Base interactions energy: -129.809 where: short stacking energy: -75.672 Base-Backbone interact. energy: -0.205 local terms energy: -101.659716 where: bonds (distance) C4'-P energy: -19.351 bonds (distance) P-C4' energy: -20.168 flat angles C4'-P-C4' energy: -29.861 flat angles P-C4'-P energy: -19.580 tors. eta vs tors. theta energy: -12.699 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -216.474742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.474742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.488654 (E_RNA) where: Base-Base interactions energy: -131.692 where: short stacking energy: -69.669 Base-Backbone interact. energy: -0.179 local terms energy: -84.618047 where: bonds (distance) C4'-P energy: -19.591 bonds (distance) P-C4' energy: -21.242 flat angles C4'-P-C4' energy: -19.609 flat angles P-C4'-P energy: -11.447 tors. eta vs tors. theta energy: -12.729 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -202.337403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.337403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.374970 (E_RNA) where: Base-Base interactions energy: -120.699 where: short stacking energy: -71.762 Base-Backbone interact. energy: 0.929 local terms energy: -82.605195 where: bonds (distance) C4'-P energy: -11.177 bonds (distance) P-C4' energy: -22.964 flat angles C4'-P-C4' energy: -22.893 flat angles P-C4'-P energy: -14.672 tors. eta vs tors. theta energy: -10.899 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -379.635066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.635066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.641535 (E_RNA) where: Base-Base interactions energy: -259.009 where: short stacking energy: -106.987 Base-Backbone interact. energy: -0.382 local terms energy: -120.250974 where: bonds (distance) C4'-P energy: -25.941 bonds (distance) P-C4' energy: -25.218 flat angles C4'-P-C4' energy: -24.622 flat angles P-C4'-P energy: -18.702 tors. eta vs tors. theta energy: -25.768 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -344.878343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.878343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.972452 (E_RNA) where: Base-Base interactions energy: -228.406 where: short stacking energy: -121.088 Base-Backbone interact. energy: -0.187 local terms energy: -116.378742 where: bonds (distance) C4'-P energy: -22.539 bonds (distance) P-C4' energy: -24.577 flat angles C4'-P-C4' energy: -22.313 flat angles P-C4'-P energy: -17.277 tors. eta vs tors. theta energy: -29.673 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -340.559912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.559912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.648862 (E_RNA) where: Base-Base interactions energy: -233.279 where: short stacking energy: -116.702 Base-Backbone interact. energy: -0.486 local terms energy: -106.883119 where: bonds (distance) C4'-P energy: -15.044 bonds (distance) P-C4' energy: -26.562 flat angles C4'-P-C4' energy: -22.538 flat angles P-C4'-P energy: -14.484 tors. eta vs tors. theta energy: -28.256 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -332.554614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.554614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.554614 (E_RNA) where: Base-Base interactions energy: -220.277 where: short stacking energy: -106.288 Base-Backbone interact. energy: -0.265 local terms energy: -112.013191 where: bonds (distance) C4'-P energy: -22.393 bonds (distance) P-C4' energy: -26.571 flat angles C4'-P-C4' energy: -26.574 flat angles P-C4'-P energy: -15.046 tors. eta vs tors. theta energy: -21.429 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -269.075562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.075562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.085617 (E_RNA) where: Base-Base interactions energy: -169.616 where: short stacking energy: -84.594 Base-Backbone interact. energy: -0.661 local terms energy: -98.808301 where: bonds (distance) C4'-P energy: -19.549 bonds (distance) P-C4' energy: -25.397 flat angles C4'-P-C4' energy: -25.597 flat angles P-C4'-P energy: -10.873 tors. eta vs tors. theta energy: -17.392 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -235.887050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.887050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.908624 (E_RNA) where: Base-Base interactions energy: -145.420 where: short stacking energy: -84.673 Base-Backbone interact. energy: -0.125 local terms energy: -90.363698 where: bonds (distance) C4'-P energy: -22.163 bonds (distance) P-C4' energy: -18.910 flat angles C4'-P-C4' energy: -20.957 flat angles P-C4'-P energy: -11.862 tors. eta vs tors. theta energy: -16.471 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -241.627744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.627744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.062492 (E_RNA) where: Base-Base interactions energy: -158.246 where: short stacking energy: -78.041 Base-Backbone interact. energy: -0.340 local terms energy: -83.476781 where: bonds (distance) C4'-P energy: -17.441 bonds (distance) P-C4' energy: -20.373 flat angles C4'-P-C4' energy: -24.382 flat angles P-C4'-P energy: -11.586 tors. eta vs tors. theta energy: -9.695 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -203.822593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.822593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.041800 (E_RNA) where: Base-Base interactions energy: -115.145 where: short stacking energy: -64.568 Base-Backbone interact. energy: -0.183 local terms energy: -88.713478 where: bonds (distance) C4'-P energy: -27.643 bonds (distance) P-C4' energy: -18.659 flat angles C4'-P-C4' energy: -20.696 flat angles P-C4'-P energy: -7.822 tors. eta vs tors. theta energy: -13.894 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -208.749529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.749529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.006429 (E_RNA) where: Base-Base interactions energy: -120.729 where: short stacking energy: -71.125 Base-Backbone interact. energy: -1.898 local terms energy: -86.379566 where: bonds (distance) C4'-P energy: -18.812 bonds (distance) P-C4' energy: -20.008 flat angles C4'-P-C4' energy: -23.036 flat angles P-C4'-P energy: -12.900 tors. eta vs tors. theta energy: -11.624 Dist. restrs. and SS energy: 0.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -191.590018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.590018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.635161 (E_RNA) where: Base-Base interactions energy: -119.348 where: short stacking energy: -57.561 Base-Backbone interact. energy: -0.296 local terms energy: -71.990651 where: bonds (distance) C4'-P energy: -22.590 bonds (distance) P-C4' energy: -12.433 flat angles C4'-P-C4' energy: -19.744 flat angles P-C4'-P energy: -10.351 tors. eta vs tors. theta energy: -6.871 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -380.132434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.132434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.171485 (E_RNA) where: Base-Base interactions energy: -255.275 where: short stacking energy: -112.520 Base-Backbone interact. energy: -0.608 local terms energy: -124.288944 where: bonds (distance) C4'-P energy: -27.523 bonds (distance) P-C4' energy: -23.978 flat angles C4'-P-C4' energy: -27.554 flat angles P-C4'-P energy: -14.970 tors. eta vs tors. theta energy: -30.264 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -351.179553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.179553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.216035 (E_RNA) where: Base-Base interactions energy: -239.674 where: short stacking energy: -112.214 Base-Backbone interact. energy: -2.369 local terms energy: -109.172764 where: bonds (distance) C4'-P energy: -22.353 bonds (distance) P-C4' energy: -20.818 flat angles C4'-P-C4' energy: -22.569 flat angles P-C4'-P energy: -17.190 tors. eta vs tors. theta energy: -26.242 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -328.801420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.801420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.813535 (E_RNA) where: Base-Base interactions energy: -211.307 where: short stacking energy: -103.965 Base-Backbone interact. energy: -0.630 local terms energy: -116.877140 where: bonds (distance) C4'-P energy: -24.956 bonds (distance) P-C4' energy: -17.966 flat angles C4'-P-C4' energy: -27.264 flat angles P-C4'-P energy: -18.217 tors. eta vs tors. theta energy: -28.474 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -344.150957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.150957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.191381 (E_RNA) where: Base-Base interactions energy: -227.322 where: short stacking energy: -103.230 Base-Backbone interact. energy: -2.503 local terms energy: -114.366132 where: bonds (distance) C4'-P energy: -24.588 bonds (distance) P-C4' energy: -24.770 flat angles C4'-P-C4' energy: -26.630 flat angles P-C4'-P energy: -13.590 tors. eta vs tors. theta energy: -24.789 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -267.770769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.770769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.894115 (E_RNA) where: Base-Base interactions energy: -172.603 where: short stacking energy: -92.422 Base-Backbone interact. energy: -0.497 local terms energy: -94.794454 where: bonds (distance) C4'-P energy: -20.908 bonds (distance) P-C4' energy: -19.077 flat angles C4'-P-C4' energy: -22.251 flat angles P-C4'-P energy: -16.262 tors. eta vs tors. theta energy: -16.296 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -244.032689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.032689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.131456 (E_RNA) where: Base-Base interactions energy: -150.517 where: short stacking energy: -82.826 Base-Backbone interact. energy: -0.222 local terms energy: -93.392523 where: bonds (distance) C4'-P energy: -26.156 bonds (distance) P-C4' energy: -20.202 flat angles C4'-P-C4' energy: -20.360 flat angles P-C4'-P energy: -11.130 tors. eta vs tors. theta energy: -15.544 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -220.615920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.615920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.666345 (E_RNA) where: Base-Base interactions energy: -130.042 where: short stacking energy: -75.638 Base-Backbone interact. energy: -0.358 local terms energy: -90.266319 where: bonds (distance) C4'-P energy: -20.087 bonds (distance) P-C4' energy: -18.971 flat angles C4'-P-C4' energy: -23.801 flat angles P-C4'-P energy: -10.482 tors. eta vs tors. theta energy: -16.924 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -216.950052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.950052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.950052 (E_RNA) where: Base-Base interactions energy: -118.754 where: short stacking energy: -64.600 Base-Backbone interact. energy: -0.632 local terms energy: -97.564175 where: bonds (distance) C4'-P energy: -25.836 bonds (distance) P-C4' energy: -20.790 flat angles C4'-P-C4' energy: -24.165 flat angles P-C4'-P energy: -13.031 tors. eta vs tors. theta energy: -13.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -200.684295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.684295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.749773 (E_RNA) where: Base-Base interactions energy: -114.280 where: short stacking energy: -72.768 Base-Backbone interact. energy: -0.229 local terms energy: -86.240470 where: bonds (distance) C4'-P energy: -17.644 bonds (distance) P-C4' energy: -20.625 flat angles C4'-P-C4' energy: -18.904 flat angles P-C4'-P energy: -14.488 tors. eta vs tors. theta energy: -14.579 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -212.865857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.865857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.943872 (E_RNA) where: Base-Base interactions energy: -121.302 where: short stacking energy: -67.696 Base-Backbone interact. energy: -1.779 local terms energy: -89.862674 where: bonds (distance) C4'-P energy: -17.198 bonds (distance) P-C4' energy: -23.339 flat angles C4'-P-C4' energy: -20.576 flat angles P-C4'-P energy: -13.778 tors. eta vs tors. theta energy: -14.971 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -374.804096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.804096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.805408 (E_RNA) where: Base-Base interactions energy: -260.324 where: short stacking energy: -115.518 Base-Backbone interact. energy: -1.956 local terms energy: -112.525138 where: bonds (distance) C4'-P energy: -24.261 bonds (distance) P-C4' energy: -19.664 flat angles C4'-P-C4' energy: -23.542 flat angles P-C4'-P energy: -13.313 tors. eta vs tors. theta energy: -31.745 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -325.797898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.797898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.861437 (E_RNA) where: Base-Base interactions energy: -217.865 where: short stacking energy: -108.586 Base-Backbone interact. energy: -0.725 local terms energy: -107.271009 where: bonds (distance) C4'-P energy: -24.120 bonds (distance) P-C4' energy: -18.898 flat angles C4'-P-C4' energy: -24.050 flat angles P-C4'-P energy: -15.039 tors. eta vs tors. theta energy: -25.164 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -328.470430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.470430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.478579 (E_RNA) where: Base-Base interactions energy: -219.462 where: short stacking energy: -112.611 Base-Backbone interact. energy: -0.313 local terms energy: -108.703638 where: bonds (distance) C4'-P energy: -20.746 bonds (distance) P-C4' energy: -25.799 flat angles C4'-P-C4' energy: -20.849 flat angles P-C4'-P energy: -17.657 tors. eta vs tors. theta energy: -23.653 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -336.451088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.451088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.451088 (E_RNA) where: Base-Base interactions energy: -220.013 where: short stacking energy: -111.212 Base-Backbone interact. energy: -0.712 local terms energy: -115.726154 where: bonds (distance) C4'-P energy: -23.491 bonds (distance) P-C4' energy: -20.489 flat angles C4'-P-C4' energy: -23.568 flat angles P-C4'-P energy: -18.123 tors. eta vs tors. theta energy: -30.055 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -257.783075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.783075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.875096 (E_RNA) where: Base-Base interactions energy: -156.671 where: short stacking energy: -86.166 Base-Backbone interact. energy: -0.303 local terms energy: -100.900955 where: bonds (distance) C4'-P energy: -20.365 bonds (distance) P-C4' energy: -20.320 flat angles C4'-P-C4' energy: -23.359 flat angles P-C4'-P energy: -19.714 tors. eta vs tors. theta energy: -17.143 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -271.319422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.319422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.325807 (E_RNA) where: Base-Base interactions energy: -165.201 where: short stacking energy: -85.113 Base-Backbone interact. energy: -0.276 local terms energy: -105.849263 where: bonds (distance) C4'-P energy: -24.031 bonds (distance) P-C4' energy: -22.833 flat angles C4'-P-C4' energy: -25.442 flat angles P-C4'-P energy: -14.739 tors. eta vs tors. theta energy: -18.803 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -230.998159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.998159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.024595 (E_RNA) where: Base-Base interactions energy: -130.116 where: short stacking energy: -79.785 Base-Backbone interact. energy: -0.629 local terms energy: -100.279497 where: bonds (distance) C4'-P energy: -21.490 bonds (distance) P-C4' energy: -19.127 flat angles C4'-P-C4' energy: -22.120 flat angles P-C4'-P energy: -11.848 tors. eta vs tors. theta energy: -25.694 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -212.944663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.944663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.014068 (E_RNA) where: Base-Base interactions energy: -125.797 where: short stacking energy: -69.805 Base-Backbone interact. energy: -0.103 local terms energy: -87.114098 where: bonds (distance) C4'-P energy: -18.080 bonds (distance) P-C4' energy: -28.992 flat angles C4'-P-C4' energy: -14.459 flat angles P-C4'-P energy: -12.425 tors. eta vs tors. theta energy: -13.158 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -200.455352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.455352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.554272 (E_RNA) where: Base-Base interactions energy: -112.910 where: short stacking energy: -65.640 Base-Backbone interact. energy: -0.438 local terms energy: -87.205903 where: bonds (distance) C4'-P energy: -16.648 bonds (distance) P-C4' energy: -20.712 flat angles C4'-P-C4' energy: -22.468 flat angles P-C4'-P energy: -11.668 tors. eta vs tors. theta energy: -15.709 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -199.055300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.055300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.495502 (E_RNA) where: Base-Base interactions energy: -110.654 where: short stacking energy: -60.124 Base-Backbone interact. energy: 0.345 local terms energy: -89.186911 where: bonds (distance) C4'-P energy: -23.855 bonds (distance) P-C4' energy: -19.805 flat angles C4'-P-C4' energy: -19.655 flat angles P-C4'-P energy: -16.463 tors. eta vs tors. theta energy: -9.410 Dist. restrs. and SS energy: 0.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -374.107499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.107499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.107499 (E_RNA) where: Base-Base interactions energy: -251.065 where: short stacking energy: -124.336 Base-Backbone interact. energy: -1.466 local terms energy: -121.576110 where: bonds (distance) C4'-P energy: -21.579 bonds (distance) P-C4' energy: -21.619 flat angles C4'-P-C4' energy: -26.373 flat angles P-C4'-P energy: -18.768 tors. eta vs tors. theta energy: -33.237 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -345.628450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.628450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.659137 (E_RNA) where: Base-Base interactions energy: -231.927 where: short stacking energy: -118.327 Base-Backbone interact. energy: -1.268 local terms energy: -112.464902 where: bonds (distance) C4'-P energy: -18.304 bonds (distance) P-C4' energy: -23.437 flat angles C4'-P-C4' energy: -24.212 flat angles P-C4'-P energy: -20.252 tors. eta vs tors. theta energy: -26.259 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -328.714271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.714271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.755741 (E_RNA) where: Base-Base interactions energy: -218.872 where: short stacking energy: -105.254 Base-Backbone interact. energy: -0.671 local terms energy: -109.212157 where: bonds (distance) C4'-P energy: -20.245 bonds (distance) P-C4' energy: -23.600 flat angles C4'-P-C4' energy: -22.201 flat angles P-C4'-P energy: -18.394 tors. eta vs tors. theta energy: -24.772 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -325.635887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.635887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.974434 (E_RNA) where: Base-Base interactions energy: -219.175 where: short stacking energy: -111.504 Base-Backbone interact. energy: -0.104 local terms energy: -106.695922 where: bonds (distance) C4'-P energy: -15.927 bonds (distance) P-C4' energy: -26.847 flat angles C4'-P-C4' energy: -22.404 flat angles P-C4'-P energy: -13.359 tors. eta vs tors. theta energy: -28.159 Dist. restrs. and SS energy: 0.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -294.592072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.592072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.821363 (E_RNA) where: Base-Base interactions energy: -184.694 where: short stacking energy: -99.351 Base-Backbone interact. energy: -0.070 local terms energy: -110.056718 where: bonds (distance) C4'-P energy: -19.628 bonds (distance) P-C4' energy: -22.221 flat angles C4'-P-C4' energy: -28.208 flat angles P-C4'-P energy: -18.288 tors. eta vs tors. theta energy: -21.712 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -243.455621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.455621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.565421 (E_RNA) where: Base-Base interactions energy: -149.259 where: short stacking energy: -83.231 Base-Backbone interact. energy: -0.585 local terms energy: -93.722004 where: bonds (distance) C4'-P energy: -19.302 bonds (distance) P-C4' energy: -23.623 flat angles C4'-P-C4' energy: -19.949 flat angles P-C4'-P energy: -16.142 tors. eta vs tors. theta energy: -14.706 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -276.262143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.262143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.416458 (E_RNA) where: Base-Base interactions energy: -166.741 where: short stacking energy: -82.468 Base-Backbone interact. energy: 0.485 local terms energy: -110.160455 where: bonds (distance) C4'-P energy: -22.178 bonds (distance) P-C4' energy: -26.931 flat angles C4'-P-C4' energy: -23.554 flat angles P-C4'-P energy: -16.496 tors. eta vs tors. theta energy: -21.001 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -221.611563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.611563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.611563 (E_RNA) where: Base-Base interactions energy: -130.881 where: short stacking energy: -73.960 Base-Backbone interact. energy: -0.242 local terms energy: -90.488784 where: bonds (distance) C4'-P energy: -18.792 bonds (distance) P-C4' energy: -25.564 flat angles C4'-P-C4' energy: -16.924 flat angles P-C4'-P energy: -14.331 tors. eta vs tors. theta energy: -14.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -211.892344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.892344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.251675 (E_RNA) where: Base-Base interactions energy: -121.411 where: short stacking energy: -74.283 Base-Backbone interact. energy: -0.963 local terms energy: -89.877913 where: bonds (distance) C4'-P energy: -16.100 bonds (distance) P-C4' energy: -26.131 flat angles C4'-P-C4' energy: -18.008 flat angles P-C4'-P energy: -7.607 tors. eta vs tors. theta energy: -22.032 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -187.841816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.841816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.068071 (E_RNA) where: Base-Base interactions energy: -108.564 where: short stacking energy: -56.573 Base-Backbone interact. energy: -0.341 local terms energy: -79.162786 where: bonds (distance) C4'-P energy: -20.165 bonds (distance) P-C4' energy: -20.336 flat angles C4'-P-C4' energy: -20.306 flat angles P-C4'-P energy: -10.681 tors. eta vs tors. theta energy: -7.675 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -369.887883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.887883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.913554 (E_RNA) where: Base-Base interactions energy: -247.788 where: short stacking energy: -115.333 Base-Backbone interact. energy: -0.517 local terms energy: -121.607981 where: bonds (distance) C4'-P energy: -24.882 bonds (distance) P-C4' energy: -25.864 flat angles C4'-P-C4' energy: -24.615 flat angles P-C4'-P energy: -17.213 tors. eta vs tors. theta energy: -29.033 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -343.132953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.132953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.132953 (E_RNA) where: Base-Base interactions energy: -226.454 where: short stacking energy: -111.204 Base-Backbone interact. energy: -0.524 local terms energy: -116.154873 where: bonds (distance) C4'-P energy: -24.537 bonds (distance) P-C4' energy: -24.945 flat angles C4'-P-C4' energy: -25.174 flat angles P-C4'-P energy: -16.812 tors. eta vs tors. theta energy: -24.687 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -335.221758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.221758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.261497 (E_RNA) where: Base-Base interactions energy: -208.958 where: short stacking energy: -102.888 Base-Backbone interact. energy: -0.568 local terms energy: -125.735301 where: bonds (distance) C4'-P energy: -23.227 bonds (distance) P-C4' energy: -24.047 flat angles C4'-P-C4' energy: -28.612 flat angles P-C4'-P energy: -20.362 tors. eta vs tors. theta energy: -29.488 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -331.823008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.823008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.845408 (E_RNA) where: Base-Base interactions energy: -222.310 where: short stacking energy: -104.834 Base-Backbone interact. energy: -0.134 local terms energy: -109.400661 where: bonds (distance) C4'-P energy: -20.742 bonds (distance) P-C4' energy: -24.027 flat angles C4'-P-C4' energy: -25.411 flat angles P-C4'-P energy: -15.640 tors. eta vs tors. theta energy: -23.582 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -291.681321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.681321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.747581 (E_RNA) where: Base-Base interactions energy: -190.986 where: short stacking energy: -84.806 Base-Backbone interact. energy: -0.372 local terms energy: -100.389644 where: bonds (distance) C4'-P energy: -25.765 bonds (distance) P-C4' energy: -22.592 flat angles C4'-P-C4' energy: -24.625 flat angles P-C4'-P energy: -13.980 tors. eta vs tors. theta energy: -13.429 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -236.914645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.914645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.914645 (E_RNA) where: Base-Base interactions energy: -144.510 where: short stacking energy: -72.858 Base-Backbone interact. energy: -1.181 local terms energy: -91.224213 where: bonds (distance) C4'-P energy: -22.353 bonds (distance) P-C4' energy: -18.982 flat angles C4'-P-C4' energy: -27.125 flat angles P-C4'-P energy: -12.011 tors. eta vs tors. theta energy: -10.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -218.199375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.199375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.285115 (E_RNA) where: Base-Base interactions energy: -128.925 where: short stacking energy: -78.159 Base-Backbone interact. energy: -0.304 local terms energy: -89.056227 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -22.185 flat angles C4'-P-C4' energy: -20.058 flat angles P-C4'-P energy: -10.685 tors. eta vs tors. theta energy: -14.754 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -268.351304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.351304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.374795 (E_RNA) where: Base-Base interactions energy: -174.702 where: short stacking energy: -85.458 Base-Backbone interact. energy: -0.450 local terms energy: -93.222204 where: bonds (distance) C4'-P energy: -18.593 bonds (distance) P-C4' energy: -26.990 flat angles C4'-P-C4' energy: -15.452 flat angles P-C4'-P energy: -12.884 tors. eta vs tors. theta energy: -19.303 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -208.136794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.136794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.243213 (E_RNA) where: Base-Base interactions energy: -118.426 where: short stacking energy: -63.099 Base-Backbone interact. energy: -0.685 local terms energy: -89.132236 where: bonds (distance) C4'-P energy: -22.340 bonds (distance) P-C4' energy: -22.961 flat angles C4'-P-C4' energy: -15.787 flat angles P-C4'-P energy: -16.164 tors. eta vs tors. theta energy: -11.880 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -185.376622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.376622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.691967 (E_RNA) where: Base-Base interactions energy: -101.253 where: short stacking energy: -55.700 Base-Backbone interact. energy: 1.493 local terms energy: -85.932189 where: bonds (distance) C4'-P energy: -22.513 bonds (distance) P-C4' energy: -27.043 flat angles C4'-P-C4' energy: -15.535 flat angles P-C4'-P energy: -6.936 tors. eta vs tors. theta energy: -13.905 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -365.600175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.600175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.614031 (E_RNA) where: Base-Base interactions energy: -246.394 where: short stacking energy: -110.987 Base-Backbone interact. energy: -0.879 local terms energy: -118.340781 where: bonds (distance) C4'-P energy: -18.741 bonds (distance) P-C4' energy: -28.439 flat angles C4'-P-C4' energy: -22.666 flat angles P-C4'-P energy: -20.931 tors. eta vs tors. theta energy: -27.563 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -348.710580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.710580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.023011 (E_RNA) where: Base-Base interactions energy: -232.722 where: short stacking energy: -111.950 Base-Backbone interact. energy: -0.579 local terms energy: -115.721758 where: bonds (distance) C4'-P energy: -22.157 bonds (distance) P-C4' energy: -24.271 flat angles C4'-P-C4' energy: -21.313 flat angles P-C4'-P energy: -19.081 tors. eta vs tors. theta energy: -28.900 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -343.255083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.255083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.255083 (E_RNA) where: Base-Base interactions energy: -234.688 where: short stacking energy: -113.582 Base-Backbone interact. energy: 0.406 local terms energy: -108.973651 where: bonds (distance) C4'-P energy: -21.479 bonds (distance) P-C4' energy: -22.554 flat angles C4'-P-C4' energy: -19.867 flat angles P-C4'-P energy: -20.204 tors. eta vs tors. theta energy: -24.870 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -334.998064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.998064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.998064 (E_RNA) where: Base-Base interactions energy: -229.163 where: short stacking energy: -104.772 Base-Backbone interact. energy: -1.532 local terms energy: -104.302979 where: bonds (distance) C4'-P energy: -16.392 bonds (distance) P-C4' energy: -22.429 flat angles C4'-P-C4' energy: -26.130 flat angles P-C4'-P energy: -13.297 tors. eta vs tors. theta energy: -26.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -316.692505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.692505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.722405 (E_RNA) where: Base-Base interactions energy: -211.235 where: short stacking energy: -101.047 Base-Backbone interact. energy: -0.271 local terms energy: -105.215571 where: bonds (distance) C4'-P energy: -21.442 bonds (distance) P-C4' energy: -21.612 flat angles C4'-P-C4' energy: -24.302 flat angles P-C4'-P energy: -18.830 tors. eta vs tors. theta energy: -19.029 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -234.227195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.227195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.257326 (E_RNA) where: Base-Base interactions energy: -142.741 where: short stacking energy: -86.934 Base-Backbone interact. energy: 4.252 local terms energy: -95.767640 where: bonds (distance) C4'-P energy: -14.978 bonds (distance) P-C4' energy: -24.295 flat angles C4'-P-C4' energy: -23.114 flat angles P-C4'-P energy: -16.291 tors. eta vs tors. theta energy: -17.090 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -226.048531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.048531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.102825 (E_RNA) where: Base-Base interactions energy: -132.222 where: short stacking energy: -77.696 Base-Backbone interact. energy: -1.036 local terms energy: -92.844841 where: bonds (distance) C4'-P energy: -18.105 bonds (distance) P-C4' energy: -25.132 flat angles C4'-P-C4' energy: -21.972 flat angles P-C4'-P energy: -14.991 tors. eta vs tors. theta energy: -12.644 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -248.264729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.264729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.266972 (E_RNA) where: Base-Base interactions energy: -157.793 where: short stacking energy: -83.651 Base-Backbone interact. energy: -0.611 local terms energy: -89.862630 where: bonds (distance) C4'-P energy: -14.160 bonds (distance) P-C4' energy: -20.812 flat angles C4'-P-C4' energy: -20.720 flat angles P-C4'-P energy: -21.125 tors. eta vs tors. theta energy: -13.046 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -215.598273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.598273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.622301 (E_RNA) where: Base-Base interactions energy: -125.787 where: short stacking energy: -66.630 Base-Backbone interact. energy: -0.584 local terms energy: -89.251278 where: bonds (distance) C4'-P energy: -17.683 bonds (distance) P-C4' energy: -23.151 flat angles C4'-P-C4' energy: -24.648 flat angles P-C4'-P energy: -11.348 tors. eta vs tors. theta energy: -12.422 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -209.143423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.143423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.772331 (E_RNA) where: Base-Base interactions energy: -130.109 where: short stacking energy: -58.916 Base-Backbone interact. energy: -0.993 local terms energy: -80.670787 where: bonds (distance) C4'-P energy: -19.661 bonds (distance) P-C4' energy: -22.366 flat angles C4'-P-C4' energy: -19.609 flat angles P-C4'-P energy: -9.283 tors. eta vs tors. theta energy: -9.752 Dist. restrs. and SS energy: 2.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -373.953568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.953568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.013033 (E_RNA) where: Base-Base interactions energy: -245.793 where: short stacking energy: -115.138 Base-Backbone interact. energy: -0.094 local terms energy: -128.126359 where: bonds (distance) C4'-P energy: -25.147 bonds (distance) P-C4' energy: -26.547 flat angles C4'-P-C4' energy: -29.703 flat angles P-C4'-P energy: -18.346 tors. eta vs tors. theta energy: -28.384 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -345.046432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.046432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.304203 (E_RNA) where: Base-Base interactions energy: -221.207 where: short stacking energy: -101.301 Base-Backbone interact. energy: -0.293 local terms energy: -123.804092 where: bonds (distance) C4'-P energy: -26.684 bonds (distance) P-C4' energy: -25.222 flat angles C4'-P-C4' energy: -25.734 flat angles P-C4'-P energy: -18.352 tors. eta vs tors. theta energy: -27.813 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -327.920803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.920803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.926898 (E_RNA) where: Base-Base interactions energy: -216.633 where: short stacking energy: -101.041 Base-Backbone interact. energy: -0.116 local terms energy: -111.177401 where: bonds (distance) C4'-P energy: -22.803 bonds (distance) P-C4' energy: -16.435 flat angles C4'-P-C4' energy: -27.947 flat angles P-C4'-P energy: -15.892 tors. eta vs tors. theta energy: -28.100 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -316.210614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.210614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.226321 (E_RNA) where: Base-Base interactions energy: -216.402 where: short stacking energy: -103.578 Base-Backbone interact. energy: -0.306 local terms energy: -99.518386 where: bonds (distance) C4'-P energy: -17.923 bonds (distance) P-C4' energy: -26.667 flat angles C4'-P-C4' energy: -23.111 flat angles P-C4'-P energy: -13.343 tors. eta vs tors. theta energy: -18.474 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -329.733625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.733625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.754150 (E_RNA) where: Base-Base interactions energy: -216.940 where: short stacking energy: -96.131 Base-Backbone interact. energy: -0.579 local terms energy: -112.235064 where: bonds (distance) C4'-P energy: -21.289 bonds (distance) P-C4' energy: -25.131 flat angles C4'-P-C4' energy: -24.711 flat angles P-C4'-P energy: -16.867 tors. eta vs tors. theta energy: -24.238 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -248.008581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.008581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.051482 (E_RNA) where: Base-Base interactions energy: -150.157 where: short stacking energy: -76.037 Base-Backbone interact. energy: -0.515 local terms energy: -97.379461 where: bonds (distance) C4'-P energy: -22.952 bonds (distance) P-C4' energy: -22.435 flat angles C4'-P-C4' energy: -24.861 flat angles P-C4'-P energy: -12.509 tors. eta vs tors. theta energy: -14.623 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -219.311866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.311866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.425078 (E_RNA) where: Base-Base interactions energy: -126.458 where: short stacking energy: -68.932 Base-Backbone interact. energy: -0.330 local terms energy: -92.636504 where: bonds (distance) C4'-P energy: -23.674 bonds (distance) P-C4' energy: -19.791 flat angles C4'-P-C4' energy: -23.897 flat angles P-C4'-P energy: -13.162 tors. eta vs tors. theta energy: -12.112 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -227.379101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.379101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.477831 (E_RNA) where: Base-Base interactions energy: -137.779 where: short stacking energy: -76.688 Base-Backbone interact. energy: -0.392 local terms energy: -89.306791 where: bonds (distance) C4'-P energy: -21.943 bonds (distance) P-C4' energy: -21.406 flat angles C4'-P-C4' energy: -23.697 flat angles P-C4'-P energy: -14.267 tors. eta vs tors. theta energy: -7.994 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -218.721833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.721833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.950140 (E_RNA) where: Base-Base interactions energy: -132.043 where: short stacking energy: -67.937 Base-Backbone interact. energy: -0.120 local terms energy: -86.786369 where: bonds (distance) C4'-P energy: -19.020 bonds (distance) P-C4' energy: -21.175 flat angles C4'-P-C4' energy: -21.853 flat angles P-C4'-P energy: -10.843 tors. eta vs tors. theta energy: -13.895 Dist. restrs. and SS energy: 0.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -197.992496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.992496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.002649 (E_RNA) where: Base-Base interactions energy: -117.359 where: short stacking energy: -66.687 Base-Backbone interact. energy: -0.345 local terms energy: -80.299087 where: bonds (distance) C4'-P energy: -18.080 bonds (distance) P-C4' energy: -21.586 flat angles C4'-P-C4' energy: -14.270 flat angles P-C4'-P energy: -15.550 tors. eta vs tors. theta energy: -10.813 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -367.844276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.844276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.844276 (E_RNA) where: Base-Base interactions energy: -252.532 where: short stacking energy: -112.102 Base-Backbone interact. energy: -0.761 local terms energy: -114.551653 where: bonds (distance) C4'-P energy: -23.139 bonds (distance) P-C4' energy: -24.753 flat angles C4'-P-C4' energy: -26.607 flat angles P-C4'-P energy: -15.026 tors. eta vs tors. theta energy: -25.026 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -360.561810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.561810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.567322 (E_RNA) where: Base-Base interactions energy: -240.124 where: short stacking energy: -103.535 Base-Backbone interact. energy: -1.918 local terms energy: -118.526053 where: bonds (distance) C4'-P energy: -24.359 bonds (distance) P-C4' energy: -26.695 flat angles C4'-P-C4' energy: -25.853 flat angles P-C4'-P energy: -14.526 tors. eta vs tors. theta energy: -27.093 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -339.738274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.738274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.738274 (E_RNA) where: Base-Base interactions energy: -234.564 where: short stacking energy: -111.285 Base-Backbone interact. energy: -0.581 local terms energy: -104.593031 where: bonds (distance) C4'-P energy: -24.208 bonds (distance) P-C4' energy: -21.006 flat angles C4'-P-C4' energy: -22.866 flat angles P-C4'-P energy: -11.552 tors. eta vs tors. theta energy: -24.961 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -343.416117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.416117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.533649 (E_RNA) where: Base-Base interactions energy: -226.203 where: short stacking energy: -105.566 Base-Backbone interact. energy: -0.359 local terms energy: -116.971057 where: bonds (distance) C4'-P energy: -19.600 bonds (distance) P-C4' energy: -23.184 flat angles C4'-P-C4' energy: -25.690 flat angles P-C4'-P energy: -20.218 tors. eta vs tors. theta energy: -28.279 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -320.795911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.795911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.912693 (E_RNA) where: Base-Base interactions energy: -221.308 where: short stacking energy: -109.751 Base-Backbone interact. energy: 0.066 local terms energy: -99.671157 where: bonds (distance) C4'-P energy: -20.975 bonds (distance) P-C4' energy: -20.478 flat angles C4'-P-C4' energy: -17.159 flat angles P-C4'-P energy: -14.972 tors. eta vs tors. theta energy: -26.088 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -248.888152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.888152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.896403 (E_RNA) where: Base-Base interactions energy: -153.084 where: short stacking energy: -89.530 Base-Backbone interact. energy: -0.537 local terms energy: -95.275463 where: bonds (distance) C4'-P energy: -16.578 bonds (distance) P-C4' energy: -22.006 flat angles C4'-P-C4' energy: -19.827 flat angles P-C4'-P energy: -13.996 tors. eta vs tors. theta energy: -22.868 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -219.603240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.603240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.702978 (E_RNA) where: Base-Base interactions energy: -135.798 where: short stacking energy: -73.263 Base-Backbone interact. energy: -0.114 local terms energy: -83.790861 where: bonds (distance) C4'-P energy: -13.647 bonds (distance) P-C4' energy: -22.282 flat angles C4'-P-C4' energy: -20.651 flat angles P-C4'-P energy: -14.693 tors. eta vs tors. theta energy: -12.519 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -228.467570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.467570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.467570 (E_RNA) where: Base-Base interactions energy: -143.516 where: short stacking energy: -84.750 Base-Backbone interact. energy: -0.185 local terms energy: -84.766849 where: bonds (distance) C4'-P energy: -20.660 bonds (distance) P-C4' energy: -17.510 flat angles C4'-P-C4' energy: -17.221 flat angles P-C4'-P energy: -12.326 tors. eta vs tors. theta energy: -17.050 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -199.872520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.872520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.956734 (E_RNA) where: Base-Base interactions energy: -116.400 where: short stacking energy: -63.160 Base-Backbone interact. energy: -0.367 local terms energy: -83.189730 where: bonds (distance) C4'-P energy: -10.343 bonds (distance) P-C4' energy: -22.706 flat angles C4'-P-C4' energy: -23.135 flat angles P-C4'-P energy: -16.465 tors. eta vs tors. theta energy: -10.541 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -191.692726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.692726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.714714 (E_RNA) where: Base-Base interactions energy: -105.578 where: short stacking energy: -61.862 Base-Backbone interact. energy: 1.322 local terms energy: -87.458570 where: bonds (distance) C4'-P energy: -14.752 bonds (distance) P-C4' energy: -25.458 flat angles C4'-P-C4' energy: -16.419 flat angles P-C4'-P energy: -14.961 tors. eta vs tors. theta energy: -15.868 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -358.287120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.287120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.301278 (E_RNA) where: Base-Base interactions energy: -237.658 where: short stacking energy: -102.381 Base-Backbone interact. energy: -0.104 local terms energy: -120.539248 where: bonds (distance) C4'-P energy: -25.109 bonds (distance) P-C4' energy: -27.089 flat angles C4'-P-C4' energy: -26.163 flat angles P-C4'-P energy: -16.047 tors. eta vs tors. theta energy: -26.131 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -355.467844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.467844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.482271 (E_RNA) where: Base-Base interactions energy: -236.762 where: short stacking energy: -99.864 Base-Backbone interact. energy: -0.311 local terms energy: -118.409753 where: bonds (distance) C4'-P energy: -20.178 bonds (distance) P-C4' energy: -28.380 flat angles C4'-P-C4' energy: -27.567 flat angles P-C4'-P energy: -21.506 tors. eta vs tors. theta energy: -20.780 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -344.069572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.069572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.185231 (E_RNA) where: Base-Base interactions energy: -226.310 where: short stacking energy: -106.886 Base-Backbone interact. energy: -1.374 local terms energy: -116.501232 where: bonds (distance) C4'-P energy: -20.394 bonds (distance) P-C4' energy: -22.041 flat angles C4'-P-C4' energy: -24.689 flat angles P-C4'-P energy: -20.914 tors. eta vs tors. theta energy: -28.464 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -345.130397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.130397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.130397 (E_RNA) where: Base-Base interactions energy: -229.417 where: short stacking energy: -110.672 Base-Backbone interact. energy: -0.618 local terms energy: -115.095100 where: bonds (distance) C4'-P energy: -24.777 bonds (distance) P-C4' energy: -24.155 flat angles C4'-P-C4' energy: -24.840 flat angles P-C4'-P energy: -16.990 tors. eta vs tors. theta energy: -24.333 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -320.756814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.756814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.867815 (E_RNA) where: Base-Base interactions energy: -219.594 where: short stacking energy: -106.958 Base-Backbone interact. energy: -0.128 local terms energy: -101.145626 where: bonds (distance) C4'-P energy: -17.285 bonds (distance) P-C4' energy: -21.707 flat angles C4'-P-C4' energy: -23.110 flat angles P-C4'-P energy: -9.210 tors. eta vs tors. theta energy: -29.833 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -249.557974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.557974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.696390 (E_RNA) where: Base-Base interactions energy: -139.972 where: short stacking energy: -85.151 Base-Backbone interact. energy: -0.215 local terms energy: -109.509352 where: bonds (distance) C4'-P energy: -23.818 bonds (distance) P-C4' energy: -23.336 flat angles C4'-P-C4' energy: -25.423 flat angles P-C4'-P energy: -12.681 tors. eta vs tors. theta energy: -24.251 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -224.597416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.597416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.695137 (E_RNA) where: Base-Base interactions energy: -120.227 where: short stacking energy: -67.362 Base-Backbone interact. energy: -0.165 local terms energy: -104.303305 where: bonds (distance) C4'-P energy: -19.236 bonds (distance) P-C4' energy: -28.348 flat angles C4'-P-C4' energy: -24.216 flat angles P-C4'-P energy: -16.318 tors. eta vs tors. theta energy: -16.185 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -214.341482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.341482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.346357 (E_RNA) where: Base-Base interactions energy: -119.178 where: short stacking energy: -56.265 Base-Backbone interact. energy: -0.329 local terms energy: -94.839501 where: bonds (distance) C4'-P energy: -19.902 bonds (distance) P-C4' energy: -25.252 flat angles C4'-P-C4' energy: -22.322 flat angles P-C4'-P energy: -16.322 tors. eta vs tors. theta energy: -11.042 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -221.836406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.836406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.896124 (E_RNA) where: Base-Base interactions energy: -128.841 where: short stacking energy: -79.180 Base-Backbone interact. energy: -1.079 local terms energy: -91.976568 where: bonds (distance) C4'-P energy: -24.902 bonds (distance) P-C4' energy: -17.729 flat angles C4'-P-C4' energy: -23.334 flat angles P-C4'-P energy: -14.980 tors. eta vs tors. theta energy: -11.031 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -209.487455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.487455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.504925 (E_RNA) where: Base-Base interactions energy: -124.305 where: short stacking energy: -72.405 Base-Backbone interact. energy: -0.096 local terms energy: -85.104362 where: bonds (distance) C4'-P energy: -16.031 bonds (distance) P-C4' energy: -20.713 flat angles C4'-P-C4' energy: -21.402 flat angles P-C4'-P energy: -15.335 tors. eta vs tors. theta energy: -11.624 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -359.415653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.415653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.415653 (E_RNA) where: Base-Base interactions energy: -239.822 where: short stacking energy: -113.387 Base-Backbone interact. energy: -2.338 local terms energy: -117.255683 where: bonds (distance) C4'-P energy: -21.561 bonds (distance) P-C4' energy: -25.613 flat angles C4'-P-C4' energy: -24.121 flat angles P-C4'-P energy: -18.377 tors. eta vs tors. theta energy: -27.584 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -365.934655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.934655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.997852 (E_RNA) where: Base-Base interactions energy: -256.091 where: short stacking energy: -112.664 Base-Backbone interact. energy: -0.034 local terms energy: -109.872504 where: bonds (distance) C4'-P energy: -20.770 bonds (distance) P-C4' energy: -25.284 flat angles C4'-P-C4' energy: -24.313 flat angles P-C4'-P energy: -10.399 tors. eta vs tors. theta energy: -29.106 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -344.755373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.755373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.833499 (E_RNA) where: Base-Base interactions energy: -227.088 where: short stacking energy: -107.723 Base-Backbone interact. energy: -1.182 local terms energy: -116.564139 where: bonds (distance) C4'-P energy: -22.967 bonds (distance) P-C4' energy: -21.857 flat angles C4'-P-C4' energy: -26.791 flat angles P-C4'-P energy: -15.268 tors. eta vs tors. theta energy: -29.680 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -333.022304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.022304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.022304 (E_RNA) where: Base-Base interactions energy: -222.026 where: short stacking energy: -110.690 Base-Backbone interact. energy: -1.578 local terms energy: -109.418393 where: bonds (distance) C4'-P energy: -25.053 bonds (distance) P-C4' energy: -21.147 flat angles C4'-P-C4' energy: -22.339 flat angles P-C4'-P energy: -15.923 tors. eta vs tors. theta energy: -24.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -314.266204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.266204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.291200 (E_RNA) where: Base-Base interactions energy: -209.110 where: short stacking energy: -97.791 Base-Backbone interact. energy: -0.459 local terms energy: -104.721680 where: bonds (distance) C4'-P energy: -18.503 bonds (distance) P-C4' energy: -24.834 flat angles C4'-P-C4' energy: -18.059 flat angles P-C4'-P energy: -14.713 tors. eta vs tors. theta energy: -28.613 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -229.849902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.849902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.951840 (E_RNA) where: Base-Base interactions energy: -130.440 where: short stacking energy: -75.474 Base-Backbone interact. energy: -0.204 local terms energy: -99.307031 where: bonds (distance) C4'-P energy: -22.236 bonds (distance) P-C4' energy: -23.751 flat angles C4'-P-C4' energy: -24.890 flat angles P-C4'-P energy: -11.399 tors. eta vs tors. theta energy: -17.030 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -238.762042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.762042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.141284 (E_RNA) where: Base-Base interactions energy: -154.566 where: short stacking energy: -82.738 Base-Backbone interact. energy: -0.385 local terms energy: -84.190713 where: bonds (distance) C4'-P energy: -21.010 bonds (distance) P-C4' energy: -22.008 flat angles C4'-P-C4' energy: -20.118 flat angles P-C4'-P energy: -8.581 tors. eta vs tors. theta energy: -12.474 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -224.175791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.175791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.241337 (E_RNA) where: Base-Base interactions energy: -127.584 where: short stacking energy: -69.579 Base-Backbone interact. energy: -0.823 local terms energy: -95.833505 where: bonds (distance) C4'-P energy: -25.817 bonds (distance) P-C4' energy: -23.878 flat angles C4'-P-C4' energy: -18.680 flat angles P-C4'-P energy: -14.170 tors. eta vs tors. theta energy: -13.289 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -205.795248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.795248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.830508 (E_RNA) where: Base-Base interactions energy: -122.885 where: short stacking energy: -69.521 Base-Backbone interact. energy: -0.163 local terms energy: -82.781755 where: bonds (distance) C4'-P energy: -15.085 bonds (distance) P-C4' energy: -16.735 flat angles C4'-P-C4' energy: -21.598 flat angles P-C4'-P energy: -16.772 tors. eta vs tors. theta energy: -12.591 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -185.869358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.869358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.953282 (E_RNA) where: Base-Base interactions energy: -95.159 where: short stacking energy: -58.346 Base-Backbone interact. energy: -0.228 local terms energy: -90.566198 where: bonds (distance) C4'-P energy: -22.992 bonds (distance) P-C4' energy: -26.878 flat angles C4'-P-C4' energy: -20.989 flat angles P-C4'-P energy: -13.335 tors. eta vs tors. theta energy: -6.372 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -363.701620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.701620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.750605 (E_RNA) where: Base-Base interactions energy: -255.378 where: short stacking energy: -105.132 Base-Backbone interact. energy: -0.302 local terms energy: -108.070536 where: bonds (distance) C4'-P energy: -20.758 bonds (distance) P-C4' energy: -20.003 flat angles C4'-P-C4' energy: -27.140 flat angles P-C4'-P energy: -13.964 tors. eta vs tors. theta energy: -26.205 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -342.736349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.736349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.780329 (E_RNA) where: Base-Base interactions energy: -224.652 where: short stacking energy: -106.003 Base-Backbone interact. energy: -0.503 local terms energy: -117.624638 where: bonds (distance) C4'-P energy: -22.524 bonds (distance) P-C4' energy: -26.903 flat angles C4'-P-C4' energy: -21.903 flat angles P-C4'-P energy: -21.165 tors. eta vs tors. theta energy: -25.130 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -349.653040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.653040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.686707 (E_RNA) where: Base-Base interactions energy: -222.320 where: short stacking energy: -120.332 Base-Backbone interact. energy: -0.897 local terms energy: -126.469576 where: bonds (distance) C4'-P energy: -22.700 bonds (distance) P-C4' energy: -22.167 flat angles C4'-P-C4' energy: -29.064 flat angles P-C4'-P energy: -16.509 tors. eta vs tors. theta energy: -36.030 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -332.075868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.075868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.116597 (E_RNA) where: Base-Base interactions energy: -226.186 where: short stacking energy: -111.971 Base-Backbone interact. energy: -0.570 local terms energy: -105.359829 where: bonds (distance) C4'-P energy: -16.908 bonds (distance) P-C4' energy: -17.578 flat angles C4'-P-C4' energy: -25.966 flat angles P-C4'-P energy: -14.486 tors. eta vs tors. theta energy: -30.422 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -297.026926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.026926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.053220 (E_RNA) where: Base-Base interactions energy: -202.169 where: short stacking energy: -87.505 Base-Backbone interact. energy: -1.115 local terms energy: -93.769482 where: bonds (distance) C4'-P energy: -18.634 bonds (distance) P-C4' energy: -16.314 flat angles C4'-P-C4' energy: -21.992 flat angles P-C4'-P energy: -18.314 tors. eta vs tors. theta energy: -18.515 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -241.163367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.163367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.197002 (E_RNA) where: Base-Base interactions energy: -154.106 where: short stacking energy: -87.854 Base-Backbone interact. energy: -0.300 local terms energy: -86.791478 where: bonds (distance) C4'-P energy: -22.040 bonds (distance) P-C4' energy: -21.718 flat angles C4'-P-C4' energy: -21.054 flat angles P-C4'-P energy: -7.536 tors. eta vs tors. theta energy: -14.443 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -229.739638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.739638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.048548 (E_RNA) where: Base-Base interactions energy: -142.625 where: short stacking energy: -60.503 Base-Backbone interact. energy: -1.325 local terms energy: -86.099235 where: bonds (distance) C4'-P energy: -22.814 bonds (distance) P-C4' energy: -20.352 flat angles C4'-P-C4' energy: -18.484 flat angles P-C4'-P energy: -15.367 tors. eta vs tors. theta energy: -9.083 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -215.277988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.277988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.464416 (E_RNA) where: Base-Base interactions energy: -124.405 where: short stacking energy: -68.669 Base-Backbone interact. energy: 0.630 local terms energy: -91.688995 where: bonds (distance) C4'-P energy: -27.048 bonds (distance) P-C4' energy: -21.601 flat angles C4'-P-C4' energy: -21.950 flat angles P-C4'-P energy: -9.255 tors. eta vs tors. theta energy: -11.835 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -219.541197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.541197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.552771 (E_RNA) where: Base-Base interactions energy: -124.428 where: short stacking energy: -60.711 Base-Backbone interact. energy: -0.243 local terms energy: -94.881573 where: bonds (distance) C4'-P energy: -25.599 bonds (distance) P-C4' energy: -22.975 flat angles C4'-P-C4' energy: -20.135 flat angles P-C4'-P energy: -13.866 tors. eta vs tors. theta energy: -12.307 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -198.001710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.001710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.006673 (E_RNA) where: Base-Base interactions energy: -122.344 where: short stacking energy: -65.565 Base-Backbone interact. energy: 0.095 local terms energy: -75.757769 where: bonds (distance) C4'-P energy: -14.701 bonds (distance) P-C4' energy: -14.902 flat angles C4'-P-C4' energy: -20.427 flat angles P-C4'-P energy: -12.465 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -365.944462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.944462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.947476 (E_RNA) where: Base-Base interactions energy: -244.919 where: short stacking energy: -101.128 Base-Backbone interact. energy: -0.131 local terms energy: -120.897748 where: bonds (distance) C4'-P energy: -26.301 bonds (distance) P-C4' energy: -26.707 flat angles C4'-P-C4' energy: -26.475 flat angles P-C4'-P energy: -17.622 tors. eta vs tors. theta energy: -23.793 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -362.343614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.343614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.392726 (E_RNA) where: Base-Base interactions energy: -238.933 where: short stacking energy: -114.555 Base-Backbone interact. energy: -0.896 local terms energy: -122.563750 where: bonds (distance) C4'-P energy: -22.138 bonds (distance) P-C4' energy: -26.666 flat angles C4'-P-C4' energy: -28.924 flat angles P-C4'-P energy: -15.419 tors. eta vs tors. theta energy: -29.417 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -333.763261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.763261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.791461 (E_RNA) where: Base-Base interactions energy: -223.305 where: short stacking energy: -104.771 Base-Backbone interact. energy: -0.063 local terms energy: -110.423861 where: bonds (distance) C4'-P energy: -22.183 bonds (distance) P-C4' energy: -21.397 flat angles C4'-P-C4' energy: -26.726 flat angles P-C4'-P energy: -12.089 tors. eta vs tors. theta energy: -28.029 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -326.128794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.128794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.203749 (E_RNA) where: Base-Base interactions energy: -215.960 where: short stacking energy: -105.093 Base-Backbone interact. energy: 0.782 local terms energy: -111.026097 where: bonds (distance) C4'-P energy: -20.762 bonds (distance) P-C4' energy: -26.655 flat angles C4'-P-C4' energy: -24.072 flat angles P-C4'-P energy: -19.026 tors. eta vs tors. theta energy: -20.511 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -324.317859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.317859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.321581 (E_RNA) where: Base-Base interactions energy: -219.627 where: short stacking energy: -115.900 Base-Backbone interact. energy: -1.246 local terms energy: -103.448326 where: bonds (distance) C4'-P energy: -20.468 bonds (distance) P-C4' energy: -20.919 flat angles C4'-P-C4' energy: -22.735 flat angles P-C4'-P energy: -10.517 tors. eta vs tors. theta energy: -28.810 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -228.992433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.992433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.992433 (E_RNA) where: Base-Base interactions energy: -139.828 where: short stacking energy: -78.995 Base-Backbone interact. energy: -1.166 local terms energy: -87.997956 where: bonds (distance) C4'-P energy: -18.419 bonds (distance) P-C4' energy: -18.224 flat angles C4'-P-C4' energy: -20.562 flat angles P-C4'-P energy: -12.015 tors. eta vs tors. theta energy: -18.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -232.015337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.015337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.148092 (E_RNA) where: Base-Base interactions energy: -142.519 where: short stacking energy: -91.747 Base-Backbone interact. energy: -0.563 local terms energy: -89.066102 where: bonds (distance) C4'-P energy: -18.718 bonds (distance) P-C4' energy: -18.161 flat angles C4'-P-C4' energy: -19.887 flat angles P-C4'-P energy: -10.839 tors. eta vs tors. theta energy: -21.462 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -214.421140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.421140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.719259 (E_RNA) where: Base-Base interactions energy: -118.182 where: short stacking energy: -65.442 Base-Backbone interact. energy: -0.397 local terms energy: -96.140569 where: bonds (distance) C4'-P energy: -16.258 bonds (distance) P-C4' energy: -24.604 flat angles C4'-P-C4' energy: -20.302 flat angles P-C4'-P energy: -18.398 tors. eta vs tors. theta energy: -16.579 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -201.388447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.388447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.569338 (E_RNA) where: Base-Base interactions energy: -117.207 where: short stacking energy: -63.418 Base-Backbone interact. energy: -0.322 local terms energy: -84.040510 where: bonds (distance) C4'-P energy: -23.043 bonds (distance) P-C4' energy: -13.842 flat angles C4'-P-C4' energy: -22.768 flat angles P-C4'-P energy: -15.147 tors. eta vs tors. theta energy: -9.240 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -204.872541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.872541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.955469 (E_RNA) where: Base-Base interactions energy: -132.431 where: short stacking energy: -74.578 Base-Backbone interact. energy: -0.409 local terms energy: -72.115813 where: bonds (distance) C4'-P energy: -15.687 bonds (distance) P-C4' energy: -23.958 flat angles C4'-P-C4' energy: -18.145 flat angles P-C4'-P energy: -7.720 tors. eta vs tors. theta energy: -6.605 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -367.557495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.557495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.557495 (E_RNA) where: Base-Base interactions energy: -250.711 where: short stacking energy: -114.533 Base-Backbone interact. energy: 0.360 local terms energy: -117.206457 where: bonds (distance) C4'-P energy: -20.252 bonds (distance) P-C4' energy: -21.297 flat angles C4'-P-C4' energy: -26.451 flat angles P-C4'-P energy: -14.394 tors. eta vs tors. theta energy: -34.813 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -350.460618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.460618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.555724 (E_RNA) where: Base-Base interactions energy: -230.810 where: short stacking energy: -103.769 Base-Backbone interact. energy: -1.211 local terms energy: -118.534246 where: bonds (distance) C4'-P energy: -26.099 bonds (distance) P-C4' energy: -23.166 flat angles C4'-P-C4' energy: -24.394 flat angles P-C4'-P energy: -17.738 tors. eta vs tors. theta energy: -27.137 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -344.293601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.293601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.388979 (E_RNA) where: Base-Base interactions energy: -218.688 where: short stacking energy: -112.277 Base-Backbone interact. energy: -0.453 local terms energy: -125.248075 where: bonds (distance) C4'-P energy: -27.481 bonds (distance) P-C4' energy: -25.098 flat angles C4'-P-C4' energy: -24.656 flat angles P-C4'-P energy: -16.115 tors. eta vs tors. theta energy: -31.899 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -338.344817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.344817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.587283 (E_RNA) where: Base-Base interactions energy: -230.000 where: short stacking energy: -103.360 Base-Backbone interact. energy: -0.145 local terms energy: -108.442646 where: bonds (distance) C4'-P energy: -19.889 bonds (distance) P-C4' energy: -24.508 flat angles C4'-P-C4' energy: -25.144 flat angles P-C4'-P energy: -16.136 tors. eta vs tors. theta energy: -22.766 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -319.379405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.379405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.402848 (E_RNA) where: Base-Base interactions energy: -203.241 where: short stacking energy: -102.887 Base-Backbone interact. energy: -0.347 local terms energy: -115.814451 where: bonds (distance) C4'-P energy: -26.522 bonds (distance) P-C4' energy: -22.695 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -14.987 tors. eta vs tors. theta energy: -28.149 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -246.268815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.268815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.355593 (E_RNA) where: Base-Base interactions energy: -134.558 where: short stacking energy: -81.922 Base-Backbone interact. energy: -2.354 local terms energy: -109.443579 where: bonds (distance) C4'-P energy: -25.206 bonds (distance) P-C4' energy: -23.527 flat angles C4'-P-C4' energy: -21.691 flat angles P-C4'-P energy: -16.552 tors. eta vs tors. theta energy: -22.468 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -230.089946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.089946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.202935 (E_RNA) where: Base-Base interactions energy: -138.719 where: short stacking energy: -76.251 Base-Backbone interact. energy: 0.237 local terms energy: -91.720812 where: bonds (distance) C4'-P energy: -23.117 bonds (distance) P-C4' energy: -21.232 flat angles C4'-P-C4' energy: -17.696 flat angles P-C4'-P energy: -14.796 tors. eta vs tors. theta energy: -14.879 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -209.243525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.243525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.243525 (E_RNA) where: Base-Base interactions energy: -114.038 where: short stacking energy: -53.035 Base-Backbone interact. energy: -0.824 local terms energy: -94.381879 where: bonds (distance) C4'-P energy: -22.025 bonds (distance) P-C4' energy: -18.748 flat angles C4'-P-C4' energy: -20.554 flat angles P-C4'-P energy: -17.882 tors. eta vs tors. theta energy: -15.172 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -208.955702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.955702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.997873 (E_RNA) where: Base-Base interactions energy: -128.705 where: short stacking energy: -64.297 Base-Backbone interact. energy: -0.373 local terms energy: -79.919767 where: bonds (distance) C4'-P energy: -18.489 bonds (distance) P-C4' energy: -18.184 flat angles C4'-P-C4' energy: -17.206 flat angles P-C4'-P energy: -16.405 tors. eta vs tors. theta energy: -9.636 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -205.583332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.583332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.668828 (E_RNA) where: Base-Base interactions energy: -113.257 where: short stacking energy: -63.732 Base-Backbone interact. energy: -1.887 local terms energy: -90.525323 where: bonds (distance) C4'-P energy: -18.580 bonds (distance) P-C4' energy: -23.032 flat angles C4'-P-C4' energy: -17.323 flat angles P-C4'-P energy: -19.956 tors. eta vs tors. theta energy: -11.634 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -365.284009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.284009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.285938 (E_RNA) where: Base-Base interactions energy: -252.650 where: short stacking energy: -110.468 Base-Backbone interact. energy: -0.329 local terms energy: -112.306177 where: bonds (distance) C4'-P energy: -23.284 bonds (distance) P-C4' energy: -21.547 flat angles C4'-P-C4' energy: -24.096 flat angles P-C4'-P energy: -14.524 tors. eta vs tors. theta energy: -28.855 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -353.151645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.151645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.170206 (E_RNA) where: Base-Base interactions energy: -230.864 where: short stacking energy: -121.145 Base-Backbone interact. energy: -0.007 local terms energy: -122.298742 where: bonds (distance) C4'-P energy: -25.553 bonds (distance) P-C4' energy: -26.324 flat angles C4'-P-C4' energy: -25.862 flat angles P-C4'-P energy: -13.903 tors. eta vs tors. theta energy: -30.658 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -337.371073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.371073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.434624 (E_RNA) where: Base-Base interactions energy: -217.788 where: short stacking energy: -107.021 Base-Backbone interact. energy: -0.610 local terms energy: -119.037026 where: bonds (distance) C4'-P energy: -21.909 bonds (distance) P-C4' energy: -20.784 flat angles C4'-P-C4' energy: -28.766 flat angles P-C4'-P energy: -19.588 tors. eta vs tors. theta energy: -27.991 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -340.217189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.217189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.233158 (E_RNA) where: Base-Base interactions energy: -224.726 where: short stacking energy: -108.120 Base-Backbone interact. energy: -1.600 local terms energy: -113.908152 where: bonds (distance) C4'-P energy: -15.351 bonds (distance) P-C4' energy: -26.784 flat angles C4'-P-C4' energy: -24.322 flat angles P-C4'-P energy: -19.936 tors. eta vs tors. theta energy: -27.515 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -327.541100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.541100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.566584 (E_RNA) where: Base-Base interactions energy: -219.334 where: short stacking energy: -111.031 Base-Backbone interact. energy: -0.532 local terms energy: -107.699989 where: bonds (distance) C4'-P energy: -17.389 bonds (distance) P-C4' energy: -23.687 flat angles C4'-P-C4' energy: -23.699 flat angles P-C4'-P energy: -15.087 tors. eta vs tors. theta energy: -27.838 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -252.415013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.415013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.437717 (E_RNA) where: Base-Base interactions energy: -146.762 where: short stacking energy: -94.421 Base-Backbone interact. energy: -0.718 local terms energy: -104.957067 where: bonds (distance) C4'-P energy: -18.527 bonds (distance) P-C4' energy: -21.889 flat angles C4'-P-C4' energy: -26.025 flat angles P-C4'-P energy: -17.567 tors. eta vs tors. theta energy: -20.950 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -223.940064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.940064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.108450 (E_RNA) where: Base-Base interactions energy: -135.531 where: short stacking energy: -82.373 Base-Backbone interact. energy: -0.330 local terms energy: -88.248007 where: bonds (distance) C4'-P energy: -20.832 bonds (distance) P-C4' energy: -23.662 flat angles C4'-P-C4' energy: -11.504 flat angles P-C4'-P energy: -15.369 tors. eta vs tors. theta energy: -16.880 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -215.509785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.509785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.522317 (E_RNA) where: Base-Base interactions energy: -117.036 where: short stacking energy: -66.715 Base-Backbone interact. energy: 0.869 local terms energy: -99.354488 where: bonds (distance) C4'-P energy: -25.319 bonds (distance) P-C4' energy: -20.574 flat angles C4'-P-C4' energy: -19.382 flat angles P-C4'-P energy: -12.610 tors. eta vs tors. theta energy: -21.470 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -203.443287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.443287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.451582 (E_RNA) where: Base-Base interactions energy: -125.078 where: short stacking energy: -64.492 Base-Backbone interact. energy: -0.908 local terms energy: -77.465308 where: bonds (distance) C4'-P energy: -21.104 bonds (distance) P-C4' energy: -19.265 flat angles C4'-P-C4' energy: -17.769 flat angles P-C4'-P energy: -8.524 tors. eta vs tors. theta energy: -10.803 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -201.826154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.826154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.122308 (E_RNA) where: Base-Base interactions energy: -111.340 where: short stacking energy: -62.527 Base-Backbone interact. energy: 0.450 local terms energy: -91.232199 where: bonds (distance) C4'-P energy: -18.841 bonds (distance) P-C4' energy: -20.807 flat angles C4'-P-C4' energy: -23.355 flat angles P-C4'-P energy: -17.657 tors. eta vs tors. theta energy: -10.572 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -371.900376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.900376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.913947 (E_RNA) where: Base-Base interactions energy: -245.660 where: short stacking energy: -104.482 Base-Backbone interact. energy: -0.829 local terms energy: -125.424949 where: bonds (distance) C4'-P energy: -22.481 bonds (distance) P-C4' energy: -24.863 flat angles C4'-P-C4' energy: -28.448 flat angles P-C4'-P energy: -20.071 tors. eta vs tors. theta energy: -29.563 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -345.666920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.666920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.677961 (E_RNA) where: Base-Base interactions energy: -229.821 where: short stacking energy: -118.350 Base-Backbone interact. energy: -1.427 local terms energy: -114.430614 where: bonds (distance) C4'-P energy: -21.851 bonds (distance) P-C4' energy: -25.104 flat angles C4'-P-C4' energy: -26.358 flat angles P-C4'-P energy: -13.781 tors. eta vs tors. theta energy: -27.337 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -337.181288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.181288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.282408 (E_RNA) where: Base-Base interactions energy: -225.502 where: short stacking energy: -101.744 Base-Backbone interact. energy: -0.689 local terms energy: -111.090563 where: bonds (distance) C4'-P energy: -21.187 bonds (distance) P-C4' energy: -24.551 flat angles C4'-P-C4' energy: -24.007 flat angles P-C4'-P energy: -10.701 tors. eta vs tors. theta energy: -30.645 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -333.040787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.040787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.103823 (E_RNA) where: Base-Base interactions energy: -213.128 where: short stacking energy: -107.079 Base-Backbone interact. energy: -0.138 local terms energy: -119.838052 where: bonds (distance) C4'-P energy: -25.774 bonds (distance) P-C4' energy: -25.290 flat angles C4'-P-C4' energy: -25.241 flat angles P-C4'-P energy: -15.985 tors. eta vs tors. theta energy: -27.548 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -329.920575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.920575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.962541 (E_RNA) where: Base-Base interactions energy: -220.648 where: short stacking energy: -109.256 Base-Backbone interact. energy: -0.339 local terms energy: -108.976070 where: bonds (distance) C4'-P energy: -21.317 bonds (distance) P-C4' energy: -22.660 flat angles C4'-P-C4' energy: -21.420 flat angles P-C4'-P energy: -18.198 tors. eta vs tors. theta energy: -25.381 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -238.827099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.827099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.883863 (E_RNA) where: Base-Base interactions energy: -144.396 where: short stacking energy: -83.448 Base-Backbone interact. energy: -0.264 local terms energy: -94.224029 where: bonds (distance) C4'-P energy: -21.278 bonds (distance) P-C4' energy: -22.836 flat angles C4'-P-C4' energy: -20.916 flat angles P-C4'-P energy: -15.263 tors. eta vs tors. theta energy: -13.930 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -230.367235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.367235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.505800 (E_RNA) where: Base-Base interactions energy: -141.993 where: short stacking energy: -78.293 Base-Backbone interact. energy: -0.351 local terms energy: -88.161239 where: bonds (distance) C4'-P energy: -18.848 bonds (distance) P-C4' energy: -15.447 flat angles C4'-P-C4' energy: -20.599 flat angles P-C4'-P energy: -15.240 tors. eta vs tors. theta energy: -18.027 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -241.945644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.945644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.980473 (E_RNA) where: Base-Base interactions energy: -139.338 where: short stacking energy: -87.184 Base-Backbone interact. energy: -0.153 local terms energy: -102.489106 where: bonds (distance) C4'-P energy: -13.396 bonds (distance) P-C4' energy: -25.229 flat angles C4'-P-C4' energy: -23.943 flat angles P-C4'-P energy: -16.200 tors. eta vs tors. theta energy: -23.721 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -230.602565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.602565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.621996 (E_RNA) where: Base-Base interactions energy: -144.078 where: short stacking energy: -72.770 Base-Backbone interact. energy: -1.838 local terms energy: -84.705104 where: bonds (distance) C4'-P energy: -19.383 bonds (distance) P-C4' energy: -24.228 flat angles C4'-P-C4' energy: -17.577 flat angles P-C4'-P energy: -8.341 tors. eta vs tors. theta energy: -15.175 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -219.284709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.284709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.656630 (E_RNA) where: Base-Base interactions energy: -133.319 where: short stacking energy: -51.893 Base-Backbone interact. energy: 1.330 local terms energy: -87.667670 where: bonds (distance) C4'-P energy: -22.338 bonds (distance) P-C4' energy: -21.575 flat angles C4'-P-C4' energy: -24.020 flat angles P-C4'-P energy: -10.934 tors. eta vs tors. theta energy: -8.800 Dist. restrs. and SS energy: 0.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -373.611592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.611592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.611592 (E_RNA) where: Base-Base interactions energy: -253.792 where: short stacking energy: -116.532 Base-Backbone interact. energy: -1.374 local terms energy: -118.444919 where: bonds (distance) C4'-P energy: -22.584 bonds (distance) P-C4' energy: -25.111 flat angles C4'-P-C4' energy: -25.646 flat angles P-C4'-P energy: -15.947 tors. eta vs tors. theta energy: -29.157 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -351.461214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.461214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.488698 (E_RNA) where: Base-Base interactions energy: -223.881 where: short stacking energy: -109.880 Base-Backbone interact. energy: -1.649 local terms energy: -125.958708 where: bonds (distance) C4'-P energy: -25.887 bonds (distance) P-C4' energy: -23.378 flat angles C4'-P-C4' energy: -25.066 flat angles P-C4'-P energy: -21.238 tors. eta vs tors. theta energy: -30.389 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -346.078613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.078613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.190730 (E_RNA) where: Base-Base interactions energy: -221.102 where: short stacking energy: -104.689 Base-Backbone interact. energy: -3.311 local terms energy: -121.777464 where: bonds (distance) C4'-P energy: -24.572 bonds (distance) P-C4' energy: -19.232 flat angles C4'-P-C4' energy: -26.823 flat angles P-C4'-P energy: -18.664 tors. eta vs tors. theta energy: -32.487 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -332.723801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.723801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.761824 (E_RNA) where: Base-Base interactions energy: -226.045 where: short stacking energy: -102.814 Base-Backbone interact. energy: -0.044 local terms energy: -106.672780 where: bonds (distance) C4'-P energy: -19.624 bonds (distance) P-C4' energy: -23.753 flat angles C4'-P-C4' energy: -23.707 flat angles P-C4'-P energy: -14.821 tors. eta vs tors. theta energy: -24.767 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -317.262697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.262697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.568457 (E_RNA) where: Base-Base interactions energy: -210.828 where: short stacking energy: -91.685 Base-Backbone interact. energy: -0.611 local terms energy: -106.128796 where: bonds (distance) C4'-P energy: -22.778 bonds (distance) P-C4' energy: -21.005 flat angles C4'-P-C4' energy: -28.477 flat angles P-C4'-P energy: -12.385 tors. eta vs tors. theta energy: -21.484 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -239.971932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.971932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.101589 (E_RNA) where: Base-Base interactions energy: -143.680 where: short stacking energy: -76.785 Base-Backbone interact. energy: -0.421 local terms energy: -96.000850 where: bonds (distance) C4'-P energy: -16.690 bonds (distance) P-C4' energy: -24.856 flat angles C4'-P-C4' energy: -24.314 flat angles P-C4'-P energy: -13.982 tors. eta vs tors. theta energy: -16.159 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -220.830684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.830684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.920469 (E_RNA) where: Base-Base interactions energy: -132.057 where: short stacking energy: -82.167 Base-Backbone interact. energy: -0.338 local terms energy: -88.525859 where: bonds (distance) C4'-P energy: -23.545 bonds (distance) P-C4' energy: -14.355 flat angles C4'-P-C4' energy: -16.609 flat angles P-C4'-P energy: -17.690 tors. eta vs tors. theta energy: -16.326 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -234.168036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.168036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.213004 (E_RNA) where: Base-Base interactions energy: -141.562 where: short stacking energy: -80.721 Base-Backbone interact. energy: -0.740 local terms energy: -91.911434 where: bonds (distance) C4'-P energy: -21.771 bonds (distance) P-C4' energy: -12.143 flat angles C4'-P-C4' energy: -20.901 flat angles P-C4'-P energy: -17.257 tors. eta vs tors. theta energy: -19.840 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -206.930116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.930116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.978103 (E_RNA) where: Base-Base interactions energy: -132.890 where: short stacking energy: -67.045 Base-Backbone interact. energy: 1.242 local terms energy: -75.329903 where: bonds (distance) C4'-P energy: -9.341 bonds (distance) P-C4' energy: -27.796 flat angles C4'-P-C4' energy: -19.958 flat angles P-C4'-P energy: -8.437 tors. eta vs tors. theta energy: -9.799 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -209.229305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.229305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.263195 (E_RNA) where: Base-Base interactions energy: -120.867 where: short stacking energy: -69.800 Base-Backbone interact. energy: -0.004 local terms energy: -88.392044 where: bonds (distance) C4'-P energy: -22.629 bonds (distance) P-C4' energy: -20.599 flat angles C4'-P-C4' energy: -19.271 flat angles P-C4'-P energy: -15.105 tors. eta vs tors. theta energy: -10.788 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -368.339273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.339273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.370080 (E_RNA) where: Base-Base interactions energy: -245.303 where: short stacking energy: -106.766 Base-Backbone interact. energy: -0.615 local terms energy: -122.452047 where: bonds (distance) C4'-P energy: -24.911 bonds (distance) P-C4' energy: -26.978 flat angles C4'-P-C4' energy: -25.228 flat angles P-C4'-P energy: -17.783 tors. eta vs tors. theta energy: -27.552 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -355.310921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.310921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.318283 (E_RNA) where: Base-Base interactions energy: -233.927 where: short stacking energy: -126.271 Base-Backbone interact. energy: -0.409 local terms energy: -120.982463 where: bonds (distance) C4'-P energy: -27.697 bonds (distance) P-C4' energy: -25.317 flat angles C4'-P-C4' energy: -23.433 flat angles P-C4'-P energy: -9.536 tors. eta vs tors. theta energy: -35.000 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -347.119212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.119212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.137222 (E_RNA) where: Base-Base interactions energy: -226.017 where: short stacking energy: -108.493 Base-Backbone interact. energy: -0.843 local terms energy: -120.277338 where: bonds (distance) C4'-P energy: -21.238 bonds (distance) P-C4' energy: -22.672 flat angles C4'-P-C4' energy: -28.590 flat angles P-C4'-P energy: -16.188 tors. eta vs tors. theta energy: -31.589 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -332.187380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.187380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.240007 (E_RNA) where: Base-Base interactions energy: -219.715 where: short stacking energy: -106.119 Base-Backbone interact. energy: -0.189 local terms energy: -112.335512 where: bonds (distance) C4'-P energy: -20.544 bonds (distance) P-C4' energy: -23.217 flat angles C4'-P-C4' energy: -24.492 flat angles P-C4'-P energy: -16.233 tors. eta vs tors. theta energy: -27.850 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -329.946196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.946196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.946196 (E_RNA) where: Base-Base interactions energy: -220.384 where: short stacking energy: -96.969 Base-Backbone interact. energy: -1.474 local terms energy: -108.088842 where: bonds (distance) C4'-P energy: -17.623 bonds (distance) P-C4' energy: -24.281 flat angles C4'-P-C4' energy: -23.309 flat angles P-C4'-P energy: -21.267 tors. eta vs tors. theta energy: -21.610 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -245.653726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.653726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.653726 (E_RNA) where: Base-Base interactions energy: -153.683 where: short stacking energy: -85.266 Base-Backbone interact. energy: -0.471 local terms energy: -91.499161 where: bonds (distance) C4'-P energy: -15.652 bonds (distance) P-C4' energy: -26.163 flat angles C4'-P-C4' energy: -21.093 flat angles P-C4'-P energy: -14.220 tors. eta vs tors. theta energy: -14.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -259.148544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.148544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.213594 (E_RNA) where: Base-Base interactions energy: -165.002 where: short stacking energy: -90.641 Base-Backbone interact. energy: -0.424 local terms energy: -93.787979 where: bonds (distance) C4'-P energy: -18.618 bonds (distance) P-C4' energy: -20.554 flat angles C4'-P-C4' energy: -18.622 flat angles P-C4'-P energy: -15.103 tors. eta vs tors. theta energy: -20.891 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -216.579773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.579773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.693843 (E_RNA) where: Base-Base interactions energy: -132.876 where: short stacking energy: -77.767 Base-Backbone interact. energy: -0.044 local terms energy: -83.773839 where: bonds (distance) C4'-P energy: -16.662 bonds (distance) P-C4' energy: -18.649 flat angles C4'-P-C4' energy: -20.693 flat angles P-C4'-P energy: -12.087 tors. eta vs tors. theta energy: -15.682 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -216.744192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.744192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.840894 (E_RNA) where: Base-Base interactions energy: -129.829 where: short stacking energy: -70.946 Base-Backbone interact. energy: -0.754 local terms energy: -86.258133 where: bonds (distance) C4'-P energy: -21.263 bonds (distance) P-C4' energy: -25.142 flat angles C4'-P-C4' energy: -18.144 flat angles P-C4'-P energy: -10.741 tors. eta vs tors. theta energy: -10.968 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -213.599294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.599294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.682660 (E_RNA) where: Base-Base interactions energy: -122.521 where: short stacking energy: -69.457 Base-Backbone interact. energy: -0.069 local terms energy: -91.092717 where: bonds (distance) C4'-P energy: -14.712 bonds (distance) P-C4' energy: -17.466 flat angles C4'-P-C4' energy: -22.406 flat angles P-C4'-P energy: -17.296 tors. eta vs tors. theta energy: -19.212 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -368.989828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.989828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.016812 (E_RNA) where: Base-Base interactions energy: -249.038 where: short stacking energy: -116.944 Base-Backbone interact. energy: -0.059 local terms energy: -119.919481 where: bonds (distance) C4'-P energy: -18.373 bonds (distance) P-C4' energy: -27.232 flat angles C4'-P-C4' energy: -29.354 flat angles P-C4'-P energy: -18.147 tors. eta vs tors. theta energy: -26.814 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -346.345758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.345758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.357738 (E_RNA) where: Base-Base interactions energy: -220.046 where: short stacking energy: -111.551 Base-Backbone interact. energy: -1.016 local terms energy: -125.295802 where: bonds (distance) C4'-P energy: -24.289 bonds (distance) P-C4' energy: -22.851 flat angles C4'-P-C4' energy: -27.721 flat angles P-C4'-P energy: -16.217 tors. eta vs tors. theta energy: -34.218 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -338.514411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.514411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.527600 (E_RNA) where: Base-Base interactions energy: -216.670 where: short stacking energy: -111.550 Base-Backbone interact. energy: -0.186 local terms energy: -121.671664 where: bonds (distance) C4'-P energy: -20.542 bonds (distance) P-C4' energy: -24.697 flat angles C4'-P-C4' energy: -27.700 flat angles P-C4'-P energy: -17.976 tors. eta vs tors. theta energy: -30.756 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -327.155611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.155611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.159296 (E_RNA) where: Base-Base interactions energy: -212.522 where: short stacking energy: -100.862 Base-Backbone interact. energy: 1.750 local terms energy: -116.387132 where: bonds (distance) C4'-P energy: -24.923 bonds (distance) P-C4' energy: -23.768 flat angles C4'-P-C4' energy: -23.810 flat angles P-C4'-P energy: -13.552 tors. eta vs tors. theta energy: -30.333 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -312.699952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.699952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.728604 (E_RNA) where: Base-Base interactions energy: -205.457 where: short stacking energy: -90.621 Base-Backbone interact. energy: -2.606 local terms energy: -104.665822 where: bonds (distance) C4'-P energy: -21.237 bonds (distance) P-C4' energy: -20.216 flat angles C4'-P-C4' energy: -24.158 flat angles P-C4'-P energy: -13.908 tors. eta vs tors. theta energy: -25.146 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -275.495431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.495431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.548956 (E_RNA) where: Base-Base interactions energy: -176.581 where: short stacking energy: -82.037 Base-Backbone interact. energy: -0.149 local terms energy: -98.818610 where: bonds (distance) C4'-P energy: -21.267 bonds (distance) P-C4' energy: -17.770 flat angles C4'-P-C4' energy: -24.513 flat angles P-C4'-P energy: -14.258 tors. eta vs tors. theta energy: -21.011 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -242.127229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.127229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.127229 (E_RNA) where: Base-Base interactions energy: -148.193 where: short stacking energy: -86.947 Base-Backbone interact. energy: -0.466 local terms energy: -93.468566 where: bonds (distance) C4'-P energy: -22.919 bonds (distance) P-C4' energy: -15.898 flat angles C4'-P-C4' energy: -19.707 flat angles P-C4'-P energy: -17.646 tors. eta vs tors. theta energy: -17.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -228.908357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.908357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.908357 (E_RNA) where: Base-Base interactions energy: -133.903 where: short stacking energy: -78.218 Base-Backbone interact. energy: -0.115 local terms energy: -94.890783 where: bonds (distance) C4'-P energy: -25.752 bonds (distance) P-C4' energy: -22.751 flat angles C4'-P-C4' energy: -24.203 flat angles P-C4'-P energy: -8.236 tors. eta vs tors. theta energy: -13.949 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -216.438633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.438633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.502707 (E_RNA) where: Base-Base interactions energy: -129.227 where: short stacking energy: -66.533 Base-Backbone interact. energy: -0.354 local terms energy: -86.921279 where: bonds (distance) C4'-P energy: -18.329 bonds (distance) P-C4' energy: -23.300 flat angles C4'-P-C4' energy: -18.295 flat angles P-C4'-P energy: -17.180 tors. eta vs tors. theta energy: -9.818 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -220.797218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.797218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.106790 (E_RNA) where: Base-Base interactions energy: -126.365 where: short stacking energy: -61.922 Base-Backbone interact. energy: -1.726 local terms energy: -93.016337 where: bonds (distance) C4'-P energy: -22.662 bonds (distance) P-C4' energy: -19.841 flat angles C4'-P-C4' energy: -20.655 flat angles P-C4'-P energy: -14.448 tors. eta vs tors. theta energy: -15.411 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -371.683926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.683926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.765396 (E_RNA) where: Base-Base interactions energy: -252.541 where: short stacking energy: -116.496 Base-Backbone interact. energy: 0.075 local terms energy: -119.298788 where: bonds (distance) C4'-P energy: -19.482 bonds (distance) P-C4' energy: -23.644 flat angles C4'-P-C4' energy: -28.096 flat angles P-C4'-P energy: -21.758 tors. eta vs tors. theta energy: -26.319 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -352.913515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.913515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.913515 (E_RNA) where: Base-Base interactions energy: -226.597 where: short stacking energy: -114.185 Base-Backbone interact. energy: 0.348 local terms energy: -126.663939 where: bonds (distance) C4'-P energy: -25.515 bonds (distance) P-C4' energy: -24.115 flat angles C4'-P-C4' energy: -26.587 flat angles P-C4'-P energy: -17.439 tors. eta vs tors. theta energy: -33.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -331.639790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.639790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.696397 (E_RNA) where: Base-Base interactions energy: -212.520 where: short stacking energy: -111.099 Base-Backbone interact. energy: -0.078 local terms energy: -119.098580 where: bonds (distance) C4'-P energy: -22.975 bonds (distance) P-C4' energy: -24.508 flat angles C4'-P-C4' energy: -27.287 flat angles P-C4'-P energy: -12.406 tors. eta vs tors. theta energy: -31.922 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -342.121355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.121355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.156033 (E_RNA) where: Base-Base interactions energy: -219.937 where: short stacking energy: -107.924 Base-Backbone interact. energy: -1.155 local terms energy: -121.064411 where: bonds (distance) C4'-P energy: -25.300 bonds (distance) P-C4' energy: -26.019 flat angles C4'-P-C4' energy: -28.330 flat angles P-C4'-P energy: -14.079 tors. eta vs tors. theta energy: -27.336 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -333.549285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.549285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.588414 (E_RNA) where: Base-Base interactions energy: -213.884 where: short stacking energy: -106.597 Base-Backbone interact. energy: -0.736 local terms energy: -118.967982 where: bonds (distance) C4'-P energy: -17.234 bonds (distance) P-C4' energy: -27.563 flat angles C4'-P-C4' energy: -25.961 flat angles P-C4'-P energy: -16.826 tors. eta vs tors. theta energy: -31.384 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -271.484678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.484678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.619939 (E_RNA) where: Base-Base interactions energy: -172.241 where: short stacking energy: -82.376 Base-Backbone interact. energy: -0.297 local terms energy: -99.081916 where: bonds (distance) C4'-P energy: -25.953 bonds (distance) P-C4' energy: -20.042 flat angles C4'-P-C4' energy: -17.467 flat angles P-C4'-P energy: -18.275 tors. eta vs tors. theta energy: -17.345 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -220.209151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.209151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.320953 (E_RNA) where: Base-Base interactions energy: -122.609 where: short stacking energy: -76.797 Base-Backbone interact. energy: -0.334 local terms energy: -97.378593 where: bonds (distance) C4'-P energy: -19.355 bonds (distance) P-C4' energy: -27.474 flat angles C4'-P-C4' energy: -22.937 flat angles P-C4'-P energy: -16.315 tors. eta vs tors. theta energy: -11.297 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -226.200079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.200079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.200079 (E_RNA) where: Base-Base interactions energy: -133.471 where: short stacking energy: -77.461 Base-Backbone interact. energy: -0.335 local terms energy: -92.394776 where: bonds (distance) C4'-P energy: -20.780 bonds (distance) P-C4' energy: -21.023 flat angles C4'-P-C4' energy: -18.057 flat angles P-C4'-P energy: -12.672 tors. eta vs tors. theta energy: -19.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -217.022530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.022530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.147637 (E_RNA) where: Base-Base interactions energy: -126.882 where: short stacking energy: -77.008 Base-Backbone interact. energy: -0.030 local terms energy: -90.235519 where: bonds (distance) C4'-P energy: -18.000 bonds (distance) P-C4' energy: -19.442 flat angles C4'-P-C4' energy: -21.769 flat angles P-C4'-P energy: -16.707 tors. eta vs tors. theta energy: -14.317 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -212.812793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.812793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.853599 (E_RNA) where: Base-Base interactions energy: -126.382 where: short stacking energy: -70.856 Base-Backbone interact. energy: -0.473 local terms energy: -85.998993 where: bonds (distance) C4'-P energy: -15.970 bonds (distance) P-C4' energy: -25.183 flat angles C4'-P-C4' energy: -21.067 flat angles P-C4'-P energy: -10.816 tors. eta vs tors. theta energy: -12.963 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -383.835466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.835466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.895665 (E_RNA) where: Base-Base interactions energy: -258.944 where: short stacking energy: -116.652 Base-Backbone interact. energy: 0.565 local terms energy: -125.516698 where: bonds (distance) C4'-P energy: -24.008 bonds (distance) P-C4' energy: -28.594 flat angles C4'-P-C4' energy: -24.490 flat angles P-C4'-P energy: -18.807 tors. eta vs tors. theta energy: -29.617 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -344.250394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.250394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.256806 (E_RNA) where: Base-Base interactions energy: -224.914 where: short stacking energy: -115.600 Base-Backbone interact. energy: -0.104 local terms energy: -119.239498 where: bonds (distance) C4'-P energy: -20.229 bonds (distance) P-C4' energy: -26.324 flat angles C4'-P-C4' energy: -27.993 flat angles P-C4'-P energy: -19.082 tors. eta vs tors. theta energy: -25.612 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -337.432907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.432907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.432907 (E_RNA) where: Base-Base interactions energy: -217.546 where: short stacking energy: -110.085 Base-Backbone interact. energy: -0.401 local terms energy: -119.485484 where: bonds (distance) C4'-P energy: -24.338 bonds (distance) P-C4' energy: -25.285 flat angles C4'-P-C4' energy: -22.729 flat angles P-C4'-P energy: -18.543 tors. eta vs tors. theta energy: -28.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -328.918270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.918270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.087105 (E_RNA) where: Base-Base interactions energy: -217.599 where: short stacking energy: -94.102 Base-Backbone interact. energy: -1.225 local terms energy: -110.262526 where: bonds (distance) C4'-P energy: -18.729 bonds (distance) P-C4' energy: -25.117 flat angles C4'-P-C4' energy: -25.207 flat angles P-C4'-P energy: -18.204 tors. eta vs tors. theta energy: -23.005 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -321.018584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.018584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.019702 (E_RNA) where: Base-Base interactions energy: -203.015 where: short stacking energy: -100.937 Base-Backbone interact. energy: -0.620 local terms energy: -117.383964 where: bonds (distance) C4'-P energy: -24.769 bonds (distance) P-C4' energy: -27.649 flat angles C4'-P-C4' energy: -22.637 flat angles P-C4'-P energy: -10.129 tors. eta vs tors. theta energy: -32.199 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -284.954089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.954089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.032583 (E_RNA) where: Base-Base interactions energy: -183.948 where: short stacking energy: -85.573 Base-Backbone interact. energy: -0.621 local terms energy: -100.463240 where: bonds (distance) C4'-P energy: -19.369 bonds (distance) P-C4' energy: -23.672 flat angles C4'-P-C4' energy: -23.105 flat angles P-C4'-P energy: -12.875 tors. eta vs tors. theta energy: -21.443 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -227.968277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.968277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.991215 (E_RNA) where: Base-Base interactions energy: -141.650 where: short stacking energy: -79.382 Base-Backbone interact. energy: -0.708 local terms energy: -85.633869 where: bonds (distance) C4'-P energy: -20.153 bonds (distance) P-C4' energy: -13.224 flat angles C4'-P-C4' energy: -24.355 flat angles P-C4'-P energy: -9.241 tors. eta vs tors. theta energy: -18.661 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -218.692519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.692519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.758002 (E_RNA) where: Base-Base interactions energy: -128.104 where: short stacking energy: -74.042 Base-Backbone interact. energy: -0.640 local terms energy: -90.014126 where: bonds (distance) C4'-P energy: -15.489 bonds (distance) P-C4' energy: -23.631 flat angles C4'-P-C4' energy: -25.129 flat angles P-C4'-P energy: -11.960 tors. eta vs tors. theta energy: -13.806 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -214.987701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.987701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.020437 (E_RNA) where: Base-Base interactions energy: -136.758 where: short stacking energy: -77.548 Base-Backbone interact. energy: 3.159 local terms energy: -81.420565 where: bonds (distance) C4'-P energy: -21.661 bonds (distance) P-C4' energy: -12.792 flat angles C4'-P-C4' energy: -19.275 flat angles P-C4'-P energy: -11.432 tors. eta vs tors. theta energy: -16.260 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -204.804822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.804822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.804822 (E_RNA) where: Base-Base interactions energy: -115.723 where: short stacking energy: -64.277 Base-Backbone interact. energy: -1.241 local terms energy: -87.840404 where: bonds (distance) C4'-P energy: -21.207 bonds (distance) P-C4' energy: -16.936 flat angles C4'-P-C4' energy: -19.061 flat angles P-C4'-P energy: -17.444 tors. eta vs tors. theta energy: -13.192 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -379.192960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.192960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.243908 (E_RNA) where: Base-Base interactions energy: -256.643 where: short stacking energy: -121.315 Base-Backbone interact. energy: -2.313 local terms energy: -120.287962 where: bonds (distance) C4'-P energy: -21.499 bonds (distance) P-C4' energy: -26.715 flat angles C4'-P-C4' energy: -27.212 flat angles P-C4'-P energy: -14.792 tors. eta vs tors. theta energy: -30.070 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -336.708567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.708567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.853178 (E_RNA) where: Base-Base interactions energy: -227.146 where: short stacking energy: -108.077 Base-Backbone interact. energy: -0.388 local terms energy: -109.319086 where: bonds (distance) C4'-P energy: -19.222 bonds (distance) P-C4' energy: -27.321 flat angles C4'-P-C4' energy: -17.654 flat angles P-C4'-P energy: -17.475 tors. eta vs tors. theta energy: -27.647 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -340.198103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.198103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.342067 (E_RNA) where: Base-Base interactions energy: -228.220 where: short stacking energy: -116.096 Base-Backbone interact. energy: -0.029 local terms energy: -112.093084 where: bonds (distance) C4'-P energy: -24.651 bonds (distance) P-C4' energy: -19.377 flat angles C4'-P-C4' energy: -25.424 flat angles P-C4'-P energy: -13.889 tors. eta vs tors. theta energy: -28.752 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -323.761991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.761991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.761991 (E_RNA) where: Base-Base interactions energy: -204.656 where: short stacking energy: -91.980 Base-Backbone interact. energy: -0.277 local terms energy: -118.829829 where: bonds (distance) C4'-P energy: -25.746 bonds (distance) P-C4' energy: -25.962 flat angles C4'-P-C4' energy: -22.876 flat angles P-C4'-P energy: -20.589 tors. eta vs tors. theta energy: -23.656 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -318.930879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.930879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.981279 (E_RNA) where: Base-Base interactions energy: -208.050 where: short stacking energy: -103.392 Base-Backbone interact. energy: -1.015 local terms energy: -109.916778 where: bonds (distance) C4'-P energy: -21.797 bonds (distance) P-C4' energy: -23.506 flat angles C4'-P-C4' energy: -23.403 flat angles P-C4'-P energy: -12.171 tors. eta vs tors. theta energy: -29.039 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -246.744469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.744469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.053821 (E_RNA) where: Base-Base interactions energy: -146.239 where: short stacking energy: -88.900 Base-Backbone interact. energy: 2.646 local terms energy: -103.461364 where: bonds (distance) C4'-P energy: -22.186 bonds (distance) P-C4' energy: -21.265 flat angles C4'-P-C4' energy: -23.950 flat angles P-C4'-P energy: -12.333 tors. eta vs tors. theta energy: -23.728 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -228.777062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.777062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.464828 (E_RNA) where: Base-Base interactions energy: -131.804 where: short stacking energy: -82.675 Base-Backbone interact. energy: -0.349 local terms energy: -97.311357 where: bonds (distance) C4'-P energy: -21.777 bonds (distance) P-C4' energy: -24.532 flat angles C4'-P-C4' energy: -19.723 flat angles P-C4'-P energy: -10.721 tors. eta vs tors. theta energy: -20.557 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -220.058810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.058810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.092301 (E_RNA) where: Base-Base interactions energy: -122.033 where: short stacking energy: -65.984 Base-Backbone interact. energy: -1.017 local terms energy: -97.041819 where: bonds (distance) C4'-P energy: -24.104 bonds (distance) P-C4' energy: -26.547 flat angles C4'-P-C4' energy: -24.503 flat angles P-C4'-P energy: -8.734 tors. eta vs tors. theta energy: -13.154 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -220.411417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.411417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.467030 (E_RNA) where: Base-Base interactions energy: -130.592 where: short stacking energy: -82.118 Base-Backbone interact. energy: -0.347 local terms energy: -89.528365 where: bonds (distance) C4'-P energy: -16.904 bonds (distance) P-C4' energy: -17.123 flat angles C4'-P-C4' energy: -21.485 flat angles P-C4'-P energy: -16.730 tors. eta vs tors. theta energy: -17.287 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -189.660143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.660143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.769661 (E_RNA) where: Base-Base interactions energy: -108.181 where: short stacking energy: -55.110 Base-Backbone interact. energy: -0.167 local terms energy: -81.422137 where: bonds (distance) C4'-P energy: -22.720 bonds (distance) P-C4' energy: -23.768 flat angles C4'-P-C4' energy: -14.442 flat angles P-C4'-P energy: -10.346 tors. eta vs tors. theta energy: -10.146 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -389.738880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.738880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.792055 (E_RNA) where: Base-Base interactions energy: -275.016 where: short stacking energy: -118.877 Base-Backbone interact. energy: -0.697 local terms energy: -114.078457 where: bonds (distance) C4'-P energy: -19.295 bonds (distance) P-C4' energy: -23.248 flat angles C4'-P-C4' energy: -25.744 flat angles P-C4'-P energy: -16.646 tors. eta vs tors. theta energy: -29.146 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -351.375520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.375520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.375520 (E_RNA) where: Base-Base interactions energy: -229.016 where: short stacking energy: -109.172 Base-Backbone interact. energy: -0.761 local terms energy: -121.598687 where: bonds (distance) C4'-P energy: -23.621 bonds (distance) P-C4' energy: -27.995 flat angles C4'-P-C4' energy: -26.659 flat angles P-C4'-P energy: -18.548 tors. eta vs tors. theta energy: -24.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -336.616968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.616968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.679591 (E_RNA) where: Base-Base interactions energy: -217.326 where: short stacking energy: -108.222 Base-Backbone interact. energy: -0.587 local terms energy: -118.766941 where: bonds (distance) C4'-P energy: -23.290 bonds (distance) P-C4' energy: -20.021 flat angles C4'-P-C4' energy: -25.822 flat angles P-C4'-P energy: -19.560 tors. eta vs tors. theta energy: -30.075 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -336.441352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.441352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.441352 (E_RNA) where: Base-Base interactions energy: -221.276 where: short stacking energy: -108.275 Base-Backbone interact. energy: 0.064 local terms energy: -115.229462 where: bonds (distance) C4'-P energy: -22.209 bonds (distance) P-C4' energy: -23.734 flat angles C4'-P-C4' energy: -25.031 flat angles P-C4'-P energy: -17.828 tors. eta vs tors. theta energy: -26.426 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -323.235193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.235193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.235193 (E_RNA) where: Base-Base interactions energy: -224.954 where: short stacking energy: -106.025 Base-Backbone interact. energy: -0.177 local terms energy: -98.103261 where: bonds (distance) C4'-P energy: -14.914 bonds (distance) P-C4' energy: -21.143 flat angles C4'-P-C4' energy: -14.119 flat angles P-C4'-P energy: -18.653 tors. eta vs tors. theta energy: -29.275 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -239.532115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.532115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.532115 (E_RNA) where: Base-Base interactions energy: -140.633 where: short stacking energy: -85.336 Base-Backbone interact. energy: -0.242 local terms energy: -98.656803 where: bonds (distance) C4'-P energy: -24.281 bonds (distance) P-C4' energy: -24.159 flat angles C4'-P-C4' energy: -15.366 flat angles P-C4'-P energy: -11.691 tors. eta vs tors. theta energy: -23.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -233.136352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.136352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.229202 (E_RNA) where: Base-Base interactions energy: -139.086 where: short stacking energy: -75.257 Base-Backbone interact. energy: -0.805 local terms energy: -93.338049 where: bonds (distance) C4'-P energy: -21.813 bonds (distance) P-C4' energy: -22.570 flat angles C4'-P-C4' energy: -21.754 flat angles P-C4'-P energy: -15.451 tors. eta vs tors. theta energy: -11.750 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -214.114500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.114500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.379281 (E_RNA) where: Base-Base interactions energy: -129.658 where: short stacking energy: -78.778 Base-Backbone interact. energy: -0.065 local terms energy: -84.656236 where: bonds (distance) C4'-P energy: -24.894 bonds (distance) P-C4' energy: -21.742 flat angles C4'-P-C4' energy: -16.511 flat angles P-C4'-P energy: -11.528 tors. eta vs tors. theta energy: -9.981 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -201.498343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.498343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.650914 (E_RNA) where: Base-Base interactions energy: -118.476 where: short stacking energy: -70.653 Base-Backbone interact. energy: -0.581 local terms energy: -82.593428 where: bonds (distance) C4'-P energy: -21.231 bonds (distance) P-C4' energy: -12.747 flat angles C4'-P-C4' energy: -24.373 flat angles P-C4'-P energy: -13.017 tors. eta vs tors. theta energy: -11.226 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -197.819355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.819355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.159872 (E_RNA) where: Base-Base interactions energy: -117.185 where: short stacking energy: -70.586 Base-Backbone interact. energy: -0.114 local terms energy: -80.860594 where: bonds (distance) C4'-P energy: -17.787 bonds (distance) P-C4' energy: -20.859 flat angles C4'-P-C4' energy: -20.927 flat angles P-C4'-P energy: -6.915 tors. eta vs tors. theta energy: -14.373 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -363.487188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.487188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.487188 (E_RNA) where: Base-Base interactions energy: -248.555 where: short stacking energy: -115.454 Base-Backbone interact. energy: -0.292 local terms energy: -114.640093 where: bonds (distance) C4'-P energy: -21.715 bonds (distance) P-C4' energy: -20.018 flat angles C4'-P-C4' energy: -27.632 flat angles P-C4'-P energy: -17.376 tors. eta vs tors. theta energy: -27.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -377.711594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.711594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.743806 (E_RNA) where: Base-Base interactions energy: -264.760 where: short stacking energy: -106.604 Base-Backbone interact. energy: -1.237 local terms energy: -111.747044 where: bonds (distance) C4'-P energy: -23.392 bonds (distance) P-C4' energy: -22.927 flat angles C4'-P-C4' energy: -22.955 flat angles P-C4'-P energy: -15.945 tors. eta vs tors. theta energy: -26.528 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -345.359527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.359527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.372012 (E_RNA) where: Base-Base interactions energy: -233.562 where: short stacking energy: -114.541 Base-Backbone interact. energy: -0.008 local terms energy: -111.802057 where: bonds (distance) C4'-P energy: -21.143 bonds (distance) P-C4' energy: -22.842 flat angles C4'-P-C4' energy: -23.773 flat angles P-C4'-P energy: -14.853 tors. eta vs tors. theta energy: -29.191 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -341.833102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.833102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.862925 (E_RNA) where: Base-Base interactions energy: -233.912 where: short stacking energy: -120.964 Base-Backbone interact. energy: -0.493 local terms energy: -107.458169 where: bonds (distance) C4'-P energy: -19.842 bonds (distance) P-C4' energy: -21.233 flat angles C4'-P-C4' energy: -23.497 flat angles P-C4'-P energy: -13.953 tors. eta vs tors. theta energy: -28.933 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -321.588606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.588606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.589869 (E_RNA) where: Base-Base interactions energy: -211.274 where: short stacking energy: -108.219 Base-Backbone interact. energy: -0.110 local terms energy: -110.205911 where: bonds (distance) C4'-P energy: -15.737 bonds (distance) P-C4' energy: -21.712 flat angles C4'-P-C4' energy: -26.364 flat angles P-C4'-P energy: -16.952 tors. eta vs tors. theta energy: -29.441 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -231.889651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.889651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.889651 (E_RNA) where: Base-Base interactions energy: -139.835 where: short stacking energy: -79.178 Base-Backbone interact. energy: -0.189 local terms energy: -91.865090 where: bonds (distance) C4'-P energy: -21.230 bonds (distance) P-C4' energy: -23.111 flat angles C4'-P-C4' energy: -22.024 flat angles P-C4'-P energy: -13.276 tors. eta vs tors. theta energy: -12.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -225.757837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.757837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.853635 (E_RNA) where: Base-Base interactions energy: -127.380 where: short stacking energy: -74.288 Base-Backbone interact. energy: -0.814 local terms energy: -97.659102 where: bonds (distance) C4'-P energy: -21.260 bonds (distance) P-C4' energy: -19.879 flat angles C4'-P-C4' energy: -25.143 flat angles P-C4'-P energy: -16.261 tors. eta vs tors. theta energy: -15.116 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -219.727304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.727304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.819576 (E_RNA) where: Base-Base interactions energy: -127.286 where: short stacking energy: -77.846 Base-Backbone interact. energy: -0.547 local terms energy: -91.987147 where: bonds (distance) C4'-P energy: -21.375 bonds (distance) P-C4' energy: -23.038 flat angles C4'-P-C4' energy: -20.723 flat angles P-C4'-P energy: -10.281 tors. eta vs tors. theta energy: -16.569 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -197.346135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.346135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.361408 (E_RNA) where: Base-Base interactions energy: -124.999 where: short stacking energy: -55.180 Base-Backbone interact. energy: 0.067 local terms energy: -72.429847 where: bonds (distance) C4'-P energy: -22.150 bonds (distance) P-C4' energy: -22.125 flat angles C4'-P-C4' energy: -15.054 flat angles P-C4'-P energy: -9.681 tors. eta vs tors. theta energy: -3.419 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -201.340326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.340326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.500239 (E_RNA) where: Base-Base interactions energy: -105.737 where: short stacking energy: -67.910 Base-Backbone interact. energy: -0.607 local terms energy: -95.156267 where: bonds (distance) C4'-P energy: -14.536 bonds (distance) P-C4' energy: -24.429 flat angles C4'-P-C4' energy: -27.276 flat angles P-C4'-P energy: -11.724 tors. eta vs tors. theta energy: -17.192 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -363.514999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.514999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.522593 (E_RNA) where: Base-Base interactions energy: -239.152 where: short stacking energy: -111.532 Base-Backbone interact. energy: 1.237 local terms energy: -125.607495 where: bonds (distance) C4'-P energy: -24.261 bonds (distance) P-C4' energy: -24.048 flat angles C4'-P-C4' energy: -25.969 flat angles P-C4'-P energy: -20.963 tors. eta vs tors. theta energy: -30.367 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -361.967809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.967809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.080121 (E_RNA) where: Base-Base interactions energy: -245.159 where: short stacking energy: -113.412 Base-Backbone interact. energy: -0.428 local terms energy: -116.492831 where: bonds (distance) C4'-P energy: -24.489 bonds (distance) P-C4' energy: -24.856 flat angles C4'-P-C4' energy: -21.657 flat angles P-C4'-P energy: -15.474 tors. eta vs tors. theta energy: -30.018 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -338.971093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.971093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.065575 (E_RNA) where: Base-Base interactions energy: -218.377 where: short stacking energy: -109.681 Base-Backbone interact. energy: -0.889 local terms energy: -119.799899 where: bonds (distance) C4'-P energy: -24.293 bonds (distance) P-C4' energy: -24.358 flat angles C4'-P-C4' energy: -28.505 flat angles P-C4'-P energy: -13.022 tors. eta vs tors. theta energy: -29.623 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -342.234943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.234943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.300352 (E_RNA) where: Base-Base interactions energy: -235.738 where: short stacking energy: -107.562 Base-Backbone interact. energy: 2.131 local terms energy: -108.693415 where: bonds (distance) C4'-P energy: -23.181 bonds (distance) P-C4' energy: -22.150 flat angles C4'-P-C4' energy: -24.413 flat angles P-C4'-P energy: -18.279 tors. eta vs tors. theta energy: -20.670 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -319.239210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.239210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.245495 (E_RNA) where: Base-Base interactions energy: -210.952 where: short stacking energy: -100.409 Base-Backbone interact. energy: -0.406 local terms energy: -107.887493 where: bonds (distance) C4'-P energy: -20.955 bonds (distance) P-C4' energy: -25.144 flat angles C4'-P-C4' energy: -25.905 flat angles P-C4'-P energy: -13.254 tors. eta vs tors. theta energy: -22.630 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -293.997153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.997153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.339667 (E_RNA) where: Base-Base interactions energy: -195.467 where: short stacking energy: -84.726 Base-Backbone interact. energy: -0.075 local terms energy: -98.798165 where: bonds (distance) C4'-P energy: -22.376 bonds (distance) P-C4' energy: -20.882 flat angles C4'-P-C4' energy: -19.300 flat angles P-C4'-P energy: -14.737 tors. eta vs tors. theta energy: -21.503 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -228.989558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.989558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.172475 (E_RNA) where: Base-Base interactions energy: -135.474 where: short stacking energy: -75.998 Base-Backbone interact. energy: 0.259 local terms energy: -93.957650 where: bonds (distance) C4'-P energy: -18.603 bonds (distance) P-C4' energy: -19.134 flat angles C4'-P-C4' energy: -25.259 flat angles P-C4'-P energy: -16.660 tors. eta vs tors. theta energy: -14.302 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -224.109615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.109615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.116987 (E_RNA) where: Base-Base interactions energy: -128.275 where: short stacking energy: -75.164 Base-Backbone interact. energy: -0.730 local terms energy: -95.112837 where: bonds (distance) C4'-P energy: -21.512 bonds (distance) P-C4' energy: -16.530 flat angles C4'-P-C4' energy: -23.904 flat angles P-C4'-P energy: -14.272 tors. eta vs tors. theta energy: -18.896 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -217.204982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.204982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.408622 (E_RNA) where: Base-Base interactions energy: -126.013 where: short stacking energy: -67.714 Base-Backbone interact. energy: 2.757 local terms energy: -94.153210 where: bonds (distance) C4'-P energy: -19.511 bonds (distance) P-C4' energy: -24.607 flat angles C4'-P-C4' energy: -25.702 flat angles P-C4'-P energy: -10.982 tors. eta vs tors. theta energy: -13.352 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -212.806324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.806324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.919083 (E_RNA) where: Base-Base interactions energy: -133.762 where: short stacking energy: -74.181 Base-Backbone interact. energy: -0.562 local terms energy: -78.595084 where: bonds (distance) C4'-P energy: -18.386 bonds (distance) P-C4' energy: -19.441 flat angles C4'-P-C4' energy: -17.290 flat angles P-C4'-P energy: -6.031 tors. eta vs tors. theta energy: -17.447 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -392.212402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.212402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.254459 (E_RNA) where: Base-Base interactions energy: -269.386 where: short stacking energy: -117.989 Base-Backbone interact. energy: 0.156 local terms energy: -123.024258 where: bonds (distance) C4'-P energy: -26.380 bonds (distance) P-C4' energy: -25.644 flat angles C4'-P-C4' energy: -26.525 flat angles P-C4'-P energy: -14.354 tors. eta vs tors. theta energy: -30.120 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -357.972385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.972385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.088045 (E_RNA) where: Base-Base interactions energy: -231.568 where: short stacking energy: -105.850 Base-Backbone interact. energy: -0.343 local terms energy: -126.176993 where: bonds (distance) C4'-P energy: -25.880 bonds (distance) P-C4' energy: -27.235 flat angles C4'-P-C4' energy: -26.665 flat angles P-C4'-P energy: -19.945 tors. eta vs tors. theta energy: -26.452 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -336.382201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.382201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.392471 (E_RNA) where: Base-Base interactions energy: -222.718 where: short stacking energy: -101.915 Base-Backbone interact. energy: -0.386 local terms energy: -113.287878 where: bonds (distance) C4'-P energy: -21.542 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -26.423 flat angles P-C4'-P energy: -16.380 tors. eta vs tors. theta energy: -26.136 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -331.632357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.632357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.642849 (E_RNA) where: Base-Base interactions energy: -219.808 where: short stacking energy: -100.938 Base-Backbone interact. energy: -0.902 local terms energy: -110.932301 where: bonds (distance) C4'-P energy: -20.684 bonds (distance) P-C4' energy: -22.270 flat angles C4'-P-C4' energy: -22.687 flat angles P-C4'-P energy: -19.138 tors. eta vs tors. theta energy: -26.153 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -328.237650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.237650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.395204 (E_RNA) where: Base-Base interactions energy: -214.651 where: short stacking energy: -98.722 Base-Backbone interact. energy: -0.643 local terms energy: -113.101560 where: bonds (distance) C4'-P energy: -19.330 bonds (distance) P-C4' energy: -26.078 flat angles C4'-P-C4' energy: -26.084 flat angles P-C4'-P energy: -16.191 tors. eta vs tors. theta energy: -25.418 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -320.150610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.150610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.263267 (E_RNA) where: Base-Base interactions energy: -205.235 where: short stacking energy: -107.664 Base-Backbone interact. energy: -0.377 local terms energy: -114.651432 where: bonds (distance) C4'-P energy: -17.741 bonds (distance) P-C4' energy: -27.396 flat angles C4'-P-C4' energy: -25.366 flat angles P-C4'-P energy: -18.480 tors. eta vs tors. theta energy: -25.668 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -219.195476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.195476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.615314 (E_RNA) where: Base-Base interactions energy: -125.726 where: short stacking energy: -77.333 Base-Backbone interact. energy: -1.184 local terms energy: -92.705563 where: bonds (distance) C4'-P energy: -21.082 bonds (distance) P-C4' energy: -18.486 flat angles C4'-P-C4' energy: -26.150 flat angles P-C4'-P energy: -13.273 tors. eta vs tors. theta energy: -13.714 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -198.019744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.019744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.079758 (E_RNA) where: Base-Base interactions energy: -104.513 where: short stacking energy: -53.682 Base-Backbone interact. energy: -0.256 local terms energy: -93.310839 where: bonds (distance) C4'-P energy: -23.011 bonds (distance) P-C4' energy: -27.897 flat angles C4'-P-C4' energy: -21.644 flat angles P-C4'-P energy: -13.735 tors. eta vs tors. theta energy: -7.023 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -211.169350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.169350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.359108 (E_RNA) where: Base-Base interactions energy: -123.581 where: short stacking energy: -66.234 Base-Backbone interact. energy: -0.754 local terms energy: -87.024508 where: bonds (distance) C4'-P energy: -22.049 bonds (distance) P-C4' energy: -20.865 flat angles C4'-P-C4' energy: -23.199 flat angles P-C4'-P energy: -11.270 tors. eta vs tors. theta energy: -9.642 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -204.567362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.567362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.677477 (E_RNA) where: Base-Base interactions energy: -113.395 where: short stacking energy: -65.430 Base-Backbone interact. energy: -0.343 local terms energy: -90.939119 where: bonds (distance) C4'-P energy: -23.340 bonds (distance) P-C4' energy: -22.476 flat angles C4'-P-C4' energy: -17.439 flat angles P-C4'-P energy: -15.819 tors. eta vs tors. theta energy: -11.865 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -377.155451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.155451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.155451 (E_RNA) where: Base-Base interactions energy: -264.354 where: short stacking energy: -116.515 Base-Backbone interact. energy: -0.413 local terms energy: -112.388102 where: bonds (distance) C4'-P energy: -18.143 bonds (distance) P-C4' energy: -22.313 flat angles C4'-P-C4' energy: -25.604 flat angles P-C4'-P energy: -20.589 tors. eta vs tors. theta energy: -25.739 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -355.177731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.177731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.342135 (E_RNA) where: Base-Base interactions energy: -237.401 where: short stacking energy: -113.527 Base-Backbone interact. energy: -0.469 local terms energy: -117.471481 where: bonds (distance) C4'-P energy: -25.921 bonds (distance) P-C4' energy: -24.204 flat angles C4'-P-C4' energy: -24.270 flat angles P-C4'-P energy: -15.748 tors. eta vs tors. theta energy: -27.329 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -346.027543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.027543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.082549 (E_RNA) where: Base-Base interactions energy: -226.353 where: short stacking energy: -113.699 Base-Backbone interact. energy: -0.294 local terms energy: -119.435443 where: bonds (distance) C4'-P energy: -26.475 bonds (distance) P-C4' energy: -21.920 flat angles C4'-P-C4' energy: -25.667 flat angles P-C4'-P energy: -18.191 tors. eta vs tors. theta energy: -27.182 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -333.119652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.119652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.228657 (E_RNA) where: Base-Base interactions energy: -215.587 where: short stacking energy: -102.196 Base-Backbone interact. energy: -0.707 local terms energy: -116.934400 where: bonds (distance) C4'-P energy: -23.148 bonds (distance) P-C4' energy: -27.309 flat angles C4'-P-C4' energy: -23.933 flat angles P-C4'-P energy: -15.534 tors. eta vs tors. theta energy: -27.011 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -332.979097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.979097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.049769 (E_RNA) where: Base-Base interactions energy: -219.031 where: short stacking energy: -101.822 Base-Backbone interact. energy: -0.802 local terms energy: -113.217023 where: bonds (distance) C4'-P energy: -17.969 bonds (distance) P-C4' energy: -21.898 flat angles C4'-P-C4' energy: -25.606 flat angles P-C4'-P energy: -15.825 tors. eta vs tors. theta energy: -31.919 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -315.611177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.611177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.611177 (E_RNA) where: Base-Base interactions energy: -205.968 where: short stacking energy: -99.477 Base-Backbone interact. energy: -0.051 local terms energy: -109.591363 where: bonds (distance) C4'-P energy: -20.780 bonds (distance) P-C4' energy: -26.175 flat angles C4'-P-C4' energy: -24.038 flat angles P-C4'-P energy: -10.587 tors. eta vs tors. theta energy: -28.012 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -233.446372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.446372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.593798 (E_RNA) where: Base-Base interactions energy: -141.984 where: short stacking energy: -80.866 Base-Backbone interact. energy: -0.186 local terms energy: -91.423326 where: bonds (distance) C4'-P energy: -15.858 bonds (distance) P-C4' energy: -25.465 flat angles C4'-P-C4' energy: -23.494 flat angles P-C4'-P energy: -13.185 tors. eta vs tors. theta energy: -13.421 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -229.011354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.011354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.044943 (E_RNA) where: Base-Base interactions energy: -146.149 where: short stacking energy: -75.120 Base-Backbone interact. energy: 0.611 local terms energy: -83.506961 where: bonds (distance) C4'-P energy: -21.178 bonds (distance) P-C4' energy: -17.681 flat angles C4'-P-C4' energy: -14.705 flat angles P-C4'-P energy: -17.851 tors. eta vs tors. theta energy: -12.092 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -213.078890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.078890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.078890 (E_RNA) where: Base-Base interactions energy: -125.876 where: short stacking energy: -67.029 Base-Backbone interact. energy: 0.771 local terms energy: -87.974337 where: bonds (distance) C4'-P energy: -17.822 bonds (distance) P-C4' energy: -22.928 flat angles C4'-P-C4' energy: -20.126 flat angles P-C4'-P energy: -14.560 tors. eta vs tors. theta energy: -12.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -200.362857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.362857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.478786 (E_RNA) where: Base-Base interactions energy: -120.891 where: short stacking energy: -66.987 Base-Backbone interact. energy: -1.217 local terms energy: -78.371114 where: bonds (distance) C4'-P energy: -22.601 bonds (distance) P-C4' energy: -22.329 flat angles C4'-P-C4' energy: -15.277 flat angles P-C4'-P energy: -5.390 tors. eta vs tors. theta energy: -12.773 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -380.966791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.966791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.993424 (E_RNA) where: Base-Base interactions energy: -267.740 where: short stacking energy: -107.340 Base-Backbone interact. energy: -0.571 local terms energy: -112.682183 where: bonds (distance) C4'-P energy: -21.161 bonds (distance) P-C4' energy: -24.254 flat angles C4'-P-C4' energy: -26.946 flat angles P-C4'-P energy: -17.032 tors. eta vs tors. theta energy: -23.289 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -361.090899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.090899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.105551 (E_RNA) where: Base-Base interactions energy: -232.973 where: short stacking energy: -115.360 Base-Backbone interact. energy: 0.636 local terms energy: -128.768918 where: bonds (distance) C4'-P energy: -23.417 bonds (distance) P-C4' energy: -26.622 flat angles C4'-P-C4' energy: -28.791 flat angles P-C4'-P energy: -16.034 tors. eta vs tors. theta energy: -33.905 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -339.387402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.387402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.837449 (E_RNA) where: Base-Base interactions energy: -226.762 where: short stacking energy: -105.424 Base-Backbone interact. energy: -2.079 local terms energy: -110.997054 where: bonds (distance) C4'-P energy: -27.635 bonds (distance) P-C4' energy: -22.106 flat angles C4'-P-C4' energy: -28.185 flat angles P-C4'-P energy: -11.481 tors. eta vs tors. theta energy: -21.590 Dist. restrs. and SS energy: 0.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -341.819348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.819348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.004863 (E_RNA) where: Base-Base interactions energy: -223.851 where: short stacking energy: -109.883 Base-Backbone interact. energy: -0.424 local terms energy: -117.730571 where: bonds (distance) C4'-P energy: -24.798 bonds (distance) P-C4' energy: -20.705 flat angles C4'-P-C4' energy: -27.220 flat angles P-C4'-P energy: -17.184 tors. eta vs tors. theta energy: -27.823 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -320.570655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.570655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.570655 (E_RNA) where: Base-Base interactions energy: -215.408 where: short stacking energy: -103.528 Base-Backbone interact. energy: -1.693 local terms energy: -103.470463 where: bonds (distance) C4'-P energy: -21.474 bonds (distance) P-C4' energy: -23.532 flat angles C4'-P-C4' energy: -21.672 flat angles P-C4'-P energy: -8.059 tors. eta vs tors. theta energy: -28.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -290.174004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.174004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.254946 (E_RNA) where: Base-Base interactions energy: -192.572 where: short stacking energy: -88.261 Base-Backbone interact. energy: -0.548 local terms energy: -97.135111 where: bonds (distance) C4'-P energy: -21.693 bonds (distance) P-C4' energy: -25.486 flat angles C4'-P-C4' energy: -12.559 flat angles P-C4'-P energy: -15.241 tors. eta vs tors. theta energy: -22.155 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -235.288765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.288765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.365496 (E_RNA) where: Base-Base interactions energy: -147.205 where: short stacking energy: -87.277 Base-Backbone interact. energy: 1.790 local terms energy: -89.950244 where: bonds (distance) C4'-P energy: -17.513 bonds (distance) P-C4' energy: -19.351 flat angles C4'-P-C4' energy: -23.414 flat angles P-C4'-P energy: -15.215 tors. eta vs tors. theta energy: -14.457 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -227.473002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.473002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.653727 (E_RNA) where: Base-Base interactions energy: -135.499 where: short stacking energy: -78.871 Base-Backbone interact. energy: -0.711 local terms energy: -91.443441 where: bonds (distance) C4'-P energy: -19.396 bonds (distance) P-C4' energy: -22.221 flat angles C4'-P-C4' energy: -20.661 flat angles P-C4'-P energy: -13.707 tors. eta vs tors. theta energy: -15.459 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -214.694848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.694848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.740628 (E_RNA) where: Base-Base interactions energy: -134.838 where: short stacking energy: -68.854 Base-Backbone interact. energy: -0.445 local terms energy: -79.458359 where: bonds (distance) C4'-P energy: -24.152 bonds (distance) P-C4' energy: -16.781 flat angles C4'-P-C4' energy: -18.324 flat angles P-C4'-P energy: -10.801 tors. eta vs tors. theta energy: -9.400 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -200.445085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.445085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.510694 (E_RNA) where: Base-Base interactions energy: -122.723 where: short stacking energy: -64.135 Base-Backbone interact. energy: 4.390 local terms energy: -82.177454 where: bonds (distance) C4'-P energy: -21.381 bonds (distance) P-C4' energy: -17.492 flat angles C4'-P-C4' energy: -19.312 flat angles P-C4'-P energy: -13.988 tors. eta vs tors. theta energy: -10.003 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -383.673840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.673840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.713679 (E_RNA) where: Base-Base interactions energy: -266.369 where: short stacking energy: -112.695 Base-Backbone interact. energy: -0.618 local terms energy: -116.726533 where: bonds (distance) C4'-P energy: -25.404 bonds (distance) P-C4' energy: -24.368 flat angles C4'-P-C4' energy: -23.515 flat angles P-C4'-P energy: -14.997 tors. eta vs tors. theta energy: -28.443 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -354.749296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.749296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.827919 (E_RNA) where: Base-Base interactions energy: -236.230 where: short stacking energy: -123.445 Base-Backbone interact. energy: -0.003 local terms energy: -118.595059 where: bonds (distance) C4'-P energy: -19.277 bonds (distance) P-C4' energy: -23.162 flat angles C4'-P-C4' energy: -25.386 flat angles P-C4'-P energy: -18.260 tors. eta vs tors. theta energy: -32.509 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -357.391425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.391425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.411310 (E_RNA) where: Base-Base interactions energy: -238.042 where: short stacking energy: -122.955 Base-Backbone interact. energy: -2.351 local terms energy: -117.017711 where: bonds (distance) C4'-P energy: -24.066 bonds (distance) P-C4' energy: -20.771 flat angles C4'-P-C4' energy: -29.021 flat angles P-C4'-P energy: -18.396 tors. eta vs tors. theta energy: -24.764 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -347.638639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.638639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.841153 (E_RNA) where: Base-Base interactions energy: -244.490 where: short stacking energy: -125.478 Base-Backbone interact. energy: 5.655 local terms energy: -109.005343 where: bonds (distance) C4'-P energy: -22.020 bonds (distance) P-C4' energy: -16.438 flat angles C4'-P-C4' energy: -24.818 flat angles P-C4'-P energy: -15.522 tors. eta vs tors. theta energy: -30.208 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -333.983864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.983864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.072685 (E_RNA) where: Base-Base interactions energy: -214.426 where: short stacking energy: -108.094 Base-Backbone interact. energy: -1.185 local terms energy: -118.461925 where: bonds (distance) C4'-P energy: -15.389 bonds (distance) P-C4' energy: -22.227 flat angles C4'-P-C4' energy: -29.021 flat angles P-C4'-P energy: -18.581 tors. eta vs tors. theta energy: -33.243 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -314.369193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.369193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.400012 (E_RNA) where: Base-Base interactions energy: -212.535 where: short stacking energy: -99.595 Base-Backbone interact. energy: -1.811 local terms energy: -100.053592 where: bonds (distance) C4'-P energy: -23.435 bonds (distance) P-C4' energy: -16.387 flat angles C4'-P-C4' energy: -19.536 flat angles P-C4'-P energy: -16.190 tors. eta vs tors. theta energy: -24.505 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -240.138287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.138287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.390256 (E_RNA) where: Base-Base interactions energy: -131.238 where: short stacking energy: -72.920 Base-Backbone interact. energy: -0.727 local terms energy: -108.424732 where: bonds (distance) C4'-P energy: -23.078 bonds (distance) P-C4' energy: -22.828 flat angles C4'-P-C4' energy: -26.067 flat angles P-C4'-P energy: -17.533 tors. eta vs tors. theta energy: -18.919 Dist. restrs. and SS energy: 0.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -219.939934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.939934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.006228 (E_RNA) where: Base-Base interactions energy: -139.382 where: short stacking energy: -76.262 Base-Backbone interact. energy: 0.503 local terms energy: -81.127193 where: bonds (distance) C4'-P energy: -15.970 bonds (distance) P-C4' energy: -22.642 flat angles C4'-P-C4' energy: -17.885 flat angles P-C4'-P energy: -12.733 tors. eta vs tors. theta energy: -11.897 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -188.982061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.982061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.275885 (E_RNA) where: Base-Base interactions energy: -110.839 where: short stacking energy: -66.778 Base-Backbone interact. energy: -0.645 local terms energy: -77.792703 where: bonds (distance) C4'-P energy: -19.338 bonds (distance) P-C4' energy: -22.546 flat angles C4'-P-C4' energy: -22.170 flat angles P-C4'-P energy: -0.038 tors. eta vs tors. theta energy: -13.701 Dist. restrs. and SS energy: 0.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -193.200319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.200319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.332280 (E_RNA) where: Base-Base interactions energy: -115.601 where: short stacking energy: -63.706 Base-Backbone interact. energy: -0.197 local terms energy: -77.534529 where: bonds (distance) C4'-P energy: -19.107 bonds (distance) P-C4' energy: -13.542 flat angles C4'-P-C4' energy: -23.783 flat angles P-C4'-P energy: -12.770 tors. eta vs tors. theta energy: -8.332 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -377.522649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.522649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.555115 (E_RNA) where: Base-Base interactions energy: -262.416 where: short stacking energy: -109.303 Base-Backbone interact. energy: -0.979 local terms energy: -114.159874 where: bonds (distance) C4'-P energy: -26.106 bonds (distance) P-C4' energy: -21.893 flat angles C4'-P-C4' energy: -24.540 flat angles P-C4'-P energy: -13.948 tors. eta vs tors. theta energy: -27.673 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -345.881384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.881384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.907230 (E_RNA) where: Base-Base interactions energy: -220.748 where: short stacking energy: -109.103 Base-Backbone interact. energy: -0.055 local terms energy: -125.103931 where: bonds (distance) C4'-P energy: -24.995 bonds (distance) P-C4' energy: -25.440 flat angles C4'-P-C4' energy: -28.104 flat angles P-C4'-P energy: -15.137 tors. eta vs tors. theta energy: -31.429 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -354.481107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.481107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.513770 (E_RNA) where: Base-Base interactions energy: -233.001 where: short stacking energy: -112.937 Base-Backbone interact. energy: -2.194 local terms energy: -119.319179 where: bonds (distance) C4'-P energy: -23.696 bonds (distance) P-C4' energy: -25.242 flat angles C4'-P-C4' energy: -26.332 flat angles P-C4'-P energy: -16.479 tors. eta vs tors. theta energy: -27.569 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -336.735994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.735994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.830175 (E_RNA) where: Base-Base interactions energy: -218.294 where: short stacking energy: -113.058 Base-Backbone interact. energy: -0.204 local terms energy: -118.331417 where: bonds (distance) C4'-P energy: -21.851 bonds (distance) P-C4' energy: -22.538 flat angles C4'-P-C4' energy: -28.904 flat angles P-C4'-P energy: -19.595 tors. eta vs tors. theta energy: -25.444 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -323.748581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.748581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.748581 (E_RNA) where: Base-Base interactions energy: -208.754 where: short stacking energy: -97.772 Base-Backbone interact. energy: 1.427 local terms energy: -116.421347 where: bonds (distance) C4'-P energy: -25.178 bonds (distance) P-C4' energy: -26.718 flat angles C4'-P-C4' energy: -24.924 flat angles P-C4'-P energy: -14.905 tors. eta vs tors. theta energy: -24.696 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -327.213671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.213671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.213671 (E_RNA) where: Base-Base interactions energy: -213.297 where: short stacking energy: -96.715 Base-Backbone interact. energy: -0.234 local terms energy: -113.683052 where: bonds (distance) C4'-P energy: -29.348 bonds (distance) P-C4' energy: -19.517 flat angles C4'-P-C4' energy: -24.033 flat angles P-C4'-P energy: -12.889 tors. eta vs tors. theta energy: -27.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -272.516032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.516032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.538565 (E_RNA) where: Base-Base interactions energy: -171.986 where: short stacking energy: -82.212 Base-Backbone interact. energy: -0.367 local terms energy: -100.185668 where: bonds (distance) C4'-P energy: -23.748 bonds (distance) P-C4' energy: -24.127 flat angles C4'-P-C4' energy: -22.521 flat angles P-C4'-P energy: -11.162 tors. eta vs tors. theta energy: -18.628 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -214.698997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.698997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.805105 (E_RNA) where: Base-Base interactions energy: -134.128 where: short stacking energy: -83.306 Base-Backbone interact. energy: 1.083 local terms energy: -81.759770 where: bonds (distance) C4'-P energy: -18.337 bonds (distance) P-C4' energy: -23.847 flat angles C4'-P-C4' energy: -16.886 flat angles P-C4'-P energy: -8.719 tors. eta vs tors. theta energy: -13.972 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -198.320196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.320196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.345172 (E_RNA) where: Base-Base interactions energy: -106.109 where: short stacking energy: -58.090 Base-Backbone interact. energy: 0.184 local terms energy: -92.419840 where: bonds (distance) C4'-P energy: -21.249 bonds (distance) P-C4' energy: -21.336 flat angles C4'-P-C4' energy: -20.576 flat angles P-C4'-P energy: -19.293 tors. eta vs tors. theta energy: -9.966 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -197.731094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.731094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.835057 (E_RNA) where: Base-Base interactions energy: -103.541 where: short stacking energy: -55.634 Base-Backbone interact. energy: -0.618 local terms energy: -93.676559 where: bonds (distance) C4'-P energy: -22.746 bonds (distance) P-C4' energy: -18.817 flat angles C4'-P-C4' energy: -22.872 flat angles P-C4'-P energy: -16.176 tors. eta vs tors. theta energy: -13.067 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -361.392090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.392090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.449960 (E_RNA) where: Base-Base interactions energy: -253.805 where: short stacking energy: -109.503 Base-Backbone interact. energy: -0.229 local terms energy: -107.416412 where: bonds (distance) C4'-P energy: -24.422 bonds (distance) P-C4' energy: -20.256 flat angles C4'-P-C4' energy: -25.537 flat angles P-C4'-P energy: -9.729 tors. eta vs tors. theta energy: -27.471 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -349.209583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.209583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.244775 (E_RNA) where: Base-Base interactions energy: -235.380 where: short stacking energy: -115.293 Base-Backbone interact. energy: -0.860 local terms energy: -113.004815 where: bonds (distance) C4'-P energy: -22.917 bonds (distance) P-C4' energy: -17.304 flat angles C4'-P-C4' energy: -25.207 flat angles P-C4'-P energy: -20.957 tors. eta vs tors. theta energy: -26.619 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -341.484314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.484314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.556545 (E_RNA) where: Base-Base interactions energy: -223.491 where: short stacking energy: -111.155 Base-Backbone interact. energy: -0.958 local terms energy: -117.107456 where: bonds (distance) C4'-P energy: -24.611 bonds (distance) P-C4' energy: -18.981 flat angles C4'-P-C4' energy: -22.907 flat angles P-C4'-P energy: -18.240 tors. eta vs tors. theta energy: -32.369 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -361.795407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.795407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.846571 (E_RNA) where: Base-Base interactions energy: -243.200 where: short stacking energy: -115.528 Base-Backbone interact. energy: -0.126 local terms energy: -118.520317 where: bonds (distance) C4'-P energy: -25.411 bonds (distance) P-C4' energy: -20.196 flat angles C4'-P-C4' energy: -26.814 flat angles P-C4'-P energy: -17.822 tors. eta vs tors. theta energy: -28.278 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -328.511189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.511189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.860386 (E_RNA) where: Base-Base interactions energy: -215.113 where: short stacking energy: -104.748 Base-Backbone interact. energy: 0.311 local terms energy: -114.058531 where: bonds (distance) C4'-P energy: -22.099 bonds (distance) P-C4' energy: -24.688 flat angles C4'-P-C4' energy: -22.241 flat angles P-C4'-P energy: -15.160 tors. eta vs tors. theta energy: -29.870 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -279.294272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.294272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.384016 (E_RNA) where: Base-Base interactions energy: -176.347 where: short stacking energy: -97.884 Base-Backbone interact. energy: -0.227 local terms energy: -102.810293 where: bonds (distance) C4'-P energy: -23.428 bonds (distance) P-C4' energy: -18.281 flat angles C4'-P-C4' energy: -26.490 flat angles P-C4'-P energy: -9.496 tors. eta vs tors. theta energy: -25.115 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -319.545721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.545721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.554477 (E_RNA) where: Base-Base interactions energy: -219.035 where: short stacking energy: -109.693 Base-Backbone interact. energy: -0.445 local terms energy: -100.075087 where: bonds (distance) C4'-P energy: -18.336 bonds (distance) P-C4' energy: -23.241 flat angles C4'-P-C4' energy: -21.236 flat angles P-C4'-P energy: -13.273 tors. eta vs tors. theta energy: -23.989 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -226.867176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.867176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.930579 (E_RNA) where: Base-Base interactions energy: -128.131 where: short stacking energy: -73.173 Base-Backbone interact. energy: -0.251 local terms energy: -98.548945 where: bonds (distance) C4'-P energy: -24.629 bonds (distance) P-C4' energy: -20.912 flat angles C4'-P-C4' energy: -23.586 flat angles P-C4'-P energy: -14.280 tors. eta vs tors. theta energy: -15.143 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -196.926706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.926706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.176005 (E_RNA) where: Base-Base interactions energy: -118.428 where: short stacking energy: -56.088 Base-Backbone interact. energy: -0.408 local terms energy: -78.340155 where: bonds (distance) C4'-P energy: -20.845 bonds (distance) P-C4' energy: -13.688 flat angles C4'-P-C4' energy: -23.435 flat angles P-C4'-P energy: -12.700 tors. eta vs tors. theta energy: -7.672 Dist. restrs. and SS energy: 0.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -213.930118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.930118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.938956 (E_RNA) where: Base-Base interactions energy: -130.346 where: short stacking energy: -76.820 Base-Backbone interact. energy: -0.242 local terms energy: -83.350597 where: bonds (distance) C4'-P energy: -17.649 bonds (distance) P-C4' energy: -16.143 flat angles C4'-P-C4' energy: -25.134 flat angles P-C4'-P energy: -14.214 tors. eta vs tors. theta energy: -10.211 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -371.344467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.344467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.344467 (E_RNA) where: Base-Base interactions energy: -250.308 where: short stacking energy: -113.221 Base-Backbone interact. energy: -2.062 local terms energy: -118.975302 where: bonds (distance) C4'-P energy: -27.105 bonds (distance) P-C4' energy: -20.655 flat angles C4'-P-C4' energy: -28.347 flat angles P-C4'-P energy: -13.666 tors. eta vs tors. theta energy: -29.203 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -354.859566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.859566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.999297 (E_RNA) where: Base-Base interactions energy: -236.341 where: short stacking energy: -118.128 Base-Backbone interact. energy: -1.133 local terms energy: -117.525182 where: bonds (distance) C4'-P energy: -22.231 bonds (distance) P-C4' energy: -23.219 flat angles C4'-P-C4' energy: -27.134 flat angles P-C4'-P energy: -13.627 tors. eta vs tors. theta energy: -31.314 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -341.048347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.048347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.053912 (E_RNA) where: Base-Base interactions energy: -220.048 where: short stacking energy: -100.468 Base-Backbone interact. energy: -1.274 local terms energy: -119.732600 where: bonds (distance) C4'-P energy: -24.483 bonds (distance) P-C4' energy: -25.838 flat angles C4'-P-C4' energy: -28.493 flat angles P-C4'-P energy: -15.885 tors. eta vs tors. theta energy: -25.034 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -328.410499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.410499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.416136 (E_RNA) where: Base-Base interactions energy: -217.697 where: short stacking energy: -108.370 Base-Backbone interact. energy: -1.186 local terms energy: -109.532344 where: bonds (distance) C4'-P energy: -17.960 bonds (distance) P-C4' energy: -28.702 flat angles C4'-P-C4' energy: -24.632 flat angles P-C4'-P energy: -13.725 tors. eta vs tors. theta energy: -24.514 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -247.223676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.223676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.285789 (E_RNA) where: Base-Base interactions energy: -142.769 where: short stacking energy: -87.206 Base-Backbone interact. energy: 1.012 local terms energy: -105.529155 where: bonds (distance) C4'-P energy: -24.815 bonds (distance) P-C4' energy: -26.015 flat angles C4'-P-C4' energy: -26.982 flat angles P-C4'-P energy: -11.864 tors. eta vs tors. theta energy: -15.853 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -330.035831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.035831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.157054 (E_RNA) where: Base-Base interactions energy: -216.779 where: short stacking energy: -101.728 Base-Backbone interact. energy: -2.196 local terms energy: -111.181855 where: bonds (distance) C4'-P energy: -26.608 bonds (distance) P-C4' energy: -21.966 flat angles C4'-P-C4' energy: -18.083 flat angles P-C4'-P energy: -19.748 tors. eta vs tors. theta energy: -24.777 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -324.264257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.264257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.373559 (E_RNA) where: Base-Base interactions energy: -215.948 where: short stacking energy: -109.484 Base-Backbone interact. energy: -0.538 local terms energy: -107.888056 where: bonds (distance) C4'-P energy: -20.103 bonds (distance) P-C4' energy: -23.863 flat angles C4'-P-C4' energy: -23.188 flat angles P-C4'-P energy: -15.515 tors. eta vs tors. theta energy: -25.220 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -219.116228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.116228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.116228 (E_RNA) where: Base-Base interactions energy: -125.506 where: short stacking energy: -68.411 Base-Backbone interact. energy: -0.123 local terms energy: -93.487300 where: bonds (distance) C4'-P energy: -23.470 bonds (distance) P-C4' energy: -21.694 flat angles C4'-P-C4' energy: -20.788 flat angles P-C4'-P energy: -14.425 tors. eta vs tors. theta energy: -13.110 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -212.320742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.320742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.365611 (E_RNA) where: Base-Base interactions energy: -115.139 where: short stacking energy: -62.640 Base-Backbone interact. energy: 1.419 local terms energy: -98.646079 where: bonds (distance) C4'-P energy: -21.596 bonds (distance) P-C4' energy: -25.720 flat angles C4'-P-C4' energy: -21.453 flat angles P-C4'-P energy: -15.747 tors. eta vs tors. theta energy: -14.129 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -203.002119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.002119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.485075 (E_RNA) where: Base-Base interactions energy: -121.362 where: short stacking energy: -66.088 Base-Backbone interact. energy: -0.730 local terms energy: -81.393003 where: bonds (distance) C4'-P energy: -22.570 bonds (distance) P-C4' energy: -20.149 flat angles C4'-P-C4' energy: -20.837 flat angles P-C4'-P energy: -12.404 tors. eta vs tors. theta energy: -5.433 Dist. restrs. and SS energy: 0.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -371.161221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.161221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.257232 (E_RNA) where: Base-Base interactions energy: -254.855 where: short stacking energy: -119.280 Base-Backbone interact. energy: -0.377 local terms energy: -116.025656 where: bonds (distance) C4'-P energy: -24.340 bonds (distance) P-C4' energy: -20.838 flat angles C4'-P-C4' energy: -27.485 flat angles P-C4'-P energy: -12.830 tors. eta vs tors. theta energy: -30.532 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -359.058696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.058696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.302306 (E_RNA) where: Base-Base interactions energy: -244.008 where: short stacking energy: -119.479 Base-Backbone interact. energy: 1.719 local terms energy: -117.013426 where: bonds (distance) C4'-P energy: -22.008 bonds (distance) P-C4' energy: -26.885 flat angles C4'-P-C4' energy: -22.974 flat angles P-C4'-P energy: -17.726 tors. eta vs tors. theta energy: -27.420 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -360.633695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.633695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.661546 (E_RNA) where: Base-Base interactions energy: -245.479 where: short stacking energy: -119.759 Base-Backbone interact. energy: -0.605 local terms energy: -114.577664 where: bonds (distance) C4'-P energy: -19.361 bonds (distance) P-C4' energy: -23.834 flat angles C4'-P-C4' energy: -22.513 flat angles P-C4'-P energy: -16.168 tors. eta vs tors. theta energy: -32.701 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -282.476609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.476609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.516907 (E_RNA) where: Base-Base interactions energy: -175.998 where: short stacking energy: -98.064 Base-Backbone interact. energy: -0.340 local terms energy: -106.179097 where: bonds (distance) C4'-P energy: -20.905 bonds (distance) P-C4' energy: -20.445 flat angles C4'-P-C4' energy: -26.442 flat angles P-C4'-P energy: -15.400 tors. eta vs tors. theta energy: -22.986 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -251.820467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.820467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.877037 (E_RNA) where: Base-Base interactions energy: -149.803 where: short stacking energy: -90.591 Base-Backbone interact. energy: -0.461 local terms energy: -101.613292 where: bonds (distance) C4'-P energy: -22.720 bonds (distance) P-C4' energy: -25.195 flat angles C4'-P-C4' energy: -20.999 flat angles P-C4'-P energy: -12.919 tors. eta vs tors. theta energy: -19.781 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -314.648564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.648564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.713160 (E_RNA) where: Base-Base interactions energy: -205.929 where: short stacking energy: -90.954 Base-Backbone interact. energy: -0.926 local terms energy: -107.858180 where: bonds (distance) C4'-P energy: -21.369 bonds (distance) P-C4' energy: -21.744 flat angles C4'-P-C4' energy: -23.969 flat angles P-C4'-P energy: -14.961 tors. eta vs tors. theta energy: -25.814 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -321.572872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.572872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.628732 (E_RNA) where: Base-Base interactions energy: -212.938 where: short stacking energy: -103.290 Base-Backbone interact. energy: -0.207 local terms energy: -108.483453 where: bonds (distance) C4'-P energy: -19.987 bonds (distance) P-C4' energy: -26.020 flat angles C4'-P-C4' energy: -22.016 flat angles P-C4'-P energy: -15.604 tors. eta vs tors. theta energy: -24.857 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -214.340561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.340561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.695214 (E_RNA) where: Base-Base interactions energy: -131.456 where: short stacking energy: -79.950 Base-Backbone interact. energy: -0.069 local terms energy: -83.170157 where: bonds (distance) C4'-P energy: -9.559 bonds (distance) P-C4' energy: -24.043 flat angles C4'-P-C4' energy: -16.814 flat angles P-C4'-P energy: -12.918 tors. eta vs tors. theta energy: -19.837 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -197.802680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.802680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.900975 (E_RNA) where: Base-Base interactions energy: -115.923 where: short stacking energy: -58.916 Base-Backbone interact. energy: -0.512 local terms energy: -81.465505 where: bonds (distance) C4'-P energy: -19.075 bonds (distance) P-C4' energy: -19.985 flat angles C4'-P-C4' energy: -18.518 flat angles P-C4'-P energy: -13.123 tors. eta vs tors. theta energy: -10.765 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -208.024318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.024318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.218727 (E_RNA) where: Base-Base interactions energy: -124.282 where: short stacking energy: -73.506 Base-Backbone interact. energy: -0.672 local terms energy: -83.264443 where: bonds (distance) C4'-P energy: -20.513 bonds (distance) P-C4' energy: -19.563 flat angles C4'-P-C4' energy: -19.021 flat angles P-C4'-P energy: -13.622 tors. eta vs tors. theta energy: -10.545 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -365.486351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.486351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.486351 (E_RNA) where: Base-Base interactions energy: -240.925 where: short stacking energy: -115.141 Base-Backbone interact. energy: -0.794 local terms energy: -123.767656 where: bonds (distance) C4'-P energy: -25.596 bonds (distance) P-C4' energy: -25.364 flat angles C4'-P-C4' energy: -23.927 flat angles P-C4'-P energy: -18.182 tors. eta vs tors. theta energy: -30.699 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -366.161735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.161735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.161735 (E_RNA) where: Base-Base interactions energy: -241.535 where: short stacking energy: -120.218 Base-Backbone interact. energy: -1.029 local terms energy: -123.597665 where: bonds (distance) C4'-P energy: -22.741 bonds (distance) P-C4' energy: -27.117 flat angles C4'-P-C4' energy: -25.041 flat angles P-C4'-P energy: -16.744 tors. eta vs tors. theta energy: -31.955 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -356.510962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.510962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.510962 (E_RNA) where: Base-Base interactions energy: -239.754 where: short stacking energy: -118.092 Base-Backbone interact. energy: 0.287 local terms energy: -117.044181 where: bonds (distance) C4'-P energy: -22.134 bonds (distance) P-C4' energy: -25.569 flat angles C4'-P-C4' energy: -25.255 flat angles P-C4'-P energy: -16.789 tors. eta vs tors. theta energy: -27.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -258.556514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.556514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.571310 (E_RNA) where: Base-Base interactions energy: -152.384 where: short stacking energy: -91.147 Base-Backbone interact. energy: 0.958 local terms energy: -107.145247 where: bonds (distance) C4'-P energy: -22.360 bonds (distance) P-C4' energy: -25.747 flat angles C4'-P-C4' energy: -28.607 flat angles P-C4'-P energy: -11.201 tors. eta vs tors. theta energy: -19.230 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -327.353594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.353594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.353594 (E_RNA) where: Base-Base interactions energy: -218.412 where: short stacking energy: -98.029 Base-Backbone interact. energy: -0.530 local terms energy: -108.411283 where: bonds (distance) C4'-P energy: -21.501 bonds (distance) P-C4' energy: -21.757 flat angles C4'-P-C4' energy: -26.983 flat angles P-C4'-P energy: -16.637 tors. eta vs tors. theta energy: -21.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -236.596342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.596342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.602687 (E_RNA) where: Base-Base interactions energy: -123.777 where: short stacking energy: -74.381 Base-Backbone interact. energy: -0.140 local terms energy: -112.685124 where: bonds (distance) C4'-P energy: -25.101 bonds (distance) P-C4' energy: -25.560 flat angles C4'-P-C4' energy: -22.696 flat angles P-C4'-P energy: -19.243 tors. eta vs tors. theta energy: -20.086 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -302.103497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.103497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.143977 (E_RNA) where: Base-Base interactions energy: -205.328 where: short stacking energy: -97.011 Base-Backbone interact. energy: -1.054 local terms energy: -95.762204 where: bonds (distance) C4'-P energy: -17.308 bonds (distance) P-C4' energy: -15.857 flat angles C4'-P-C4' energy: -24.727 flat angles P-C4'-P energy: -14.908 tors. eta vs tors. theta energy: -22.962 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -213.416094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.416094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.782843 (E_RNA) where: Base-Base interactions energy: -122.980 where: short stacking energy: -60.805 Base-Backbone interact. energy: -0.843 local terms energy: -89.959933 where: bonds (distance) C4'-P energy: -19.602 bonds (distance) P-C4' energy: -21.531 flat angles C4'-P-C4' energy: -21.746 flat angles P-C4'-P energy: -18.185 tors. eta vs tors. theta energy: -8.897 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -206.860791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.860791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.886121 (E_RNA) where: Base-Base interactions energy: -128.300 where: short stacking energy: -67.738 Base-Backbone interact. energy: -1.099 local terms energy: -77.487118 where: bonds (distance) C4'-P energy: -15.549 bonds (distance) P-C4' energy: -11.569 flat angles C4'-P-C4' energy: -24.051 flat angles P-C4'-P energy: -13.135 tors. eta vs tors. theta energy: -13.183 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -220.283413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.283413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.286244 (E_RNA) where: Base-Base interactions energy: -128.744 where: short stacking energy: -63.122 Base-Backbone interact. energy: -0.838 local terms energy: -90.704927 where: bonds (distance) C4'-P energy: -20.187 bonds (distance) P-C4' energy: -19.796 flat angles C4'-P-C4' energy: -21.822 flat angles P-C4'-P energy: -14.148 tors. eta vs tors. theta energy: -14.753 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -367.029046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.029046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.047385 (E_RNA) where: Base-Base interactions energy: -245.978 where: short stacking energy: -111.669 Base-Backbone interact. energy: -0.453 local terms energy: -120.616073 where: bonds (distance) C4'-P energy: -26.396 bonds (distance) P-C4' energy: -25.239 flat angles C4'-P-C4' energy: -27.545 flat angles P-C4'-P energy: -17.818 tors. eta vs tors. theta energy: -23.617 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -360.565898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.565898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.619410 (E_RNA) where: Base-Base interactions energy: -238.988 where: short stacking energy: -114.430 Base-Backbone interact. energy: -0.782 local terms energy: -120.849031 where: bonds (distance) C4'-P energy: -25.378 bonds (distance) P-C4' energy: -21.262 flat angles C4'-P-C4' energy: -27.604 flat angles P-C4'-P energy: -20.235 tors. eta vs tors. theta energy: -26.370 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -362.437373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.437373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.459764 (E_RNA) where: Base-Base interactions energy: -239.539 where: short stacking energy: -110.812 Base-Backbone interact. energy: -0.630 local terms energy: -122.291657 where: bonds (distance) C4'-P energy: -22.056 bonds (distance) P-C4' energy: -26.584 flat angles C4'-P-C4' energy: -23.786 flat angles P-C4'-P energy: -20.150 tors. eta vs tors. theta energy: -29.716 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -344.384716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.384716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.384716 (E_RNA) where: Base-Base interactions energy: -232.927 where: short stacking energy: -113.772 Base-Backbone interact. energy: -0.126 local terms energy: -111.332122 where: bonds (distance) C4'-P energy: -21.300 bonds (distance) P-C4' energy: -24.218 flat angles C4'-P-C4' energy: -24.611 flat angles P-C4'-P energy: -15.329 tors. eta vs tors. theta energy: -25.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -252.274367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.274367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.428773 (E_RNA) where: Base-Base interactions energy: -149.328 where: short stacking energy: -90.176 Base-Backbone interact. energy: -0.506 local terms energy: -102.594390 where: bonds (distance) C4'-P energy: -25.274 bonds (distance) P-C4' energy: -22.793 flat angles C4'-P-C4' energy: -20.813 flat angles P-C4'-P energy: -17.889 tors. eta vs tors. theta energy: -15.824 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -336.457392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.457392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.457392 (E_RNA) where: Base-Base interactions energy: -228.140 where: short stacking energy: -101.479 Base-Backbone interact. energy: 0.244 local terms energy: -108.560919 where: bonds (distance) C4'-P energy: -19.654 bonds (distance) P-C4' energy: -23.531 flat angles C4'-P-C4' energy: -27.133 flat angles P-C4'-P energy: -16.264 tors. eta vs tors. theta energy: -21.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -248.751752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.751752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.998909 (E_RNA) where: Base-Base interactions energy: -156.157 where: short stacking energy: -87.347 Base-Backbone interact. energy: -1.575 local terms energy: -91.267166 where: bonds (distance) C4'-P energy: -21.221 bonds (distance) P-C4' energy: -13.848 flat angles C4'-P-C4' energy: -27.550 flat angles P-C4'-P energy: -11.218 tors. eta vs tors. theta energy: -17.430 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -215.843524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.843524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.965609 (E_RNA) where: Base-Base interactions energy: -121.000 where: short stacking energy: -64.069 Base-Backbone interact. energy: -0.683 local terms energy: -94.282800 where: bonds (distance) C4'-P energy: -18.620 bonds (distance) P-C4' energy: -25.135 flat angles C4'-P-C4' energy: -22.545 flat angles P-C4'-P energy: -12.895 tors. eta vs tors. theta energy: -15.087 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -213.485346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.485346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.485346 (E_RNA) where: Base-Base interactions energy: -124.478 where: short stacking energy: -69.406 Base-Backbone interact. energy: -1.722 local terms energy: -87.285580 where: bonds (distance) C4'-P energy: -23.300 bonds (distance) P-C4' energy: -20.544 flat angles C4'-P-C4' energy: -21.214 flat angles P-C4'-P energy: -13.737 tors. eta vs tors. theta energy: -8.491 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -191.861756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.861756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.905481 (E_RNA) where: Base-Base interactions energy: -107.763 where: short stacking energy: -62.108 Base-Backbone interact. energy: -0.256 local terms energy: -83.886067 where: bonds (distance) C4'-P energy: -15.905 bonds (distance) P-C4' energy: -24.600 flat angles C4'-P-C4' energy: -20.739 flat angles P-C4'-P energy: -16.397 tors. eta vs tors. theta energy: -6.245 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -362.383361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.383361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.383361 (E_RNA) where: Base-Base interactions energy: -245.781 where: short stacking energy: -108.175 Base-Backbone interact. energy: -1.336 local terms energy: -115.265999 where: bonds (distance) C4'-P energy: -26.058 bonds (distance) P-C4' energy: -21.674 flat angles C4'-P-C4' energy: -24.812 flat angles P-C4'-P energy: -20.742 tors. eta vs tors. theta energy: -21.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -339.516014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.516014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.538722 (E_RNA) where: Base-Base interactions energy: -214.629 where: short stacking energy: -107.084 Base-Backbone interact. energy: -0.865 local terms energy: -124.044526 where: bonds (distance) C4'-P energy: -22.750 bonds (distance) P-C4' energy: -28.280 flat angles C4'-P-C4' energy: -28.184 flat angles P-C4'-P energy: -20.900 tors. eta vs tors. theta energy: -23.931 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -369.272760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.272760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.328723 (E_RNA) where: Base-Base interactions energy: -251.138 where: short stacking energy: -104.919 Base-Backbone interact. energy: -0.747 local terms energy: -117.443626 where: bonds (distance) C4'-P energy: -24.596 bonds (distance) P-C4' energy: -25.983 flat angles C4'-P-C4' energy: -22.096 flat angles P-C4'-P energy: -16.188 tors. eta vs tors. theta energy: -28.581 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -340.141430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.141430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.165641 (E_RNA) where: Base-Base interactions energy: -225.128 where: short stacking energy: -112.650 Base-Backbone interact. energy: -2.182 local terms energy: -112.854877 where: bonds (distance) C4'-P energy: -22.875 bonds (distance) P-C4' energy: -26.242 flat angles C4'-P-C4' energy: -20.653 flat angles P-C4'-P energy: -12.618 tors. eta vs tors. theta energy: -30.466 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -329.625584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.625584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.765881 (E_RNA) where: Base-Base interactions energy: -214.068 where: short stacking energy: -93.288 Base-Backbone interact. energy: -0.143 local terms energy: -115.555239 where: bonds (distance) C4'-P energy: -26.233 bonds (distance) P-C4' energy: -22.165 flat angles C4'-P-C4' energy: -25.792 flat angles P-C4'-P energy: -19.093 tors. eta vs tors. theta energy: -22.272 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -246.310444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.310444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.310444 (E_RNA) where: Base-Base interactions energy: -145.636 where: short stacking energy: -90.934 Base-Backbone interact. energy: -0.052 local terms energy: -100.622060 where: bonds (distance) C4'-P energy: -19.677 bonds (distance) P-C4' energy: -19.705 flat angles C4'-P-C4' energy: -23.583 flat angles P-C4'-P energy: -18.670 tors. eta vs tors. theta energy: -18.987 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -221.045196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.045196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.104435 (E_RNA) where: Base-Base interactions energy: -119.223 where: short stacking energy: -68.191 Base-Backbone interact. energy: -2.023 local terms energy: -99.858294 where: bonds (distance) C4'-P energy: -25.311 bonds (distance) P-C4' energy: -20.540 flat angles C4'-P-C4' energy: -22.596 flat angles P-C4'-P energy: -18.628 tors. eta vs tors. theta energy: -12.784 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -225.578324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.578324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.683915 (E_RNA) where: Base-Base interactions energy: -126.148 where: short stacking energy: -76.941 Base-Backbone interact. energy: -0.038 local terms energy: -99.497724 where: bonds (distance) C4'-P energy: -22.029 bonds (distance) P-C4' energy: -24.487 flat angles C4'-P-C4' energy: -19.341 flat angles P-C4'-P energy: -16.203 tors. eta vs tors. theta energy: -17.437 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -211.451747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.451747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.605427 (E_RNA) where: Base-Base interactions energy: -130.734 where: short stacking energy: -75.206 Base-Backbone interact. energy: -0.851 local terms energy: -80.019939 where: bonds (distance) C4'-P energy: -14.618 bonds (distance) P-C4' energy: -17.214 flat angles C4'-P-C4' energy: -23.191 flat angles P-C4'-P energy: -11.116 tors. eta vs tors. theta energy: -13.880 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -202.158083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.158083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.401629 (E_RNA) where: Base-Base interactions energy: -126.581 where: short stacking energy: -73.484 Base-Backbone interact. energy: -0.075 local terms energy: -75.745216 where: bonds (distance) C4'-P energy: -12.510 bonds (distance) P-C4' energy: -22.941 flat angles C4'-P-C4' energy: -19.647 flat angles P-C4'-P energy: -12.576 tors. eta vs tors. theta energy: -8.071 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -377.593940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.593940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.761823 (E_RNA) where: Base-Base interactions energy: -253.384 where: short stacking energy: -124.503 Base-Backbone interact. energy: -0.374 local terms energy: -124.003602 where: bonds (distance) C4'-P energy: -19.879 bonds (distance) P-C4' energy: -24.425 flat angles C4'-P-C4' energy: -26.234 flat angles P-C4'-P energy: -19.045 tors. eta vs tors. theta energy: -34.421 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -372.883654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.883654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.883654 (E_RNA) where: Base-Base interactions energy: -249.374 where: short stacking energy: -106.404 Base-Backbone interact. energy: -2.004 local terms energy: -121.505905 where: bonds (distance) C4'-P energy: -24.426 bonds (distance) P-C4' energy: -27.051 flat angles C4'-P-C4' energy: -24.905 flat angles P-C4'-P energy: -14.861 tors. eta vs tors. theta energy: -30.262 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -337.543404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.543404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.549060 (E_RNA) where: Base-Base interactions energy: -223.307 where: short stacking energy: -115.292 Base-Backbone interact. energy: -1.059 local terms energy: -113.182537 where: bonds (distance) C4'-P energy: -18.728 bonds (distance) P-C4' energy: -28.404 flat angles C4'-P-C4' energy: -25.681 flat angles P-C4'-P energy: -15.169 tors. eta vs tors. theta energy: -25.200 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -354.823653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.823653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.900872 (E_RNA) where: Base-Base interactions energy: -244.546 where: short stacking energy: -118.982 Base-Backbone interact. energy: 0.165 local terms energy: -110.519813 where: bonds (distance) C4'-P energy: -17.106 bonds (distance) P-C4' energy: -20.811 flat angles C4'-P-C4' energy: -25.465 flat angles P-C4'-P energy: -15.694 tors. eta vs tors. theta energy: -31.444 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -331.676442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.676442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.704255 (E_RNA) where: Base-Base interactions energy: -217.297 where: short stacking energy: -96.812 Base-Backbone interact. energy: -0.541 local terms energy: -113.865528 where: bonds (distance) C4'-P energy: -19.985 bonds (distance) P-C4' energy: -24.543 flat angles C4'-P-C4' energy: -25.075 flat angles P-C4'-P energy: -17.817 tors. eta vs tors. theta energy: -26.445 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -234.561476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.561476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.630515 (E_RNA) where: Base-Base interactions energy: -134.637 where: short stacking energy: -85.482 Base-Backbone interact. energy: -0.036 local terms energy: -99.957705 where: bonds (distance) C4'-P energy: -26.599 bonds (distance) P-C4' energy: -19.939 flat angles C4'-P-C4' energy: -22.908 flat angles P-C4'-P energy: -15.753 tors. eta vs tors. theta energy: -14.759 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -228.517545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.517545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.555302 (E_RNA) where: Base-Base interactions energy: -137.913 where: short stacking energy: -72.422 Base-Backbone interact. energy: -0.685 local terms energy: -89.957136 where: bonds (distance) C4'-P energy: -22.661 bonds (distance) P-C4' energy: -23.071 flat angles C4'-P-C4' energy: -16.993 flat angles P-C4'-P energy: -12.163 tors. eta vs tors. theta energy: -15.069 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -217.498239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.498239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.622315 (E_RNA) where: Base-Base interactions energy: -121.985 where: short stacking energy: -63.760 Base-Backbone interact. energy: -0.989 local terms energy: -94.649016 where: bonds (distance) C4'-P energy: -21.560 bonds (distance) P-C4' energy: -27.202 flat angles C4'-P-C4' energy: -20.195 flat angles P-C4'-P energy: -16.169 tors. eta vs tors. theta energy: -9.522 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -218.788826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.788826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.025628 (E_RNA) where: Base-Base interactions energy: -129.855 where: short stacking energy: -73.518 Base-Backbone interact. energy: -0.976 local terms energy: -88.195127 where: bonds (distance) C4'-P energy: -14.578 bonds (distance) P-C4' energy: -16.055 flat angles C4'-P-C4' energy: -23.858 flat angles P-C4'-P energy: -17.123 tors. eta vs tors. theta energy: -16.580 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -214.358266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.358266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.630216 (E_RNA) where: Base-Base interactions energy: -127.642 where: short stacking energy: -77.702 Base-Backbone interact. energy: -0.067 local terms energy: -86.920989 where: bonds (distance) C4'-P energy: -22.113 bonds (distance) P-C4' energy: -14.869 flat angles C4'-P-C4' energy: -22.430 flat angles P-C4'-P energy: -10.579 tors. eta vs tors. theta energy: -16.930 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -376.199467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.199467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.236520 (E_RNA) where: Base-Base interactions energy: -255.929 where: short stacking energy: -119.935 Base-Backbone interact. energy: -0.498 local terms energy: -119.810021 where: bonds (distance) C4'-P energy: -24.562 bonds (distance) P-C4' energy: -23.682 flat angles C4'-P-C4' energy: -27.214 flat angles P-C4'-P energy: -17.178 tors. eta vs tors. theta energy: -27.174 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -364.927819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.927819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.945726 (E_RNA) where: Base-Base interactions energy: -247.458 where: short stacking energy: -124.285 Base-Backbone interact. energy: -1.505 local terms energy: -115.982588 where: bonds (distance) C4'-P energy: -22.310 bonds (distance) P-C4' energy: -24.316 flat angles C4'-P-C4' energy: -24.313 flat angles P-C4'-P energy: -13.319 tors. eta vs tors. theta energy: -31.726 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -344.425783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.425783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.445261 (E_RNA) where: Base-Base interactions energy: -222.864 where: short stacking energy: -106.882 Base-Backbone interact. energy: -1.283 local terms energy: -120.298942 where: bonds (distance) C4'-P energy: -19.438 bonds (distance) P-C4' energy: -26.789 flat angles C4'-P-C4' energy: -29.246 flat angles P-C4'-P energy: -18.972 tors. eta vs tors. theta energy: -25.854 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -332.494386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.494386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.494386 (E_RNA) where: Base-Base interactions energy: -217.214 where: short stacking energy: -98.795 Base-Backbone interact. energy: -2.271 local terms energy: -113.009903 where: bonds (distance) C4'-P energy: -24.798 bonds (distance) P-C4' energy: -22.195 flat angles C4'-P-C4' energy: -24.006 flat angles P-C4'-P energy: -19.688 tors. eta vs tors. theta energy: -22.322 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -316.453363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.453363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.515034 (E_RNA) where: Base-Base interactions energy: -205.933 where: short stacking energy: -100.742 Base-Backbone interact. energy: -0.322 local terms energy: -110.260353 where: bonds (distance) C4'-P energy: -24.252 bonds (distance) P-C4' energy: -24.109 flat angles C4'-P-C4' energy: -29.740 flat angles P-C4'-P energy: -10.963 tors. eta vs tors. theta energy: -21.196 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -248.518538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.518538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.988093 (E_RNA) where: Base-Base interactions energy: -155.272 where: short stacking energy: -81.311 Base-Backbone interact. energy: -1.440 local terms energy: -92.276685 where: bonds (distance) C4'-P energy: -19.110 bonds (distance) P-C4' energy: -21.355 flat angles C4'-P-C4' energy: -16.944 flat angles P-C4'-P energy: -15.294 tors. eta vs tors. theta energy: -19.575 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -224.840792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.840792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.001926 (E_RNA) where: Base-Base interactions energy: -131.062 where: short stacking energy: -75.606 Base-Backbone interact. energy: -0.043 local terms energy: -93.896201 where: bonds (distance) C4'-P energy: -19.517 bonds (distance) P-C4' energy: -21.266 flat angles C4'-P-C4' energy: -23.987 flat angles P-C4'-P energy: -13.987 tors. eta vs tors. theta energy: -15.139 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -208.583205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.583205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.583205 (E_RNA) where: Base-Base interactions energy: -130.439 where: short stacking energy: -65.611 Base-Backbone interact. energy: -0.458 local terms energy: -77.686619 where: bonds (distance) C4'-P energy: -15.927 bonds (distance) P-C4' energy: -20.595 flat angles C4'-P-C4' energy: -17.847 flat angles P-C4'-P energy: -8.377 tors. eta vs tors. theta energy: -14.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -214.262324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.262324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.328098 (E_RNA) where: Base-Base interactions energy: -126.077 where: short stacking energy: -71.221 Base-Backbone interact. energy: -1.073 local terms energy: -87.178131 where: bonds (distance) C4'-P energy: -22.160 bonds (distance) P-C4' energy: -22.682 flat angles C4'-P-C4' energy: -16.245 flat angles P-C4'-P energy: -13.260 tors. eta vs tors. theta energy: -12.831 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -194.420091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.420091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.435036 (E_RNA) where: Base-Base interactions energy: -123.989 where: short stacking energy: -65.273 Base-Backbone interact. energy: 0.353 local terms energy: -70.798998 where: bonds (distance) C4'-P energy: -17.221 bonds (distance) P-C4' energy: -24.129 flat angles C4'-P-C4' energy: -13.280 flat angles P-C4'-P energy: -10.977 tors. eta vs tors. theta energy: -5.192 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -371.975449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.975449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.999925 (E_RNA) where: Base-Base interactions energy: -241.628 where: short stacking energy: -114.219 Base-Backbone interact. energy: -0.401 local terms energy: -129.971588 where: bonds (distance) C4'-P energy: -26.004 bonds (distance) P-C4' energy: -26.787 flat angles C4'-P-C4' energy: -28.102 flat angles P-C4'-P energy: -19.276 tors. eta vs tors. theta energy: -29.803 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -366.054179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.054179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.089506 (E_RNA) where: Base-Base interactions energy: -248.922 where: short stacking energy: -121.100 Base-Backbone interact. energy: 1.419 local terms energy: -118.587014 where: bonds (distance) C4'-P energy: -20.924 bonds (distance) P-C4' energy: -24.127 flat angles C4'-P-C4' energy: -23.939 flat angles P-C4'-P energy: -18.720 tors. eta vs tors. theta energy: -30.877 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -339.589743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.589743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.625129 (E_RNA) where: Base-Base interactions energy: -217.063 where: short stacking energy: -100.615 Base-Backbone interact. energy: -0.587 local terms energy: -121.974595 where: bonds (distance) C4'-P energy: -23.614 bonds (distance) P-C4' energy: -28.401 flat angles C4'-P-C4' energy: -28.000 flat angles P-C4'-P energy: -15.595 tors. eta vs tors. theta energy: -26.365 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -341.321841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.321841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.479412 (E_RNA) where: Base-Base interactions energy: -225.623 where: short stacking energy: -104.138 Base-Backbone interact. energy: -0.990 local terms energy: -114.865787 where: bonds (distance) C4'-P energy: -21.803 bonds (distance) P-C4' energy: -27.009 flat angles C4'-P-C4' energy: -26.770 flat angles P-C4'-P energy: -18.892 tors. eta vs tors. theta energy: -20.392 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -329.831300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.831300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.904288 (E_RNA) where: Base-Base interactions energy: -217.838 where: short stacking energy: -107.832 Base-Backbone interact. energy: -0.178 local terms energy: -111.888711 where: bonds (distance) C4'-P energy: -19.686 bonds (distance) P-C4' energy: -18.859 flat angles C4'-P-C4' energy: -24.995 flat angles P-C4'-P energy: -18.173 tors. eta vs tors. theta energy: -30.176 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -242.494335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.494335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.767175 (E_RNA) where: Base-Base interactions energy: -143.356 where: short stacking energy: -89.587 Base-Backbone interact. energy: -0.625 local terms energy: -98.786478 where: bonds (distance) C4'-P energy: -18.743 bonds (distance) P-C4' energy: -19.999 flat angles C4'-P-C4' energy: -25.535 flat angles P-C4'-P energy: -15.534 tors. eta vs tors. theta energy: -18.975 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -242.181043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.181043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.304988 (E_RNA) where: Base-Base interactions energy: -140.012 where: short stacking energy: -66.129 Base-Backbone interact. energy: -0.290 local terms energy: -102.003296 where: bonds (distance) C4'-P energy: -24.187 bonds (distance) P-C4' energy: -25.994 flat angles C4'-P-C4' energy: -26.319 flat angles P-C4'-P energy: -12.417 tors. eta vs tors. theta energy: -13.085 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -218.746725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.746725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.823192 (E_RNA) where: Base-Base interactions energy: -141.485 where: short stacking energy: -69.826 Base-Backbone interact. energy: -1.650 local terms energy: -75.688121 where: bonds (distance) C4'-P energy: -21.422 bonds (distance) P-C4' energy: -18.500 flat angles C4'-P-C4' energy: -16.433 flat angles P-C4'-P energy: -12.884 tors. eta vs tors. theta energy: -6.449 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -200.375620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.375620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.420930 (E_RNA) where: Base-Base interactions energy: -121.903 where: short stacking energy: -66.511 Base-Backbone interact. energy: -0.112 local terms energy: -78.405683 where: bonds (distance) C4'-P energy: -15.661 bonds (distance) P-C4' energy: -23.135 flat angles C4'-P-C4' energy: -15.699 flat angles P-C4'-P energy: -12.071 tors. eta vs tors. theta energy: -11.839 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -204.273883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.273883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.292102 (E_RNA) where: Base-Base interactions energy: -117.868 where: short stacking energy: -67.644 Base-Backbone interact. energy: -0.278 local terms energy: -86.145885 where: bonds (distance) C4'-P energy: -21.193 bonds (distance) P-C4' energy: -24.937 flat angles C4'-P-C4' energy: -12.022 flat angles P-C4'-P energy: -15.110 tors. eta vs tors. theta energy: -12.884 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -372.132074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.132074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.200112 (E_RNA) where: Base-Base interactions energy: -256.265 where: short stacking energy: -105.137 Base-Backbone interact. energy: 0.065 local terms energy: -116.000185 where: bonds (distance) C4'-P energy: -23.453 bonds (distance) P-C4' energy: -24.519 flat angles C4'-P-C4' energy: -24.239 flat angles P-C4'-P energy: -14.289 tors. eta vs tors. theta energy: -29.500 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -369.667625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.667625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.726455 (E_RNA) where: Base-Base interactions energy: -253.385 where: short stacking energy: -109.983 Base-Backbone interact. energy: -0.601 local terms energy: -115.740542 where: bonds (distance) C4'-P energy: -19.892 bonds (distance) P-C4' energy: -25.212 flat angles C4'-P-C4' energy: -29.176 flat angles P-C4'-P energy: -16.373 tors. eta vs tors. theta energy: -25.087 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -345.645534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.645534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.663835 (E_RNA) where: Base-Base interactions energy: -230.505 where: short stacking energy: -106.636 Base-Backbone interact. energy: -0.677 local terms energy: -114.481710 where: bonds (distance) C4'-P energy: -22.926 bonds (distance) P-C4' energy: -24.759 flat angles C4'-P-C4' energy: -25.870 flat angles P-C4'-P energy: -16.848 tors. eta vs tors. theta energy: -24.078 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -353.104631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.104631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.186733 (E_RNA) where: Base-Base interactions energy: -235.735 where: short stacking energy: -116.720 Base-Backbone interact. energy: -0.199 local terms energy: -117.252688 where: bonds (distance) C4'-P energy: -24.935 bonds (distance) P-C4' energy: -20.144 flat angles C4'-P-C4' energy: -26.077 flat angles P-C4'-P energy: -15.195 tors. eta vs tors. theta energy: -30.902 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -333.962670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.962670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.000886 (E_RNA) where: Base-Base interactions energy: -225.236 where: short stacking energy: -101.829 Base-Backbone interact. energy: -0.798 local terms energy: -107.966944 where: bonds (distance) C4'-P energy: -21.838 bonds (distance) P-C4' energy: -24.553 flat angles C4'-P-C4' energy: -21.274 flat angles P-C4'-P energy: -18.699 tors. eta vs tors. theta energy: -21.603 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -240.697870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.697870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.993939 (E_RNA) where: Base-Base interactions energy: -138.212 where: short stacking energy: -92.184 Base-Backbone interact. energy: -0.168 local terms energy: -102.613600 where: bonds (distance) C4'-P energy: -24.803 bonds (distance) P-C4' energy: -24.109 flat angles C4'-P-C4' energy: -26.180 flat angles P-C4'-P energy: -10.523 tors. eta vs tors. theta energy: -16.999 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -240.131344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.131344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.186574 (E_RNA) where: Base-Base interactions energy: -134.600 where: short stacking energy: -77.190 Base-Backbone interact. energy: -0.830 local terms energy: -104.756488 where: bonds (distance) C4'-P energy: -25.258 bonds (distance) P-C4' energy: -23.971 flat angles C4'-P-C4' energy: -20.250 flat angles P-C4'-P energy: -13.544 tors. eta vs tors. theta energy: -21.734 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -218.768685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.768685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.144137 (E_RNA) where: Base-Base interactions energy: -127.597 where: short stacking energy: -76.349 Base-Backbone interact. energy: 0.127 local terms energy: -91.673724 where: bonds (distance) C4'-P energy: -18.642 bonds (distance) P-C4' energy: -23.816 flat angles C4'-P-C4' energy: -23.685 flat angles P-C4'-P energy: -8.612 tors. eta vs tors. theta energy: -16.919 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -224.399225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.399225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.569996 (E_RNA) where: Base-Base interactions energy: -137.858 where: short stacking energy: -77.173 Base-Backbone interact. energy: 2.205 local terms energy: -88.916825 where: bonds (distance) C4'-P energy: -18.739 bonds (distance) P-C4' energy: -22.463 flat angles C4'-P-C4' energy: -25.198 flat angles P-C4'-P energy: -9.899 tors. eta vs tors. theta energy: -12.618 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -182.862633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.862633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.994424 (E_RNA) where: Base-Base interactions energy: -105.160 where: short stacking energy: -62.003 Base-Backbone interact. energy: -0.692 local terms energy: -77.143020 where: bonds (distance) C4'-P energy: -18.992 bonds (distance) P-C4' energy: -26.191 flat angles C4'-P-C4' energy: -21.151 flat angles P-C4'-P energy: -4.462 tors. eta vs tors. theta energy: -6.347 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -362.643627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.643627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.675411 (E_RNA) where: Base-Base interactions energy: -242.281 where: short stacking energy: -115.441 Base-Backbone interact. energy: -0.290 local terms energy: -120.104723 where: bonds (distance) C4'-P energy: -20.497 bonds (distance) P-C4' energy: -27.336 flat angles C4'-P-C4' energy: -24.053 flat angles P-C4'-P energy: -19.621 tors. eta vs tors. theta energy: -28.598 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -378.238052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.238052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.238052 (E_RNA) where: Base-Base interactions energy: -257.670 where: short stacking energy: -114.984 Base-Backbone interact. energy: -2.048 local terms energy: -118.520092 where: bonds (distance) C4'-P energy: -23.381 bonds (distance) P-C4' energy: -22.229 flat angles C4'-P-C4' energy: -23.280 flat angles P-C4'-P energy: -20.585 tors. eta vs tors. theta energy: -29.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -351.345681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.345681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.515820 (E_RNA) where: Base-Base interactions energy: -227.954 where: short stacking energy: -111.328 Base-Backbone interact. energy: -2.485 local terms energy: -121.076611 where: bonds (distance) C4'-P energy: -22.892 bonds (distance) P-C4' energy: -27.011 flat angles C4'-P-C4' energy: -22.961 flat angles P-C4'-P energy: -18.329 tors. eta vs tors. theta energy: -29.884 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -329.078676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.078676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.108267 (E_RNA) where: Base-Base interactions energy: -212.918 where: short stacking energy: -112.841 Base-Backbone interact. energy: -0.100 local terms energy: -116.089514 where: bonds (distance) C4'-P energy: -20.552 bonds (distance) P-C4' energy: -25.240 flat angles C4'-P-C4' energy: -25.720 flat angles P-C4'-P energy: -13.456 tors. eta vs tors. theta energy: -31.122 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -333.458457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.458457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.538670 (E_RNA) where: Base-Base interactions energy: -231.105 where: short stacking energy: -103.047 Base-Backbone interact. energy: -2.986 local terms energy: -99.446997 where: bonds (distance) C4'-P energy: -15.635 bonds (distance) P-C4' energy: -18.848 flat angles C4'-P-C4' energy: -17.368 flat angles P-C4'-P energy: -20.481 tors. eta vs tors. theta energy: -27.115 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -239.991240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.991240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.372915 (E_RNA) where: Base-Base interactions energy: -139.079 where: short stacking energy: -89.109 Base-Backbone interact. energy: -0.393 local terms energy: -100.900855 where: bonds (distance) C4'-P energy: -19.920 bonds (distance) P-C4' energy: -22.325 flat angles C4'-P-C4' energy: -23.046 flat angles P-C4'-P energy: -13.538 tors. eta vs tors. theta energy: -22.072 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -228.937569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.937569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.033832 (E_RNA) where: Base-Base interactions energy: -138.576 where: short stacking energy: -80.374 Base-Backbone interact. energy: -3.591 local terms energy: -86.866185 where: bonds (distance) C4'-P energy: -18.572 bonds (distance) P-C4' energy: -17.859 flat angles C4'-P-C4' energy: -21.218 flat angles P-C4'-P energy: -13.313 tors. eta vs tors. theta energy: -15.904 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -210.969551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.969551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.112245 (E_RNA) where: Base-Base interactions energy: -133.023 where: short stacking energy: -77.252 Base-Backbone interact. energy: -0.341 local terms energy: -77.748458 where: bonds (distance) C4'-P energy: -20.128 bonds (distance) P-C4' energy: -19.098 flat angles C4'-P-C4' energy: -14.041 flat angles P-C4'-P energy: -9.222 tors. eta vs tors. theta energy: -15.260 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -217.711147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.711147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.736394 (E_RNA) where: Base-Base interactions energy: -125.287 where: short stacking energy: -64.228 Base-Backbone interact. energy: -0.602 local terms energy: -91.846925 where: bonds (distance) C4'-P energy: -21.090 bonds (distance) P-C4' energy: -17.284 flat angles C4'-P-C4' energy: -25.091 flat angles P-C4'-P energy: -18.132 tors. eta vs tors. theta energy: -10.250 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -196.415562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.415562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.441069 (E_RNA) where: Base-Base interactions energy: -112.788 where: short stacking energy: -60.462 Base-Backbone interact. energy: -0.858 local terms energy: -82.794881 where: bonds (distance) C4'-P energy: -19.534 bonds (distance) P-C4' energy: -20.436 flat angles C4'-P-C4' energy: -19.028 flat angles P-C4'-P energy: -11.456 tors. eta vs tors. theta energy: -12.341 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -375.972914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.972914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.972914 (E_RNA) where: Base-Base interactions energy: -246.765 where: short stacking energy: -117.529 Base-Backbone interact. energy: -1.833 local terms energy: -127.375202 where: bonds (distance) C4'-P energy: -24.854 bonds (distance) P-C4' energy: -27.213 flat angles C4'-P-C4' energy: -25.833 flat angles P-C4'-P energy: -18.923 tors. eta vs tors. theta energy: -30.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -352.385049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.385049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.387975 (E_RNA) where: Base-Base interactions energy: -249.755 where: short stacking energy: -114.515 Base-Backbone interact. energy: -0.669 local terms energy: -101.963792 where: bonds (distance) C4'-P energy: -21.217 bonds (distance) P-C4' energy: -21.093 flat angles C4'-P-C4' energy: -21.591 flat angles P-C4'-P energy: -18.438 tors. eta vs tors. theta energy: -19.623 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -351.146416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.146416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.149941 (E_RNA) where: Base-Base interactions energy: -226.900 where: short stacking energy: -119.724 Base-Backbone interact. energy: -0.124 local terms energy: -124.125973 where: bonds (distance) C4'-P energy: -20.906 bonds (distance) P-C4' energy: -29.263 flat angles C4'-P-C4' energy: -24.757 flat angles P-C4'-P energy: -15.759 tors. eta vs tors. theta energy: -33.442 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -342.898061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.898061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.898061 (E_RNA) where: Base-Base interactions energy: -223.064 where: short stacking energy: -109.111 Base-Backbone interact. energy: 0.027 local terms energy: -119.860782 where: bonds (distance) C4'-P energy: -21.957 bonds (distance) P-C4' energy: -25.049 flat angles C4'-P-C4' energy: -25.145 flat angles P-C4'-P energy: -18.767 tors. eta vs tors. theta energy: -28.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -319.128070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.128070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.198436 (E_RNA) where: Base-Base interactions energy: -211.544 where: short stacking energy: -96.199 Base-Backbone interact. energy: -0.793 local terms energy: -106.862029 where: bonds (distance) C4'-P energy: -22.165 bonds (distance) P-C4' energy: -26.463 flat angles C4'-P-C4' energy: -23.139 flat angles P-C4'-P energy: -11.440 tors. eta vs tors. theta energy: -23.655 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -244.257729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.257729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.293957 (E_RNA) where: Base-Base interactions energy: -143.110 where: short stacking energy: -92.116 Base-Backbone interact. energy: -0.299 local terms energy: -100.885424 where: bonds (distance) C4'-P energy: -23.799 bonds (distance) P-C4' energy: -19.891 flat angles C4'-P-C4' energy: -19.141 flat angles P-C4'-P energy: -16.171 tors. eta vs tors. theta energy: -21.884 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -219.846778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.846778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.915713 (E_RNA) where: Base-Base interactions energy: -127.203 where: short stacking energy: -75.071 Base-Backbone interact. energy: -0.151 local terms energy: -92.562300 where: bonds (distance) C4'-P energy: -20.017 bonds (distance) P-C4' energy: -24.624 flat angles C4'-P-C4' energy: -20.778 flat angles P-C4'-P energy: -15.438 tors. eta vs tors. theta energy: -11.705 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -221.030128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.030128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.169656 (E_RNA) where: Base-Base interactions energy: -132.507 where: short stacking energy: -78.864 Base-Backbone interact. energy: -1.089 local terms energy: -87.574410 where: bonds (distance) C4'-P energy: -14.391 bonds (distance) P-C4' energy: -20.491 flat angles C4'-P-C4' energy: -25.938 flat angles P-C4'-P energy: -15.779 tors. eta vs tors. theta energy: -10.976 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -212.372558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.372558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.381475 (E_RNA) where: Base-Base interactions energy: -125.997 where: short stacking energy: -67.874 Base-Backbone interact. energy: 0.094 local terms energy: -86.478577 where: bonds (distance) C4'-P energy: -17.377 bonds (distance) P-C4' energy: -19.735 flat angles C4'-P-C4' energy: -19.989 flat angles P-C4'-P energy: -15.956 tors. eta vs tors. theta energy: -13.421 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -207.295890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.295890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.529129 (E_RNA) where: Base-Base interactions energy: -125.000 where: short stacking energy: -69.083 Base-Backbone interact. energy: -0.094 local terms energy: -82.435499 where: bonds (distance) C4'-P energy: -17.005 bonds (distance) P-C4' energy: -24.979 flat angles C4'-P-C4' energy: -17.514 flat angles P-C4'-P energy: -14.033 tors. eta vs tors. theta energy: -8.905 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -367.860116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.860116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.860116 (E_RNA) where: Base-Base interactions energy: -244.408 where: short stacking energy: -119.664 Base-Backbone interact. energy: -0.898 local terms energy: -122.553285 where: bonds (distance) C4'-P energy: -27.854 bonds (distance) P-C4' energy: -25.805 flat angles C4'-P-C4' energy: -22.950 flat angles P-C4'-P energy: -15.348 tors. eta vs tors. theta energy: -30.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -352.772790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.772790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.818196 (E_RNA) where: Base-Base interactions energy: -227.505 where: short stacking energy: -115.174 Base-Backbone interact. energy: -2.101 local terms energy: -123.212168 where: bonds (distance) C4'-P energy: -21.003 bonds (distance) P-C4' energy: -27.594 flat angles C4'-P-C4' energy: -26.474 flat angles P-C4'-P energy: -19.607 tors. eta vs tors. theta energy: -28.534 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -340.382963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.382963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.489264 (E_RNA) where: Base-Base interactions energy: -224.118 where: short stacking energy: -106.346 Base-Backbone interact. energy: -0.109 local terms energy: -116.262636 where: bonds (distance) C4'-P energy: -21.578 bonds (distance) P-C4' energy: -26.987 flat angles C4'-P-C4' energy: -25.966 flat angles P-C4'-P energy: -15.325 tors. eta vs tors. theta energy: -26.406 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -333.950763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.950763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.950763 (E_RNA) where: Base-Base interactions energy: -220.067 where: short stacking energy: -104.422 Base-Backbone interact. energy: -2.010 local terms energy: -111.872854 where: bonds (distance) C4'-P energy: -20.258 bonds (distance) P-C4' energy: -22.222 flat angles C4'-P-C4' energy: -25.580 flat angles P-C4'-P energy: -15.578 tors. eta vs tors. theta energy: -28.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -332.076315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.076315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.080865 (E_RNA) where: Base-Base interactions energy: -222.604 where: short stacking energy: -109.940 Base-Backbone interact. energy: 0.039 local terms energy: -109.514989 where: bonds (distance) C4'-P energy: -20.476 bonds (distance) P-C4' energy: -24.468 flat angles C4'-P-C4' energy: -21.519 flat angles P-C4'-P energy: -13.255 tors. eta vs tors. theta energy: -29.798 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -236.401083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.401083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.600386 (E_RNA) where: Base-Base interactions energy: -129.433 where: short stacking energy: -70.664 Base-Backbone interact. energy: -0.973 local terms energy: -106.194517 where: bonds (distance) C4'-P energy: -22.918 bonds (distance) P-C4' energy: -27.922 flat angles C4'-P-C4' energy: -21.173 flat angles P-C4'-P energy: -15.751 tors. eta vs tors. theta energy: -18.431 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -226.522748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.522748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.739605 (E_RNA) where: Base-Base interactions energy: -128.505 where: short stacking energy: -73.828 Base-Backbone interact. energy: -0.723 local terms energy: -97.511322 where: bonds (distance) C4'-P energy: -17.993 bonds (distance) P-C4' energy: -21.593 flat angles C4'-P-C4' energy: -26.720 flat angles P-C4'-P energy: -14.599 tors. eta vs tors. theta energy: -16.606 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -218.035898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.035898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.075330 (E_RNA) where: Base-Base interactions energy: -127.560 where: short stacking energy: -67.038 Base-Backbone interact. energy: 0.146 local terms energy: -90.661784 where: bonds (distance) C4'-P energy: -15.645 bonds (distance) P-C4' energy: -25.367 flat angles C4'-P-C4' energy: -19.714 flat angles P-C4'-P energy: -16.467 tors. eta vs tors. theta energy: -13.469 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -207.035164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.035164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.095580 (E_RNA) where: Base-Base interactions energy: -125.414 where: short stacking energy: -73.019 Base-Backbone interact. energy: -0.755 local terms energy: -80.926904 where: bonds (distance) C4'-P energy: -13.143 bonds (distance) P-C4' energy: -23.279 flat angles C4'-P-C4' energy: -18.823 flat angles P-C4'-P energy: -13.349 tors. eta vs tors. theta energy: -12.332 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -212.713898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.713898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.752878 (E_RNA) where: Base-Base interactions energy: -124.556 where: short stacking energy: -74.551 Base-Backbone interact. energy: -0.967 local terms energy: -87.230552 where: bonds (distance) C4'-P energy: -19.473 bonds (distance) P-C4' energy: -23.453 flat angles C4'-P-C4' energy: -21.657 flat angles P-C4'-P energy: -9.118 tors. eta vs tors. theta energy: -13.530 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -379.185281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.185281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.185281 (E_RNA) where: Base-Base interactions energy: -257.223 where: short stacking energy: -117.777 Base-Backbone interact. energy: -0.956 local terms energy: -121.006036 where: bonds (distance) C4'-P energy: -24.305 bonds (distance) P-C4' energy: -20.913 flat angles C4'-P-C4' energy: -22.010 flat angles P-C4'-P energy: -18.562 tors. eta vs tors. theta energy: -35.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -362.464379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.464379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.528336 (E_RNA) where: Base-Base interactions energy: -241.666 where: short stacking energy: -122.164 Base-Backbone interact. energy: -0.629 local terms energy: -120.233300 where: bonds (distance) C4'-P energy: -22.141 bonds (distance) P-C4' energy: -23.790 flat angles C4'-P-C4' energy: -26.215 flat angles P-C4'-P energy: -18.788 tors. eta vs tors. theta energy: -29.299 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -351.654697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.654697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.654697 (E_RNA) where: Base-Base interactions energy: -242.154 where: short stacking energy: -108.707 Base-Backbone interact. energy: -1.130 local terms energy: -108.371207 where: bonds (distance) C4'-P energy: -21.924 bonds (distance) P-C4' energy: -27.289 flat angles C4'-P-C4' energy: -25.815 flat angles P-C4'-P energy: -10.804 tors. eta vs tors. theta energy: -22.539 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -334.263346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.263346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.521754 (E_RNA) where: Base-Base interactions energy: -216.132 where: short stacking energy: -105.003 Base-Backbone interact. energy: -0.469 local terms energy: -117.920795 where: bonds (distance) C4'-P energy: -22.886 bonds (distance) P-C4' energy: -25.818 flat angles C4'-P-C4' energy: -26.400 flat angles P-C4'-P energy: -13.518 tors. eta vs tors. theta energy: -29.299 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -323.378127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.378127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.600244 (E_RNA) where: Base-Base interactions energy: -212.977 where: short stacking energy: -102.463 Base-Backbone interact. energy: -0.219 local terms energy: -110.404043 where: bonds (distance) C4'-P energy: -17.016 bonds (distance) P-C4' energy: -27.125 flat angles C4'-P-C4' energy: -26.615 flat angles P-C4'-P energy: -18.132 tors. eta vs tors. theta energy: -21.515 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -243.488064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.488064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.566675 (E_RNA) where: Base-Base interactions energy: -138.184 where: short stacking energy: -71.637 Base-Backbone interact. energy: -2.116 local terms energy: -103.267395 where: bonds (distance) C4'-P energy: -25.325 bonds (distance) P-C4' energy: -26.167 flat angles C4'-P-C4' energy: -24.988 flat angles P-C4'-P energy: -13.027 tors. eta vs tors. theta energy: -13.761 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -243.686012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.686012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.697295 (E_RNA) where: Base-Base interactions energy: -154.766 where: short stacking energy: -80.888 Base-Backbone interact. energy: -0.266 local terms energy: -88.664662 where: bonds (distance) C4'-P energy: -17.465 bonds (distance) P-C4' energy: -20.749 flat angles C4'-P-C4' energy: -18.410 flat angles P-C4'-P energy: -17.651 tors. eta vs tors. theta energy: -14.391 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -220.214300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.214300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.478630 (E_RNA) where: Base-Base interactions energy: -132.983 where: short stacking energy: -74.680 Base-Backbone interact. energy: -0.997 local terms energy: -86.498406 where: bonds (distance) C4'-P energy: -14.592 bonds (distance) P-C4' energy: -24.183 flat angles C4'-P-C4' energy: -24.892 flat angles P-C4'-P energy: -10.424 tors. eta vs tors. theta energy: -12.407 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -204.255619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.255619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.496693 (E_RNA) where: Base-Base interactions energy: -117.251 where: short stacking energy: -63.260 Base-Backbone interact. energy: -0.162 local terms energy: -87.084050 where: bonds (distance) C4'-P energy: -17.708 bonds (distance) P-C4' energy: -24.173 flat angles C4'-P-C4' energy: -22.772 flat angles P-C4'-P energy: -9.812 tors. eta vs tors. theta energy: -12.619 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -198.178374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.178374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.549008 (E_RNA) where: Base-Base interactions energy: -113.312 where: short stacking energy: -60.771 Base-Backbone interact. energy: -0.303 local terms energy: -84.934425 where: bonds (distance) C4'-P energy: -24.688 bonds (distance) P-C4' energy: -23.058 flat angles C4'-P-C4' energy: -19.243 flat angles P-C4'-P energy: -10.519 tors. eta vs tors. theta energy: -7.427 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -377.367610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.367610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.413833 (E_RNA) where: Base-Base interactions energy: -245.025 where: short stacking energy: -121.246 Base-Backbone interact. energy: -0.749 local terms energy: -131.640073 where: bonds (distance) C4'-P energy: -26.269 bonds (distance) P-C4' energy: -29.306 flat angles C4'-P-C4' energy: -23.647 flat angles P-C4'-P energy: -21.608 tors. eta vs tors. theta energy: -30.810 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -354.414917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.414917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.414917 (E_RNA) where: Base-Base interactions energy: -239.291 where: short stacking energy: -118.098 Base-Backbone interact. energy: -1.558 local terms energy: -113.566316 where: bonds (distance) C4'-P energy: -19.106 bonds (distance) P-C4' energy: -25.113 flat angles C4'-P-C4' energy: -21.347 flat angles P-C4'-P energy: -17.027 tors. eta vs tors. theta energy: -30.973 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -337.532141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.532141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.600528 (E_RNA) where: Base-Base interactions energy: -229.086 where: short stacking energy: -102.037 Base-Backbone interact. energy: -0.258 local terms energy: -108.257409 where: bonds (distance) C4'-P energy: -17.653 bonds (distance) P-C4' energy: -22.479 flat angles C4'-P-C4' energy: -28.099 flat angles P-C4'-P energy: -15.865 tors. eta vs tors. theta energy: -24.162 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -344.575042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.575042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.575042 (E_RNA) where: Base-Base interactions energy: -232.181 where: short stacking energy: -113.342 Base-Backbone interact. energy: -0.739 local terms energy: -111.654990 where: bonds (distance) C4'-P energy: -15.626 bonds (distance) P-C4' energy: -25.229 flat angles C4'-P-C4' energy: -22.240 flat angles P-C4'-P energy: -20.681 tors. eta vs tors. theta energy: -27.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -328.350594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.350594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.371649 (E_RNA) where: Base-Base interactions energy: -219.267 where: short stacking energy: -107.796 Base-Backbone interact. energy: -1.117 local terms energy: -107.987727 where: bonds (distance) C4'-P energy: -19.162 bonds (distance) P-C4' energy: -26.228 flat angles C4'-P-C4' energy: -20.833 flat angles P-C4'-P energy: -15.976 tors. eta vs tors. theta energy: -25.789 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -232.708456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.708456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.855441 (E_RNA) where: Base-Base interactions energy: -141.662 where: short stacking energy: -69.779 Base-Backbone interact. energy: -1.529 local terms energy: -89.664595 where: bonds (distance) C4'-P energy: -22.613 bonds (distance) P-C4' energy: -24.223 flat angles C4'-P-C4' energy: -23.216 flat angles P-C4'-P energy: -11.881 tors. eta vs tors. theta energy: -7.731 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -226.095765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.095765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.234557 (E_RNA) where: Base-Base interactions energy: -132.958 where: short stacking energy: -70.950 Base-Backbone interact. energy: -0.286 local terms energy: -92.990515 where: bonds (distance) C4'-P energy: -20.742 bonds (distance) P-C4' energy: -23.374 flat angles C4'-P-C4' energy: -19.093 flat angles P-C4'-P energy: -17.956 tors. eta vs tors. theta energy: -11.825 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -214.275411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.275411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.275411 (E_RNA) where: Base-Base interactions energy: -122.855 where: short stacking energy: -69.146 Base-Backbone interact. energy: -0.166 local terms energy: -91.254348 where: bonds (distance) C4'-P energy: -24.277 bonds (distance) P-C4' energy: -19.696 flat angles C4'-P-C4' energy: -22.628 flat angles P-C4'-P energy: -12.273 tors. eta vs tors. theta energy: -12.380 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -203.718824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.718824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.854779 (E_RNA) where: Base-Base interactions energy: -118.260 where: short stacking energy: -66.514 Base-Backbone interact. energy: -0.402 local terms energy: -85.192748 where: bonds (distance) C4'-P energy: -23.501 bonds (distance) P-C4' energy: -20.846 flat angles C4'-P-C4' energy: -19.935 flat angles P-C4'-P energy: -10.457 tors. eta vs tors. theta energy: -10.453 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -199.612998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.612998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.735193 (E_RNA) where: Base-Base interactions energy: -112.013 where: short stacking energy: -60.369 Base-Backbone interact. energy: -0.295 local terms energy: -87.427318 where: bonds (distance) C4'-P energy: -20.443 bonds (distance) P-C4' energy: -21.400 flat angles C4'-P-C4' energy: -18.327 flat angles P-C4'-P energy: -13.491 tors. eta vs tors. theta energy: -13.767 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -368.804092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.804092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.827596 (E_RNA) where: Base-Base interactions energy: -248.441 where: short stacking energy: -117.611 Base-Backbone interact. energy: -0.719 local terms energy: -119.668303 where: bonds (distance) C4'-P energy: -22.869 bonds (distance) P-C4' energy: -22.218 flat angles C4'-P-C4' energy: -27.306 flat angles P-C4'-P energy: -18.937 tors. eta vs tors. theta energy: -28.338 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -368.849294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.849294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.881885 (E_RNA) where: Base-Base interactions energy: -243.521 where: short stacking energy: -117.085 Base-Backbone interact. energy: -0.711 local terms energy: -124.650401 where: bonds (distance) C4'-P energy: -23.888 bonds (distance) P-C4' energy: -23.873 flat angles C4'-P-C4' energy: -27.555 flat angles P-C4'-P energy: -19.161 tors. eta vs tors. theta energy: -30.173 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -358.267195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.267195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.267195 (E_RNA) where: Base-Base interactions energy: -243.165 where: short stacking energy: -120.111 Base-Backbone interact. energy: -0.133 local terms energy: -114.968677 where: bonds (distance) C4'-P energy: -26.649 bonds (distance) P-C4' energy: -23.985 flat angles C4'-P-C4' energy: -22.115 flat angles P-C4'-P energy: -15.648 tors. eta vs tors. theta energy: -26.572 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -336.819188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.819188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.821023 (E_RNA) where: Base-Base interactions energy: -224.300 where: short stacking energy: -106.147 Base-Backbone interact. energy: -0.376 local terms energy: -112.145850 where: bonds (distance) C4'-P energy: -24.981 bonds (distance) P-C4' energy: -18.930 flat angles C4'-P-C4' energy: -22.726 flat angles P-C4'-P energy: -17.346 tors. eta vs tors. theta energy: -28.163 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -338.247590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.247590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.328178 (E_RNA) where: Base-Base interactions energy: -223.889 where: short stacking energy: -109.889 Base-Backbone interact. energy: 3.395 local terms energy: -117.834262 where: bonds (distance) C4'-P energy: -20.482 bonds (distance) P-C4' energy: -25.695 flat angles C4'-P-C4' energy: -23.246 flat angles P-C4'-P energy: -18.831 tors. eta vs tors. theta energy: -29.580 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -233.215949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.215949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.224568 (E_RNA) where: Base-Base interactions energy: -135.616 where: short stacking energy: -84.476 Base-Backbone interact. energy: -0.320 local terms energy: -97.289184 where: bonds (distance) C4'-P energy: -20.876 bonds (distance) P-C4' energy: -26.448 flat angles C4'-P-C4' energy: -20.495 flat angles P-C4'-P energy: -12.577 tors. eta vs tors. theta energy: -16.893 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -217.271381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.271381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.317707 (E_RNA) where: Base-Base interactions energy: -122.478 where: short stacking energy: -69.535 Base-Backbone interact. energy: -0.585 local terms energy: -94.254594 where: bonds (distance) C4'-P energy: -25.283 bonds (distance) P-C4' energy: -19.849 flat angles C4'-P-C4' energy: -22.224 flat angles P-C4'-P energy: -17.199 tors. eta vs tors. theta energy: -9.699 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -218.715293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.715293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.715293 (E_RNA) where: Base-Base interactions energy: -132.853 where: short stacking energy: -77.991 Base-Backbone interact. energy: -1.206 local terms energy: -84.656609 where: bonds (distance) C4'-P energy: -17.328 bonds (distance) P-C4' energy: -18.989 flat angles C4'-P-C4' energy: -23.833 flat angles P-C4'-P energy: -7.579 tors. eta vs tors. theta energy: -16.928 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -213.236920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.236920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.236920 (E_RNA) where: Base-Base interactions energy: -122.738 where: short stacking energy: -68.144 Base-Backbone interact. energy: -0.347 local terms energy: -90.152175 where: bonds (distance) C4'-P energy: -23.702 bonds (distance) P-C4' energy: -26.178 flat angles C4'-P-C4' energy: -22.044 flat angles P-C4'-P energy: -7.504 tors. eta vs tors. theta energy: -10.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -194.952609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.952609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.048641 (E_RNA) where: Base-Base interactions energy: -116.136 where: short stacking energy: -61.197 Base-Backbone interact. energy: -0.848 local terms energy: -78.064617 where: bonds (distance) C4'-P energy: -14.009 bonds (distance) P-C4' energy: -19.625 flat angles C4'-P-C4' energy: -19.953 flat angles P-C4'-P energy: -14.395 tors. eta vs tors. theta energy: -10.083 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -374.011800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.011800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.143437 (E_RNA) where: Base-Base interactions energy: -252.808 where: short stacking energy: -122.028 Base-Backbone interact. energy: -1.502 local terms energy: -119.833933 where: bonds (distance) C4'-P energy: -19.808 bonds (distance) P-C4' energy: -25.384 flat angles C4'-P-C4' energy: -27.474 flat angles P-C4'-P energy: -17.096 tors. eta vs tors. theta energy: -30.072 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -365.794083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.794083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.807932 (E_RNA) where: Base-Base interactions energy: -249.420 where: short stacking energy: -120.240 Base-Backbone interact. energy: -0.373 local terms energy: -116.014919 where: bonds (distance) C4'-P energy: -18.069 bonds (distance) P-C4' energy: -25.079 flat angles C4'-P-C4' energy: -24.287 flat angles P-C4'-P energy: -19.271 tors. eta vs tors. theta energy: -29.309 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -370.119602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.119602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.119602 (E_RNA) where: Base-Base interactions energy: -261.813 where: short stacking energy: -122.340 Base-Backbone interact. energy: -0.134 local terms energy: -108.172263 where: bonds (distance) C4'-P energy: -23.120 bonds (distance) P-C4' energy: -17.161 flat angles C4'-P-C4' energy: -24.203 flat angles P-C4'-P energy: -14.135 tors. eta vs tors. theta energy: -29.553 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -335.886520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.886520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.887811 (E_RNA) where: Base-Base interactions energy: -225.676 where: short stacking energy: -113.859 Base-Backbone interact. energy: -1.453 local terms energy: -108.759602 where: bonds (distance) C4'-P energy: -19.682 bonds (distance) P-C4' energy: -21.651 flat angles C4'-P-C4' energy: -18.306 flat angles P-C4'-P energy: -21.096 tors. eta vs tors. theta energy: -28.025 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -328.983773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.983773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.002972 (E_RNA) where: Base-Base interactions energy: -229.149 where: short stacking energy: -111.930 Base-Backbone interact. energy: 3.694 local terms energy: -103.548092 where: bonds (distance) C4'-P energy: -18.916 bonds (distance) P-C4' energy: -22.430 flat angles C4'-P-C4' energy: -21.433 flat angles P-C4'-P energy: -16.050 tors. eta vs tors. theta energy: -24.718 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -240.894665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.894665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.894665 (E_RNA) where: Base-Base interactions energy: -139.995 where: short stacking energy: -72.002 Base-Backbone interact. energy: -0.291 local terms energy: -100.608470 where: bonds (distance) C4'-P energy: -25.171 bonds (distance) P-C4' energy: -19.657 flat angles C4'-P-C4' energy: -21.025 flat angles P-C4'-P energy: -14.755 tors. eta vs tors. theta energy: -20.001 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -231.064990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.064990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.119054 (E_RNA) where: Base-Base interactions energy: -150.341 where: short stacking energy: -74.753 Base-Backbone interact. energy: -1.062 local terms energy: -79.716048 where: bonds (distance) C4'-P energy: -18.203 bonds (distance) P-C4' energy: -23.479 flat angles C4'-P-C4' energy: -12.703 flat angles P-C4'-P energy: -15.075 tors. eta vs tors. theta energy: -10.256 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -214.631931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.631931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.681308 (E_RNA) where: Base-Base interactions energy: -124.185 where: short stacking energy: -66.717 Base-Backbone interact. energy: -1.090 local terms energy: -89.405551 where: bonds (distance) C4'-P energy: -21.313 bonds (distance) P-C4' energy: -21.417 flat angles C4'-P-C4' energy: -22.582 flat angles P-C4'-P energy: -10.224 tors. eta vs tors. theta energy: -13.870 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -215.940751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.940751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.041411 (E_RNA) where: Base-Base interactions energy: -132.653 where: short stacking energy: -77.697 Base-Backbone interact. energy: -1.814 local terms energy: -81.574582 where: bonds (distance) C4'-P energy: -18.834 bonds (distance) P-C4' energy: -19.390 flat angles C4'-P-C4' energy: -16.553 flat angles P-C4'-P energy: -13.683 tors. eta vs tors. theta energy: -13.115 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -183.437528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.437528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.503614 (E_RNA) where: Base-Base interactions energy: -117.914 where: short stacking energy: -68.806 Base-Backbone interact. energy: -0.170 local terms energy: -65.419349 where: bonds (distance) C4'-P energy: -22.555 bonds (distance) P-C4' energy: -10.308 flat angles C4'-P-C4' energy: -10.347 flat angles P-C4'-P energy: -9.492 tors. eta vs tors. theta energy: -12.717 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -372.983341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.983341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.983341 (E_RNA) where: Base-Base interactions energy: -249.534 where: short stacking energy: -125.429 Base-Backbone interact. energy: -0.789 local terms energy: -122.660675 where: bonds (distance) C4'-P energy: -18.500 bonds (distance) P-C4' energy: -26.120 flat angles C4'-P-C4' energy: -25.809 flat angles P-C4'-P energy: -19.521 tors. eta vs tors. theta energy: -32.711 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -370.025630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.025630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.046468 (E_RNA) where: Base-Base interactions energy: -253.307 where: short stacking energy: -113.707 Base-Backbone interact. energy: -1.172 local terms energy: -115.567547 where: bonds (distance) C4'-P energy: -23.520 bonds (distance) P-C4' energy: -24.707 flat angles C4'-P-C4' energy: -27.335 flat angles P-C4'-P energy: -15.040 tors. eta vs tors. theta energy: -24.965 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -366.835787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.835787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.842013 (E_RNA) where: Base-Base interactions energy: -247.465 where: short stacking energy: -108.758 Base-Backbone interact. energy: -0.230 local terms energy: -119.146406 where: bonds (distance) C4'-P energy: -20.412 bonds (distance) P-C4' energy: -25.328 flat angles C4'-P-C4' energy: -23.955 flat angles P-C4'-P energy: -17.096 tors. eta vs tors. theta energy: -32.356 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -339.736384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.736384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.776883 (E_RNA) where: Base-Base interactions energy: -225.026 where: short stacking energy: -107.615 Base-Backbone interact. energy: -2.496 local terms energy: -112.255005 where: bonds (distance) C4'-P energy: -18.768 bonds (distance) P-C4' energy: -24.576 flat angles C4'-P-C4' energy: -23.687 flat angles P-C4'-P energy: -14.959 tors. eta vs tors. theta energy: -30.264 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -343.560572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.560572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.591707 (E_RNA) where: Base-Base interactions energy: -229.453 where: short stacking energy: -109.141 Base-Backbone interact. energy: 0.777 local terms energy: -114.916201 where: bonds (distance) C4'-P energy: -24.782 bonds (distance) P-C4' energy: -20.291 flat angles C4'-P-C4' energy: -24.235 flat angles P-C4'-P energy: -20.324 tors. eta vs tors. theta energy: -25.284 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -241.492760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.492760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.533738 (E_RNA) where: Base-Base interactions energy: -138.613 where: short stacking energy: -83.338 Base-Backbone interact. energy: -1.279 local terms energy: -101.641707 where: bonds (distance) C4'-P energy: -23.828 bonds (distance) P-C4' energy: -16.803 flat angles C4'-P-C4' energy: -25.371 flat angles P-C4'-P energy: -14.770 tors. eta vs tors. theta energy: -20.870 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -230.370685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.370685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.433285 (E_RNA) where: Base-Base interactions energy: -142.437 where: short stacking energy: -63.674 Base-Backbone interact. energy: -1.209 local terms energy: -86.787602 where: bonds (distance) C4'-P energy: -24.046 bonds (distance) P-C4' energy: -20.058 flat angles C4'-P-C4' energy: -19.200 flat angles P-C4'-P energy: -16.585 tors. eta vs tors. theta energy: -6.900 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -221.673126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.673126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.773546 (E_RNA) where: Base-Base interactions energy: -127.924 where: short stacking energy: -76.053 Base-Backbone interact. energy: -0.584 local terms energy: -93.266339 where: bonds (distance) C4'-P energy: -19.152 bonds (distance) P-C4' energy: -25.729 flat angles C4'-P-C4' energy: -23.667 flat angles P-C4'-P energy: -14.847 tors. eta vs tors. theta energy: -9.871 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -204.694694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.694694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.173990 (E_RNA) where: Base-Base interactions energy: -113.951 where: short stacking energy: -63.794 Base-Backbone interact. energy: 3.858 local terms energy: -95.080825 where: bonds (distance) C4'-P energy: -22.447 bonds (distance) P-C4' energy: -20.659 flat angles C4'-P-C4' energy: -22.612 flat angles P-C4'-P energy: -18.799 tors. eta vs tors. theta energy: -10.563 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -199.912653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.912653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.003314 (E_RNA) where: Base-Base interactions energy: -115.841 where: short stacking energy: -66.647 Base-Backbone interact. energy: -0.157 local terms energy: -84.005520 where: bonds (distance) C4'-P energy: -23.512 bonds (distance) P-C4' energy: -11.115 flat angles C4'-P-C4' energy: -23.018 flat angles P-C4'-P energy: -8.594 tors. eta vs tors. theta energy: -17.767 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -369.418395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.418395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.421667 (E_RNA) where: Base-Base interactions energy: -245.243 where: short stacking energy: -123.723 Base-Backbone interact. energy: -1.312 local terms energy: -122.866590 where: bonds (distance) C4'-P energy: -25.139 bonds (distance) P-C4' energy: -20.442 flat angles C4'-P-C4' energy: -26.955 flat angles P-C4'-P energy: -21.227 tors. eta vs tors. theta energy: -29.104 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -372.920608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.920608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.936560 (E_RNA) where: Base-Base interactions energy: -250.309 where: short stacking energy: -115.481 Base-Backbone interact. energy: -0.309 local terms energy: -122.318620 where: bonds (distance) C4'-P energy: -25.271 bonds (distance) P-C4' energy: -25.268 flat angles C4'-P-C4' energy: -27.885 flat angles P-C4'-P energy: -15.281 tors. eta vs tors. theta energy: -28.614 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -356.902246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.902246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.902246 (E_RNA) where: Base-Base interactions energy: -240.023 where: short stacking energy: -110.367 Base-Backbone interact. energy: 0.240 local terms energy: -117.119378 where: bonds (distance) C4'-P energy: -23.607 bonds (distance) P-C4' energy: -28.411 flat angles C4'-P-C4' energy: -24.131 flat angles P-C4'-P energy: -14.365 tors. eta vs tors. theta energy: -26.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -341.473258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.473258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.748604 (E_RNA) where: Base-Base interactions energy: -215.306 where: short stacking energy: -112.578 Base-Backbone interact. energy: -1.859 local terms energy: -124.583158 where: bonds (distance) C4'-P energy: -27.618 bonds (distance) P-C4' energy: -24.974 flat angles C4'-P-C4' energy: -23.491 flat angles P-C4'-P energy: -17.620 tors. eta vs tors. theta energy: -30.880 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -325.563944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.563944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.631206 (E_RNA) where: Base-Base interactions energy: -215.911 where: short stacking energy: -105.338 Base-Backbone interact. energy: 0.308 local terms energy: -110.028226 where: bonds (distance) C4'-P energy: -26.182 bonds (distance) P-C4' energy: -24.904 flat angles C4'-P-C4' energy: -18.272 flat angles P-C4'-P energy: -15.858 tors. eta vs tors. theta energy: -24.812 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -244.924362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.924362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.924362 (E_RNA) where: Base-Base interactions energy: -140.393 where: short stacking energy: -87.327 Base-Backbone interact. energy: -0.456 local terms energy: -104.075250 where: bonds (distance) C4'-P energy: -25.649 bonds (distance) P-C4' energy: -20.973 flat angles C4'-P-C4' energy: -23.594 flat angles P-C4'-P energy: -13.370 tors. eta vs tors. theta energy: -20.490 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -246.926282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.926282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.993872 (E_RNA) where: Base-Base interactions energy: -165.386 where: short stacking energy: -71.079 Base-Backbone interact. energy: -0.542 local terms energy: -81.066245 where: bonds (distance) C4'-P energy: -22.227 bonds (distance) P-C4' energy: -20.183 flat angles C4'-P-C4' energy: -18.239 flat angles P-C4'-P energy: -7.708 tors. eta vs tors. theta energy: -12.708 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -223.576623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.576623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.717239 (E_RNA) where: Base-Base interactions energy: -141.233 where: short stacking energy: -72.050 Base-Backbone interact. energy: -0.682 local terms energy: -81.802926 where: bonds (distance) C4'-P energy: -14.821 bonds (distance) P-C4' energy: -24.518 flat angles C4'-P-C4' energy: -22.208 flat angles P-C4'-P energy: -7.838 tors. eta vs tors. theta energy: -12.417 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -215.720758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.720758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.921695 (E_RNA) where: Base-Base interactions energy: -123.126 where: short stacking energy: -64.855 Base-Backbone interact. energy: -1.034 local terms energy: -91.761139 where: bonds (distance) C4'-P energy: -22.231 bonds (distance) P-C4' energy: -19.726 flat angles C4'-P-C4' energy: -19.444 flat angles P-C4'-P energy: -15.714 tors. eta vs tors. theta energy: -14.646 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -198.934200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.934200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.977959 (E_RNA) where: Base-Base interactions energy: -106.288 where: short stacking energy: -54.768 Base-Backbone interact. energy: 1.846 local terms energy: -94.535345 where: bonds (distance) C4'-P energy: -21.559 bonds (distance) P-C4' energy: -22.082 flat angles C4'-P-C4' energy: -27.139 flat angles P-C4'-P energy: -11.287 tors. eta vs tors. theta energy: -12.469 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -373.472307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.472307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.472307 (E_RNA) where: Base-Base interactions energy: -246.629 where: short stacking energy: -119.553 Base-Backbone interact. energy: -0.946 local terms energy: -125.897692 where: bonds (distance) C4'-P energy: -22.199 bonds (distance) P-C4' energy: -22.324 flat angles C4'-P-C4' energy: -27.564 flat angles P-C4'-P energy: -21.536 tors. eta vs tors. theta energy: -32.276 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -367.598318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.598318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.336154 (E_RNA) where: Base-Base interactions energy: -244.743 where: short stacking energy: -114.319 Base-Backbone interact. energy: 0.247 local terms energy: -123.841029 where: bonds (distance) C4'-P energy: -22.650 bonds (distance) P-C4' energy: -25.075 flat angles C4'-P-C4' energy: -27.719 flat angles P-C4'-P energy: -19.732 tors. eta vs tors. theta energy: -28.663 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -351.529193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.529193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.601438 (E_RNA) where: Base-Base interactions energy: -248.738 where: short stacking energy: -114.602 Base-Backbone interact. energy: -0.386 local terms energy: -102.477881 where: bonds (distance) C4'-P energy: -17.323 bonds (distance) P-C4' energy: -19.552 flat angles C4'-P-C4' energy: -24.156 flat angles P-C4'-P energy: -16.586 tors. eta vs tors. theta energy: -24.862 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -348.083503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.083503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.138640 (E_RNA) where: Base-Base interactions energy: -233.665 where: short stacking energy: -110.157 Base-Backbone interact. energy: -0.193 local terms energy: -114.280217 where: bonds (distance) C4'-P energy: -22.784 bonds (distance) P-C4' energy: -22.888 flat angles C4'-P-C4' energy: -23.526 flat angles P-C4'-P energy: -15.032 tors. eta vs tors. theta energy: -30.051 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -340.484355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.484355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.506426 (E_RNA) where: Base-Base interactions energy: -224.366 where: short stacking energy: -116.470 Base-Backbone interact. energy: 0.532 local terms energy: -116.671887 where: bonds (distance) C4'-P energy: -23.141 bonds (distance) P-C4' energy: -23.221 flat angles C4'-P-C4' energy: -23.311 flat angles P-C4'-P energy: -16.941 tors. eta vs tors. theta energy: -30.058 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -233.339475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.339475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.423621 (E_RNA) where: Base-Base interactions energy: -134.169 where: short stacking energy: -74.379 Base-Backbone interact. energy: -0.412 local terms energy: -98.842585 where: bonds (distance) C4'-P energy: -26.435 bonds (distance) P-C4' energy: -18.883 flat angles C4'-P-C4' energy: -26.904 flat angles P-C4'-P energy: -13.288 tors. eta vs tors. theta energy: -13.333 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -252.653585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.653585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.780557 (E_RNA) where: Base-Base interactions energy: -155.783 where: short stacking energy: -72.798 Base-Backbone interact. energy: 0.321 local terms energy: -97.318868 where: bonds (distance) C4'-P energy: -22.623 bonds (distance) P-C4' energy: -23.762 flat angles C4'-P-C4' energy: -25.648 flat angles P-C4'-P energy: -9.486 tors. eta vs tors. theta energy: -15.800 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -255.583921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.583921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.593505 (E_RNA) where: Base-Base interactions energy: -163.632 where: short stacking energy: -84.095 Base-Backbone interact. energy: -1.126 local terms energy: -90.835348 where: bonds (distance) C4'-P energy: -24.599 bonds (distance) P-C4' energy: -17.604 flat angles C4'-P-C4' energy: -19.860 flat angles P-C4'-P energy: -9.342 tors. eta vs tors. theta energy: -19.430 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -204.010868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.010868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.184563 (E_RNA) where: Base-Base interactions energy: -113.597 where: short stacking energy: -59.180 Base-Backbone interact. energy: -0.051 local terms energy: -90.536950 where: bonds (distance) C4'-P energy: -27.267 bonds (distance) P-C4' energy: -23.387 flat angles C4'-P-C4' energy: -16.139 flat angles P-C4'-P energy: -15.103 tors. eta vs tors. theta energy: -8.641 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -195.089993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.089993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.135074 (E_RNA) where: Base-Base interactions energy: -113.117 where: short stacking energy: -55.685 Base-Backbone interact. energy: 0.076 local terms energy: -82.094357 where: bonds (distance) C4'-P energy: -26.777 bonds (distance) P-C4' energy: -17.585 flat angles C4'-P-C4' energy: -22.076 flat angles P-C4'-P energy: -11.583 tors. eta vs tors. theta energy: -4.074 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -378.535330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.535330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.554038 (E_RNA) where: Base-Base interactions energy: -254.474 where: short stacking energy: -121.076 Base-Backbone interact. energy: -2.270 local terms energy: -121.810259 where: bonds (distance) C4'-P energy: -24.012 bonds (distance) P-C4' energy: -19.662 flat angles C4'-P-C4' energy: -24.945 flat angles P-C4'-P energy: -18.268 tors. eta vs tors. theta energy: -34.924 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -370.284452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.284452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.302404 (E_RNA) where: Base-Base interactions energy: -256.571 where: short stacking energy: -116.180 Base-Backbone interact. energy: -0.933 local terms energy: -112.798275 where: bonds (distance) C4'-P energy: -20.267 bonds (distance) P-C4' energy: -23.452 flat angles C4'-P-C4' energy: -26.289 flat angles P-C4'-P energy: -11.857 tors. eta vs tors. theta energy: -30.934 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -356.359923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.359923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.382960 (E_RNA) where: Base-Base interactions energy: -236.955 where: short stacking energy: -111.713 Base-Backbone interact. energy: -0.754 local terms energy: -118.674154 where: bonds (distance) C4'-P energy: -21.822 bonds (distance) P-C4' energy: -20.961 flat angles C4'-P-C4' energy: -26.798 flat angles P-C4'-P energy: -17.512 tors. eta vs tors. theta energy: -31.581 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -334.145859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.145859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.146970 (E_RNA) where: Base-Base interactions energy: -214.006 where: short stacking energy: -98.150 Base-Backbone interact. energy: -0.728 local terms energy: -119.413052 where: bonds (distance) C4'-P energy: -15.068 bonds (distance) P-C4' energy: -25.061 flat angles C4'-P-C4' energy: -26.979 flat angles P-C4'-P energy: -22.213 tors. eta vs tors. theta energy: -30.091 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -321.440359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.440359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.463898 (E_RNA) where: Base-Base interactions energy: -208.831 where: short stacking energy: -94.095 Base-Backbone interact. energy: -0.964 local terms energy: -111.669060 where: bonds (distance) C4'-P energy: -21.098 bonds (distance) P-C4' energy: -25.088 flat angles C4'-P-C4' energy: -27.765 flat angles P-C4'-P energy: -16.288 tors. eta vs tors. theta energy: -21.431 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -257.899182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.899182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.926417 (E_RNA) where: Base-Base interactions energy: -157.904 where: short stacking energy: -82.448 Base-Backbone interact. energy: -1.575 local terms energy: -98.446962 where: bonds (distance) C4'-P energy: -21.438 bonds (distance) P-C4' energy: -20.467 flat angles C4'-P-C4' energy: -23.779 flat angles P-C4'-P energy: -14.910 tors. eta vs tors. theta energy: -17.852 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -227.266970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.266970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.276321 (E_RNA) where: Base-Base interactions energy: -126.575 where: short stacking energy: -76.488 Base-Backbone interact. energy: -0.064 local terms energy: -100.637534 where: bonds (distance) C4'-P energy: -23.226 bonds (distance) P-C4' energy: -23.650 flat angles C4'-P-C4' energy: -23.441 flat angles P-C4'-P energy: -10.991 tors. eta vs tors. theta energy: -19.329 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -213.170081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.170081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.359127 (E_RNA) where: Base-Base interactions energy: -127.875 where: short stacking energy: -78.331 Base-Backbone interact. energy: -1.257 local terms energy: -84.226490 where: bonds (distance) C4'-P energy: -7.137 bonds (distance) P-C4' energy: -22.667 flat angles C4'-P-C4' energy: -20.902 flat angles P-C4'-P energy: -17.194 tors. eta vs tors. theta energy: -16.325 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -217.256746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.256746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.398501 (E_RNA) where: Base-Base interactions energy: -124.301 where: short stacking energy: -73.663 Base-Backbone interact. energy: -0.503 local terms energy: -92.594263 where: bonds (distance) C4'-P energy: -10.706 bonds (distance) P-C4' energy: -26.776 flat angles C4'-P-C4' energy: -21.761 flat angles P-C4'-P energy: -14.451 tors. eta vs tors. theta energy: -18.900 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -202.104562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.104562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.208994 (E_RNA) where: Base-Base interactions energy: -123.564 where: short stacking energy: -72.582 Base-Backbone interact. energy: -0.560 local terms energy: -78.085930 where: bonds (distance) C4'-P energy: -13.778 bonds (distance) P-C4' energy: -18.242 flat angles C4'-P-C4' energy: -16.056 flat angles P-C4'-P energy: -17.485 tors. eta vs tors. theta energy: -12.526 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -378.031720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.031720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.035291 (E_RNA) where: Base-Base interactions energy: -255.772 where: short stacking energy: -113.551 Base-Backbone interact. energy: -0.722 local terms energy: -121.541662 where: bonds (distance) C4'-P energy: -22.431 bonds (distance) P-C4' energy: -24.668 flat angles C4'-P-C4' energy: -27.017 flat angles P-C4'-P energy: -17.211 tors. eta vs tors. theta energy: -30.214 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -380.991142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.991142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.005379 (E_RNA) where: Base-Base interactions energy: -248.512 where: short stacking energy: -119.740 Base-Backbone interact. energy: -0.310 local terms energy: -132.183220 where: bonds (distance) C4'-P energy: -27.618 bonds (distance) P-C4' energy: -28.383 flat angles C4'-P-C4' energy: -23.851 flat angles P-C4'-P energy: -14.394 tors. eta vs tors. theta energy: -37.937 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -355.883788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.883788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.197129 (E_RNA) where: Base-Base interactions energy: -229.371 where: short stacking energy: -118.375 Base-Backbone interact. energy: 0.625 local terms energy: -127.451077 where: bonds (distance) C4'-P energy: -23.005 bonds (distance) P-C4' energy: -27.294 flat angles C4'-P-C4' energy: -26.582 flat angles P-C4'-P energy: -16.370 tors. eta vs tors. theta energy: -34.199 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -338.071750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.071750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.110200 (E_RNA) where: Base-Base interactions energy: -215.935 where: short stacking energy: -104.426 Base-Backbone interact. energy: -0.243 local terms energy: -121.932758 where: bonds (distance) C4'-P energy: -25.613 bonds (distance) P-C4' energy: -23.699 flat angles C4'-P-C4' energy: -22.138 flat angles P-C4'-P energy: -19.642 tors. eta vs tors. theta energy: -30.842 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -329.807992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.807992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.815105 (E_RNA) where: Base-Base interactions energy: -221.452 where: short stacking energy: -107.519 Base-Backbone interact. energy: -0.818 local terms energy: -107.545268 where: bonds (distance) C4'-P energy: -20.825 bonds (distance) P-C4' energy: -23.226 flat angles C4'-P-C4' energy: -25.971 flat angles P-C4'-P energy: -13.081 tors. eta vs tors. theta energy: -24.442 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -250.601807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.601807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.830519 (E_RNA) where: Base-Base interactions energy: -149.816 where: short stacking energy: -93.838 Base-Backbone interact. energy: -1.186 local terms energy: -99.828647 where: bonds (distance) C4'-P energy: -18.820 bonds (distance) P-C4' energy: -26.495 flat angles C4'-P-C4' energy: -20.594 flat angles P-C4'-P energy: -11.048 tors. eta vs tors. theta energy: -22.872 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -242.729202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.729202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.859334 (E_RNA) where: Base-Base interactions energy: -147.167 where: short stacking energy: -93.252 Base-Backbone interact. energy: -0.178 local terms energy: -95.515222 where: bonds (distance) C4'-P energy: -18.643 bonds (distance) P-C4' energy: -17.182 flat angles C4'-P-C4' energy: -23.677 flat angles P-C4'-P energy: -18.220 tors. eta vs tors. theta energy: -17.794 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -224.383075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.383075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.383075 (E_RNA) where: Base-Base interactions energy: -136.244 where: short stacking energy: -68.603 Base-Backbone interact. energy: -0.349 local terms energy: -87.790200 where: bonds (distance) C4'-P energy: -20.871 bonds (distance) P-C4' energy: -21.036 flat angles C4'-P-C4' energy: -19.827 flat angles P-C4'-P energy: -9.669 tors. eta vs tors. theta energy: -16.388 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -218.471576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.471576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.486057 (E_RNA) where: Base-Base interactions energy: -132.737 where: short stacking energy: -73.998 Base-Backbone interact. energy: 0.181 local terms energy: -85.929999 where: bonds (distance) C4'-P energy: -23.835 bonds (distance) P-C4' energy: -14.061 flat angles C4'-P-C4' energy: -16.255 flat angles P-C4'-P energy: -18.488 tors. eta vs tors. theta energy: -13.291 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -212.955720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.955720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.055899 (E_RNA) where: Base-Base interactions energy: -136.507 where: short stacking energy: -68.139 Base-Backbone interact. energy: 0.393 local terms energy: -76.941582 where: bonds (distance) C4'-P energy: -13.070 bonds (distance) P-C4' energy: -19.303 flat angles C4'-P-C4' energy: -18.259 flat angles P-C4'-P energy: -15.702 tors. eta vs tors. theta energy: -10.606 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -377.483371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.483371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.486372 (E_RNA) where: Base-Base interactions energy: -255.066 where: short stacking energy: -109.268 Base-Backbone interact. energy: -1.105 local terms energy: -121.315487 where: bonds (distance) C4'-P energy: -23.645 bonds (distance) P-C4' energy: -26.990 flat angles C4'-P-C4' energy: -26.041 flat angles P-C4'-P energy: -16.320 tors. eta vs tors. theta energy: -28.319 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -368.982231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.982231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.990305 (E_RNA) where: Base-Base interactions energy: -245.652 where: short stacking energy: -113.395 Base-Backbone interact. energy: -1.047 local terms energy: -122.290878 where: bonds (distance) C4'-P energy: -27.291 bonds (distance) P-C4' energy: -21.434 flat angles C4'-P-C4' energy: -28.354 flat angles P-C4'-P energy: -16.392 tors. eta vs tors. theta energy: -28.820 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -349.014721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.014721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.114226 (E_RNA) where: Base-Base interactions energy: -223.006 where: short stacking energy: -106.116 Base-Backbone interact. energy: -0.785 local terms energy: -125.323460 where: bonds (distance) C4'-P energy: -26.779 bonds (distance) P-C4' energy: -24.452 flat angles C4'-P-C4' energy: -27.417 flat angles P-C4'-P energy: -18.926 tors. eta vs tors. theta energy: -27.749 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -333.263697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.263697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.273574 (E_RNA) where: Base-Base interactions energy: -208.928 where: short stacking energy: -101.446 Base-Backbone interact. energy: -0.924 local terms energy: -123.422332 where: bonds (distance) C4'-P energy: -26.172 bonds (distance) P-C4' energy: -27.227 flat angles C4'-P-C4' energy: -26.573 flat angles P-C4'-P energy: -16.015 tors. eta vs tors. theta energy: -27.435 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -354.418874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.418874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.547027 (E_RNA) where: Base-Base interactions energy: -233.498 where: short stacking energy: -114.244 Base-Backbone interact. energy: -0.693 local terms energy: -120.355901 where: bonds (distance) C4'-P energy: -18.746 bonds (distance) P-C4' energy: -19.528 flat angles C4'-P-C4' energy: -29.471 flat angles P-C4'-P energy: -18.866 tors. eta vs tors. theta energy: -33.745 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -230.601029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.601029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.601029 (E_RNA) where: Base-Base interactions energy: -135.214 where: short stacking energy: -80.948 Base-Backbone interact. energy: -0.969 local terms energy: -94.417803 where: bonds (distance) C4'-P energy: -21.865 bonds (distance) P-C4' energy: -22.919 flat angles C4'-P-C4' energy: -22.457 flat angles P-C4'-P energy: -13.306 tors. eta vs tors. theta energy: -13.871 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -237.259388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.259388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.266555 (E_RNA) where: Base-Base interactions energy: -137.985 where: short stacking energy: -77.978 Base-Backbone interact. energy: -0.156 local terms energy: -99.126180 where: bonds (distance) C4'-P energy: -17.719 bonds (distance) P-C4' energy: -23.012 flat angles C4'-P-C4' energy: -20.817 flat angles P-C4'-P energy: -16.474 tors. eta vs tors. theta energy: -21.104 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -226.064726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.064726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.096100 (E_RNA) where: Base-Base interactions energy: -145.282 where: short stacking energy: -83.212 Base-Backbone interact. energy: -0.856 local terms energy: -79.958274 where: bonds (distance) C4'-P energy: -12.344 bonds (distance) P-C4' energy: -17.831 flat angles C4'-P-C4' energy: -16.775 flat angles P-C4'-P energy: -19.737 tors. eta vs tors. theta energy: -13.271 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -215.531632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.531632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.567846 (E_RNA) where: Base-Base interactions energy: -122.866 where: short stacking energy: -69.988 Base-Backbone interact. energy: -0.447 local terms energy: -92.254631 where: bonds (distance) C4'-P energy: -22.325 bonds (distance) P-C4' energy: -21.377 flat angles C4'-P-C4' energy: -20.628 flat angles P-C4'-P energy: -13.240 tors. eta vs tors. theta energy: -14.685 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -207.525494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.525494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.647780 (E_RNA) where: Base-Base interactions energy: -121.737 where: short stacking energy: -74.075 Base-Backbone interact. energy: 1.455 local terms energy: -87.365313 where: bonds (distance) C4'-P energy: -10.745 bonds (distance) P-C4' energy: -23.916 flat angles C4'-P-C4' energy: -20.968 flat angles P-C4'-P energy: -18.368 tors. eta vs tors. theta energy: -13.368 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -376.367055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.367055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.404137 (E_RNA) where: Base-Base interactions energy: -242.719 where: short stacking energy: -114.088 Base-Backbone interact. energy: -3.313 local terms energy: -130.372642 where: bonds (distance) C4'-P energy: -25.859 bonds (distance) P-C4' energy: -24.422 flat angles C4'-P-C4' energy: -27.665 flat angles P-C4'-P energy: -19.955 tors. eta vs tors. theta energy: -32.472 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -367.167892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.167892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.167892 (E_RNA) where: Base-Base interactions energy: -244.555 where: short stacking energy: -100.417 Base-Backbone interact. energy: -0.590 local terms energy: -122.022916 where: bonds (distance) C4'-P energy: -25.498 bonds (distance) P-C4' energy: -26.254 flat angles C4'-P-C4' energy: -25.878 flat angles P-C4'-P energy: -15.735 tors. eta vs tors. theta energy: -28.659 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -335.250229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.250229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.257065 (E_RNA) where: Base-Base interactions energy: -217.609 where: short stacking energy: -109.132 Base-Backbone interact. energy: -0.501 local terms energy: -117.146878 where: bonds (distance) C4'-P energy: -21.167 bonds (distance) P-C4' energy: -22.541 flat angles C4'-P-C4' energy: -25.670 flat angles P-C4'-P energy: -15.488 tors. eta vs tors. theta energy: -32.280 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -331.352562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.352562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.475612 (E_RNA) where: Base-Base interactions energy: -224.213 where: short stacking energy: -100.825 Base-Backbone interact. energy: -2.552 local terms energy: -104.710852 where: bonds (distance) C4'-P energy: -26.439 bonds (distance) P-C4' energy: -25.508 flat angles C4'-P-C4' energy: -18.667 flat angles P-C4'-P energy: -11.927 tors. eta vs tors. theta energy: -22.170 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -341.471498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.471498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.471498 (E_RNA) where: Base-Base interactions energy: -228.603 where: short stacking energy: -107.703 Base-Backbone interact. energy: -1.490 local terms energy: -111.378419 where: bonds (distance) C4'-P energy: -21.509 bonds (distance) P-C4' energy: -23.467 flat angles C4'-P-C4' energy: -24.507 flat angles P-C4'-P energy: -15.093 tors. eta vs tors. theta energy: -26.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -255.966984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.966984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.090208 (E_RNA) where: Base-Base interactions energy: -146.365 where: short stacking energy: -88.129 Base-Backbone interact. energy: -0.682 local terms energy: -109.043199 where: bonds (distance) C4'-P energy: -22.194 bonds (distance) P-C4' energy: -28.440 flat angles C4'-P-C4' energy: -18.392 flat angles P-C4'-P energy: -15.136 tors. eta vs tors. theta energy: -24.881 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -241.628204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.628204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.784372 (E_RNA) where: Base-Base interactions energy: -148.934 where: short stacking energy: -88.502 Base-Backbone interact. energy: -0.223 local terms energy: -92.626574 where: bonds (distance) C4'-P energy: -18.126 bonds (distance) P-C4' energy: -23.057 flat angles C4'-P-C4' energy: -20.404 flat angles P-C4'-P energy: -15.080 tors. eta vs tors. theta energy: -15.959 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -212.371586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.371586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.411873 (E_RNA) where: Base-Base interactions energy: -130.908 where: short stacking energy: -67.750 Base-Backbone interact. energy: -0.180 local terms energy: -81.323826 where: bonds (distance) C4'-P energy: -23.826 bonds (distance) P-C4' energy: -17.318 flat angles C4'-P-C4' energy: -18.846 flat angles P-C4'-P energy: -9.903 tors. eta vs tors. theta energy: -11.432 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -214.260739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.260739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.374194 (E_RNA) where: Base-Base interactions energy: -131.225 where: short stacking energy: -79.795 Base-Backbone interact. energy: 0.231 local terms energy: -83.380215 where: bonds (distance) C4'-P energy: -19.939 bonds (distance) P-C4' energy: -17.264 flat angles C4'-P-C4' energy: -20.061 flat angles P-C4'-P energy: -12.037 tors. eta vs tors. theta energy: -14.079 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -210.225500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.225500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.225500 (E_RNA) where: Base-Base interactions energy: -119.204 where: short stacking energy: -66.386 Base-Backbone interact. energy: -0.272 local terms energy: -90.749355 where: bonds (distance) C4'-P energy: -19.590 bonds (distance) P-C4' energy: -15.873 flat angles C4'-P-C4' energy: -21.406 flat angles P-C4'-P energy: -19.267 tors. eta vs tors. theta energy: -14.614 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -365.288964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.288964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.308361 (E_RNA) where: Base-Base interactions energy: -243.850 where: short stacking energy: -114.656 Base-Backbone interact. energy: -2.054 local terms energy: -119.404561 where: bonds (distance) C4'-P energy: -27.610 bonds (distance) P-C4' energy: -25.487 flat angles C4'-P-C4' energy: -26.964 flat angles P-C4'-P energy: -12.559 tors. eta vs tors. theta energy: -26.785 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -373.219737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.219737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.258076 (E_RNA) where: Base-Base interactions energy: -273.768 where: short stacking energy: -109.442 Base-Backbone interact. energy: -0.909 local terms energy: -98.580973 where: bonds (distance) C4'-P energy: -17.445 bonds (distance) P-C4' energy: -20.425 flat angles C4'-P-C4' energy: -20.122 flat angles P-C4'-P energy: -14.201 tors. eta vs tors. theta energy: -26.388 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -347.966634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.966634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.023015 (E_RNA) where: Base-Base interactions energy: -225.700 where: short stacking energy: -115.961 Base-Backbone interact. energy: 3.754 local terms energy: -126.077587 where: bonds (distance) C4'-P energy: -23.348 bonds (distance) P-C4' energy: -24.726 flat angles C4'-P-C4' energy: -27.876 flat angles P-C4'-P energy: -18.200 tors. eta vs tors. theta energy: -31.926 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -333.769306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.769306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.828010 (E_RNA) where: Base-Base interactions energy: -225.583 where: short stacking energy: -102.442 Base-Backbone interact. energy: -0.177 local terms energy: -108.068524 where: bonds (distance) C4'-P energy: -24.332 bonds (distance) P-C4' energy: -16.391 flat angles C4'-P-C4' energy: -25.360 flat angles P-C4'-P energy: -16.275 tors. eta vs tors. theta energy: -25.710 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -327.159409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.159409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.165786 (E_RNA) where: Base-Base interactions energy: -217.700 where: short stacking energy: -109.046 Base-Backbone interact. energy: -0.225 local terms energy: -109.240862 where: bonds (distance) C4'-P energy: -22.227 bonds (distance) P-C4' energy: -15.193 flat angles C4'-P-C4' energy: -24.639 flat angles P-C4'-P energy: -15.872 tors. eta vs tors. theta energy: -31.311 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -235.743698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.743698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.841770 (E_RNA) where: Base-Base interactions energy: -137.979 where: short stacking energy: -80.279 Base-Backbone interact. energy: -1.119 local terms energy: -96.743469 where: bonds (distance) C4'-P energy: -22.662 bonds (distance) P-C4' energy: -23.671 flat angles C4'-P-C4' energy: -25.042 flat angles P-C4'-P energy: -15.675 tors. eta vs tors. theta energy: -9.694 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -222.713001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.713001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.713001 (E_RNA) where: Base-Base interactions energy: -133.620 where: short stacking energy: -81.108 Base-Backbone interact. energy: -0.111 local terms energy: -88.981617 where: bonds (distance) C4'-P energy: -13.738 bonds (distance) P-C4' energy: -23.711 flat angles C4'-P-C4' energy: -19.893 flat angles P-C4'-P energy: -16.327 tors. eta vs tors. theta energy: -15.312 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -225.626654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.626654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.670996 (E_RNA) where: Base-Base interactions energy: -127.318 where: short stacking energy: -74.199 Base-Backbone interact. energy: -0.235 local terms energy: -98.117774 where: bonds (distance) C4'-P energy: -21.105 bonds (distance) P-C4' energy: -25.519 flat angles C4'-P-C4' energy: -19.917 flat angles P-C4'-P energy: -11.860 tors. eta vs tors. theta energy: -19.716 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -228.820308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.820308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.820308 (E_RNA) where: Base-Base interactions energy: -139.123 where: short stacking energy: -89.463 Base-Backbone interact. energy: -0.167 local terms energy: -89.530607 where: bonds (distance) C4'-P energy: -14.458 bonds (distance) P-C4' energy: -20.974 flat angles C4'-P-C4' energy: -26.591 flat angles P-C4'-P energy: -11.495 tors. eta vs tors. theta energy: -16.013 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -200.599981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.599981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.718456 (E_RNA) where: Base-Base interactions energy: -103.720 where: short stacking energy: -67.249 Base-Backbone interact. energy: -0.067 local terms energy: -96.931973 where: bonds (distance) C4'-P energy: -21.413 bonds (distance) P-C4' energy: -23.079 flat angles C4'-P-C4' energy: -23.751 flat angles P-C4'-P energy: -11.129 tors. eta vs tors. theta energy: -17.560 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -400.419437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.419437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.419437 (E_RNA) where: Base-Base interactions energy: -288.841 where: short stacking energy: -117.212 Base-Backbone interact. energy: -0.279 local terms energy: -111.299648 where: bonds (distance) C4'-P energy: -25.723 bonds (distance) P-C4' energy: -25.754 flat angles C4'-P-C4' energy: -20.183 flat angles P-C4'-P energy: -13.065 tors. eta vs tors. theta energy: -26.574 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -361.363568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.363568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.398010 (E_RNA) where: Base-Base interactions energy: -238.207 where: short stacking energy: -108.664 Base-Backbone interact. energy: -1.628 local terms energy: -121.563081 where: bonds (distance) C4'-P energy: -22.882 bonds (distance) P-C4' energy: -25.484 flat angles C4'-P-C4' energy: -27.161 flat angles P-C4'-P energy: -18.576 tors. eta vs tors. theta energy: -27.460 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -349.257703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.257703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.284720 (E_RNA) where: Base-Base interactions energy: -230.869 where: short stacking energy: -119.138 Base-Backbone interact. energy: -0.484 local terms energy: -117.931182 where: bonds (distance) C4'-P energy: -18.123 bonds (distance) P-C4' energy: -27.605 flat angles C4'-P-C4' energy: -25.750 flat angles P-C4'-P energy: -12.899 tors. eta vs tors. theta energy: -33.554 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -334.066052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.066052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.066052 (E_RNA) where: Base-Base interactions energy: -215.771 where: short stacking energy: -101.300 Base-Backbone interact. energy: -0.609 local terms energy: -117.686364 where: bonds (distance) C4'-P energy: -26.504 bonds (distance) P-C4' energy: -23.379 flat angles C4'-P-C4' energy: -20.315 flat angles P-C4'-P energy: -21.775 tors. eta vs tors. theta energy: -25.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -323.951411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.951411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.954564 (E_RNA) where: Base-Base interactions energy: -214.193 where: short stacking energy: -97.751 Base-Backbone interact. energy: -1.074 local terms energy: -108.687773 where: bonds (distance) C4'-P energy: -16.255 bonds (distance) P-C4' energy: -22.466 flat angles C4'-P-C4' energy: -25.527 flat angles P-C4'-P energy: -18.410 tors. eta vs tors. theta energy: -26.030 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -236.332398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.332398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.332398 (E_RNA) where: Base-Base interactions energy: -144.395 where: short stacking energy: -90.592 Base-Backbone interact. energy: -1.154 local terms energy: -90.782892 where: bonds (distance) C4'-P energy: -22.153 bonds (distance) P-C4' energy: -15.943 flat angles C4'-P-C4' energy: -22.415 flat angles P-C4'-P energy: -16.275 tors. eta vs tors. theta energy: -13.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -234.136485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.136485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.190468 (E_RNA) where: Base-Base interactions energy: -138.432 where: short stacking energy: -82.818 Base-Backbone interact. energy: -0.306 local terms energy: -95.451925 where: bonds (distance) C4'-P energy: -20.396 bonds (distance) P-C4' energy: -22.178 flat angles C4'-P-C4' energy: -23.825 flat angles P-C4'-P energy: -13.849 tors. eta vs tors. theta energy: -15.204 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -222.289739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.289739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.341876 (E_RNA) where: Base-Base interactions energy: -129.851 where: short stacking energy: -71.145 Base-Backbone interact. energy: -0.281 local terms energy: -92.210260 where: bonds (distance) C4'-P energy: -16.286 bonds (distance) P-C4' energy: -16.258 flat angles C4'-P-C4' energy: -25.086 flat angles P-C4'-P energy: -18.192 tors. eta vs tors. theta energy: -16.389 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -213.475032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.475032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.898761 (E_RNA) where: Base-Base interactions energy: -123.065 where: short stacking energy: -70.445 Base-Backbone interact. energy: 0.976 local terms energy: -91.810330 where: bonds (distance) C4'-P energy: -21.716 bonds (distance) P-C4' energy: -23.348 flat angles C4'-P-C4' energy: -23.947 flat angles P-C4'-P energy: -11.696 tors. eta vs tors. theta energy: -11.103 Dist. restrs. and SS energy: 0.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -191.635530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.635530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.770520 (E_RNA) where: Base-Base interactions energy: -108.806 where: short stacking energy: -51.061 Base-Backbone interact. energy: -0.380 local terms energy: -82.584574 where: bonds (distance) C4'-P energy: -17.604 bonds (distance) P-C4' energy: -20.980 flat angles C4'-P-C4' energy: -21.018 flat angles P-C4'-P energy: -13.638 tors. eta vs tors. theta energy: -9.344 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -399.690941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.690941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.723408 (E_RNA) where: Base-Base interactions energy: -282.920 where: short stacking energy: -121.179 Base-Backbone interact. energy: -0.293 local terms energy: -116.510615 where: bonds (distance) C4'-P energy: -22.669 bonds (distance) P-C4' energy: -22.751 flat angles C4'-P-C4' energy: -23.468 flat angles P-C4'-P energy: -19.317 tors. eta vs tors. theta energy: -28.306 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -358.534065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.534065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.537387 (E_RNA) where: Base-Base interactions energy: -234.990 where: short stacking energy: -110.117 Base-Backbone interact. energy: -0.261 local terms energy: -123.286874 where: bonds (distance) C4'-P energy: -28.951 bonds (distance) P-C4' energy: -22.365 flat angles C4'-P-C4' energy: -26.603 flat angles P-C4'-P energy: -15.332 tors. eta vs tors. theta energy: -30.036 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -367.376276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.376276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.376276 (E_RNA) where: Base-Base interactions energy: -252.044 where: short stacking energy: -123.720 Base-Backbone interact. energy: -1.175 local terms energy: -114.156832 where: bonds (distance) C4'-P energy: -21.660 bonds (distance) P-C4' energy: -24.525 flat angles C4'-P-C4' energy: -23.882 flat angles P-C4'-P energy: -15.135 tors. eta vs tors. theta energy: -28.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -341.050898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.050898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.071848 (E_RNA) where: Base-Base interactions energy: -219.465 where: short stacking energy: -102.125 Base-Backbone interact. energy: -0.210 local terms energy: -121.396444 where: bonds (distance) C4'-P energy: -25.908 bonds (distance) P-C4' energy: -25.501 flat angles C4'-P-C4' energy: -26.063 flat angles P-C4'-P energy: -15.620 tors. eta vs tors. theta energy: -28.305 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -330.852981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.852981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.852981 (E_RNA) where: Base-Base interactions energy: -215.920 where: short stacking energy: -106.164 Base-Backbone interact. energy: 0.605 local terms energy: -115.538002 where: bonds (distance) C4'-P energy: -25.302 bonds (distance) P-C4' energy: -27.879 flat angles C4'-P-C4' energy: -23.268 flat angles P-C4'-P energy: -12.805 tors. eta vs tors. theta energy: -26.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -249.868456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.868456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.868456 (E_RNA) where: Base-Base interactions energy: -150.835 where: short stacking energy: -83.511 Base-Backbone interact. energy: 0.944 local terms energy: -99.976586 where: bonds (distance) C4'-P energy: -24.330 bonds (distance) P-C4' energy: -25.247 flat angles C4'-P-C4' energy: -14.968 flat angles P-C4'-P energy: -14.711 tors. eta vs tors. theta energy: -20.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -219.159386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.159386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.189546 (E_RNA) where: Base-Base interactions energy: -131.719 where: short stacking energy: -69.188 Base-Backbone interact. energy: -0.231 local terms energy: -87.240354 where: bonds (distance) C4'-P energy: -25.010 bonds (distance) P-C4' energy: -20.098 flat angles C4'-P-C4' energy: -16.859 flat angles P-C4'-P energy: -9.290 tors. eta vs tors. theta energy: -15.984 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -210.378236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.378236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.738838 (E_RNA) where: Base-Base interactions energy: -120.579 where: short stacking energy: -66.663 Base-Backbone interact. energy: -0.958 local terms energy: -89.201929 where: bonds (distance) C4'-P energy: -20.042 bonds (distance) P-C4' energy: -16.634 flat angles C4'-P-C4' energy: -21.353 flat angles P-C4'-P energy: -17.407 tors. eta vs tors. theta energy: -13.766 Dist. restrs. and SS energy: 0.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -212.145854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.145854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.247474 (E_RNA) where: Base-Base interactions energy: -119.709 where: short stacking energy: -63.938 Base-Backbone interact. energy: -0.433 local terms energy: -92.105306 where: bonds (distance) C4'-P energy: -21.946 bonds (distance) P-C4' energy: -21.249 flat angles C4'-P-C4' energy: -21.064 flat angles P-C4'-P energy: -15.268 tors. eta vs tors. theta energy: -12.579 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -198.800439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.800439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.957688 (E_RNA) where: Base-Base interactions energy: -119.818 where: short stacking energy: -68.905 Base-Backbone interact. energy: -0.355 local terms energy: -78.784978 where: bonds (distance) C4'-P energy: -15.033 bonds (distance) P-C4' energy: -18.983 flat angles C4'-P-C4' energy: -18.251 flat angles P-C4'-P energy: -12.116 tors. eta vs tors. theta energy: -14.401 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -373.862081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.862081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.862081 (E_RNA) where: Base-Base interactions energy: -250.032 where: short stacking energy: -115.842 Base-Backbone interact. energy: -1.723 local terms energy: -122.107199 where: bonds (distance) C4'-P energy: -26.286 bonds (distance) P-C4' energy: -24.310 flat angles C4'-P-C4' energy: -23.528 flat angles P-C4'-P energy: -15.035 tors. eta vs tors. theta energy: -32.948 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -382.340174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.340174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.340174 (E_RNA) where: Base-Base interactions energy: -274.700 where: short stacking energy: -115.416 Base-Backbone interact. energy: -0.736 local terms energy: -106.904923 where: bonds (distance) C4'-P energy: -19.788 bonds (distance) P-C4' energy: -25.099 flat angles C4'-P-C4' energy: -23.582 flat angles P-C4'-P energy: -6.480 tors. eta vs tors. theta energy: -31.956 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -355.918906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.918906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.026778 (E_RNA) where: Base-Base interactions energy: -246.983 where: short stacking energy: -111.562 Base-Backbone interact. energy: -3.029 local terms energy: -106.014639 where: bonds (distance) C4'-P energy: -18.840 bonds (distance) P-C4' energy: -23.276 flat angles C4'-P-C4' energy: -22.855 flat angles P-C4'-P energy: -15.349 tors. eta vs tors. theta energy: -25.694 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -330.898261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.898261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.900200 (E_RNA) where: Base-Base interactions energy: -222.137 where: short stacking energy: -105.399 Base-Backbone interact. energy: -0.154 local terms energy: -108.608922 where: bonds (distance) C4'-P energy: -26.810 bonds (distance) P-C4' energy: -21.800 flat angles C4'-P-C4' energy: -21.059 flat angles P-C4'-P energy: -10.439 tors. eta vs tors. theta energy: -28.500 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -329.897944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.897944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.959699 (E_RNA) where: Base-Base interactions energy: -210.134 where: short stacking energy: -105.990 Base-Backbone interact. energy: 0.829 local terms energy: -120.654290 where: bonds (distance) C4'-P energy: -19.061 bonds (distance) P-C4' energy: -25.543 flat angles C4'-P-C4' energy: -27.503 flat angles P-C4'-P energy: -18.105 tors. eta vs tors. theta energy: -30.442 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -233.609038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.609038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.764955 (E_RNA) where: Base-Base interactions energy: -134.896 where: short stacking energy: -85.038 Base-Backbone interact. energy: -0.944 local terms energy: -97.925163 where: bonds (distance) C4'-P energy: -19.097 bonds (distance) P-C4' energy: -24.850 flat angles C4'-P-C4' energy: -22.635 flat angles P-C4'-P energy: -16.245 tors. eta vs tors. theta energy: -15.098 Dist. restrs. and SS energy: 0.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -247.250637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.250637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.483060 (E_RNA) where: Base-Base interactions energy: -132.535 where: short stacking energy: -83.068 Base-Backbone interact. energy: -0.509 local terms energy: -114.439491 where: bonds (distance) C4'-P energy: -23.131 bonds (distance) P-C4' energy: -24.359 flat angles C4'-P-C4' energy: -26.538 flat angles P-C4'-P energy: -14.868 tors. eta vs tors. theta energy: -25.543 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -236.193551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.193551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.250985 (E_RNA) where: Base-Base interactions energy: -129.796 where: short stacking energy: -70.522 Base-Backbone interact. energy: -0.267 local terms energy: -106.188484 where: bonds (distance) C4'-P energy: -23.382 bonds (distance) P-C4' energy: -25.053 flat angles C4'-P-C4' energy: -22.973 flat angles P-C4'-P energy: -17.121 tors. eta vs tors. theta energy: -17.659 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -176.145254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.145254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.623090 (E_RNA) where: Base-Base interactions energy: -100.019 where: short stacking energy: -66.032 Base-Backbone interact. energy: -0.345 local terms energy: -76.259360 where: bonds (distance) C4'-P energy: -14.265 bonds (distance) P-C4' energy: -19.740 flat angles C4'-P-C4' energy: -22.491 flat angles P-C4'-P energy: -12.824 tors. eta vs tors. theta energy: -6.940 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -207.637048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.637048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.697110 (E_RNA) where: Base-Base interactions energy: -115.137 where: short stacking energy: -68.107 Base-Backbone interact. energy: -0.545 local terms energy: -92.014776 where: bonds (distance) C4'-P energy: -18.170 bonds (distance) P-C4' energy: -25.355 flat angles C4'-P-C4' energy: -21.492 flat angles P-C4'-P energy: -12.526 tors. eta vs tors. theta energy: -14.472 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -377.227119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.227119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.261428 (E_RNA) where: Base-Base interactions energy: -250.726 where: short stacking energy: -114.796 Base-Backbone interact. energy: -2.144 local terms energy: -124.391339 where: bonds (distance) C4'-P energy: -25.211 bonds (distance) P-C4' energy: -23.077 flat angles C4'-P-C4' energy: -27.718 flat angles P-C4'-P energy: -17.505 tors. eta vs tors. theta energy: -30.881 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -379.103525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.103525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.156650 (E_RNA) where: Base-Base interactions energy: -258.621 where: short stacking energy: -110.359 Base-Backbone interact. energy: -0.935 local terms energy: -119.600698 where: bonds (distance) C4'-P energy: -28.371 bonds (distance) P-C4' energy: -25.958 flat angles C4'-P-C4' energy: -22.180 flat angles P-C4'-P energy: -16.273 tors. eta vs tors. theta energy: -26.818 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -358.148863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.148863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.163190 (E_RNA) where: Base-Base interactions energy: -229.894 where: short stacking energy: -117.750 Base-Backbone interact. energy: -0.452 local terms energy: -127.817440 where: bonds (distance) C4'-P energy: -23.930 bonds (distance) P-C4' energy: -24.083 flat angles C4'-P-C4' energy: -28.649 flat angles P-C4'-P energy: -18.219 tors. eta vs tors. theta energy: -32.936 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -346.542639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.542639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.555427 (E_RNA) where: Base-Base interactions energy: -227.197 where: short stacking energy: -110.074 Base-Backbone interact. energy: -0.362 local terms energy: -118.996016 where: bonds (distance) C4'-P energy: -20.380 bonds (distance) P-C4' energy: -22.395 flat angles C4'-P-C4' energy: -27.893 flat angles P-C4'-P energy: -19.627 tors. eta vs tors. theta energy: -28.700 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -331.481690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.481690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.492130 (E_RNA) where: Base-Base interactions energy: -216.810 where: short stacking energy: -102.234 Base-Backbone interact. energy: 0.588 local terms energy: -115.270289 where: bonds (distance) C4'-P energy: -17.317 bonds (distance) P-C4' energy: -23.549 flat angles C4'-P-C4' energy: -29.029 flat angles P-C4'-P energy: -18.562 tors. eta vs tors. theta energy: -26.814 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -241.937130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.937130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.969571 (E_RNA) where: Base-Base interactions energy: -141.329 where: short stacking energy: -75.514 Base-Backbone interact. energy: -0.073 local terms energy: -100.566941 where: bonds (distance) C4'-P energy: -24.490 bonds (distance) P-C4' energy: -18.286 flat angles C4'-P-C4' energy: -23.596 flat angles P-C4'-P energy: -17.084 tors. eta vs tors. theta energy: -17.111 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -236.342808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.342808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.778720 (E_RNA) where: Base-Base interactions energy: -133.594 where: short stacking energy: -80.294 Base-Backbone interact. energy: -0.013 local terms energy: -103.171603 where: bonds (distance) C4'-P energy: -23.644 bonds (distance) P-C4' energy: -26.171 flat angles C4'-P-C4' energy: -17.979 flat angles P-C4'-P energy: -18.394 tors. eta vs tors. theta energy: -16.984 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -205.019617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.019617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.031564 (E_RNA) where: Base-Base interactions energy: -127.875 where: short stacking energy: -74.436 Base-Backbone interact. energy: -0.362 local terms energy: -76.794910 where: bonds (distance) C4'-P energy: -21.942 bonds (distance) P-C4' energy: -20.728 flat angles C4'-P-C4' energy: -24.505 flat angles P-C4'-P energy: -0.778 tors. eta vs tors. theta energy: -8.842 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -203.838365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.838365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.869938 (E_RNA) where: Base-Base interactions energy: -125.646 where: short stacking energy: -57.541 Base-Backbone interact. energy: 1.358 local terms energy: -79.581952 where: bonds (distance) C4'-P energy: -21.737 bonds (distance) P-C4' energy: -17.469 flat angles C4'-P-C4' energy: -17.616 flat angles P-C4'-P energy: -8.311 tors. eta vs tors. theta energy: -14.449 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -184.168262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.168262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.951341 (E_RNA) where: Base-Base interactions energy: -102.772 where: short stacking energy: -67.271 Base-Backbone interact. energy: -0.042 local terms energy: -82.137338 where: bonds (distance) C4'-P energy: -21.916 bonds (distance) P-C4' energy: -17.290 flat angles C4'-P-C4' energy: -25.422 flat angles P-C4'-P energy: -10.174 tors. eta vs tors. theta energy: -7.335 Dist. restrs. and SS energy: 0.783 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -384.377546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.377546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.453844 (E_RNA) where: Base-Base interactions energy: -272.006 where: short stacking energy: -124.797 Base-Backbone interact. energy: -1.758 local terms energy: -110.690419 where: bonds (distance) C4'-P energy: -19.135 bonds (distance) P-C4' energy: -20.168 flat angles C4'-P-C4' energy: -26.194 flat angles P-C4'-P energy: -13.847 tors. eta vs tors. theta energy: -31.346 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -354.762914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.762914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.790628 (E_RNA) where: Base-Base interactions energy: -245.126 where: short stacking energy: -119.318 Base-Backbone interact. energy: -1.131 local terms energy: -108.533822 where: bonds (distance) C4'-P energy: -21.553 bonds (distance) P-C4' energy: -19.032 flat angles C4'-P-C4' energy: -22.741 flat angles P-C4'-P energy: -16.899 tors. eta vs tors. theta energy: -28.310 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -353.126057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.126057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.126057 (E_RNA) where: Base-Base interactions energy: -228.911 where: short stacking energy: -112.387 Base-Backbone interact. energy: -0.177 local terms energy: -124.037680 where: bonds (distance) C4'-P energy: -25.006 bonds (distance) P-C4' energy: -26.303 flat angles C4'-P-C4' energy: -25.396 flat angles P-C4'-P energy: -16.759 tors. eta vs tors. theta energy: -30.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -353.242249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.242249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.242249 (E_RNA) where: Base-Base interactions energy: -234.195 where: short stacking energy: -112.365 Base-Backbone interact. energy: -0.268 local terms energy: -118.779430 where: bonds (distance) C4'-P energy: -22.122 bonds (distance) P-C4' energy: -23.530 flat angles C4'-P-C4' energy: -24.220 flat angles P-C4'-P energy: -18.243 tors. eta vs tors. theta energy: -30.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -331.221160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.221160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.322318 (E_RNA) where: Base-Base interactions energy: -217.902 where: short stacking energy: -96.701 Base-Backbone interact. energy: -0.325 local terms energy: -113.095416 where: bonds (distance) C4'-P energy: -21.682 bonds (distance) P-C4' energy: -26.076 flat angles C4'-P-C4' energy: -25.042 flat angles P-C4'-P energy: -15.329 tors. eta vs tors. theta energy: -24.967 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -233.935208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.935208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.056893 (E_RNA) where: Base-Base interactions energy: -129.940 where: short stacking energy: -81.477 Base-Backbone interact. energy: -0.867 local terms energy: -103.249780 where: bonds (distance) C4'-P energy: -22.210 bonds (distance) P-C4' energy: -23.839 flat angles C4'-P-C4' energy: -18.995 flat angles P-C4'-P energy: -17.375 tors. eta vs tors. theta energy: -20.831 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -225.831766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.831766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.839725 (E_RNA) where: Base-Base interactions energy: -132.295 where: short stacking energy: -78.208 Base-Backbone interact. energy: -2.474 local terms energy: -91.071276 where: bonds (distance) C4'-P energy: -16.211 bonds (distance) P-C4' energy: -21.053 flat angles C4'-P-C4' energy: -17.589 flat angles P-C4'-P energy: -17.675 tors. eta vs tors. theta energy: -18.544 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -223.464071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.464071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.686764 (E_RNA) where: Base-Base interactions energy: -142.365 where: short stacking energy: -88.954 Base-Backbone interact. energy: -0.279 local terms energy: -81.042758 where: bonds (distance) C4'-P energy: -17.421 bonds (distance) P-C4' energy: -18.258 flat angles C4'-P-C4' energy: -19.026 flat angles P-C4'-P energy: -13.150 tors. eta vs tors. theta energy: -13.188 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -206.368504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.368504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.368504 (E_RNA) where: Base-Base interactions energy: -128.202 where: short stacking energy: -72.623 Base-Backbone interact. energy: -0.364 local terms energy: -77.801964 where: bonds (distance) C4'-P energy: -19.444 bonds (distance) P-C4' energy: -18.021 flat angles C4'-P-C4' energy: -17.051 flat angles P-C4'-P energy: -7.470 tors. eta vs tors. theta energy: -15.816 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -220.352111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.352111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.459676 (E_RNA) where: Base-Base interactions energy: -139.853 where: short stacking energy: -73.242 Base-Backbone interact. energy: -1.677 local terms energy: -78.929628 where: bonds (distance) C4'-P energy: -13.114 bonds (distance) P-C4' energy: -24.606 flat angles C4'-P-C4' energy: -15.001 flat angles P-C4'-P energy: -17.961 tors. eta vs tors. theta energy: -8.248 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -397.263978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.263978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.397561 (E_RNA) where: Base-Base interactions energy: -264.034 where: short stacking energy: -119.748 Base-Backbone interact. energy: -0.259 local terms energy: -133.104377 where: bonds (distance) C4'-P energy: -24.009 bonds (distance) P-C4' energy: -29.792 flat angles C4'-P-C4' energy: -27.795 flat angles P-C4'-P energy: -17.373 tors. eta vs tors. theta energy: -34.136 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -359.642688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.642688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.647491 (E_RNA) where: Base-Base interactions energy: -245.745 where: short stacking energy: -115.046 Base-Backbone interact. energy: -0.507 local terms energy: -113.395601 where: bonds (distance) C4'-P energy: -21.532 bonds (distance) P-C4' energy: -28.918 flat angles C4'-P-C4' energy: -23.600 flat angles P-C4'-P energy: -9.891 tors. eta vs tors. theta energy: -29.455 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -373.524834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.524834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.612075 (E_RNA) where: Base-Base interactions energy: -250.691 where: short stacking energy: -111.659 Base-Backbone interact. energy: -1.365 local terms energy: -121.555915 where: bonds (distance) C4'-P energy: -25.332 bonds (distance) P-C4' energy: -23.735 flat angles C4'-P-C4' energy: -27.418 flat angles P-C4'-P energy: -14.503 tors. eta vs tors. theta energy: -30.567 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -346.316570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.316570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.333566 (E_RNA) where: Base-Base interactions energy: -233.830 where: short stacking energy: -106.832 Base-Backbone interact. energy: -0.589 local terms energy: -111.914794 where: bonds (distance) C4'-P energy: -18.022 bonds (distance) P-C4' energy: -22.627 flat angles C4'-P-C4' energy: -22.585 flat angles P-C4'-P energy: -19.432 tors. eta vs tors. theta energy: -29.248 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -337.730835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.730835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.821298 (E_RNA) where: Base-Base interactions energy: -227.526 where: short stacking energy: -98.137 Base-Backbone interact. energy: -0.853 local terms energy: -109.442160 where: bonds (distance) C4'-P energy: -18.121 bonds (distance) P-C4' energy: -16.989 flat angles C4'-P-C4' energy: -27.666 flat angles P-C4'-P energy: -22.839 tors. eta vs tors. theta energy: -23.827 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -231.514196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.514196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.948171 (E_RNA) where: Base-Base interactions energy: -125.755 where: short stacking energy: -72.940 Base-Backbone interact. energy: -0.294 local terms energy: -105.899107 where: bonds (distance) C4'-P energy: -23.825 bonds (distance) P-C4' energy: -25.814 flat angles C4'-P-C4' energy: -22.848 flat angles P-C4'-P energy: -15.319 tors. eta vs tors. theta energy: -18.093 Dist. restrs. and SS energy: 0.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -232.189933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.189933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.224214 (E_RNA) where: Base-Base interactions energy: -135.865 where: short stacking energy: -66.423 Base-Backbone interact. energy: -1.218 local terms energy: -95.141327 where: bonds (distance) C4'-P energy: -23.286 bonds (distance) P-C4' energy: -20.914 flat angles C4'-P-C4' energy: -22.519 flat angles P-C4'-P energy: -14.161 tors. eta vs tors. theta energy: -14.261 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -215.385965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.385965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.681960 (E_RNA) where: Base-Base interactions energy: -122.758 where: short stacking energy: -74.014 Base-Backbone interact. energy: 0.589 local terms energy: -93.513033 where: bonds (distance) C4'-P energy: -25.978 bonds (distance) P-C4' energy: -23.864 flat angles C4'-P-C4' energy: -16.699 flat angles P-C4'-P energy: -17.935 tors. eta vs tors. theta energy: -9.036 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -219.046120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.046120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.236693 (E_RNA) where: Base-Base interactions energy: -122.536 where: short stacking energy: -72.472 Base-Backbone interact. energy: -0.828 local terms energy: -95.873129 where: bonds (distance) C4'-P energy: -16.693 bonds (distance) P-C4' energy: -23.569 flat angles C4'-P-C4' energy: -25.252 flat angles P-C4'-P energy: -15.707 tors. eta vs tors. theta energy: -14.653 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -202.527230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.527230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.593968 (E_RNA) where: Base-Base interactions energy: -126.929 where: short stacking energy: -69.925 Base-Backbone interact. energy: -0.712 local terms energy: -74.953464 where: bonds (distance) C4'-P energy: -15.527 bonds (distance) P-C4' energy: -16.196 flat angles C4'-P-C4' energy: -19.941 flat angles P-C4'-P energy: -12.672 tors. eta vs tors. theta energy: -10.617 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -392.761733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.761733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.761733 (E_RNA) where: Base-Base interactions energy: -266.463 where: short stacking energy: -118.268 Base-Backbone interact. energy: -0.436 local terms energy: -125.862660 where: bonds (distance) C4'-P energy: -25.979 bonds (distance) P-C4' energy: -26.986 flat angles C4'-P-C4' energy: -24.788 flat angles P-C4'-P energy: -17.894 tors. eta vs tors. theta energy: -30.214 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -354.133454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.133454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.133925 (E_RNA) where: Base-Base interactions energy: -242.101 where: short stacking energy: -117.354 Base-Backbone interact. energy: -0.277 local terms energy: -111.756402 where: bonds (distance) C4'-P energy: -25.308 bonds (distance) P-C4' energy: -18.701 flat angles C4'-P-C4' energy: -26.965 flat angles P-C4'-P energy: -9.968 tors. eta vs tors. theta energy: -30.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -361.013393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.013393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.013393 (E_RNA) where: Base-Base interactions energy: -246.049 where: short stacking energy: -106.863 Base-Backbone interact. energy: -1.243 local terms energy: -113.721338 where: bonds (distance) C4'-P energy: -18.172 bonds (distance) P-C4' energy: -26.589 flat angles C4'-P-C4' energy: -25.713 flat angles P-C4'-P energy: -15.665 tors. eta vs tors. theta energy: -27.583 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -350.248706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.248706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.297080 (E_RNA) where: Base-Base interactions energy: -236.769 where: short stacking energy: -114.197 Base-Backbone interact. energy: -0.855 local terms energy: -112.672732 where: bonds (distance) C4'-P energy: -18.411 bonds (distance) P-C4' energy: -23.482 flat angles C4'-P-C4' energy: -22.821 flat angles P-C4'-P energy: -14.967 tors. eta vs tors. theta energy: -32.992 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -333.376542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.376542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.444004 (E_RNA) where: Base-Base interactions energy: -219.441 where: short stacking energy: -108.410 Base-Backbone interact. energy: -0.474 local terms energy: -113.529177 where: bonds (distance) C4'-P energy: -21.823 bonds (distance) P-C4' energy: -21.683 flat angles C4'-P-C4' energy: -28.266 flat angles P-C4'-P energy: -14.499 tors. eta vs tors. theta energy: -27.257 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -230.481091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.481091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.484452 (E_RNA) where: Base-Base interactions energy: -135.708 where: short stacking energy: -76.878 Base-Backbone interact. energy: -0.548 local terms energy: -94.227677 where: bonds (distance) C4'-P energy: -13.732 bonds (distance) P-C4' energy: -24.109 flat angles C4'-P-C4' energy: -21.959 flat angles P-C4'-P energy: -18.749 tors. eta vs tors. theta energy: -15.679 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -243.001569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.001569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.223902 (E_RNA) where: Base-Base interactions energy: -154.243 where: short stacking energy: -77.526 Base-Backbone interact. energy: -0.416 local terms energy: -88.565233 where: bonds (distance) C4'-P energy: -13.930 bonds (distance) P-C4' energy: -20.028 flat angles C4'-P-C4' energy: -22.558 flat angles P-C4'-P energy: -13.672 tors. eta vs tors. theta energy: -18.378 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -211.572317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.572317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.656956 (E_RNA) where: Base-Base interactions energy: -125.331 where: short stacking energy: -68.222 Base-Backbone interact. energy: -0.154 local terms energy: -86.171817 where: bonds (distance) C4'-P energy: -17.599 bonds (distance) P-C4' energy: -26.541 flat angles C4'-P-C4' energy: -19.707 flat angles P-C4'-P energy: -10.212 tors. eta vs tors. theta energy: -12.112 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -212.038645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.038645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.190965 (E_RNA) where: Base-Base interactions energy: -131.388 where: short stacking energy: -71.270 Base-Backbone interact. energy: 0.051 local terms energy: -80.854344 where: bonds (distance) C4'-P energy: -19.885 bonds (distance) P-C4' energy: -22.170 flat angles C4'-P-C4' energy: -20.799 flat angles P-C4'-P energy: -5.304 tors. eta vs tors. theta energy: -12.697 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -208.596339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.596339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.696457 (E_RNA) where: Base-Base interactions energy: -123.109 where: short stacking energy: -77.667 Base-Backbone interact. energy: -1.100 local terms energy: -84.488101 where: bonds (distance) C4'-P energy: -14.136 bonds (distance) P-C4' energy: -23.108 flat angles C4'-P-C4' energy: -17.706 flat angles P-C4'-P energy: -13.854 tors. eta vs tors. theta energy: -15.684 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -385.499182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.499182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.499182 (E_RNA) where: Base-Base interactions energy: -269.670 where: short stacking energy: -120.701 Base-Backbone interact. energy: -0.975 local terms energy: -114.853989 where: bonds (distance) C4'-P energy: -19.843 bonds (distance) P-C4' energy: -23.381 flat angles C4'-P-C4' energy: -20.007 flat angles P-C4'-P energy: -20.864 tors. eta vs tors. theta energy: -30.758 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -375.513291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.513291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.638098 (E_RNA) where: Base-Base interactions energy: -248.855 where: short stacking energy: -110.414 Base-Backbone interact. energy: -0.521 local terms energy: -126.262237 where: bonds (distance) C4'-P energy: -23.569 bonds (distance) P-C4' energy: -28.495 flat angles C4'-P-C4' energy: -28.531 flat angles P-C4'-P energy: -16.842 tors. eta vs tors. theta energy: -28.824 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -346.395118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.395118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.697755 (E_RNA) where: Base-Base interactions energy: -227.941 where: short stacking energy: -107.601 Base-Backbone interact. energy: -0.471 local terms energy: -118.286330 where: bonds (distance) C4'-P energy: -26.126 bonds (distance) P-C4' energy: -23.688 flat angles C4'-P-C4' energy: -20.097 flat angles P-C4'-P energy: -19.103 tors. eta vs tors. theta energy: -29.273 Dist. restrs. and SS energy: 0.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -337.933783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.933783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.034819 (E_RNA) where: Base-Base interactions energy: -221.361 where: short stacking energy: -109.933 Base-Backbone interact. energy: -0.298 local terms energy: -116.375829 where: bonds (distance) C4'-P energy: -20.044 bonds (distance) P-C4' energy: -24.975 flat angles C4'-P-C4' energy: -25.986 flat angles P-C4'-P energy: -18.272 tors. eta vs tors. theta energy: -27.099 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -338.114775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.114775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.232735 (E_RNA) where: Base-Base interactions energy: -227.241 where: short stacking energy: -102.824 Base-Backbone interact. energy: -2.442 local terms energy: -108.549162 where: bonds (distance) C4'-P energy: -18.199 bonds (distance) P-C4' energy: -20.319 flat angles C4'-P-C4' energy: -27.426 flat angles P-C4'-P energy: -15.640 tors. eta vs tors. theta energy: -26.964 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -249.538834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.538834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.582190 (E_RNA) where: Base-Base interactions energy: -148.064 where: short stacking energy: -85.009 Base-Backbone interact. energy: 1.008 local terms energy: -102.526575 where: bonds (distance) C4'-P energy: -24.016 bonds (distance) P-C4' energy: -23.333 flat angles C4'-P-C4' energy: -24.271 flat angles P-C4'-P energy: -12.428 tors. eta vs tors. theta energy: -18.479 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -221.101272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.101272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.101272 (E_RNA) where: Base-Base interactions energy: -128.487 where: short stacking energy: -70.713 Base-Backbone interact. energy: -2.876 local terms energy: -89.737792 where: bonds (distance) C4'-P energy: -21.058 bonds (distance) P-C4' energy: -22.224 flat angles C4'-P-C4' energy: -24.375 flat angles P-C4'-P energy: -14.688 tors. eta vs tors. theta energy: -7.393 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -219.195015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.195015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.333284 (E_RNA) where: Base-Base interactions energy: -130.212 where: short stacking energy: -70.807 Base-Backbone interact. energy: -0.065 local terms energy: -89.055933 where: bonds (distance) C4'-P energy: -16.541 bonds (distance) P-C4' energy: -24.063 flat angles C4'-P-C4' energy: -21.096 flat angles P-C4'-P energy: -16.847 tors. eta vs tors. theta energy: -10.509 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -213.883180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.883180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.908932 (E_RNA) where: Base-Base interactions energy: -132.925 where: short stacking energy: -70.082 Base-Backbone interact. energy: 3.788 local terms energy: -84.771653 where: bonds (distance) C4'-P energy: -14.354 bonds (distance) P-C4' energy: -18.125 flat angles C4'-P-C4' energy: -17.729 flat angles P-C4'-P energy: -18.866 tors. eta vs tors. theta energy: -15.697 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -206.590761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.590761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.940118 (E_RNA) where: Base-Base interactions energy: -121.779 where: short stacking energy: -72.950 Base-Backbone interact. energy: -0.862 local terms energy: -84.298642 where: bonds (distance) C4'-P energy: -18.186 bonds (distance) P-C4' energy: -24.610 flat angles C4'-P-C4' energy: -17.159 flat angles P-C4'-P energy: -12.690 tors. eta vs tors. theta energy: -11.654 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -392.140164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.140164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.157646 (E_RNA) where: Base-Base interactions energy: -267.771 where: short stacking energy: -124.310 Base-Backbone interact. energy: -2.240 local terms energy: -122.146835 where: bonds (distance) C4'-P energy: -27.032 bonds (distance) P-C4' energy: -23.685 flat angles C4'-P-C4' energy: -22.407 flat angles P-C4'-P energy: -14.164 tors. eta vs tors. theta energy: -34.858 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -369.900107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.900107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.144498 (E_RNA) where: Base-Base interactions energy: -255.448 where: short stacking energy: -109.994 Base-Backbone interact. energy: -1.631 local terms energy: -113.064725 where: bonds (distance) C4'-P energy: -23.362 bonds (distance) P-C4' energy: -23.961 flat angles C4'-P-C4' energy: -20.775 flat angles P-C4'-P energy: -15.546 tors. eta vs tors. theta energy: -29.421 Dist. restrs. and SS energy: 0.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -344.795635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.795635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.814614 (E_RNA) where: Base-Base interactions energy: -231.477 where: short stacking energy: -106.102 Base-Backbone interact. energy: -0.449 local terms energy: -112.889054 where: bonds (distance) C4'-P energy: -20.619 bonds (distance) P-C4' energy: -21.087 flat angles C4'-P-C4' energy: -26.413 flat angles P-C4'-P energy: -14.357 tors. eta vs tors. theta energy: -30.414 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -337.343492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.343492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.570761 (E_RNA) where: Base-Base interactions energy: -225.848 where: short stacking energy: -113.499 Base-Backbone interact. energy: 0.008 local terms energy: -111.731002 where: bonds (distance) C4'-P energy: -20.291 bonds (distance) P-C4' energy: -18.250 flat angles C4'-P-C4' energy: -28.402 flat angles P-C4'-P energy: -15.690 tors. eta vs tors. theta energy: -29.098 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -347.767870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.767870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.931683 (E_RNA) where: Base-Base interactions energy: -226.543 where: short stacking energy: -111.243 Base-Backbone interact. energy: -0.911 local terms energy: -120.477417 where: bonds (distance) C4'-P energy: -23.272 bonds (distance) P-C4' energy: -25.922 flat angles C4'-P-C4' energy: -27.064 flat angles P-C4'-P energy: -16.263 tors. eta vs tors. theta energy: -27.957 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -232.750694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.750694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.754347 (E_RNA) where: Base-Base interactions energy: -139.442 where: short stacking energy: -80.155 Base-Backbone interact. energy: -0.258 local terms energy: -93.054400 where: bonds (distance) C4'-P energy: -20.105 bonds (distance) P-C4' energy: -20.791 flat angles C4'-P-C4' energy: -22.668 flat angles P-C4'-P energy: -12.048 tors. eta vs tors. theta energy: -17.442 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -232.474177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.474177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.500702 (E_RNA) where: Base-Base interactions energy: -139.698 where: short stacking energy: -86.160 Base-Backbone interact. energy: -0.107 local terms energy: -92.695577 where: bonds (distance) C4'-P energy: -18.095 bonds (distance) P-C4' energy: -14.598 flat angles C4'-P-C4' energy: -24.852 flat angles P-C4'-P energy: -16.140 tors. eta vs tors. theta energy: -19.010 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -233.845010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.845010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.110845 (E_RNA) where: Base-Base interactions energy: -131.179 where: short stacking energy: -87.021 Base-Backbone interact. energy: -0.003 local terms energy: -102.929481 where: bonds (distance) C4'-P energy: -18.918 bonds (distance) P-C4' energy: -21.891 flat angles C4'-P-C4' energy: -22.477 flat angles P-C4'-P energy: -16.049 tors. eta vs tors. theta energy: -23.596 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -230.071757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.071757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.284113 (E_RNA) where: Base-Base interactions energy: -141.904 where: short stacking energy: -63.237 Base-Backbone interact. energy: 1.618 local terms energy: -89.998206 where: bonds (distance) C4'-P energy: -15.426 bonds (distance) P-C4' energy: -25.498 flat angles C4'-P-C4' energy: -22.056 flat angles P-C4'-P energy: -9.184 tors. eta vs tors. theta energy: -17.834 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -200.649065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.649065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.685884 (E_RNA) where: Base-Base interactions energy: -124.483 where: short stacking energy: -59.889 Base-Backbone interact. energy: -1.229 local terms energy: -74.974350 where: bonds (distance) C4'-P energy: -20.564 bonds (distance) P-C4' energy: -11.189 flat angles C4'-P-C4' energy: -20.324 flat angles P-C4'-P energy: -10.771 tors. eta vs tors. theta energy: -12.127 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -389.108366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.108366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.150437 (E_RNA) where: Base-Base interactions energy: -270.442 where: short stacking energy: -119.040 Base-Backbone interact. energy: -0.736 local terms energy: -117.973163 where: bonds (distance) C4'-P energy: -25.090 bonds (distance) P-C4' energy: -26.823 flat angles C4'-P-C4' energy: -22.438 flat angles P-C4'-P energy: -15.244 tors. eta vs tors. theta energy: -28.378 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -366.834924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.834924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.945509 (E_RNA) where: Base-Base interactions energy: -252.342 where: short stacking energy: -126.114 Base-Backbone interact. energy: -0.293 local terms energy: -114.310903 where: bonds (distance) C4'-P energy: -19.306 bonds (distance) P-C4' energy: -17.466 flat angles C4'-P-C4' energy: -26.022 flat angles P-C4'-P energy: -20.872 tors. eta vs tors. theta energy: -30.646 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -359.058045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.058045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.078423 (E_RNA) where: Base-Base interactions energy: -230.458 where: short stacking energy: -117.853 Base-Backbone interact. energy: -1.053 local terms energy: -127.566850 where: bonds (distance) C4'-P energy: -29.291 bonds (distance) P-C4' energy: -23.209 flat angles C4'-P-C4' energy: -28.231 flat angles P-C4'-P energy: -18.009 tors. eta vs tors. theta energy: -28.828 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -344.325593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.325593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.325593 (E_RNA) where: Base-Base interactions energy: -236.737 where: short stacking energy: -112.810 Base-Backbone interact. energy: -0.497 local terms energy: -107.091769 where: bonds (distance) C4'-P energy: -19.110 bonds (distance) P-C4' energy: -20.848 flat angles C4'-P-C4' energy: -24.484 flat angles P-C4'-P energy: -13.967 tors. eta vs tors. theta energy: -28.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -329.332390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.332390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.352408 (E_RNA) where: Base-Base interactions energy: -219.696 where: short stacking energy: -102.869 Base-Backbone interact. energy: -0.244 local terms energy: -109.412314 where: bonds (distance) C4'-P energy: -25.523 bonds (distance) P-C4' energy: -18.499 flat angles C4'-P-C4' energy: -21.370 flat angles P-C4'-P energy: -17.806 tors. eta vs tors. theta energy: -26.215 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -252.859213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.859213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.932575 (E_RNA) where: Base-Base interactions energy: -149.082 where: short stacking energy: -87.009 Base-Backbone interact. energy: -0.421 local terms energy: -103.430155 where: bonds (distance) C4'-P energy: -22.331 bonds (distance) P-C4' energy: -25.263 flat angles C4'-P-C4' energy: -19.889 flat angles P-C4'-P energy: -17.001 tors. eta vs tors. theta energy: -18.945 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -219.888598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.888598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.988990 (E_RNA) where: Base-Base interactions energy: -126.389 where: short stacking energy: -68.807 Base-Backbone interact. energy: -0.334 local terms energy: -93.266154 where: bonds (distance) C4'-P energy: -17.690 bonds (distance) P-C4' energy: -17.431 flat angles C4'-P-C4' energy: -28.069 flat angles P-C4'-P energy: -17.176 tors. eta vs tors. theta energy: -12.901 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -211.085886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.085886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.573473 (E_RNA) where: Base-Base interactions energy: -125.632 where: short stacking energy: -73.577 Base-Backbone interact. energy: -0.541 local terms energy: -85.399962 where: bonds (distance) C4'-P energy: -11.316 bonds (distance) P-C4' energy: -25.955 flat angles C4'-P-C4' energy: -20.652 flat angles P-C4'-P energy: -11.360 tors. eta vs tors. theta energy: -16.118 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -223.359101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.359101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.402464 (E_RNA) where: Base-Base interactions energy: -133.558 where: short stacking energy: -74.289 Base-Backbone interact. energy: -0.458 local terms energy: -89.386866 where: bonds (distance) C4'-P energy: -18.425 bonds (distance) P-C4' energy: -22.768 flat angles C4'-P-C4' energy: -19.263 flat angles P-C4'-P energy: -16.424 tors. eta vs tors. theta energy: -12.507 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -207.521444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.521444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.525796 (E_RNA) where: Base-Base interactions energy: -116.214 where: short stacking energy: -66.671 Base-Backbone interact. energy: -0.302 local terms energy: -91.010141 where: bonds (distance) C4'-P energy: -21.657 bonds (distance) P-C4' energy: -24.950 flat angles C4'-P-C4' energy: -20.353 flat angles P-C4'-P energy: -13.429 tors. eta vs tors. theta energy: -10.621 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -399.088750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.088750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.105681 (E_RNA) where: Base-Base interactions energy: -271.182 where: short stacking energy: -116.213 Base-Backbone interact. energy: -0.639 local terms energy: -127.284273 where: bonds (distance) C4'-P energy: -24.610 bonds (distance) P-C4' energy: -26.109 flat angles C4'-P-C4' energy: -25.986 flat angles P-C4'-P energy: -20.999 tors. eta vs tors. theta energy: -29.582 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -373.618732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.618732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.618732 (E_RNA) where: Base-Base interactions energy: -247.943 where: short stacking energy: -115.363 Base-Backbone interact. energy: 0.493 local terms energy: -126.168563 where: bonds (distance) C4'-P energy: -26.510 bonds (distance) P-C4' energy: -26.385 flat angles C4'-P-C4' energy: -26.949 flat angles P-C4'-P energy: -17.284 tors. eta vs tors. theta energy: -29.041 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -355.841890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.841890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.841890 (E_RNA) where: Base-Base interactions energy: -233.296 where: short stacking energy: -105.963 Base-Backbone interact. energy: -0.292 local terms energy: -122.254121 where: bonds (distance) C4'-P energy: -26.384 bonds (distance) P-C4' energy: -22.597 flat angles C4'-P-C4' energy: -25.736 flat angles P-C4'-P energy: -17.042 tors. eta vs tors. theta energy: -30.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -337.852445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.852445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.891600 (E_RNA) where: Base-Base interactions energy: -228.696 where: short stacking energy: -110.614 Base-Backbone interact. energy: -0.917 local terms energy: -108.278937 where: bonds (distance) C4'-P energy: -22.112 bonds (distance) P-C4' energy: -21.394 flat angles C4'-P-C4' energy: -22.832 flat angles P-C4'-P energy: -10.122 tors. eta vs tors. theta energy: -31.819 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -345.988735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.988735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.044803 (E_RNA) where: Base-Base interactions energy: -232.271 where: short stacking energy: -108.243 Base-Backbone interact. energy: -0.354 local terms energy: -113.419958 where: bonds (distance) C4'-P energy: -22.292 bonds (distance) P-C4' energy: -22.978 flat angles C4'-P-C4' energy: -27.317 flat angles P-C4'-P energy: -12.615 tors. eta vs tors. theta energy: -28.217 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -235.728437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.728437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.781227 (E_RNA) where: Base-Base interactions energy: -140.262 where: short stacking energy: -78.954 Base-Backbone interact. energy: -0.495 local terms energy: -95.025007 where: bonds (distance) C4'-P energy: -18.305 bonds (distance) P-C4' energy: -22.849 flat angles C4'-P-C4' energy: -22.611 flat angles P-C4'-P energy: -15.894 tors. eta vs tors. theta energy: -15.366 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -239.528068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.528068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.582028 (E_RNA) where: Base-Base interactions energy: -153.659 where: short stacking energy: -87.309 Base-Backbone interact. energy: -1.206 local terms energy: -84.717689 where: bonds (distance) C4'-P energy: -15.658 bonds (distance) P-C4' energy: -17.330 flat angles C4'-P-C4' energy: -21.760 flat angles P-C4'-P energy: -13.706 tors. eta vs tors. theta energy: -16.264 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -213.601250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.601250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.611865 (E_RNA) where: Base-Base interactions energy: -125.667 where: short stacking energy: -67.327 Base-Backbone interact. energy: -0.353 local terms energy: -87.592395 where: bonds (distance) C4'-P energy: -23.019 bonds (distance) P-C4' energy: -18.078 flat angles C4'-P-C4' energy: -20.978 flat angles P-C4'-P energy: -11.758 tors. eta vs tors. theta energy: -13.759 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -209.947331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.947331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.206225 (E_RNA) where: Base-Base interactions energy: -112.756 where: short stacking energy: -70.897 Base-Backbone interact. energy: -1.734 local terms energy: -95.715791 where: bonds (distance) C4'-P energy: -26.959 bonds (distance) P-C4' energy: -21.461 flat angles C4'-P-C4' energy: -22.185 flat angles P-C4'-P energy: -9.874 tors. eta vs tors. theta energy: -15.236 Dist. restrs. and SS energy: 0.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -196.010685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.010685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.117572 (E_RNA) where: Base-Base interactions energy: -118.763 where: short stacking energy: -61.586 Base-Backbone interact. energy: 3.125 local terms energy: -80.479818 where: bonds (distance) C4'-P energy: -20.095 bonds (distance) P-C4' energy: -20.601 flat angles C4'-P-C4' energy: -11.831 flat angles P-C4'-P energy: -20.115 tors. eta vs tors. theta energy: -7.837 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -399.274461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.274461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.329982 (E_RNA) where: Base-Base interactions energy: -266.841 where: short stacking energy: -112.475 Base-Backbone interact. energy: -3.030 local terms energy: -129.459546 where: bonds (distance) C4'-P energy: -27.507 bonds (distance) P-C4' energy: -24.707 flat angles C4'-P-C4' energy: -27.675 flat angles P-C4'-P energy: -16.782 tors. eta vs tors. theta energy: -32.789 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -372.830963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.830963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.830963 (E_RNA) where: Base-Base interactions energy: -246.870 where: short stacking energy: -125.608 Base-Backbone interact. energy: 0.543 local terms energy: -126.504288 where: bonds (distance) C4'-P energy: -21.934 bonds (distance) P-C4' energy: -25.835 flat angles C4'-P-C4' energy: -28.172 flat angles P-C4'-P energy: -18.990 tors. eta vs tors. theta energy: -31.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -368.318563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.318563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.320603 (E_RNA) where: Base-Base interactions energy: -244.654 where: short stacking energy: -104.161 Base-Backbone interact. energy: -0.572 local terms energy: -123.095020 where: bonds (distance) C4'-P energy: -26.438 bonds (distance) P-C4' energy: -26.183 flat angles C4'-P-C4' energy: -29.557 flat angles P-C4'-P energy: -15.555 tors. eta vs tors. theta energy: -25.362 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -356.811309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.811309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.861927 (E_RNA) where: Base-Base interactions energy: -236.701 where: short stacking energy: -111.446 Base-Backbone interact. energy: -0.954 local terms energy: -119.206579 where: bonds (distance) C4'-P energy: -19.831 bonds (distance) P-C4' energy: -23.877 flat angles C4'-P-C4' energy: -25.280 flat angles P-C4'-P energy: -19.221 tors. eta vs tors. theta energy: -30.998 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -334.078330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.078330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.165103 (E_RNA) where: Base-Base interactions energy: -226.535 where: short stacking energy: -112.479 Base-Backbone interact. energy: -1.941 local terms energy: -105.688856 where: bonds (distance) C4'-P energy: -19.426 bonds (distance) P-C4' energy: -20.959 flat angles C4'-P-C4' energy: -24.394 flat angles P-C4'-P energy: -13.266 tors. eta vs tors. theta energy: -27.644 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -226.825075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.825075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.825075 (E_RNA) where: Base-Base interactions energy: -131.526 where: short stacking energy: -69.653 Base-Backbone interact. energy: -0.184 local terms energy: -95.115662 where: bonds (distance) C4'-P energy: -19.384 bonds (distance) P-C4' energy: -24.790 flat angles C4'-P-C4' energy: -23.937 flat angles P-C4'-P energy: -12.621 tors. eta vs tors. theta energy: -14.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -238.135718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.135718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.267640 (E_RNA) where: Base-Base interactions energy: -141.330 where: short stacking energy: -91.118 Base-Backbone interact. energy: -0.863 local terms energy: -96.075040 where: bonds (distance) C4'-P energy: -13.132 bonds (distance) P-C4' energy: -21.071 flat angles C4'-P-C4' energy: -25.517 flat angles P-C4'-P energy: -14.681 tors. eta vs tors. theta energy: -21.674 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -208.841307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.841307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.883181 (E_RNA) where: Base-Base interactions energy: -125.626 where: short stacking energy: -75.270 Base-Backbone interact. energy: -0.577 local terms energy: -82.680365 where: bonds (distance) C4'-P energy: -23.954 bonds (distance) P-C4' energy: -20.630 flat angles C4'-P-C4' energy: -20.951 flat angles P-C4'-P energy: -10.704 tors. eta vs tors. theta energy: -6.441 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -228.317204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.317204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.534597 (E_RNA) where: Base-Base interactions energy: -132.730 where: short stacking energy: -73.593 Base-Backbone interact. energy: 0.081 local terms energy: -95.885788 where: bonds (distance) C4'-P energy: -25.883 bonds (distance) P-C4' energy: -24.098 flat angles C4'-P-C4' energy: -15.545 flat angles P-C4'-P energy: -11.264 tors. eta vs tors. theta energy: -19.095 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -193.782849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.782849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.802829 (E_RNA) where: Base-Base interactions energy: -126.370 where: short stacking energy: -60.369 Base-Backbone interact. energy: 0.556 local terms energy: -67.989756 where: bonds (distance) C4'-P energy: -17.286 bonds (distance) P-C4' energy: -20.926 flat angles C4'-P-C4' energy: -14.939 flat angles P-C4'-P energy: -8.506 tors. eta vs tors. theta energy: -6.332 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -388.613861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.613861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.690757 (E_RNA) where: Base-Base interactions energy: -272.147 where: short stacking energy: -119.483 Base-Backbone interact. energy: -0.419 local terms energy: -116.124197 where: bonds (distance) C4'-P energy: -27.229 bonds (distance) P-C4' energy: -22.258 flat angles C4'-P-C4' energy: -22.313 flat angles P-C4'-P energy: -12.683 tors. eta vs tors. theta energy: -31.640 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -358.656040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.656040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.663610 (E_RNA) where: Base-Base interactions energy: -234.751 where: short stacking energy: -106.021 Base-Backbone interact. energy: -0.961 local terms energy: -122.952033 where: bonds (distance) C4'-P energy: -24.572 bonds (distance) P-C4' energy: -25.903 flat angles C4'-P-C4' energy: -26.333 flat angles P-C4'-P energy: -17.113 tors. eta vs tors. theta energy: -29.031 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -354.211398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.211398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.245534 (E_RNA) where: Base-Base interactions energy: -237.575 where: short stacking energy: -109.314 Base-Backbone interact. energy: -0.071 local terms energy: -116.599174 where: bonds (distance) C4'-P energy: -23.358 bonds (distance) P-C4' energy: -28.918 flat angles C4'-P-C4' energy: -23.148 flat angles P-C4'-P energy: -15.848 tors. eta vs tors. theta energy: -25.327 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -323.009179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.009179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.009179 (E_RNA) where: Base-Base interactions energy: -204.434 where: short stacking energy: -99.265 Base-Backbone interact. energy: -0.685 local terms energy: -117.891014 where: bonds (distance) C4'-P energy: -18.615 bonds (distance) P-C4' energy: -24.437 flat angles C4'-P-C4' energy: -26.098 flat angles P-C4'-P energy: -22.474 tors. eta vs tors. theta energy: -26.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -330.880014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.880014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.081163 (E_RNA) where: Base-Base interactions energy: -204.851 where: short stacking energy: -96.249 Base-Backbone interact. energy: -0.005 local terms energy: -126.225590 where: bonds (distance) C4'-P energy: -25.436 bonds (distance) P-C4' energy: -26.093 flat angles C4'-P-C4' energy: -27.001 flat angles P-C4'-P energy: -17.457 tors. eta vs tors. theta energy: -30.238 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -245.040011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.040011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.054160 (E_RNA) where: Base-Base interactions energy: -138.027 where: short stacking energy: -83.275 Base-Backbone interact. energy: -0.214 local terms energy: -106.813262 where: bonds (distance) C4'-P energy: -17.681 bonds (distance) P-C4' energy: -24.571 flat angles C4'-P-C4' energy: -23.375 flat angles P-C4'-P energy: -15.621 tors. eta vs tors. theta energy: -25.565 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -231.131854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.131854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.154535 (E_RNA) where: Base-Base interactions energy: -148.484 where: short stacking energy: -73.091 Base-Backbone interact. energy: -0.142 local terms energy: -82.527986 where: bonds (distance) C4'-P energy: -13.903 bonds (distance) P-C4' energy: -17.779 flat angles C4'-P-C4' energy: -20.725 flat angles P-C4'-P energy: -14.778 tors. eta vs tors. theta energy: -15.343 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -229.569132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.569132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.603033 (E_RNA) where: Base-Base interactions energy: -134.790 where: short stacking energy: -75.210 Base-Backbone interact. energy: -0.407 local terms energy: -94.406894 where: bonds (distance) C4'-P energy: -16.160 bonds (distance) P-C4' energy: -25.246 flat angles C4'-P-C4' energy: -18.298 flat angles P-C4'-P energy: -16.639 tors. eta vs tors. theta energy: -18.063 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -211.006542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.006542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.128038 (E_RNA) where: Base-Base interactions energy: -119.273 where: short stacking energy: -71.732 Base-Backbone interact. energy: -0.708 local terms energy: -91.147559 where: bonds (distance) C4'-P energy: -22.761 bonds (distance) P-C4' energy: -21.482 flat angles C4'-P-C4' energy: -20.238 flat angles P-C4'-P energy: -13.231 tors. eta vs tors. theta energy: -13.436 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -202.440573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.440573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.468775 (E_RNA) where: Base-Base interactions energy: -116.607 where: short stacking energy: -60.452 Base-Backbone interact. energy: -0.976 local terms energy: -84.885556 where: bonds (distance) C4'-P energy: -19.674 bonds (distance) P-C4' energy: -18.507 flat angles C4'-P-C4' energy: -17.548 flat angles P-C4'-P energy: -15.980 tors. eta vs tors. theta energy: -13.178 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -394.585993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.585993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.585993 (E_RNA) where: Base-Base interactions energy: -278.075 where: short stacking energy: -117.555 Base-Backbone interact. energy: -0.275 local terms energy: -116.236186 where: bonds (distance) C4'-P energy: -25.702 bonds (distance) P-C4' energy: -24.994 flat angles C4'-P-C4' energy: -23.314 flat angles P-C4'-P energy: -10.712 tors. eta vs tors. theta energy: -31.515 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -357.760995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.760995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.765159 (E_RNA) where: Base-Base interactions energy: -249.405 where: short stacking energy: -116.392 Base-Backbone interact. energy: -0.290 local terms energy: -108.070560 where: bonds (distance) C4'-P energy: -22.973 bonds (distance) P-C4' energy: -17.404 flat angles C4'-P-C4' energy: -26.169 flat angles P-C4'-P energy: -12.395 tors. eta vs tors. theta energy: -29.130 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -344.403838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.403838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.462248 (E_RNA) where: Base-Base interactions energy: -227.798 where: short stacking energy: -109.211 Base-Backbone interact. energy: 0.251 local terms energy: -116.915277 where: bonds (distance) C4'-P energy: -23.719 bonds (distance) P-C4' energy: -24.161 flat angles C4'-P-C4' energy: -26.686 flat angles P-C4'-P energy: -14.223 tors. eta vs tors. theta energy: -28.126 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -344.190844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.190844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.235012 (E_RNA) where: Base-Base interactions energy: -227.216 where: short stacking energy: -114.654 Base-Backbone interact. energy: -0.220 local terms energy: -116.798653 where: bonds (distance) C4'-P energy: -17.584 bonds (distance) P-C4' energy: -20.830 flat angles C4'-P-C4' energy: -26.971 flat angles P-C4'-P energy: -18.395 tors. eta vs tors. theta energy: -33.018 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -330.744522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.744522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.773309 (E_RNA) where: Base-Base interactions energy: -219.095 where: short stacking energy: -103.054 Base-Backbone interact. energy: -0.799 local terms energy: -110.880022 where: bonds (distance) C4'-P energy: -25.552 bonds (distance) P-C4' energy: -18.460 flat angles C4'-P-C4' energy: -27.364 flat angles P-C4'-P energy: -15.211 tors. eta vs tors. theta energy: -24.293 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -253.439056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.439056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.439056 (E_RNA) where: Base-Base interactions energy: -151.168 where: short stacking energy: -96.303 Base-Backbone interact. energy: 1.640 local terms energy: -103.910504 where: bonds (distance) C4'-P energy: -18.287 bonds (distance) P-C4' energy: -24.377 flat angles C4'-P-C4' energy: -24.220 flat angles P-C4'-P energy: -13.319 tors. eta vs tors. theta energy: -23.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -242.408366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.408366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.521148 (E_RNA) where: Base-Base interactions energy: -144.738 where: short stacking energy: -86.279 Base-Backbone interact. energy: -0.020 local terms energy: -97.763360 where: bonds (distance) C4'-P energy: -19.661 bonds (distance) P-C4' energy: -26.505 flat angles C4'-P-C4' energy: -21.933 flat angles P-C4'-P energy: -12.798 tors. eta vs tors. theta energy: -16.867 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -195.119736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.119736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.197806 (E_RNA) where: Base-Base interactions energy: -112.756 where: short stacking energy: -61.963 Base-Backbone interact. energy: -0.381 local terms energy: -82.061293 where: bonds (distance) C4'-P energy: -24.096 bonds (distance) P-C4' energy: -20.965 flat angles C4'-P-C4' energy: -24.012 flat angles P-C4'-P energy: -6.292 tors. eta vs tors. theta energy: -6.697 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -217.726419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.726419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.770190 (E_RNA) where: Base-Base interactions energy: -128.374 where: short stacking energy: -64.256 Base-Backbone interact. energy: -1.487 local terms energy: -87.908797 where: bonds (distance) C4'-P energy: -26.463 bonds (distance) P-C4' energy: -23.515 flat angles C4'-P-C4' energy: -13.673 flat angles P-C4'-P energy: -14.538 tors. eta vs tors. theta energy: -9.720 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -190.498312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.498312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.734391 (E_RNA) where: Base-Base interactions energy: -113.399 where: short stacking energy: -66.153 Base-Backbone interact. energy: -0.052 local terms energy: -77.283580 where: bonds (distance) C4'-P energy: -20.955 bonds (distance) P-C4' energy: -20.486 flat angles C4'-P-C4' energy: -19.191 flat angles P-C4'-P energy: -7.627 tors. eta vs tors. theta energy: -9.025 Dist. restrs. and SS energy: 0.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -393.967960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.967960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.973556 (E_RNA) where: Base-Base interactions energy: -271.966 where: short stacking energy: -121.468 Base-Backbone interact. energy: -1.370 local terms energy: -120.637735 where: bonds (distance) C4'-P energy: -26.658 bonds (distance) P-C4' energy: -22.960 flat angles C4'-P-C4' energy: -26.034 flat angles P-C4'-P energy: -11.482 tors. eta vs tors. theta energy: -33.504 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -367.426431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.426431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.672104 (E_RNA) where: Base-Base interactions energy: -246.774 where: short stacking energy: -112.866 Base-Backbone interact. energy: -1.059 local terms energy: -119.839400 where: bonds (distance) C4'-P energy: -21.880 bonds (distance) P-C4' energy: -24.728 flat angles C4'-P-C4' energy: -26.306 flat angles P-C4'-P energy: -20.237 tors. eta vs tors. theta energy: -26.689 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -348.680929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.680929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.681813 (E_RNA) where: Base-Base interactions energy: -222.756 where: short stacking energy: -115.673 Base-Backbone interact. energy: -0.188 local terms energy: -125.737217 where: bonds (distance) C4'-P energy: -25.766 bonds (distance) P-C4' energy: -25.856 flat angles C4'-P-C4' energy: -26.210 flat angles P-C4'-P energy: -16.934 tors. eta vs tors. theta energy: -30.971 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -337.773369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.773369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.781333 (E_RNA) where: Base-Base interactions energy: -220.860 where: short stacking energy: -99.212 Base-Backbone interact. energy: -0.708 local terms energy: -116.212678 where: bonds (distance) C4'-P energy: -20.240 bonds (distance) P-C4' energy: -21.133 flat angles C4'-P-C4' energy: -29.913 flat angles P-C4'-P energy: -16.552 tors. eta vs tors. theta energy: -28.375 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -323.382617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.382617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.453679 (E_RNA) where: Base-Base interactions energy: -214.326 where: short stacking energy: -89.370 Base-Backbone interact. energy: -1.313 local terms energy: -107.814847 where: bonds (distance) C4'-P energy: -23.185 bonds (distance) P-C4' energy: -25.360 flat angles C4'-P-C4' energy: -21.309 flat angles P-C4'-P energy: -14.976 tors. eta vs tors. theta energy: -22.986 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -245.204784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.204784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.329400 (E_RNA) where: Base-Base interactions energy: -141.475 where: short stacking energy: -89.989 Base-Backbone interact. energy: -0.101 local terms energy: -103.753938 where: bonds (distance) C4'-P energy: -25.258 bonds (distance) P-C4' energy: -22.383 flat angles C4'-P-C4' energy: -22.474 flat angles P-C4'-P energy: -11.477 tors. eta vs tors. theta energy: -22.162 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -245.365830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.365830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.551392 (E_RNA) where: Base-Base interactions energy: -140.910 where: short stacking energy: -91.041 Base-Backbone interact. energy: -0.840 local terms energy: -103.800593 where: bonds (distance) C4'-P energy: -22.679 bonds (distance) P-C4' energy: -18.727 flat angles C4'-P-C4' energy: -25.962 flat angles P-C4'-P energy: -16.497 tors. eta vs tors. theta energy: -19.935 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -199.368320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.368320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.530250 (E_RNA) where: Base-Base interactions energy: -110.049 where: short stacking energy: -60.367 Base-Backbone interact. energy: 1.506 local terms energy: -90.987847 where: bonds (distance) C4'-P energy: -20.696 bonds (distance) P-C4' energy: -22.267 flat angles C4'-P-C4' energy: -19.200 flat angles P-C4'-P energy: -16.262 tors. eta vs tors. theta energy: -12.563 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -208.158043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.158043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.209435 (E_RNA) where: Base-Base interactions energy: -119.765 where: short stacking energy: -64.136 Base-Backbone interact. energy: -0.453 local terms energy: -87.991397 where: bonds (distance) C4'-P energy: -22.468 bonds (distance) P-C4' energy: -22.246 flat angles C4'-P-C4' energy: -16.349 flat angles P-C4'-P energy: -14.139 tors. eta vs tors. theta energy: -12.789 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -202.906306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.906306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.026286 (E_RNA) where: Base-Base interactions energy: -119.303 where: short stacking energy: -61.541 Base-Backbone interact. energy: -0.374 local terms energy: -83.349355 where: bonds (distance) C4'-P energy: -15.818 bonds (distance) P-C4' energy: -18.048 flat angles C4'-P-C4' energy: -24.443 flat angles P-C4'-P energy: -14.743 tors. eta vs tors. theta energy: -10.296 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -385.214087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.214087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.214087 (E_RNA) where: Base-Base interactions energy: -253.691 where: short stacking energy: -122.819 Base-Backbone interact. energy: -1.132 local terms energy: -130.391059 where: bonds (distance) C4'-P energy: -22.589 bonds (distance) P-C4' energy: -25.929 flat angles C4'-P-C4' energy: -28.657 flat angles P-C4'-P energy: -18.061 tors. eta vs tors. theta energy: -35.155 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -374.923704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.923704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.032738 (E_RNA) where: Base-Base interactions energy: -260.043 where: short stacking energy: -112.005 Base-Backbone interact. energy: -0.142 local terms energy: -114.847231 where: bonds (distance) C4'-P energy: -20.816 bonds (distance) P-C4' energy: -26.487 flat angles C4'-P-C4' energy: -24.406 flat angles P-C4'-P energy: -16.030 tors. eta vs tors. theta energy: -27.108 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -339.565394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.565394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.657295 (E_RNA) where: Base-Base interactions energy: -225.926 where: short stacking energy: -110.782 Base-Backbone interact. energy: -0.855 local terms energy: -112.876119 where: bonds (distance) C4'-P energy: -21.909 bonds (distance) P-C4' energy: -24.380 flat angles C4'-P-C4' energy: -25.136 flat angles P-C4'-P energy: -10.184 tors. eta vs tors. theta energy: -31.267 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -332.376860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.376860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.447355 (E_RNA) where: Base-Base interactions energy: -214.831 where: short stacking energy: -107.078 Base-Backbone interact. energy: -0.139 local terms energy: -117.477939 where: bonds (distance) C4'-P energy: -24.519 bonds (distance) P-C4' energy: -26.271 flat angles C4'-P-C4' energy: -27.131 flat angles P-C4'-P energy: -14.669 tors. eta vs tors. theta energy: -24.887 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -321.511530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.511530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.529148 (E_RNA) where: Base-Base interactions energy: -214.727 where: short stacking energy: -103.400 Base-Backbone interact. energy: -0.320 local terms energy: -106.482227 where: bonds (distance) C4'-P energy: -13.817 bonds (distance) P-C4' energy: -22.122 flat angles C4'-P-C4' energy: -24.940 flat angles P-C4'-P energy: -15.112 tors. eta vs tors. theta energy: -30.491 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -259.945659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.945659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.967604 (E_RNA) where: Base-Base interactions energy: -157.950 where: short stacking energy: -80.583 Base-Backbone interact. energy: 0.747 local terms energy: -102.764757 where: bonds (distance) C4'-P energy: -21.528 bonds (distance) P-C4' energy: -24.728 flat angles C4'-P-C4' energy: -21.850 flat angles P-C4'-P energy: -14.389 tors. eta vs tors. theta energy: -20.271 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -222.879910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.879910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.919150 (E_RNA) where: Base-Base interactions energy: -127.840 where: short stacking energy: -65.985 Base-Backbone interact. energy: -0.226 local terms energy: -94.853192 where: bonds (distance) C4'-P energy: -22.766 bonds (distance) P-C4' energy: -23.379 flat angles C4'-P-C4' energy: -23.935 flat angles P-C4'-P energy: -10.962 tors. eta vs tors. theta energy: -13.810 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -227.347796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.347796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.356084 (E_RNA) where: Base-Base interactions energy: -123.896 where: short stacking energy: -70.514 Base-Backbone interact. energy: 1.724 local terms energy: -105.184116 where: bonds (distance) C4'-P energy: -26.655 bonds (distance) P-C4' energy: -20.340 flat angles C4'-P-C4' energy: -20.839 flat angles P-C4'-P energy: -19.668 tors. eta vs tors. theta energy: -17.682 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -194.068767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.068767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.726579 (E_RNA) where: Base-Base interactions energy: -106.808 where: short stacking energy: -69.139 Base-Backbone interact. energy: -1.279 local terms energy: -86.639542 where: bonds (distance) C4'-P energy: -17.312 bonds (distance) P-C4' energy: -27.439 flat angles C4'-P-C4' energy: -18.239 flat angles P-C4'-P energy: -12.352 tors. eta vs tors. theta energy: -11.298 Dist. restrs. and SS energy: 0.658 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -175.061754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.061754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.956610 (E_RNA) where: Base-Base interactions energy: -96.428 where: short stacking energy: -52.466 Base-Backbone interact. energy: 0.301 local terms energy: -82.829563 where: bonds (distance) C4'-P energy: -18.415 bonds (distance) P-C4' energy: -22.214 flat angles C4'-P-C4' energy: -20.652 flat angles P-C4'-P energy: -11.912 tors. eta vs tors. theta energy: -9.637 Dist. restrs. and SS energy: 3.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -377.111838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.111838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.116702 (E_RNA) where: Base-Base interactions energy: -257.671 where: short stacking energy: -112.030 Base-Backbone interact. energy: -1.370 local terms energy: -118.075174 where: bonds (distance) C4'-P energy: -24.749 bonds (distance) P-C4' energy: -26.173 flat angles C4'-P-C4' energy: -22.316 flat angles P-C4'-P energy: -16.271 tors. eta vs tors. theta energy: -28.567 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -373.052395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.052395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.087679 (E_RNA) where: Base-Base interactions energy: -259.023 where: short stacking energy: -119.676 Base-Backbone interact. energy: -0.544 local terms energy: -113.520323 where: bonds (distance) C4'-P energy: -18.067 bonds (distance) P-C4' energy: -25.315 flat angles C4'-P-C4' energy: -26.789 flat angles P-C4'-P energy: -12.272 tors. eta vs tors. theta energy: -31.077 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -340.963995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.963995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.083503 (E_RNA) where: Base-Base interactions energy: -227.536 where: short stacking energy: -122.820 Base-Backbone interact. energy: -0.259 local terms energy: -113.289207 where: bonds (distance) C4'-P energy: -20.487 bonds (distance) P-C4' energy: -24.303 flat angles C4'-P-C4' energy: -26.867 flat angles P-C4'-P energy: -10.816 tors. eta vs tors. theta energy: -30.816 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -336.958421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.958421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.983097 (E_RNA) where: Base-Base interactions energy: -224.957 where: short stacking energy: -112.542 Base-Backbone interact. energy: -0.178 local terms energy: -111.848737 where: bonds (distance) C4'-P energy: -23.772 bonds (distance) P-C4' energy: -18.962 flat angles C4'-P-C4' energy: -24.377 flat angles P-C4'-P energy: -16.357 tors. eta vs tors. theta energy: -28.381 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -322.706088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.706088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.821609 (E_RNA) where: Base-Base interactions energy: -219.809 where: short stacking energy: -101.626 Base-Backbone interact. energy: -2.948 local terms energy: -100.064832 where: bonds (distance) C4'-P energy: -14.952 bonds (distance) P-C4' energy: -22.818 flat angles C4'-P-C4' energy: -22.913 flat angles P-C4'-P energy: -11.918 tors. eta vs tors. theta energy: -27.465 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -252.129126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.129126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.321268 (E_RNA) where: Base-Base interactions energy: -154.028 where: short stacking energy: -80.954 Base-Backbone interact. energy: 0.268 local terms energy: -98.561354 where: bonds (distance) C4'-P energy: -23.550 bonds (distance) P-C4' energy: -24.130 flat angles C4'-P-C4' energy: -23.201 flat angles P-C4'-P energy: -13.022 tors. eta vs tors. theta energy: -14.658 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -231.921202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.921202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.937359 (E_RNA) where: Base-Base interactions energy: -139.452 where: short stacking energy: -79.657 Base-Backbone interact. energy: -0.162 local terms energy: -92.323382 where: bonds (distance) C4'-P energy: -23.007 bonds (distance) P-C4' energy: -20.379 flat angles C4'-P-C4' energy: -22.560 flat angles P-C4'-P energy: -11.524 tors. eta vs tors. theta energy: -14.852 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -218.241954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.241954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.287196 (E_RNA) where: Base-Base interactions energy: -128.755 where: short stacking energy: -73.469 Base-Backbone interact. energy: -0.207 local terms energy: -89.324869 where: bonds (distance) C4'-P energy: -22.161 bonds (distance) P-C4' energy: -23.508 flat angles C4'-P-C4' energy: -20.675 flat angles P-C4'-P energy: -16.649 tors. eta vs tors. theta energy: -6.332 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -209.815813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.815813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.974752 (E_RNA) where: Base-Base interactions energy: -129.647 where: short stacking energy: -76.380 Base-Backbone interact. energy: -0.558 local terms energy: -79.768916 where: bonds (distance) C4'-P energy: -24.680 bonds (distance) P-C4' energy: -18.639 flat angles C4'-P-C4' energy: -19.046 flat angles P-C4'-P energy: -8.234 tors. eta vs tors. theta energy: -9.170 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -201.212648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.212648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.358464 (E_RNA) where: Base-Base interactions energy: -136.490 where: short stacking energy: -74.992 Base-Backbone interact. energy: -1.004 local terms energy: -63.863960 where: bonds (distance) C4'-P energy: -21.522 bonds (distance) P-C4' energy: -19.982 flat angles C4'-P-C4' energy: -9.259 flat angles P-C4'-P energy: -1.784 tors. eta vs tors. theta energy: -11.317 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -376.091099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.091099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.136300 (E_RNA) where: Base-Base interactions energy: -252.451 where: short stacking energy: -115.453 Base-Backbone interact. energy: -0.860 local terms energy: -122.825315 where: bonds (distance) C4'-P energy: -22.020 bonds (distance) P-C4' energy: -23.087 flat angles C4'-P-C4' energy: -28.406 flat angles P-C4'-P energy: -19.083 tors. eta vs tors. theta energy: -30.229 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -396.161547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.161547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.161547 (E_RNA) where: Base-Base interactions energy: -266.571 where: short stacking energy: -121.680 Base-Backbone interact. energy: -2.039 local terms energy: -127.551113 where: bonds (distance) C4'-P energy: -23.828 bonds (distance) P-C4' energy: -23.815 flat angles C4'-P-C4' energy: -26.087 flat angles P-C4'-P energy: -21.170 tors. eta vs tors. theta energy: -32.650 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -350.243096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.243096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.318208 (E_RNA) where: Base-Base interactions energy: -234.071 where: short stacking energy: -109.887 Base-Backbone interact. energy: -1.412 local terms energy: -114.835229 where: bonds (distance) C4'-P energy: -24.807 bonds (distance) P-C4' energy: -18.148 flat angles C4'-P-C4' energy: -24.822 flat angles P-C4'-P energy: -15.455 tors. eta vs tors. theta energy: -31.603 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -341.928079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.928079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.969854 (E_RNA) where: Base-Base interactions energy: -230.047 where: short stacking energy: -114.596 Base-Backbone interact. energy: -0.120 local terms energy: -111.802834 where: bonds (distance) C4'-P energy: -24.449 bonds (distance) P-C4' energy: -17.103 flat angles C4'-P-C4' energy: -24.044 flat angles P-C4'-P energy: -16.049 tors. eta vs tors. theta energy: -30.159 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -320.230972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.230972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.301313 (E_RNA) where: Base-Base interactions energy: -208.798 where: short stacking energy: -102.255 Base-Backbone interact. energy: -1.219 local terms energy: -110.284222 where: bonds (distance) C4'-P energy: -24.849 bonds (distance) P-C4' energy: -21.489 flat angles C4'-P-C4' energy: -25.155 flat angles P-C4'-P energy: -12.044 tors. eta vs tors. theta energy: -26.748 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -231.158060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.158060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.521487 (E_RNA) where: Base-Base interactions energy: -139.136 where: short stacking energy: -83.034 Base-Backbone interact. energy: -0.570 local terms energy: -91.815713 where: bonds (distance) C4'-P energy: -22.343 bonds (distance) P-C4' energy: -16.871 flat angles C4'-P-C4' energy: -18.511 flat angles P-C4'-P energy: -14.159 tors. eta vs tors. theta energy: -19.931 Dist. restrs. and SS energy: 0.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -222.560325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.560325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.567012 (E_RNA) where: Base-Base interactions energy: -131.420 where: short stacking energy: -66.417 Base-Backbone interact. energy: -0.420 local terms energy: -90.726828 where: bonds (distance) C4'-P energy: -19.359 bonds (distance) P-C4' energy: -24.328 flat angles C4'-P-C4' energy: -18.837 flat angles P-C4'-P energy: -15.897 tors. eta vs tors. theta energy: -12.306 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -221.877842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.877842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.877842 (E_RNA) where: Base-Base interactions energy: -135.723 where: short stacking energy: -78.581 Base-Backbone interact. energy: -0.133 local terms energy: -86.021709 where: bonds (distance) C4'-P energy: -22.617 bonds (distance) P-C4' energy: -17.574 flat angles C4'-P-C4' energy: -14.853 flat angles P-C4'-P energy: -11.227 tors. eta vs tors. theta energy: -19.750 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -207.517478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.517478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.674081 (E_RNA) where: Base-Base interactions energy: -124.581 where: short stacking energy: -68.474 Base-Backbone interact. energy: -0.685 local terms energy: -82.407850 where: bonds (distance) C4'-P energy: -19.672 bonds (distance) P-C4' energy: -22.517 flat angles C4'-P-C4' energy: -20.346 flat angles P-C4'-P energy: -12.249 tors. eta vs tors. theta energy: -7.624 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -189.959349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.959349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.097846 (E_RNA) where: Base-Base interactions energy: -118.805 where: short stacking energy: -57.063 Base-Backbone interact. energy: -0.316 local terms energy: -70.976906 where: bonds (distance) C4'-P energy: -18.362 bonds (distance) P-C4' energy: -18.507 flat angles C4'-P-C4' energy: -15.290 flat angles P-C4'-P energy: -13.653 tors. eta vs tors. theta energy: -5.165 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -398.767328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.767328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.769594 (E_RNA) where: Base-Base interactions energy: -267.648 where: short stacking energy: -130.402 Base-Backbone interact. energy: -0.766 local terms energy: -130.355998 where: bonds (distance) C4'-P energy: -23.356 bonds (distance) P-C4' energy: -23.351 flat angles C4'-P-C4' energy: -28.662 flat angles P-C4'-P energy: -19.394 tors. eta vs tors. theta energy: -35.593 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -367.837090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.837090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.872358 (E_RNA) where: Base-Base interactions energy: -241.782 where: short stacking energy: -112.961 Base-Backbone interact. energy: -0.668 local terms energy: -125.422410 where: bonds (distance) C4'-P energy: -26.710 bonds (distance) P-C4' energy: -24.816 flat angles C4'-P-C4' energy: -29.456 flat angles P-C4'-P energy: -17.016 tors. eta vs tors. theta energy: -27.425 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -359.365845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.365845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.377548 (E_RNA) where: Base-Base interactions energy: -248.145 where: short stacking energy: -122.890 Base-Backbone interact. energy: -0.305 local terms energy: -110.927536 where: bonds (distance) C4'-P energy: -20.853 bonds (distance) P-C4' energy: -20.971 flat angles C4'-P-C4' energy: -22.588 flat angles P-C4'-P energy: -13.519 tors. eta vs tors. theta energy: -32.997 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -343.717681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.717681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.749422 (E_RNA) where: Base-Base interactions energy: -215.760 where: short stacking energy: -109.429 Base-Backbone interact. energy: -0.783 local terms energy: -127.206076 where: bonds (distance) C4'-P energy: -22.596 bonds (distance) P-C4' energy: -23.158 flat angles C4'-P-C4' energy: -29.214 flat angles P-C4'-P energy: -20.024 tors. eta vs tors. theta energy: -32.214 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -331.182516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.182516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.267632 (E_RNA) where: Base-Base interactions energy: -213.045 where: short stacking energy: -108.122 Base-Backbone interact. energy: -0.991 local terms energy: -117.231165 where: bonds (distance) C4'-P energy: -27.435 bonds (distance) P-C4' energy: -19.808 flat angles C4'-P-C4' energy: -25.820 flat angles P-C4'-P energy: -15.533 tors. eta vs tors. theta energy: -28.634 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -254.627298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.627298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.648584 (E_RNA) where: Base-Base interactions energy: -152.576 where: short stacking energy: -99.473 Base-Backbone interact. energy: -0.017 local terms energy: -102.056065 where: bonds (distance) C4'-P energy: -21.248 bonds (distance) P-C4' energy: -24.499 flat angles C4'-P-C4' energy: -21.348 flat angles P-C4'-P energy: -9.142 tors. eta vs tors. theta energy: -25.819 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -238.781988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.781988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.812556 (E_RNA) where: Base-Base interactions energy: -129.231 where: short stacking energy: -76.845 Base-Backbone interact. energy: -0.159 local terms energy: -109.422550 where: bonds (distance) C4'-P energy: -19.429 bonds (distance) P-C4' energy: -23.694 flat angles C4'-P-C4' energy: -24.013 flat angles P-C4'-P energy: -17.069 tors. eta vs tors. theta energy: -25.217 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -213.281009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.281009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.348882 (E_RNA) where: Base-Base interactions energy: -118.345 where: short stacking energy: -68.628 Base-Backbone interact. energy: -0.680 local terms energy: -94.323912 where: bonds (distance) C4'-P energy: -25.506 bonds (distance) P-C4' energy: -22.173 flat angles C4'-P-C4' energy: -19.522 flat angles P-C4'-P energy: -11.573 tors. eta vs tors. theta energy: -15.550 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -195.886761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.886761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.528856 (E_RNA) where: Base-Base interactions energy: -117.092 where: short stacking energy: -58.775 Base-Backbone interact. energy: -0.815 local terms energy: -78.621662 where: bonds (distance) C4'-P energy: -22.087 bonds (distance) P-C4' energy: -22.330 flat angles C4'-P-C4' energy: -18.066 flat angles P-C4'-P energy: -10.680 tors. eta vs tors. theta energy: -5.458 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -201.663366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.663366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.680369 (E_RNA) where: Base-Base interactions energy: -125.014 where: short stacking energy: -68.449 Base-Backbone interact. energy: -0.463 local terms energy: -76.203176 where: bonds (distance) C4'-P energy: -17.301 bonds (distance) P-C4' energy: -18.785 flat angles C4'-P-C4' energy: -20.096 flat angles P-C4'-P energy: -8.759 tors. eta vs tors. theta energy: -11.262 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -390.982520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.982520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.982520 (E_RNA) where: Base-Base interactions energy: -261.181 where: short stacking energy: -123.876 Base-Backbone interact. energy: -0.700 local terms energy: -129.101517 where: bonds (distance) C4'-P energy: -27.014 bonds (distance) P-C4' energy: -23.918 flat angles C4'-P-C4' energy: -24.748 flat angles P-C4'-P energy: -18.269 tors. eta vs tors. theta energy: -35.153 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -362.383088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.383088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.389053 (E_RNA) where: Base-Base interactions energy: -238.808 where: short stacking energy: -112.112 Base-Backbone interact. energy: -0.451 local terms energy: -123.130153 where: bonds (distance) C4'-P energy: -25.296 bonds (distance) P-C4' energy: -25.592 flat angles C4'-P-C4' energy: -25.660 flat angles P-C4'-P energy: -19.580 tors. eta vs tors. theta energy: -27.002 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -365.376846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.376846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.411615 (E_RNA) where: Base-Base interactions energy: -241.762 where: short stacking energy: -115.045 Base-Backbone interact. energy: 0.122 local terms energy: -123.771791 where: bonds (distance) C4'-P energy: -24.899 bonds (distance) P-C4' energy: -25.807 flat angles C4'-P-C4' energy: -27.915 flat angles P-C4'-P energy: -15.838 tors. eta vs tors. theta energy: -29.313 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -335.985004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.985004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.998866 (E_RNA) where: Base-Base interactions energy: -223.917 where: short stacking energy: -99.341 Base-Backbone interact. energy: -0.383 local terms energy: -111.697990 where: bonds (distance) C4'-P energy: -16.273 bonds (distance) P-C4' energy: -25.492 flat angles C4'-P-C4' energy: -26.325 flat angles P-C4'-P energy: -15.369 tors. eta vs tors. theta energy: -28.239 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -316.430559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.430559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.460492 (E_RNA) where: Base-Base interactions energy: -209.766 where: short stacking energy: -99.511 Base-Backbone interact. energy: -0.666 local terms energy: -106.027762 where: bonds (distance) C4'-P energy: -20.693 bonds (distance) P-C4' energy: -21.039 flat angles C4'-P-C4' energy: -20.856 flat angles P-C4'-P energy: -17.465 tors. eta vs tors. theta energy: -25.974 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -237.431224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.431224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.431224 (E_RNA) where: Base-Base interactions energy: -144.674 where: short stacking energy: -79.096 Base-Backbone interact. energy: 0.091 local terms energy: -92.848660 where: bonds (distance) C4'-P energy: -14.509 bonds (distance) P-C4' energy: -22.694 flat angles C4'-P-C4' energy: -27.287 flat angles P-C4'-P energy: -13.843 tors. eta vs tors. theta energy: -14.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -240.682035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.682035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.934966 (E_RNA) where: Base-Base interactions energy: -139.391 where: short stacking energy: -85.566 Base-Backbone interact. energy: -0.655 local terms energy: -100.888356 where: bonds (distance) C4'-P energy: -20.693 bonds (distance) P-C4' energy: -22.554 flat angles C4'-P-C4' energy: -18.854 flat angles P-C4'-P energy: -17.541 tors. eta vs tors. theta energy: -21.246 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -232.222821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.222821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.222821 (E_RNA) where: Base-Base interactions energy: -138.576 where: short stacking energy: -78.825 Base-Backbone interact. energy: -0.076 local terms energy: -93.570077 where: bonds (distance) C4'-P energy: -21.243 bonds (distance) P-C4' energy: -19.867 flat angles C4'-P-C4' energy: -19.151 flat angles P-C4'-P energy: -19.025 tors. eta vs tors. theta energy: -14.285 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -200.929379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.929379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.969663 (E_RNA) where: Base-Base interactions energy: -124.796 where: short stacking energy: -64.985 Base-Backbone interact. energy: -1.102 local terms energy: -75.071273 where: bonds (distance) C4'-P energy: -18.232 bonds (distance) P-C4' energy: -23.009 flat angles C4'-P-C4' energy: -16.199 flat angles P-C4'-P energy: -15.103 tors. eta vs tors. theta energy: -2.528 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -183.320420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.320420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.460829 (E_RNA) where: Base-Base interactions energy: -107.884 where: short stacking energy: -59.706 Base-Backbone interact. energy: -0.414 local terms energy: -75.163507 where: bonds (distance) C4'-P energy: -17.490 bonds (distance) P-C4' energy: -17.842 flat angles C4'-P-C4' energy: -17.140 flat angles P-C4'-P energy: -14.482 tors. eta vs tors. theta energy: -8.211 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -389.304567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.304567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.304623 (E_RNA) where: Base-Base interactions energy: -268.408 where: short stacking energy: -121.268 Base-Backbone interact. energy: -0.693 local terms energy: -120.203980 where: bonds (distance) C4'-P energy: -25.872 bonds (distance) P-C4' energy: -19.073 flat angles C4'-P-C4' energy: -25.243 flat angles P-C4'-P energy: -18.801 tors. eta vs tors. theta energy: -31.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -351.696803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.696803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.753103 (E_RNA) where: Base-Base interactions energy: -239.834 where: short stacking energy: -118.761 Base-Backbone interact. energy: 1.119 local terms energy: -113.038130 where: bonds (distance) C4'-P energy: -19.329 bonds (distance) P-C4' energy: -20.960 flat angles C4'-P-C4' energy: -23.491 flat angles P-C4'-P energy: -19.185 tors. eta vs tors. theta energy: -30.073 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -353.820506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.820506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.852785 (E_RNA) where: Base-Base interactions energy: -228.524 where: short stacking energy: -94.035 Base-Backbone interact. energy: -0.683 local terms energy: -124.646331 where: bonds (distance) C4'-P energy: -28.727 bonds (distance) P-C4' energy: -22.943 flat angles C4'-P-C4' energy: -25.708 flat angles P-C4'-P energy: -19.592 tors. eta vs tors. theta energy: -27.676 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -336.297845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.297845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.334134 (E_RNA) where: Base-Base interactions energy: -224.877 where: short stacking energy: -101.599 Base-Backbone interact. energy: -0.072 local terms energy: -111.386011 where: bonds (distance) C4'-P energy: -15.428 bonds (distance) P-C4' energy: -27.340 flat angles C4'-P-C4' energy: -23.816 flat angles P-C4'-P energy: -17.664 tors. eta vs tors. theta energy: -27.137 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -333.474403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.474403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.518464 (E_RNA) where: Base-Base interactions energy: -216.744 where: short stacking energy: -105.122 Base-Backbone interact. energy: -0.298 local terms energy: -116.477190 where: bonds (distance) C4'-P energy: -19.742 bonds (distance) P-C4' energy: -22.821 flat angles C4'-P-C4' energy: -25.558 flat angles P-C4'-P energy: -18.766 tors. eta vs tors. theta energy: -29.590 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -259.479229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.479229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.479229 (E_RNA) where: Base-Base interactions energy: -155.550 where: short stacking energy: -81.644 Base-Backbone interact. energy: 0.950 local terms energy: -104.879339 where: bonds (distance) C4'-P energy: -23.821 bonds (distance) P-C4' energy: -22.207 flat angles C4'-P-C4' energy: -24.463 flat angles P-C4'-P energy: -17.532 tors. eta vs tors. theta energy: -16.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -237.274267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.274267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.338926 (E_RNA) where: Base-Base interactions energy: -142.059 where: short stacking energy: -81.154 Base-Backbone interact. energy: 1.184 local terms energy: -96.464190 where: bonds (distance) C4'-P energy: -18.169 bonds (distance) P-C4' energy: -26.481 flat angles C4'-P-C4' energy: -23.541 flat angles P-C4'-P energy: -6.226 tors. eta vs tors. theta energy: -22.048 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -231.956731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.956731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.023723 (E_RNA) where: Base-Base interactions energy: -143.964 where: short stacking energy: -77.696 Base-Backbone interact. energy: -0.222 local terms energy: -87.838573 where: bonds (distance) C4'-P energy: -19.284 bonds (distance) P-C4' energy: -24.937 flat angles C4'-P-C4' energy: -20.936 flat angles P-C4'-P energy: -11.523 tors. eta vs tors. theta energy: -11.159 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -222.253755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.253755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.272741 (E_RNA) where: Base-Base interactions energy: -131.162 where: short stacking energy: -73.926 Base-Backbone interact. energy: 0.732 local terms energy: -91.843647 where: bonds (distance) C4'-P energy: -19.785 bonds (distance) P-C4' energy: -15.913 flat angles C4'-P-C4' energy: -24.854 flat angles P-C4'-P energy: -13.378 tors. eta vs tors. theta energy: -17.914 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -200.251960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.251960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.306240 (E_RNA) where: Base-Base interactions energy: -123.073 where: short stacking energy: -74.640 Base-Backbone interact. energy: -0.575 local terms energy: -76.658056 where: bonds (distance) C4'-P energy: -12.073 bonds (distance) P-C4' energy: -19.941 flat angles C4'-P-C4' energy: -23.262 flat angles P-C4'-P energy: -10.600 tors. eta vs tors. theta energy: -10.782 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -395.834351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.834351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.834351 (E_RNA) where: Base-Base interactions energy: -273.138 where: short stacking energy: -124.339 Base-Backbone interact. energy: -1.825 local terms energy: -120.870913 where: bonds (distance) C4'-P energy: -19.723 bonds (distance) P-C4' energy: -26.164 flat angles C4'-P-C4' energy: -26.293 flat angles P-C4'-P energy: -19.335 tors. eta vs tors. theta energy: -29.356 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -364.880105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.880105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.880105 (E_RNA) where: Base-Base interactions energy: -241.361 where: short stacking energy: -105.740 Base-Backbone interact. energy: -0.118 local terms energy: -123.400882 where: bonds (distance) C4'-P energy: -21.269 bonds (distance) P-C4' energy: -28.252 flat angles C4'-P-C4' energy: -27.748 flat angles P-C4'-P energy: -17.405 tors. eta vs tors. theta energy: -28.727 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -358.465442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.465442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.506622 (E_RNA) where: Base-Base interactions energy: -234.548 where: short stacking energy: -118.905 Base-Backbone interact. energy: 0.135 local terms energy: -124.093359 where: bonds (distance) C4'-P energy: -22.816 bonds (distance) P-C4' energy: -20.436 flat angles C4'-P-C4' energy: -30.474 flat angles P-C4'-P energy: -16.351 tors. eta vs tors. theta energy: -34.018 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -337.825152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.825152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.825152 (E_RNA) where: Base-Base interactions energy: -225.855 where: short stacking energy: -98.940 Base-Backbone interact. energy: -0.364 local terms energy: -111.606105 where: bonds (distance) C4'-P energy: -22.121 bonds (distance) P-C4' energy: -18.092 flat angles C4'-P-C4' energy: -26.735 flat angles P-C4'-P energy: -17.077 tors. eta vs tors. theta energy: -27.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -338.096843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.096843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.169940 (E_RNA) where: Base-Base interactions energy: -223.195 where: short stacking energy: -110.997 Base-Backbone interact. energy: -0.129 local terms energy: -114.845962 where: bonds (distance) C4'-P energy: -23.057 bonds (distance) P-C4' energy: -20.625 flat angles C4'-P-C4' energy: -25.403 flat angles P-C4'-P energy: -18.008 tors. eta vs tors. theta energy: -27.753 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -234.864716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.864716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.063873 (E_RNA) where: Base-Base interactions energy: -151.719 where: short stacking energy: -84.908 Base-Backbone interact. energy: -0.352 local terms energy: -82.992573 where: bonds (distance) C4'-P energy: -19.707 bonds (distance) P-C4' energy: -21.261 flat angles C4'-P-C4' energy: -18.143 flat angles P-C4'-P energy: -12.376 tors. eta vs tors. theta energy: -11.506 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -227.981248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.981248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.997245 (E_RNA) where: Base-Base interactions energy: -146.798 where: short stacking energy: -77.020 Base-Backbone interact. energy: -0.212 local terms energy: -80.987114 where: bonds (distance) C4'-P energy: -10.397 bonds (distance) P-C4' energy: -15.040 flat angles C4'-P-C4' energy: -25.025 flat angles P-C4'-P energy: -17.107 tors. eta vs tors. theta energy: -13.418 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -216.007989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.007989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.149627 (E_RNA) where: Base-Base interactions energy: -128.648 where: short stacking energy: -68.993 Base-Backbone interact. energy: 0.195 local terms energy: -87.696244 where: bonds (distance) C4'-P energy: -19.045 bonds (distance) P-C4' energy: -24.588 flat angles C4'-P-C4' energy: -22.643 flat angles P-C4'-P energy: -10.572 tors. eta vs tors. theta energy: -10.849 Dist. restrs. and SS energy: 0.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -206.652453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.652453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.049906 (E_RNA) where: Base-Base interactions energy: -117.329 where: short stacking energy: -69.176 Base-Backbone interact. energy: -0.168 local terms energy: -89.553480 where: bonds (distance) C4'-P energy: -22.480 bonds (distance) P-C4' energy: -22.285 flat angles C4'-P-C4' energy: -18.563 flat angles P-C4'-P energy: -15.754 tors. eta vs tors. theta energy: -10.471 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -215.030809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.030809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.082480 (E_RNA) where: Base-Base interactions energy: -124.624 where: short stacking energy: -72.217 Base-Backbone interact. energy: -0.445 local terms energy: -90.012836 where: bonds (distance) C4'-P energy: -19.993 bonds (distance) P-C4' energy: -18.076 flat angles C4'-P-C4' energy: -24.505 flat angles P-C4'-P energy: -12.041 tors. eta vs tors. theta energy: -15.398 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -382.035792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.035792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.094071 (E_RNA) where: Base-Base interactions energy: -261.790 where: short stacking energy: -126.181 Base-Backbone interact. energy: -2.272 local terms energy: -118.031407 where: bonds (distance) C4'-P energy: -18.096 bonds (distance) P-C4' energy: -24.005 flat angles C4'-P-C4' energy: -28.619 flat angles P-C4'-P energy: -15.369 tors. eta vs tors. theta energy: -31.943 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -377.021493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.021493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.044131 (E_RNA) where: Base-Base interactions energy: -253.898 where: short stacking energy: -107.109 Base-Backbone interact. energy: -0.484 local terms energy: -122.662663 where: bonds (distance) C4'-P energy: -25.408 bonds (distance) P-C4' energy: -24.395 flat angles C4'-P-C4' energy: -25.546 flat angles P-C4'-P energy: -16.570 tors. eta vs tors. theta energy: -30.743 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -352.388459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.388459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.388459 (E_RNA) where: Base-Base interactions energy: -233.596 where: short stacking energy: -109.762 Base-Backbone interact. energy: -0.542 local terms energy: -118.250738 where: bonds (distance) C4'-P energy: -23.486 bonds (distance) P-C4' energy: -24.568 flat angles C4'-P-C4' energy: -22.742 flat angles P-C4'-P energy: -16.392 tors. eta vs tors. theta energy: -31.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -341.358149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.358149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.358149 (E_RNA) where: Base-Base interactions energy: -225.308 where: short stacking energy: -105.345 Base-Backbone interact. energy: -0.716 local terms energy: -115.334037 where: bonds (distance) C4'-P energy: -21.348 bonds (distance) P-C4' energy: -25.755 flat angles C4'-P-C4' energy: -24.549 flat angles P-C4'-P energy: -18.095 tors. eta vs tors. theta energy: -25.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -321.074603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.074603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.267955 (E_RNA) where: Base-Base interactions energy: -210.351 where: short stacking energy: -103.572 Base-Backbone interact. energy: -0.145 local terms energy: -110.772228 where: bonds (distance) C4'-P energy: -25.378 bonds (distance) P-C4' energy: -21.610 flat angles C4'-P-C4' energy: -25.007 flat angles P-C4'-P energy: -13.765 tors. eta vs tors. theta energy: -25.012 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -243.335223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.335223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.520570 (E_RNA) where: Base-Base interactions energy: -149.487 where: short stacking energy: -71.666 Base-Backbone interact. energy: -0.107 local terms energy: -93.926348 where: bonds (distance) C4'-P energy: -15.270 bonds (distance) P-C4' energy: -24.574 flat angles C4'-P-C4' energy: -25.592 flat angles P-C4'-P energy: -15.686 tors. eta vs tors. theta energy: -12.804 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -227.568715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.568715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.568715 (E_RNA) where: Base-Base interactions energy: -129.810 where: short stacking energy: -69.728 Base-Backbone interact. energy: -0.450 local terms energy: -97.307913 where: bonds (distance) C4'-P energy: -18.853 bonds (distance) P-C4' energy: -25.198 flat angles C4'-P-C4' energy: -22.233 flat angles P-C4'-P energy: -18.374 tors. eta vs tors. theta energy: -12.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -234.238693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.238693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.279167 (E_RNA) where: Base-Base interactions energy: -142.843 where: short stacking energy: -80.989 Base-Backbone interact. energy: -0.398 local terms energy: -91.038090 where: bonds (distance) C4'-P energy: -15.068 bonds (distance) P-C4' energy: -25.952 flat angles C4'-P-C4' energy: -18.842 flat angles P-C4'-P energy: -13.330 tors. eta vs tors. theta energy: -17.847 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -216.109152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.109152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.221475 (E_RNA) where: Base-Base interactions energy: -123.405 where: short stacking energy: -70.480 Base-Backbone interact. energy: -0.077 local terms energy: -92.739465 where: bonds (distance) C4'-P energy: -25.548 bonds (distance) P-C4' energy: -19.635 flat angles C4'-P-C4' energy: -23.663 flat angles P-C4'-P energy: -10.238 tors. eta vs tors. theta energy: -13.657 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -241.355277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.355277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.355277 (E_RNA) where: Base-Base interactions energy: -147.206 where: short stacking energy: -74.279 Base-Backbone interact. energy: -0.013 local terms energy: -94.135983 where: bonds (distance) C4'-P energy: -21.079 bonds (distance) P-C4' energy: -20.545 flat angles C4'-P-C4' energy: -22.162 flat angles P-C4'-P energy: -12.173 tors. eta vs tors. theta energy: -18.177 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -391.437581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.437581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.437581 (E_RNA) where: Base-Base interactions energy: -261.792 where: short stacking energy: -117.956 Base-Backbone interact. energy: -1.012 local terms energy: -128.633579 where: bonds (distance) C4'-P energy: -27.990 bonds (distance) P-C4' energy: -24.445 flat angles C4'-P-C4' energy: -28.972 flat angles P-C4'-P energy: -14.827 tors. eta vs tors. theta energy: -32.399 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -378.848858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.848858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.848858 (E_RNA) where: Base-Base interactions energy: -249.059 where: short stacking energy: -114.283 Base-Backbone interact. energy: -0.369 local terms energy: -129.421193 where: bonds (distance) C4'-P energy: -25.184 bonds (distance) P-C4' energy: -26.885 flat angles C4'-P-C4' energy: -24.445 flat angles P-C4'-P energy: -20.769 tors. eta vs tors. theta energy: -32.139 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -338.725476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.725476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.846844 (E_RNA) where: Base-Base interactions energy: -222.324 where: short stacking energy: -115.387 Base-Backbone interact. energy: -0.406 local terms energy: -116.116617 where: bonds (distance) C4'-P energy: -21.157 bonds (distance) P-C4' energy: -25.001 flat angles C4'-P-C4' energy: -24.568 flat angles P-C4'-P energy: -17.605 tors. eta vs tors. theta energy: -27.786 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -327.769794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.769794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.837222 (E_RNA) where: Base-Base interactions energy: -226.287 where: short stacking energy: -109.061 Base-Backbone interact. energy: -0.355 local terms energy: -101.195256 where: bonds (distance) C4'-P energy: -17.206 bonds (distance) P-C4' energy: -19.547 flat angles C4'-P-C4' energy: -23.555 flat angles P-C4'-P energy: -18.807 tors. eta vs tors. theta energy: -22.081 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -345.568615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.568615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.671250 (E_RNA) where: Base-Base interactions energy: -220.404 where: short stacking energy: -91.279 Base-Backbone interact. energy: -0.456 local terms energy: -124.811586 where: bonds (distance) C4'-P energy: -22.506 bonds (distance) P-C4' energy: -25.575 flat angles C4'-P-C4' energy: -27.013 flat angles P-C4'-P energy: -19.364 tors. eta vs tors. theta energy: -30.354 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -242.608469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.608469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.619208 (E_RNA) where: Base-Base interactions energy: -149.979 where: short stacking energy: -85.754 Base-Backbone interact. energy: -0.056 local terms energy: -92.584380 where: bonds (distance) C4'-P energy: -17.884 bonds (distance) P-C4' energy: -22.508 flat angles C4'-P-C4' energy: -22.556 flat angles P-C4'-P energy: -14.380 tors. eta vs tors. theta energy: -15.256 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -221.671834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.671834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.748097 (E_RNA) where: Base-Base interactions energy: -132.804 where: short stacking energy: -59.103 Base-Backbone interact. energy: -0.292 local terms energy: -88.651663 where: bonds (distance) C4'-P energy: -22.010 bonds (distance) P-C4' energy: -24.678 flat angles C4'-P-C4' energy: -20.665 flat angles P-C4'-P energy: -10.768 tors. eta vs tors. theta energy: -10.532 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -211.862256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.862256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.949794 (E_RNA) where: Base-Base interactions energy: -125.232 where: short stacking energy: -72.536 Base-Backbone interact. energy: 0.513 local terms energy: -87.231147 where: bonds (distance) C4'-P energy: -17.232 bonds (distance) P-C4' energy: -23.542 flat angles C4'-P-C4' energy: -18.382 flat angles P-C4'-P energy: -17.148 tors. eta vs tors. theta energy: -10.927 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -210.723394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.723394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.801509 (E_RNA) where: Base-Base interactions energy: -121.681 where: short stacking energy: -69.988 Base-Backbone interact. energy: -0.810 local terms energy: -88.309718 where: bonds (distance) C4'-P energy: -16.660 bonds (distance) P-C4' energy: -23.055 flat angles C4'-P-C4' energy: -25.076 flat angles P-C4'-P energy: -10.796 tors. eta vs tors. theta energy: -12.723 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -186.700205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.700205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.066288 (E_RNA) where: Base-Base interactions energy: -107.382 where: short stacking energy: -66.531 Base-Backbone interact. energy: -0.083 local terms energy: -79.600912 where: bonds (distance) C4'-P energy: -17.628 bonds (distance) P-C4' energy: -13.130 flat angles C4'-P-C4' energy: -17.232 flat angles P-C4'-P energy: -12.496 tors. eta vs tors. theta energy: -19.115 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -384.851737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.851737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.874522 (E_RNA) where: Base-Base interactions energy: -258.187 where: short stacking energy: -117.533 Base-Backbone interact. energy: -0.960 local terms energy: -125.727931 where: bonds (distance) C4'-P energy: -21.180 bonds (distance) P-C4' energy: -27.202 flat angles C4'-P-C4' energy: -28.521 flat angles P-C4'-P energy: -18.504 tors. eta vs tors. theta energy: -30.321 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 108 Temperature: 0.950000 Total energy: -373.234685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.234685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.234685 (E_RNA) where: Base-Base interactions energy: -252.626 where: short stacking energy: -117.942 Base-Backbone interact. energy: -2.319 local terms energy: -118.290304 where: bonds (distance) C4'-P energy: -23.250 bonds (distance) P-C4' energy: -27.463 flat angles C4'-P-C4' energy: -24.101 flat angles P-C4'-P energy: -12.488 tors. eta vs tors. theta energy: -30.989 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 108 Temperature: 1.000000 Total energy: -341.921470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.921470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.958711 (E_RNA) where: Base-Base interactions energy: -228.170 where: short stacking energy: -109.985 Base-Backbone interact. energy: -0.283 local terms energy: -113.505761 where: bonds (distance) C4'-P energy: -24.696 bonds (distance) P-C4' energy: -23.110 flat angles C4'-P-C4' energy: -23.437 flat angles P-C4'-P energy: -15.340 tors. eta vs tors. theta energy: -26.923 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 108 Temperature: 1.050000 Total energy: -322.699217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.699217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.709103 (E_RNA) where: Base-Base interactions energy: -216.672 where: short stacking energy: -100.805 Base-Backbone interact. energy: -0.228 local terms energy: -105.808923 where: bonds (distance) C4'-P energy: -17.459 bonds (distance) P-C4' energy: -25.884 flat angles C4'-P-C4' energy: -25.689 flat angles P-C4'-P energy: -18.063 tors. eta vs tors. theta energy: -18.713 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 108 Temperature: 1.100000 Total energy: -332.759254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.759254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.912883 (E_RNA) where: Base-Base interactions energy: -224.177 where: short stacking energy: -105.590 Base-Backbone interact. energy: -1.387 local terms energy: -107.348709 where: bonds (distance) C4'-P energy: -17.996 bonds (distance) P-C4' energy: -26.932 flat angles C4'-P-C4' energy: -24.014 flat angles P-C4'-P energy: -10.702 tors. eta vs tors. theta energy: -27.704 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 108 Temperature: 1.150000 Total energy: -226.764933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.764933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.920390 (E_RNA) where: Base-Base interactions energy: -132.969 where: short stacking energy: -83.135 Base-Backbone interact. energy: -0.836 local terms energy: -93.115722 where: bonds (distance) C4'-P energy: -24.183 bonds (distance) P-C4' energy: -22.812 flat angles C4'-P-C4' energy: -22.068 flat angles P-C4'-P energy: -7.377 tors. eta vs tors. theta energy: -16.675 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 108 Temperature: 1.200000 Total energy: -207.777617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.777617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.786920 (E_RNA) where: Base-Base interactions energy: -123.755 where: short stacking energy: -66.122 Base-Backbone interact. energy: 1.902 local terms energy: -85.934581 where: bonds (distance) C4'-P energy: -24.340 bonds (distance) P-C4' energy: -24.365 flat angles C4'-P-C4' energy: -16.843 flat angles P-C4'-P energy: -12.782 tors. eta vs tors. theta energy: -7.604 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 108 Temperature: 1.250000 Total energy: -210.134122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.134122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.134122 (E_RNA) where: Base-Base interactions energy: -113.338 where: short stacking energy: -68.992 Base-Backbone interact. energy: -0.284 local terms energy: -96.512284 where: bonds (distance) C4'-P energy: -26.960 bonds (distance) P-C4' energy: -20.854 flat angles C4'-P-C4' energy: -16.350 flat angles P-C4'-P energy: -15.542 tors. eta vs tors. theta energy: -16.806 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 108 Temperature: 1.300000 Total energy: -219.368183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.368183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.404248 (E_RNA) where: Base-Base interactions energy: -135.128 where: short stacking energy: -73.570 Base-Backbone interact. energy: -0.249 local terms energy: -84.027359 where: bonds (distance) C4'-P energy: -15.839 bonds (distance) P-C4' energy: -20.549 flat angles C4'-P-C4' energy: -21.232 flat angles P-C4'-P energy: -9.085 tors. eta vs tors. theta energy: -17.321 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -180.101052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.101052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.325108 (E_RNA) where: Base-Base interactions energy: -97.778 where: short stacking energy: -55.103 Base-Backbone interact. energy: -0.279 local terms energy: -82.268020 where: bonds (distance) C4'-P energy: -26.068 bonds (distance) P-C4' energy: -20.460 flat angles C4'-P-C4' energy: -21.686 flat angles P-C4'-P energy: -8.963 tors. eta vs tors. theta energy: -5.090 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 109 Temperature: 0.900000 Total energy: -379.813556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.813556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.813556 (E_RNA) where: Base-Base interactions energy: -257.065 where: short stacking energy: -99.967 Base-Backbone interact. energy: -0.683 local terms energy: -122.065533 where: bonds (distance) C4'-P energy: -24.761 bonds (distance) P-C4' energy: -24.760 flat angles C4'-P-C4' energy: -27.202 flat angles P-C4'-P energy: -16.747 tors. eta vs tors. theta energy: -28.596 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 109 Temperature: 0.950000 Total energy: -357.833409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.833409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.833409 (E_RNA) where: Base-Base interactions energy: -240.506 where: short stacking energy: -122.794 Base-Backbone interact. energy: -0.785 local terms energy: -116.542674 where: bonds (distance) C4'-P energy: -26.292 bonds (distance) P-C4' energy: -23.505 flat angles C4'-P-C4' energy: -25.515 flat angles P-C4'-P energy: -11.097 tors. eta vs tors. theta energy: -30.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 109 Temperature: 1.000000 Total energy: -350.953621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.953621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.970747 (E_RNA) where: Base-Base interactions energy: -228.323 where: short stacking energy: -96.869 Base-Backbone interact. energy: -0.236 local terms energy: -122.412089 where: bonds (distance) C4'-P energy: -23.643 bonds (distance) P-C4' energy: -23.037 flat angles C4'-P-C4' energy: -29.238 flat angles P-C4'-P energy: -17.212 tors. eta vs tors. theta energy: -29.282 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 109 Temperature: 1.050000 Total energy: -335.840386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.840386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.933488 (E_RNA) where: Base-Base interactions energy: -222.616 where: short stacking energy: -114.312 Base-Backbone interact. energy: -0.160 local terms energy: -113.157178 where: bonds (distance) C4'-P energy: -20.950 bonds (distance) P-C4' energy: -25.737 flat angles C4'-P-C4' energy: -24.808 flat angles P-C4'-P energy: -16.513 tors. eta vs tors. theta energy: -25.148 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 109 Temperature: 1.100000 Total energy: -325.152003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.152003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.156042 (E_RNA) where: Base-Base interactions energy: -226.652 where: short stacking energy: -98.567 Base-Backbone interact. energy: -0.324 local terms energy: -98.179490 where: bonds (distance) C4'-P energy: -21.562 bonds (distance) P-C4' energy: -21.463 flat angles C4'-P-C4' energy: -21.326 flat angles P-C4'-P energy: -15.342 tors. eta vs tors. theta energy: -18.487 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 109 Temperature: 1.150000 Total energy: -244.907507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.907507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.994039 (E_RNA) where: Base-Base interactions energy: -145.378 where: short stacking energy: -93.187 Base-Backbone interact. energy: -0.039 local terms energy: -99.576806 where: bonds (distance) C4'-P energy: -13.796 bonds (distance) P-C4' energy: -24.837 flat angles C4'-P-C4' energy: -28.307 flat angles P-C4'-P energy: -13.743 tors. eta vs tors. theta energy: -18.894 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 109 Temperature: 1.200000 Total energy: -227.496327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.496327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.581421 (E_RNA) where: Base-Base interactions energy: -124.529 where: short stacking energy: -74.488 Base-Backbone interact. energy: -0.637 local terms energy: -102.415992 where: bonds (distance) C4'-P energy: -27.295 bonds (distance) P-C4' energy: -24.895 flat angles C4'-P-C4' energy: -20.338 flat angles P-C4'-P energy: -14.178 tors. eta vs tors. theta energy: -15.710 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 109 Temperature: 1.250000 Total energy: -232.506293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.506293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.716672 (E_RNA) where: Base-Base interactions energy: -135.738 where: short stacking energy: -76.308 Base-Backbone interact. energy: 1.004 local terms energy: -97.982777 where: bonds (distance) C4'-P energy: -23.549 bonds (distance) P-C4' energy: -28.474 flat angles C4'-P-C4' energy: -22.064 flat angles P-C4'-P energy: -14.232 tors. eta vs tors. theta energy: -9.663 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 109 Temperature: 1.300000 Total energy: -210.580005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.580005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.739259 (E_RNA) where: Base-Base interactions energy: -120.594 where: short stacking energy: -65.410 Base-Backbone interact. energy: -0.584 local terms energy: -89.561474 where: bonds (distance) C4'-P energy: -26.428 bonds (distance) P-C4' energy: -22.325 flat angles C4'-P-C4' energy: -22.369 flat angles P-C4'-P energy: -9.921 tors. eta vs tors. theta energy: -8.518 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 109 Temperature: 1.350000 Total energy: -176.807615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.807615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.973997 (E_RNA) where: Base-Base interactions energy: -103.921 where: short stacking energy: -57.824 Base-Backbone interact. energy: -0.837 local terms energy: -72.215899 where: bonds (distance) C4'-P energy: -13.718 bonds (distance) P-C4' energy: -18.546 flat angles C4'-P-C4' energy: -18.322 flat angles P-C4'-P energy: -13.503 tors. eta vs tors. theta energy: -8.126 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 110 Temperature: 0.900000 Total energy: -383.481641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.481641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.486555 (E_RNA) where: Base-Base interactions energy: -255.067 where: short stacking energy: -111.801 Base-Backbone interact. energy: -0.911 local terms energy: -127.508361 where: bonds (distance) C4'-P energy: -27.385 bonds (distance) P-C4' energy: -27.588 flat angles C4'-P-C4' energy: -25.415 flat angles P-C4'-P energy: -18.944 tors. eta vs tors. theta energy: -28.177 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 110 Temperature: 0.950000 Total energy: -367.117565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.117565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.117565 (E_RNA) where: Base-Base interactions energy: -239.157 where: short stacking energy: -121.640 Base-Backbone interact. energy: -1.269 local terms energy: -126.691116 where: bonds (distance) C4'-P energy: -28.099 bonds (distance) P-C4' energy: -25.222 flat angles C4'-P-C4' energy: -26.402 flat angles P-C4'-P energy: -16.527 tors. eta vs tors. theta energy: -30.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 110 Temperature: 1.000000 Total energy: -340.938462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.938462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.998316 (E_RNA) where: Base-Base interactions energy: -220.999 where: short stacking energy: -111.044 Base-Backbone interact. energy: -0.152 local terms energy: -119.846996 where: bonds (distance) C4'-P energy: -25.349 bonds (distance) P-C4' energy: -25.147 flat angles C4'-P-C4' energy: -25.058 flat angles P-C4'-P energy: -15.439 tors. eta vs tors. theta energy: -28.855 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 110 Temperature: 1.050000 Total energy: -353.241871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.241871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.261845 (E_RNA) where: Base-Base interactions energy: -234.760 where: short stacking energy: -103.900 Base-Backbone interact. energy: -0.965 local terms energy: -117.536185 where: bonds (distance) C4'-P energy: -20.531 bonds (distance) P-C4' energy: -26.916 flat angles C4'-P-C4' energy: -27.166 flat angles P-C4'-P energy: -16.184 tors. eta vs tors. theta energy: -26.739 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 110 Temperature: 1.100000 Total energy: -331.989941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.989941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.046624 (E_RNA) where: Base-Base interactions energy: -223.678 where: short stacking energy: -112.399 Base-Backbone interact. energy: -0.227 local terms energy: -108.141884 where: bonds (distance) C4'-P energy: -16.309 bonds (distance) P-C4' energy: -24.172 flat angles C4'-P-C4' energy: -26.265 flat angles P-C4'-P energy: -12.006 tors. eta vs tors. theta energy: -29.390 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 110 Temperature: 1.150000 Total energy: -235.723873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.723873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.787364 (E_RNA) where: Base-Base interactions energy: -139.781 where: short stacking energy: -85.550 Base-Backbone interact. energy: -0.304 local terms energy: -95.701920 where: bonds (distance) C4'-P energy: -15.789 bonds (distance) P-C4' energy: -26.052 flat angles C4'-P-C4' energy: -22.481 flat angles P-C4'-P energy: -17.361 tors. eta vs tors. theta energy: -14.019 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 110 Temperature: 1.200000 Total energy: -229.652147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.652147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.778389 (E_RNA) where: Base-Base interactions energy: -141.499 where: short stacking energy: -81.425 Base-Backbone interact. energy: 0.043 local terms energy: -88.323023 where: bonds (distance) C4'-P energy: -20.825 bonds (distance) P-C4' energy: -22.940 flat angles C4'-P-C4' energy: -16.970 flat angles P-C4'-P energy: -11.054 tors. eta vs tors. theta energy: -16.534 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 110 Temperature: 1.250000 Total energy: -215.526594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.526594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.614142 (E_RNA) where: Base-Base interactions energy: -124.998 where: short stacking energy: -63.923 Base-Backbone interact. energy: 0.993 local terms energy: -91.608510 where: bonds (distance) C4'-P energy: -18.348 bonds (distance) P-C4' energy: -22.683 flat angles C4'-P-C4' energy: -23.353 flat angles P-C4'-P energy: -13.838 tors. eta vs tors. theta energy: -13.386 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 110 Temperature: 1.300000 Total energy: -214.508621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.508621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.517276 (E_RNA) where: Base-Base interactions energy: -123.909 where: short stacking energy: -67.898 Base-Backbone interact. energy: -0.592 local terms energy: -90.015846 where: bonds (distance) C4'-P energy: -19.864 bonds (distance) P-C4' energy: -19.391 flat angles C4'-P-C4' energy: -26.452 flat angles P-C4'-P energy: -14.291 tors. eta vs tors. theta energy: -10.019 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 110 Temperature: 1.350000 Total energy: -193.649383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.649383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.770336 (E_RNA) where: Base-Base interactions energy: -113.102 where: short stacking energy: -56.709 Base-Backbone interact. energy: 3.831 local terms energy: -84.499581 where: bonds (distance) C4'-P energy: -19.472 bonds (distance) P-C4' energy: -23.030 flat angles C4'-P-C4' energy: -21.864 flat angles P-C4'-P energy: -13.237 tors. eta vs tors. theta energy: -6.897 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 111 Temperature: 0.900000 Total energy: -388.934556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.934556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.949298 (E_RNA) where: Base-Base interactions energy: -265.385 where: short stacking energy: -116.414 Base-Backbone interact. energy: -1.296 local terms energy: -122.268602 where: bonds (distance) C4'-P energy: -22.486 bonds (distance) P-C4' energy: -24.835 flat angles C4'-P-C4' energy: -28.144 flat angles P-C4'-P energy: -17.720 tors. eta vs tors. theta energy: -29.084 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 111 Temperature: 0.950000 Total energy: -350.921183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.921183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.930601 (E_RNA) where: Base-Base interactions energy: -224.972 where: short stacking energy: -105.858 Base-Backbone interact. energy: -0.637 local terms energy: -125.321344 where: bonds (distance) C4'-P energy: -22.427 bonds (distance) P-C4' energy: -25.468 flat angles C4'-P-C4' energy: -27.401 flat angles P-C4'-P energy: -18.293 tors. eta vs tors. theta energy: -31.732 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 111 Temperature: 1.000000 Total energy: -345.256698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.256698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.311672 (E_RNA) where: Base-Base interactions energy: -224.788 where: short stacking energy: -110.361 Base-Backbone interact. energy: -0.839 local terms energy: -119.684518 where: bonds (distance) C4'-P energy: -21.111 bonds (distance) P-C4' energy: -26.550 flat angles C4'-P-C4' energy: -25.708 flat angles P-C4'-P energy: -14.256 tors. eta vs tors. theta energy: -32.059 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 111 Temperature: 1.050000 Total energy: -346.463352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.463352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.472886 (E_RNA) where: Base-Base interactions energy: -233.578 where: short stacking energy: -114.839 Base-Backbone interact. energy: -0.219 local terms energy: -112.675728 where: bonds (distance) C4'-P energy: -22.999 bonds (distance) P-C4' energy: -21.526 flat angles C4'-P-C4' energy: -25.016 flat angles P-C4'-P energy: -15.194 tors. eta vs tors. theta energy: -27.941 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 111 Temperature: 1.100000 Total energy: -343.789498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.789498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.801269 (E_RNA) where: Base-Base interactions energy: -225.724 where: short stacking energy: -118.175 Base-Backbone interact. energy: -0.513 local terms energy: -117.564146 where: bonds (distance) C4'-P energy: -21.735 bonds (distance) P-C4' energy: -25.233 flat angles C4'-P-C4' energy: -25.240 flat angles P-C4'-P energy: -13.404 tors. eta vs tors. theta energy: -31.953 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 111 Temperature: 1.150000 Total energy: -233.390227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.390227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.518775 (E_RNA) where: Base-Base interactions energy: -136.249 where: short stacking energy: -81.159 Base-Backbone interact. energy: -0.898 local terms energy: -96.371435 where: bonds (distance) C4'-P energy: -21.872 bonds (distance) P-C4' energy: -23.552 flat angles C4'-P-C4' energy: -22.840 flat angles P-C4'-P energy: -10.357 tors. eta vs tors. theta energy: -17.751 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 111 Temperature: 1.200000 Total energy: -227.781235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.781235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.901454 (E_RNA) where: Base-Base interactions energy: -131.892 where: short stacking energy: -73.604 Base-Backbone interact. energy: -0.199 local terms energy: -95.810747 where: bonds (distance) C4'-P energy: -14.804 bonds (distance) P-C4' energy: -24.678 flat angles C4'-P-C4' energy: -20.554 flat angles P-C4'-P energy: -17.549 tors. eta vs tors. theta energy: -18.226 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 111 Temperature: 1.250000 Total energy: -235.578170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.578170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.590270 (E_RNA) where: Base-Base interactions energy: -146.530 where: short stacking energy: -78.638 Base-Backbone interact. energy: -0.958 local terms energy: -88.102359 where: bonds (distance) C4'-P energy: -18.452 bonds (distance) P-C4' energy: -20.189 flat angles C4'-P-C4' energy: -22.122 flat angles P-C4'-P energy: -14.467 tors. eta vs tors. theta energy: -12.873 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 111 Temperature: 1.300000 Total energy: -188.823012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.823012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.838009 (E_RNA) where: Base-Base interactions energy: -100.384 where: short stacking energy: -47.973 Base-Backbone interact. energy: -0.243 local terms energy: -88.210430 where: bonds (distance) C4'-P energy: -23.834 bonds (distance) P-C4' energy: -20.803 flat angles C4'-P-C4' energy: -22.803 flat angles P-C4'-P energy: -9.393 tors. eta vs tors. theta energy: -11.377 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 111 Temperature: 1.350000 Total energy: -207.004492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.004492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.032682 (E_RNA) where: Base-Base interactions energy: -124.627 where: short stacking energy: -58.843 Base-Backbone interact. energy: -0.761 local terms energy: -81.644538 where: bonds (distance) C4'-P energy: -18.247 bonds (distance) P-C4' energy: -14.179 flat angles C4'-P-C4' energy: -23.184 flat angles P-C4'-P energy: -12.671 tors. eta vs tors. theta energy: -13.364 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 112 Temperature: 0.900000 Total energy: -382.053368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.053368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.073206 (E_RNA) where: Base-Base interactions energy: -263.395 where: short stacking energy: -115.865 Base-Backbone interact. energy: -2.138 local terms energy: -116.540553 where: bonds (distance) C4'-P energy: -25.504 bonds (distance) P-C4' energy: -23.125 flat angles C4'-P-C4' energy: -24.837 flat angles P-C4'-P energy: -14.533 tors. eta vs tors. theta energy: -28.540 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 112 Temperature: 0.950000 Total energy: -345.744557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.744557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.753543 (E_RNA) where: Base-Base interactions energy: -223.592 where: short stacking energy: -112.739 Base-Backbone interact. energy: -0.067 local terms energy: -122.094954 where: bonds (distance) C4'-P energy: -24.318 bonds (distance) P-C4' energy: -25.475 flat angles C4'-P-C4' energy: -25.377 flat angles P-C4'-P energy: -16.318 tors. eta vs tors. theta energy: -30.607 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 112 Temperature: 1.000000 Total energy: -356.130888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.130888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.176944 (E_RNA) where: Base-Base interactions energy: -233.089 where: short stacking energy: -118.535 Base-Backbone interact. energy: 0.002 local terms energy: -123.090169 where: bonds (distance) C4'-P energy: -26.732 bonds (distance) P-C4' energy: -23.411 flat angles C4'-P-C4' energy: -23.625 flat angles P-C4'-P energy: -16.450 tors. eta vs tors. theta energy: -32.873 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 112 Temperature: 1.050000 Total energy: -340.628596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.628596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.781539 (E_RNA) where: Base-Base interactions energy: -222.364 where: short stacking energy: -106.279 Base-Backbone interact. energy: -0.443 local terms energy: -117.975172 where: bonds (distance) C4'-P energy: -24.637 bonds (distance) P-C4' energy: -25.244 flat angles C4'-P-C4' energy: -27.335 flat angles P-C4'-P energy: -15.199 tors. eta vs tors. theta energy: -25.560 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 112 Temperature: 1.100000 Total energy: -343.845633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.845633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.116292 (E_RNA) where: Base-Base interactions energy: -230.471 where: short stacking energy: -106.982 Base-Backbone interact. energy: -0.321 local terms energy: -113.324273 where: bonds (distance) C4'-P energy: -18.824 bonds (distance) P-C4' energy: -24.539 flat angles C4'-P-C4' energy: -25.382 flat angles P-C4'-P energy: -17.409 tors. eta vs tors. theta energy: -27.170 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 112 Temperature: 1.150000 Total energy: -243.402854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.402854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.677008 (E_RNA) where: Base-Base interactions energy: -137.952 where: short stacking energy: -89.027 Base-Backbone interact. energy: -0.180 local terms energy: -105.545069 where: bonds (distance) C4'-P energy: -24.116 bonds (distance) P-C4' energy: -18.150 flat angles C4'-P-C4' energy: -23.521 flat angles P-C4'-P energy: -16.071 tors. eta vs tors. theta energy: -23.687 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 112 Temperature: 1.200000 Total energy: -230.015823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.015823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.042562 (E_RNA) where: Base-Base interactions energy: -137.579 where: short stacking energy: -82.008 Base-Backbone interact. energy: -0.631 local terms energy: -91.832267 where: bonds (distance) C4'-P energy: -22.172 bonds (distance) P-C4' energy: -18.549 flat angles C4'-P-C4' energy: -23.918 flat angles P-C4'-P energy: -7.850 tors. eta vs tors. theta energy: -19.342 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 112 Temperature: 1.250000 Total energy: -207.025057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.025057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.087829 (E_RNA) where: Base-Base interactions energy: -119.507 where: short stacking energy: -66.421 Base-Backbone interact. energy: -0.501 local terms energy: -87.079973 where: bonds (distance) C4'-P energy: -20.713 bonds (distance) P-C4' energy: -22.920 flat angles C4'-P-C4' energy: -21.469 flat angles P-C4'-P energy: -6.259 tors. eta vs tors. theta energy: -15.720 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 112 Temperature: 1.300000 Total energy: -212.598947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.598947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.653571 (E_RNA) where: Base-Base interactions energy: -129.558 where: short stacking energy: -68.150 Base-Backbone interact. energy: -1.046 local terms energy: -82.049309 where: bonds (distance) C4'-P energy: -21.039 bonds (distance) P-C4' energy: -11.610 flat angles C4'-P-C4' energy: -22.047 flat angles P-C4'-P energy: -13.657 tors. eta vs tors. theta energy: -13.696 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 112 Temperature: 1.350000 Total energy: -202.250388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.250388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.255632 (E_RNA) where: Base-Base interactions energy: -124.347 where: short stacking energy: -67.518 Base-Backbone interact. energy: -0.949 local terms energy: -76.959395 where: bonds (distance) C4'-P energy: -12.787 bonds (distance) P-C4' energy: -20.937 flat angles C4'-P-C4' energy: -20.453 flat angles P-C4'-P energy: -13.512 tors. eta vs tors. theta energy: -9.270 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 113 Temperature: 0.900000 Total energy: -396.113657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.113657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.113657 (E_RNA) where: Base-Base interactions energy: -276.579 where: short stacking energy: -119.792 Base-Backbone interact. energy: -0.323 local terms energy: -119.211807 where: bonds (distance) C4'-P energy: -23.404 bonds (distance) P-C4' energy: -26.543 flat angles C4'-P-C4' energy: -27.064 flat angles P-C4'-P energy: -15.519 tors. eta vs tors. theta energy: -26.682 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 113 Temperature: 0.950000 Total energy: -361.395148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.395148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.395148 (E_RNA) where: Base-Base interactions energy: -238.424 where: short stacking energy: -111.619 Base-Backbone interact. energy: -0.885 local terms energy: -122.085919 where: bonds (distance) C4'-P energy: -23.578 bonds (distance) P-C4' energy: -25.042 flat angles C4'-P-C4' energy: -26.242 flat angles P-C4'-P energy: -16.499 tors. eta vs tors. theta energy: -30.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 113 Temperature: 1.000000 Total energy: -332.536027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.536027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.674112 (E_RNA) where: Base-Base interactions energy: -217.733 where: short stacking energy: -112.187 Base-Backbone interact. energy: 2.222 local terms energy: -117.162531 where: bonds (distance) C4'-P energy: -26.862 bonds (distance) P-C4' energy: -21.144 flat angles C4'-P-C4' energy: -26.342 flat angles P-C4'-P energy: -15.121 tors. eta vs tors. theta energy: -27.695 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 113 Temperature: 1.050000 Total energy: -349.922586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.922586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.927834 (E_RNA) where: Base-Base interactions energy: -236.022 where: short stacking energy: -100.524 Base-Backbone interact. energy: -1.166 local terms energy: -112.740060 where: bonds (distance) C4'-P energy: -20.075 bonds (distance) P-C4' energy: -24.539 flat angles C4'-P-C4' energy: -26.929 flat angles P-C4'-P energy: -15.483 tors. eta vs tors. theta energy: -25.715 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 113 Temperature: 1.100000 Total energy: -336.080679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.080679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.137077 (E_RNA) where: Base-Base interactions energy: -221.562 where: short stacking energy: -102.405 Base-Backbone interact. energy: -1.386 local terms energy: -113.189181 where: bonds (distance) C4'-P energy: -21.799 bonds (distance) P-C4' energy: -20.126 flat angles C4'-P-C4' energy: -25.553 flat angles P-C4'-P energy: -16.364 tors. eta vs tors. theta energy: -29.348 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 113 Temperature: 1.150000 Total energy: -240.490205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.490205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.516511 (E_RNA) where: Base-Base interactions energy: -143.252 where: short stacking energy: -80.614 Base-Backbone interact. energy: -0.459 local terms energy: -96.805389 where: bonds (distance) C4'-P energy: -15.692 bonds (distance) P-C4' energy: -27.244 flat angles C4'-P-C4' energy: -21.462 flat angles P-C4'-P energy: -15.705 tors. eta vs tors. theta energy: -16.702 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 113 Temperature: 1.200000 Total energy: -242.628990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.628990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.628990 (E_RNA) where: Base-Base interactions energy: -140.656 where: short stacking energy: -88.604 Base-Backbone interact. energy: -0.267 local terms energy: -101.706031 where: bonds (distance) C4'-P energy: -22.279 bonds (distance) P-C4' energy: -19.101 flat angles C4'-P-C4' energy: -22.256 flat angles P-C4'-P energy: -17.408 tors. eta vs tors. theta energy: -20.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 113 Temperature: 1.250000 Total energy: -227.855857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.855857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.923019 (E_RNA) where: Base-Base interactions energy: -131.583 where: short stacking energy: -74.842 Base-Backbone interact. energy: 1.543 local terms energy: -97.883166 where: bonds (distance) C4'-P energy: -21.979 bonds (distance) P-C4' energy: -20.294 flat angles C4'-P-C4' energy: -24.327 flat angles P-C4'-P energy: -16.692 tors. eta vs tors. theta energy: -14.591 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 113 Temperature: 1.300000 Total energy: -216.933431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.933431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.941740 (E_RNA) where: Base-Base interactions energy: -127.136 where: short stacking energy: -73.957 Base-Backbone interact. energy: -0.553 local terms energy: -89.253162 where: bonds (distance) C4'-P energy: -18.316 bonds (distance) P-C4' energy: -19.415 flat angles C4'-P-C4' energy: -20.793 flat angles P-C4'-P energy: -14.506 tors. eta vs tors. theta energy: -16.223 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 113 Temperature: 1.350000 Total energy: -206.283988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.283988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.393250 (E_RNA) where: Base-Base interactions energy: -124.542 where: short stacking energy: -69.057 Base-Backbone interact. energy: -0.261 local terms energy: -81.589801 where: bonds (distance) C4'-P energy: -23.582 bonds (distance) P-C4' energy: -18.177 flat angles C4'-P-C4' energy: -19.376 flat angles P-C4'-P energy: -2.338 tors. eta vs tors. theta energy: -18.117 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 114 Temperature: 0.900000 Total energy: -380.160410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.160410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.201002 (E_RNA) where: Base-Base interactions energy: -257.241 where: short stacking energy: -124.527 Base-Backbone interact. energy: -1.683 local terms energy: -121.276906 where: bonds (distance) C4'-P energy: -23.524 bonds (distance) P-C4' energy: -23.480 flat angles C4'-P-C4' energy: -25.751 flat angles P-C4'-P energy: -17.859 tors. eta vs tors. theta energy: -30.662 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 114 Temperature: 0.950000 Total energy: -362.245226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.245226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.516563 (E_RNA) where: Base-Base interactions energy: -241.515 where: short stacking energy: -121.558 Base-Backbone interact. energy: -0.234 local terms energy: -120.767297 where: bonds (distance) C4'-P energy: -23.929 bonds (distance) P-C4' energy: -23.929 flat angles C4'-P-C4' energy: -25.092 flat angles P-C4'-P energy: -17.100 tors. eta vs tors. theta energy: -30.717 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 114 Temperature: 1.000000 Total energy: -361.282005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.282005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.338467 (E_RNA) where: Base-Base interactions energy: -240.150 where: short stacking energy: -112.837 Base-Backbone interact. energy: -0.200 local terms energy: -120.987607 where: bonds (distance) C4'-P energy: -22.559 bonds (distance) P-C4' energy: -27.449 flat angles C4'-P-C4' energy: -29.834 flat angles P-C4'-P energy: -10.134 tors. eta vs tors. theta energy: -31.013 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 114 Temperature: 1.050000 Total energy: -329.537984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.537984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.650663 (E_RNA) where: Base-Base interactions energy: -219.754 where: short stacking energy: -108.179 Base-Backbone interact. energy: -1.622 local terms energy: -108.274998 where: bonds (distance) C4'-P energy: -21.176 bonds (distance) P-C4' energy: -26.759 flat angles C4'-P-C4' energy: -23.938 flat angles P-C4'-P energy: -9.186 tors. eta vs tors. theta energy: -27.216 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 114 Temperature: 1.100000 Total energy: -339.212979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.212979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.212979 (E_RNA) where: Base-Base interactions energy: -215.465 where: short stacking energy: -111.125 Base-Backbone interact. energy: -0.890 local terms energy: -122.858280 where: bonds (distance) C4'-P energy: -25.344 bonds (distance) P-C4' energy: -23.086 flat angles C4'-P-C4' energy: -20.507 flat angles P-C4'-P energy: -20.149 tors. eta vs tors. theta energy: -33.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 114 Temperature: 1.150000 Total energy: -234.165706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.165706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.194113 (E_RNA) where: Base-Base interactions energy: -138.777 where: short stacking energy: -76.936 Base-Backbone interact. energy: -0.901 local terms energy: -94.516404 where: bonds (distance) C4'-P energy: -22.779 bonds (distance) P-C4' energy: -23.000 flat angles C4'-P-C4' energy: -21.792 flat angles P-C4'-P energy: -12.646 tors. eta vs tors. theta energy: -14.300 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 114 Temperature: 1.200000 Total energy: -230.247707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.247707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.367854 (E_RNA) where: Base-Base interactions energy: -145.902 where: short stacking energy: -73.305 Base-Backbone interact. energy: -0.535 local terms energy: -83.931291 where: bonds (distance) C4'-P energy: -19.017 bonds (distance) P-C4' energy: -23.349 flat angles C4'-P-C4' energy: -19.996 flat angles P-C4'-P energy: -14.592 tors. eta vs tors. theta energy: -6.977 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 114 Temperature: 1.250000 Total energy: -214.397795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.397795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.442881 (E_RNA) where: Base-Base interactions energy: -133.381 where: short stacking energy: -72.820 Base-Backbone interact. energy: -0.095 local terms energy: -80.967206 where: bonds (distance) C4'-P energy: -14.833 bonds (distance) P-C4' energy: -21.465 flat angles C4'-P-C4' energy: -19.878 flat angles P-C4'-P energy: -11.317 tors. eta vs tors. theta energy: -13.474 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 114 Temperature: 1.300000 Total energy: -209.803087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.803087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.889825 (E_RNA) where: Base-Base interactions energy: -132.152 where: short stacking energy: -76.658 Base-Backbone interact. energy: -0.187 local terms energy: -77.551345 where: bonds (distance) C4'-P energy: -18.978 bonds (distance) P-C4' energy: -17.271 flat angles C4'-P-C4' energy: -16.990 flat angles P-C4'-P energy: -15.815 tors. eta vs tors. theta energy: -8.498 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 114 Temperature: 1.350000 Total energy: -198.668362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.668362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.727868 (E_RNA) where: Base-Base interactions energy: -115.302 where: short stacking energy: -53.318 Base-Backbone interact. energy: -0.199 local terms energy: -83.226842 where: bonds (distance) C4'-P energy: -25.044 bonds (distance) P-C4' energy: -18.276 flat angles C4'-P-C4' energy: -19.107 flat angles P-C4'-P energy: -7.824 tors. eta vs tors. theta energy: -12.975 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 115 Temperature: 0.900000 Total energy: -378.450604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.450604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.499282 (E_RNA) where: Base-Base interactions energy: -249.100 where: short stacking energy: -119.817 Base-Backbone interact. energy: -0.785 local terms energy: -128.613787 where: bonds (distance) C4'-P energy: -26.472 bonds (distance) P-C4' energy: -24.979 flat angles C4'-P-C4' energy: -28.012 flat angles P-C4'-P energy: -17.640 tors. eta vs tors. theta energy: -31.510 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 115 Temperature: 0.950000 Total energy: -371.360319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.360319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.378458 (E_RNA) where: Base-Base interactions energy: -263.907 where: short stacking energy: -122.079 Base-Backbone interact. energy: -0.953 local terms energy: -106.518464 where: bonds (distance) C4'-P energy: -23.498 bonds (distance) P-C4' energy: -24.094 flat angles C4'-P-C4' energy: -22.397 flat angles P-C4'-P energy: -6.044 tors. eta vs tors. theta energy: -30.484 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 115 Temperature: 1.000000 Total energy: -356.647699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.647699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.688030 (E_RNA) where: Base-Base interactions energy: -226.209 where: short stacking energy: -117.465 Base-Backbone interact. energy: -0.776 local terms energy: -129.702290 where: bonds (distance) C4'-P energy: -24.268 bonds (distance) P-C4' energy: -26.720 flat angles C4'-P-C4' energy: -28.301 flat angles P-C4'-P energy: -18.472 tors. eta vs tors. theta energy: -31.942 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 115 Temperature: 1.050000 Total energy: -322.881948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.881948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.954455 (E_RNA) where: Base-Base interactions energy: -209.879 where: short stacking energy: -102.563 Base-Backbone interact. energy: -1.610 local terms energy: -111.465579 where: bonds (distance) C4'-P energy: -17.931 bonds (distance) P-C4' energy: -22.668 flat angles C4'-P-C4' energy: -25.942 flat angles P-C4'-P energy: -19.064 tors. eta vs tors. theta energy: -25.859 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 115 Temperature: 1.100000 Total energy: -322.084133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.084133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.206826 (E_RNA) where: Base-Base interactions energy: -206.145 where: short stacking energy: -94.385 Base-Backbone interact. energy: -0.994 local terms energy: -115.067917 where: bonds (distance) C4'-P energy: -22.515 bonds (distance) P-C4' energy: -22.217 flat angles C4'-P-C4' energy: -26.130 flat angles P-C4'-P energy: -16.596 tors. eta vs tors. theta energy: -27.610 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 115 Temperature: 1.150000 Total energy: -241.645099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.645099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.697931 (E_RNA) where: Base-Base interactions energy: -142.406 where: short stacking energy: -86.815 Base-Backbone interact. energy: -1.186 local terms energy: -98.105712 where: bonds (distance) C4'-P energy: -19.036 bonds (distance) P-C4' energy: -22.260 flat angles C4'-P-C4' energy: -23.248 flat angles P-C4'-P energy: -9.829 tors. eta vs tors. theta energy: -23.732 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 115 Temperature: 1.200000 Total energy: -251.184121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.184121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.294439 (E_RNA) where: Base-Base interactions energy: -151.617 where: short stacking energy: -90.693 Base-Backbone interact. energy: -0.319 local terms energy: -99.358611 where: bonds (distance) C4'-P energy: -23.790 bonds (distance) P-C4' energy: -16.908 flat angles C4'-P-C4' energy: -29.255 flat angles P-C4'-P energy: -7.102 tors. eta vs tors. theta energy: -22.303 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 115 Temperature: 1.250000 Total energy: -217.947710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.947710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.571010 (E_RNA) where: Base-Base interactions energy: -123.133 where: short stacking energy: -74.792 Base-Backbone interact. energy: -0.161 local terms energy: -95.277476 where: bonds (distance) C4'-P energy: -17.784 bonds (distance) P-C4' energy: -22.918 flat angles C4'-P-C4' energy: -24.161 flat angles P-C4'-P energy: -18.971 tors. eta vs tors. theta energy: -11.443 Dist. restrs. and SS energy: 0.623 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 115 Temperature: 1.300000 Total energy: -232.535664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.535664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.630819 (E_RNA) where: Base-Base interactions energy: -130.789 where: short stacking energy: -77.800 Base-Backbone interact. energy: -0.195 local terms energy: -101.647062 where: bonds (distance) C4'-P energy: -21.728 bonds (distance) P-C4' energy: -22.744 flat angles C4'-P-C4' energy: -26.071 flat angles P-C4'-P energy: -7.588 tors. eta vs tors. theta energy: -23.515 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 115 Temperature: 1.350000 Total energy: -206.769389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.769389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.771968 (E_RNA) where: Base-Base interactions energy: -120.768 where: short stacking energy: -62.471 Base-Backbone interact. energy: 3.277 local terms energy: -89.280804 where: bonds (distance) C4'-P energy: -21.521 bonds (distance) P-C4' energy: -24.734 flat angles C4'-P-C4' energy: -18.674 flat angles P-C4'-P energy: -14.611 tors. eta vs tors. theta energy: -9.742 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 116 Temperature: 0.900000 Total energy: -377.720204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.720204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.826111 (E_RNA) where: Base-Base interactions energy: -254.557 where: short stacking energy: -121.325 Base-Backbone interact. energy: -0.136 local terms energy: -123.133589 where: bonds (distance) C4'-P energy: -25.487 bonds (distance) P-C4' energy: -29.642 flat angles C4'-P-C4' energy: -25.974 flat angles P-C4'-P energy: -12.064 tors. eta vs tors. theta energy: -29.966 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 116 Temperature: 0.950000 Total energy: -370.659042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.659042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.703555 (E_RNA) where: Base-Base interactions energy: -253.841 where: short stacking energy: -117.810 Base-Backbone interact. energy: -0.468 local terms energy: -116.394853 where: bonds (distance) C4'-P energy: -19.288 bonds (distance) P-C4' energy: -25.847 flat angles C4'-P-C4' energy: -23.771 flat angles P-C4'-P energy: -19.817 tors. eta vs tors. theta energy: -27.671 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 116 Temperature: 1.000000 Total energy: -364.449879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.449879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.514583 (E_RNA) where: Base-Base interactions energy: -238.485 where: short stacking energy: -113.597 Base-Backbone interact. energy: -0.687 local terms energy: -125.342957 where: bonds (distance) C4'-P energy: -25.573 bonds (distance) P-C4' energy: -25.930 flat angles C4'-P-C4' energy: -26.275 flat angles P-C4'-P energy: -17.689 tors. eta vs tors. theta energy: -29.875 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 116 Temperature: 1.050000 Total energy: -324.849085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.849085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.851424 (E_RNA) where: Base-Base interactions energy: -214.582 where: short stacking energy: -105.500 Base-Backbone interact. energy: -1.449 local terms energy: -108.820016 where: bonds (distance) C4'-P energy: -18.645 bonds (distance) P-C4' energy: -21.585 flat angles C4'-P-C4' energy: -22.442 flat angles P-C4'-P energy: -16.752 tors. eta vs tors. theta energy: -29.396 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 116 Temperature: 1.100000 Total energy: -338.098473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.098473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.156933 (E_RNA) where: Base-Base interactions energy: -224.272 where: short stacking energy: -111.096 Base-Backbone interact. energy: -2.243 local terms energy: -111.642399 where: bonds (distance) C4'-P energy: -22.220 bonds (distance) P-C4' energy: -25.123 flat angles C4'-P-C4' energy: -21.038 flat angles P-C4'-P energy: -18.796 tors. eta vs tors. theta energy: -24.466 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 116 Temperature: 1.150000 Total energy: -226.384168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.384168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.429150 (E_RNA) where: Base-Base interactions energy: -141.329 where: short stacking energy: -82.127 Base-Backbone interact. energy: -0.030 local terms energy: -85.070541 where: bonds (distance) C4'-P energy: -19.691 bonds (distance) P-C4' energy: -20.770 flat angles C4'-P-C4' energy: -23.652 flat angles P-C4'-P energy: -7.375 tors. eta vs tors. theta energy: -13.583 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 116 Temperature: 1.200000 Total energy: -263.568995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.568995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.724088 (E_RNA) where: Base-Base interactions energy: -166.309 where: short stacking energy: -77.398 Base-Backbone interact. energy: -0.205 local terms energy: -97.210321 where: bonds (distance) C4'-P energy: -24.191 bonds (distance) P-C4' energy: -23.470 flat angles C4'-P-C4' energy: -23.043 flat angles P-C4'-P energy: -10.032 tors. eta vs tors. theta energy: -16.474 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 116 Temperature: 1.250000 Total energy: -221.584731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.584731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.813373 (E_RNA) where: Base-Base interactions energy: -119.083 where: short stacking energy: -72.028 Base-Backbone interact. energy: -0.715 local terms energy: -102.015230 where: bonds (distance) C4'-P energy: -16.565 bonds (distance) P-C4' energy: -24.508 flat angles C4'-P-C4' energy: -26.994 flat angles P-C4'-P energy: -17.572 tors. eta vs tors. theta energy: -16.376 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 116 Temperature: 1.300000 Total energy: -207.892113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.892113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.084772 (E_RNA) where: Base-Base interactions energy: -127.611 where: short stacking energy: -68.745 Base-Backbone interact. energy: -0.165 local terms energy: -80.308973 where: bonds (distance) C4'-P energy: -13.927 bonds (distance) P-C4' energy: -25.450 flat angles C4'-P-C4' energy: -18.147 flat angles P-C4'-P energy: -9.383 tors. eta vs tors. theta energy: -13.402 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 116 Temperature: 1.350000 Total energy: -208.638728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.638728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.670066 (E_RNA) where: Base-Base interactions energy: -125.550 where: short stacking energy: -68.039 Base-Backbone interact. energy: -0.441 local terms energy: -82.679042 where: bonds (distance) C4'-P energy: -13.603 bonds (distance) P-C4' energy: -19.892 flat angles C4'-P-C4' energy: -23.769 flat angles P-C4'-P energy: -8.252 tors. eta vs tors. theta energy: -17.163 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 117 Temperature: 0.900000 Total energy: -382.173612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.173612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.231866 (E_RNA) where: Base-Base interactions energy: -250.956 where: short stacking energy: -108.809 Base-Backbone interact. energy: -0.247 local terms energy: -131.028062 where: bonds (distance) C4'-P energy: -27.075 bonds (distance) P-C4' energy: -25.883 flat angles C4'-P-C4' energy: -28.780 flat angles P-C4'-P energy: -22.919 tors. eta vs tors. theta energy: -26.372 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 117 Temperature: 0.950000 Total energy: -364.193691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.193691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.193691 (E_RNA) where: Base-Base interactions energy: -240.784 where: short stacking energy: -117.773 Base-Backbone interact. energy: -1.868 local terms energy: -121.541620 where: bonds (distance) C4'-P energy: -25.238 bonds (distance) P-C4' energy: -21.345 flat angles C4'-P-C4' energy: -24.837 flat angles P-C4'-P energy: -18.154 tors. eta vs tors. theta energy: -31.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 117 Temperature: 1.000000 Total energy: -370.289137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.289137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.399189 (E_RNA) where: Base-Base interactions energy: -249.478 where: short stacking energy: -118.302 Base-Backbone interact. energy: -0.329 local terms energy: -120.592126 where: bonds (distance) C4'-P energy: -21.435 bonds (distance) P-C4' energy: -24.006 flat angles C4'-P-C4' energy: -27.623 flat angles P-C4'-P energy: -17.367 tors. eta vs tors. theta energy: -30.161 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 117 Temperature: 1.050000 Total energy: -335.448056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.448056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.448056 (E_RNA) where: Base-Base interactions energy: -216.617 where: short stacking energy: -105.947 Base-Backbone interact. energy: -0.971 local terms energy: -117.860070 where: bonds (distance) C4'-P energy: -22.476 bonds (distance) P-C4' energy: -22.806 flat angles C4'-P-C4' energy: -25.868 flat angles P-C4'-P energy: -18.056 tors. eta vs tors. theta energy: -28.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 117 Temperature: 1.100000 Total energy: -321.801368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.801368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.916746 (E_RNA) where: Base-Base interactions energy: -212.853 where: short stacking energy: -107.251 Base-Backbone interact. energy: -0.656 local terms energy: -108.408299 where: bonds (distance) C4'-P energy: -13.575 bonds (distance) P-C4' energy: -23.765 flat angles C4'-P-C4' energy: -25.305 flat angles P-C4'-P energy: -16.526 tors. eta vs tors. theta energy: -29.238 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 117 Temperature: 1.150000 Total energy: -267.083399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.083399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.094334 (E_RNA) where: Base-Base interactions energy: -166.793 where: short stacking energy: -88.944 Base-Backbone interact. energy: 0.023 local terms energy: -100.324405 where: bonds (distance) C4'-P energy: -19.085 bonds (distance) P-C4' energy: -23.437 flat angles C4'-P-C4' energy: -23.596 flat angles P-C4'-P energy: -15.304 tors. eta vs tors. theta energy: -18.903 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 117 Temperature: 1.200000 Total energy: -227.256349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.256349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.290455 (E_RNA) where: Base-Base interactions energy: -122.991 where: short stacking energy: -71.951 Base-Backbone interact. energy: 0.204 local terms energy: -104.503215 where: bonds (distance) C4'-P energy: -18.754 bonds (distance) P-C4' energy: -24.924 flat angles C4'-P-C4' energy: -25.018 flat angles P-C4'-P energy: -16.988 tors. eta vs tors. theta energy: -18.819 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 117 Temperature: 1.250000 Total energy: -213.840386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.840386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.077408 (E_RNA) where: Base-Base interactions energy: -128.245 where: short stacking energy: -74.831 Base-Backbone interact. energy: -0.205 local terms energy: -85.626774 where: bonds (distance) C4'-P energy: -13.967 bonds (distance) P-C4' energy: -25.564 flat angles C4'-P-C4' energy: -17.276 flat angles P-C4'-P energy: -11.716 tors. eta vs tors. theta energy: -17.105 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 117 Temperature: 1.300000 Total energy: -219.118809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.118809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.221429 (E_RNA) where: Base-Base interactions energy: -132.350 where: short stacking energy: -73.034 Base-Backbone interact. energy: -0.499 local terms energy: -86.372640 where: bonds (distance) C4'-P energy: -18.709 bonds (distance) P-C4' energy: -27.616 flat angles C4'-P-C4' energy: -22.277 flat angles P-C4'-P energy: -7.816 tors. eta vs tors. theta energy: -9.956 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 117 Temperature: 1.350000 Total energy: -201.728986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.728986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.752182 (E_RNA) where: Base-Base interactions energy: -111.766 where: short stacking energy: -60.536 Base-Backbone interact. energy: -1.609 local terms energy: -88.377368 where: bonds (distance) C4'-P energy: -20.800 bonds (distance) P-C4' energy: -20.264 flat angles C4'-P-C4' energy: -23.848 flat angles P-C4'-P energy: -12.113 tors. eta vs tors. theta energy: -11.352 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 118 Temperature: 0.900000 Total energy: -389.175407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.175407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.175407 (E_RNA) where: Base-Base interactions energy: -258.397 where: short stacking energy: -120.495 Base-Backbone interact. energy: -0.254 local terms energy: -130.524351 where: bonds (distance) C4'-P energy: -26.827 bonds (distance) P-C4' energy: -26.934 flat angles C4'-P-C4' energy: -25.606 flat angles P-C4'-P energy: -16.456 tors. eta vs tors. theta energy: -34.702 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 118 Temperature: 0.950000 Total energy: -355.351236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.351236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.351236 (E_RNA) where: Base-Base interactions energy: -232.209 where: short stacking energy: -105.146 Base-Backbone interact. energy: -0.504 local terms energy: -122.638354 where: bonds (distance) C4'-P energy: -25.823 bonds (distance) P-C4' energy: -27.399 flat angles C4'-P-C4' energy: -22.883 flat angles P-C4'-P energy: -17.989 tors. eta vs tors. theta energy: -28.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 118 Temperature: 1.000000 Total energy: -354.145382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.145382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.172938 (E_RNA) where: Base-Base interactions energy: -232.897 where: short stacking energy: -108.226 Base-Backbone interact. energy: -0.815 local terms energy: -120.460839 where: bonds (distance) C4'-P energy: -25.589 bonds (distance) P-C4' energy: -26.836 flat angles C4'-P-C4' energy: -28.363 flat angles P-C4'-P energy: -13.858 tors. eta vs tors. theta energy: -25.816 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 118 Temperature: 1.050000 Total energy: -334.247955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.247955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.287991 (E_RNA) where: Base-Base interactions energy: -232.512 where: short stacking energy: -105.325 Base-Backbone interact. energy: -0.965 local terms energy: -100.811157 where: bonds (distance) C4'-P energy: -21.758 bonds (distance) P-C4' energy: -23.590 flat angles C4'-P-C4' energy: -18.788 flat angles P-C4'-P energy: -14.715 tors. eta vs tors. theta energy: -21.961 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 118 Temperature: 1.100000 Total energy: -305.771261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.771261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.771261 (E_RNA) where: Base-Base interactions energy: -203.017 where: short stacking energy: -90.337 Base-Backbone interact. energy: -1.223 local terms energy: -101.531886 where: bonds (distance) C4'-P energy: -16.550 bonds (distance) P-C4' energy: -23.051 flat angles C4'-P-C4' energy: -24.259 flat angles P-C4'-P energy: -15.830 tors. eta vs tors. theta energy: -21.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 118 Temperature: 1.150000 Total energy: -272.125564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.125564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.135966 (E_RNA) where: Base-Base interactions energy: -169.385 where: short stacking energy: -92.437 Base-Backbone interact. energy: -0.121 local terms energy: -102.630117 where: bonds (distance) C4'-P energy: -22.186 bonds (distance) P-C4' energy: -19.960 flat angles C4'-P-C4' energy: -26.159 flat angles P-C4'-P energy: -15.448 tors. eta vs tors. theta energy: -18.877 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 118 Temperature: 1.200000 Total energy: -235.709140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.709140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.942940 (E_RNA) where: Base-Base interactions energy: -139.217 where: short stacking energy: -71.146 Base-Backbone interact. energy: -0.140 local terms energy: -96.585387 where: bonds (distance) C4'-P energy: -21.524 bonds (distance) P-C4' energy: -27.071 flat angles C4'-P-C4' energy: -25.450 flat angles P-C4'-P energy: -12.817 tors. eta vs tors. theta energy: -9.723 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 118 Temperature: 1.250000 Total energy: -220.670468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.670468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.679971 (E_RNA) where: Base-Base interactions energy: -128.990 where: short stacking energy: -78.033 Base-Backbone interact. energy: -0.828 local terms energy: -90.861373 where: bonds (distance) C4'-P energy: -19.735 bonds (distance) P-C4' energy: -19.542 flat angles C4'-P-C4' energy: -25.039 flat angles P-C4'-P energy: -14.439 tors. eta vs tors. theta energy: -12.107 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 118 Temperature: 1.300000 Total energy: -202.816085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.816085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.869078 (E_RNA) where: Base-Base interactions energy: -118.164 where: short stacking energy: -68.219 Base-Backbone interact. energy: -0.394 local terms energy: -84.310599 where: bonds (distance) C4'-P energy: -20.013 bonds (distance) P-C4' energy: -10.156 flat angles C4'-P-C4' energy: -21.490 flat angles P-C4'-P energy: -17.648 tors. eta vs tors. theta energy: -15.003 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 118 Temperature: 1.350000 Total energy: -198.535745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.535745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.769688 (E_RNA) where: Base-Base interactions energy: -115.329 where: short stacking energy: -59.554 Base-Backbone interact. energy: -0.441 local terms energy: -82.999965 where: bonds (distance) C4'-P energy: -18.519 bonds (distance) P-C4' energy: -19.754 flat angles C4'-P-C4' energy: -17.775 flat angles P-C4'-P energy: -17.015 tors. eta vs tors. theta energy: -9.936 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 119 Temperature: 0.900000 Total energy: -377.048701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.048701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.048701 (E_RNA) where: Base-Base interactions energy: -246.452 where: short stacking energy: -114.468 Base-Backbone interact. energy: -0.693 local terms energy: -129.904493 where: bonds (distance) C4'-P energy: -25.701 bonds (distance) P-C4' energy: -26.718 flat angles C4'-P-C4' energy: -29.767 flat angles P-C4'-P energy: -17.887 tors. eta vs tors. theta energy: -29.831 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 119 Temperature: 0.950000 Total energy: -356.093261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.093261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.127235 (E_RNA) where: Base-Base interactions energy: -234.473 where: short stacking energy: -117.521 Base-Backbone interact. energy: -1.149 local terms energy: -120.505583 where: bonds (distance) C4'-P energy: -23.524 bonds (distance) P-C4' energy: -24.287 flat angles C4'-P-C4' energy: -22.287 flat angles P-C4'-P energy: -18.633 tors. eta vs tors. theta energy: -31.775 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 119 Temperature: 1.000000 Total energy: -359.723747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.723747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.734837 (E_RNA) where: Base-Base interactions energy: -241.861 where: short stacking energy: -117.968 Base-Backbone interact. energy: -1.127 local terms energy: -116.746381 where: bonds (distance) C4'-P energy: -24.568 bonds (distance) P-C4' energy: -20.159 flat angles C4'-P-C4' energy: -27.955 flat angles P-C4'-P energy: -11.861 tors. eta vs tors. theta energy: -32.204 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 119 Temperature: 1.050000 Total energy: -324.153398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.153398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.153398 (E_RNA) where: Base-Base interactions energy: -213.133 where: short stacking energy: -100.449 Base-Backbone interact. energy: -0.180 local terms energy: -110.840510 where: bonds (distance) C4'-P energy: -22.609 bonds (distance) P-C4' energy: -23.182 flat angles C4'-P-C4' energy: -26.686 flat angles P-C4'-P energy: -20.338 tors. eta vs tors. theta energy: -18.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 119 Temperature: 1.100000 Total energy: -337.628866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.628866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.634670 (E_RNA) where: Base-Base interactions energy: -226.499 where: short stacking energy: -110.772 Base-Backbone interact. energy: -0.720 local terms energy: -110.415641 where: bonds (distance) C4'-P energy: -19.914 bonds (distance) P-C4' energy: -21.887 flat angles C4'-P-C4' energy: -28.125 flat angles P-C4'-P energy: -12.932 tors. eta vs tors. theta energy: -27.557 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 119 Temperature: 1.150000 Total energy: -260.621019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.621019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.709238 (E_RNA) where: Base-Base interactions energy: -156.741 where: short stacking energy: -83.130 Base-Backbone interact. energy: -0.234 local terms energy: -103.733844 where: bonds (distance) C4'-P energy: -18.352 bonds (distance) P-C4' energy: -25.085 flat angles C4'-P-C4' energy: -25.353 flat angles P-C4'-P energy: -15.894 tors. eta vs tors. theta energy: -19.050 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 119 Temperature: 1.200000 Total energy: -242.793765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.793765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.007423 (E_RNA) where: Base-Base interactions energy: -151.952 where: short stacking energy: -78.743 Base-Backbone interact. energy: -0.287 local terms energy: -90.768388 where: bonds (distance) C4'-P energy: -20.917 bonds (distance) P-C4' energy: -19.030 flat angles C4'-P-C4' energy: -21.649 flat angles P-C4'-P energy: -18.261 tors. eta vs tors. theta energy: -10.913 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 119 Temperature: 1.250000 Total energy: -226.664821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.664821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.762803 (E_RNA) where: Base-Base interactions energy: -151.683 where: short stacking energy: -83.626 Base-Backbone interact. energy: -1.079 local terms energy: -74.000473 where: bonds (distance) C4'-P energy: -14.299 bonds (distance) P-C4' energy: -17.377 flat angles C4'-P-C4' energy: -18.509 flat angles P-C4'-P energy: -10.949 tors. eta vs tors. theta energy: -12.866 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 119 Temperature: 1.300000 Total energy: -212.839247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.839247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.003912 (E_RNA) where: Base-Base interactions energy: -117.039 where: short stacking energy: -59.028 Base-Backbone interact. energy: -0.523 local terms energy: -95.441391 where: bonds (distance) C4'-P energy: -22.165 bonds (distance) P-C4' energy: -20.974 flat angles C4'-P-C4' energy: -23.021 flat angles P-C4'-P energy: -16.091 tors. eta vs tors. theta energy: -13.190 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 119 Temperature: 1.350000 Total energy: -217.497776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.497776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.522758 (E_RNA) where: Base-Base interactions energy: -132.119 where: short stacking energy: -76.590 Base-Backbone interact. energy: 1.401 local terms energy: -86.803900 where: bonds (distance) C4'-P energy: -13.676 bonds (distance) P-C4' energy: -18.617 flat angles C4'-P-C4' energy: -21.132 flat angles P-C4'-P energy: -17.078 tors. eta vs tors. theta energy: -16.302 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 120 Temperature: 0.900000 Total energy: -368.512164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.512164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.624102 (E_RNA) where: Base-Base interactions energy: -244.756 where: short stacking energy: -126.637 Base-Backbone interact. energy: 1.350 local terms energy: -125.217830 where: bonds (distance) C4'-P energy: -25.510 bonds (distance) P-C4' energy: -24.771 flat angles C4'-P-C4' energy: -26.861 flat angles P-C4'-P energy: -20.311 tors. eta vs tors. theta energy: -27.764 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 120 Temperature: 0.950000 Total energy: -365.760170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.760170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.807712 (E_RNA) where: Base-Base interactions energy: -245.700 where: short stacking energy: -109.101 Base-Backbone interact. energy: -0.231 local terms energy: -119.876449 where: bonds (distance) C4'-P energy: -23.275 bonds (distance) P-C4' energy: -26.522 flat angles C4'-P-C4' energy: -24.844 flat angles P-C4'-P energy: -17.364 tors. eta vs tors. theta energy: -27.870 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 120 Temperature: 1.000000 Total energy: -341.547461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.547461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.607963 (E_RNA) where: Base-Base interactions energy: -228.844 where: short stacking energy: -116.371 Base-Backbone interact. energy: -0.220 local terms energy: -112.543923 where: bonds (distance) C4'-P energy: -27.406 bonds (distance) P-C4' energy: -25.452 flat angles C4'-P-C4' energy: -20.431 flat angles P-C4'-P energy: -14.437 tors. eta vs tors. theta energy: -24.818 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 120 Temperature: 1.050000 Total energy: -337.883949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.883949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.938641 (E_RNA) where: Base-Base interactions energy: -221.988 where: short stacking energy: -97.856 Base-Backbone interact. energy: -0.410 local terms energy: -115.541046 where: bonds (distance) C4'-P energy: -18.734 bonds (distance) P-C4' energy: -22.984 flat angles C4'-P-C4' energy: -26.201 flat angles P-C4'-P energy: -16.120 tors. eta vs tors. theta energy: -31.502 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 120 Temperature: 1.100000 Total energy: -275.432795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.432795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.464738 (E_RNA) where: Base-Base interactions energy: -171.472 where: short stacking energy: -93.101 Base-Backbone interact. energy: -0.895 local terms energy: -103.097646 where: bonds (distance) C4'-P energy: -22.666 bonds (distance) P-C4' energy: -21.860 flat angles C4'-P-C4' energy: -24.673 flat angles P-C4'-P energy: -16.949 tors. eta vs tors. theta energy: -16.950 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 120 Temperature: 1.150000 Total energy: -320.196373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.196373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.200861 (E_RNA) where: Base-Base interactions energy: -212.821 where: short stacking energy: -106.860 Base-Backbone interact. energy: -0.823 local terms energy: -106.557187 where: bonds (distance) C4'-P energy: -18.661 bonds (distance) P-C4' energy: -23.423 flat angles C4'-P-C4' energy: -23.817 flat angles P-C4'-P energy: -15.393 tors. eta vs tors. theta energy: -25.263 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 120 Temperature: 1.200000 Total energy: -223.861593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.861593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.861593 (E_RNA) where: Base-Base interactions energy: -134.418 where: short stacking energy: -73.958 Base-Backbone interact. energy: -0.516 local terms energy: -88.927628 where: bonds (distance) C4'-P energy: -15.772 bonds (distance) P-C4' energy: -21.178 flat angles C4'-P-C4' energy: -21.434 flat angles P-C4'-P energy: -14.201 tors. eta vs tors. theta energy: -16.342 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 120 Temperature: 1.250000 Total energy: -267.959882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.959882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.971997 (E_RNA) where: Base-Base interactions energy: -170.774 where: short stacking energy: -80.279 Base-Backbone interact. energy: -0.625 local terms energy: -96.573102 where: bonds (distance) C4'-P energy: -23.015 bonds (distance) P-C4' energy: -22.799 flat angles C4'-P-C4' energy: -22.296 flat angles P-C4'-P energy: -12.610 tors. eta vs tors. theta energy: -15.852 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 120 Temperature: 1.300000 Total energy: -208.057311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.057311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.114764 (E_RNA) where: Base-Base interactions energy: -119.138 where: short stacking energy: -65.920 Base-Backbone interact. energy: -0.319 local terms energy: -88.657798 where: bonds (distance) C4'-P energy: -20.379 bonds (distance) P-C4' energy: -28.720 flat angles C4'-P-C4' energy: -20.715 flat angles P-C4'-P energy: -5.323 tors. eta vs tors. theta energy: -13.521 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 120 Temperature: 1.350000 Total energy: -198.953199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.953199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.012918 (E_RNA) where: Base-Base interactions energy: -116.042 where: short stacking energy: -53.783 Base-Backbone interact. energy: -1.874 local terms energy: -81.097437 where: bonds (distance) C4'-P energy: -21.971 bonds (distance) P-C4' energy: -24.876 flat angles C4'-P-C4' energy: -20.265 flat angles P-C4'-P energy: -13.707 tors. eta vs tors. theta energy: -0.278 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 121 Temperature: 0.900000 Total energy: -372.509064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.509064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.540120 (E_RNA) where: Base-Base interactions energy: -240.158 where: short stacking energy: -121.033 Base-Backbone interact. energy: -0.702 local terms energy: -131.680239 where: bonds (distance) C4'-P energy: -27.804 bonds (distance) P-C4' energy: -26.757 flat angles C4'-P-C4' energy: -28.389 flat angles P-C4'-P energy: -19.598 tors. eta vs tors. theta energy: -29.133 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 121 Temperature: 0.950000 Total energy: -363.580203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.580203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.580203 (E_RNA) where: Base-Base interactions energy: -244.380 where: short stacking energy: -113.923 Base-Backbone interact. energy: -0.381 local terms energy: -118.819285 where: bonds (distance) C4'-P energy: -14.552 bonds (distance) P-C4' energy: -26.521 flat angles C4'-P-C4' energy: -27.591 flat angles P-C4'-P energy: -20.800 tors. eta vs tors. theta energy: -29.354 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 121 Temperature: 1.000000 Total energy: -348.488884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.488884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.539655 (E_RNA) where: Base-Base interactions energy: -228.429 where: short stacking energy: -111.124 Base-Backbone interact. energy: -0.719 local terms energy: -119.391413 where: bonds (distance) C4'-P energy: -22.906 bonds (distance) P-C4' energy: -24.359 flat angles C4'-P-C4' energy: -24.511 flat angles P-C4'-P energy: -20.103 tors. eta vs tors. theta energy: -27.513 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 121 Temperature: 1.050000 Total energy: -336.325852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.325852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.369734 (E_RNA) where: Base-Base interactions energy: -221.577 where: short stacking energy: -113.960 Base-Backbone interact. energy: -0.192 local terms energy: -114.600193 where: bonds (distance) C4'-P energy: -22.128 bonds (distance) P-C4' energy: -23.187 flat angles C4'-P-C4' energy: -25.011 flat angles P-C4'-P energy: -17.088 tors. eta vs tors. theta energy: -27.186 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 121 Temperature: 1.100000 Total energy: -253.632745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.632745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.642873 (E_RNA) where: Base-Base interactions energy: -155.322 where: short stacking energy: -95.721 Base-Backbone interact. energy: -0.178 local terms energy: -98.142363 where: bonds (distance) C4'-P energy: -20.847 bonds (distance) P-C4' energy: -21.492 flat angles C4'-P-C4' energy: -23.238 flat angles P-C4'-P energy: -11.602 tors. eta vs tors. theta energy: -20.964 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 121 Temperature: 1.150000 Total energy: -337.429790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.429790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.448343 (E_RNA) where: Base-Base interactions energy: -220.394 where: short stacking energy: -104.263 Base-Backbone interact. energy: 0.427 local terms energy: -117.482133 where: bonds (distance) C4'-P energy: -19.713 bonds (distance) P-C4' energy: -20.944 flat angles C4'-P-C4' energy: -30.394 flat angles P-C4'-P energy: -18.981 tors. eta vs tors. theta energy: -27.451 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 121 Temperature: 1.200000 Total energy: -234.825890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.825890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.847820 (E_RNA) where: Base-Base interactions energy: -149.085 where: short stacking energy: -84.368 Base-Backbone interact. energy: -0.090 local terms energy: -85.672942 where: bonds (distance) C4'-P energy: -11.935 bonds (distance) P-C4' energy: -20.443 flat angles C4'-P-C4' energy: -19.000 flat angles P-C4'-P energy: -19.950 tors. eta vs tors. theta energy: -14.345 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 121 Temperature: 1.250000 Total energy: -265.618306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.618306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.659239 (E_RNA) where: Base-Base interactions energy: -167.587 where: short stacking energy: -95.945 Base-Backbone interact. energy: -0.876 local terms energy: -97.196173 where: bonds (distance) C4'-P energy: -21.305 bonds (distance) P-C4' energy: -20.731 flat angles C4'-P-C4' energy: -19.234 flat angles P-C4'-P energy: -10.140 tors. eta vs tors. theta energy: -25.785 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 121 Temperature: 1.300000 Total energy: -228.223318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.223318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.506545 (E_RNA) where: Base-Base interactions energy: -128.336 where: short stacking energy: -70.117 Base-Backbone interact. energy: -0.159 local terms energy: -100.011159 where: bonds (distance) C4'-P energy: -26.615 bonds (distance) P-C4' energy: -20.223 flat angles C4'-P-C4' energy: -21.499 flat angles P-C4'-P energy: -16.573 tors. eta vs tors. theta energy: -15.102 Dist. restrs. and SS energy: 0.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 121 Temperature: 1.350000 Total energy: -194.091544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.091544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.276533 (E_RNA) where: Base-Base interactions energy: -120.038 where: short stacking energy: -70.967 Base-Backbone interact. energy: -0.382 local terms energy: -73.855633 where: bonds (distance) C4'-P energy: -15.798 bonds (distance) P-C4' energy: -22.819 flat angles C4'-P-C4' energy: -20.413 flat angles P-C4'-P energy: -11.089 tors. eta vs tors. theta energy: -3.736 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 122 Temperature: 0.900000 Total energy: -370.354251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.354251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.375230 (E_RNA) where: Base-Base interactions energy: -257.247 where: short stacking energy: -115.709 Base-Backbone interact. energy: -0.885 local terms energy: -112.242926 where: bonds (distance) C4'-P energy: -22.083 bonds (distance) P-C4' energy: -24.434 flat angles C4'-P-C4' energy: -25.555 flat angles P-C4'-P energy: -10.563 tors. eta vs tors. theta energy: -29.608 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 122 Temperature: 0.950000 Total energy: -356.340968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.340968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.449198 (E_RNA) where: Base-Base interactions energy: -237.707 where: short stacking energy: -117.253 Base-Backbone interact. energy: -1.145 local terms energy: -117.597749 where: bonds (distance) C4'-P energy: -21.094 bonds (distance) P-C4' energy: -22.602 flat angles C4'-P-C4' energy: -24.162 flat angles P-C4'-P energy: -19.487 tors. eta vs tors. theta energy: -30.253 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 122 Temperature: 1.000000 Total energy: -344.017918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.017918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.029533 (E_RNA) where: Base-Base interactions energy: -222.345 where: short stacking energy: -115.504 Base-Backbone interact. energy: -0.681 local terms energy: -121.003056 where: bonds (distance) C4'-P energy: -22.800 bonds (distance) P-C4' energy: -27.198 flat angles C4'-P-C4' energy: -25.743 flat angles P-C4'-P energy: -19.378 tors. eta vs tors. theta energy: -25.884 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 122 Temperature: 1.050000 Total energy: -335.343704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.343704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.376138 (E_RNA) where: Base-Base interactions energy: -221.931 where: short stacking energy: -106.402 Base-Backbone interact. energy: -0.790 local terms energy: -112.654881 where: bonds (distance) C4'-P energy: -21.371 bonds (distance) P-C4' energy: -25.346 flat angles C4'-P-C4' energy: -21.305 flat angles P-C4'-P energy: -18.412 tors. eta vs tors. theta energy: -26.219 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 122 Temperature: 1.100000 Total energy: -325.100421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.100421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.100421 (E_RNA) where: Base-Base interactions energy: -211.199 where: short stacking energy: -100.338 Base-Backbone interact. energy: 0.747 local terms energy: -114.648213 where: bonds (distance) C4'-P energy: -24.976 bonds (distance) P-C4' energy: -16.974 flat angles C4'-P-C4' energy: -27.232 flat angles P-C4'-P energy: -16.716 tors. eta vs tors. theta energy: -28.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 122 Temperature: 1.150000 Total energy: -243.733853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.733853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.744328 (E_RNA) where: Base-Base interactions energy: -145.056 where: short stacking energy: -90.041 Base-Backbone interact. energy: -1.110 local terms energy: -97.578530 where: bonds (distance) C4'-P energy: -25.541 bonds (distance) P-C4' energy: -21.985 flat angles C4'-P-C4' energy: -19.576 flat angles P-C4'-P energy: -13.891 tors. eta vs tors. theta energy: -16.586 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 122 Temperature: 1.200000 Total energy: -221.085685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.085685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.243445 (E_RNA) where: Base-Base interactions energy: -120.219 where: short stacking energy: -67.457 Base-Backbone interact. energy: 0.800 local terms energy: -101.824763 where: bonds (distance) C4'-P energy: -21.419 bonds (distance) P-C4' energy: -18.514 flat angles C4'-P-C4' energy: -28.466 flat angles P-C4'-P energy: -18.529 tors. eta vs tors. theta energy: -14.896 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 122 Temperature: 1.250000 Total energy: -259.188305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.188305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.222349 (E_RNA) where: Base-Base interactions energy: -160.640 where: short stacking energy: -75.272 Base-Backbone interact. energy: -0.542 local terms energy: -98.040421 where: bonds (distance) C4'-P energy: -22.003 bonds (distance) P-C4' energy: -25.102 flat angles C4'-P-C4' energy: -20.271 flat angles P-C4'-P energy: -13.495 tors. eta vs tors. theta energy: -17.169 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 122 Temperature: 1.300000 Total energy: -227.740991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.740991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.885384 (E_RNA) where: Base-Base interactions energy: -143.161 where: short stacking energy: -65.037 Base-Backbone interact. energy: -0.691 local terms energy: -84.033468 where: bonds (distance) C4'-P energy: -21.206 bonds (distance) P-C4' energy: -17.563 flat angles C4'-P-C4' energy: -18.476 flat angles P-C4'-P energy: -17.083 tors. eta vs tors. theta energy: -9.705 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 122 Temperature: 1.350000 Total energy: -224.801620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.801620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.054820 (E_RNA) where: Base-Base interactions energy: -135.547 where: short stacking energy: -73.127 Base-Backbone interact. energy: -0.903 local terms energy: -88.604521 where: bonds (distance) C4'-P energy: -18.257 bonds (distance) P-C4' energy: -21.812 flat angles C4'-P-C4' energy: -21.002 flat angles P-C4'-P energy: -15.490 tors. eta vs tors. theta energy: -12.043 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 123 Temperature: 0.900000 Total energy: -379.673996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.673996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.722628 (E_RNA) where: Base-Base interactions energy: -251.240 where: short stacking energy: -113.744 Base-Backbone interact. energy: 0.795 local terms energy: -129.278211 where: bonds (distance) C4'-P energy: -26.543 bonds (distance) P-C4' energy: -25.669 flat angles C4'-P-C4' energy: -26.143 flat angles P-C4'-P energy: -20.191 tors. eta vs tors. theta energy: -30.733 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 123 Temperature: 0.950000 Total energy: -361.026666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.026666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.080648 (E_RNA) where: Base-Base interactions energy: -239.448 where: short stacking energy: -129.072 Base-Backbone interact. energy: -0.036 local terms energy: -121.596450 where: bonds (distance) C4'-P energy: -15.741 bonds (distance) P-C4' energy: -20.429 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -22.618 tors. eta vs tors. theta energy: -34.173 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 123 Temperature: 1.000000 Total energy: -343.045154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.045154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.062123 (E_RNA) where: Base-Base interactions energy: -221.380 where: short stacking energy: -109.813 Base-Backbone interact. energy: -1.749 local terms energy: -119.933006 where: bonds (distance) C4'-P energy: -20.423 bonds (distance) P-C4' energy: -22.606 flat angles C4'-P-C4' energy: -26.279 flat angles P-C4'-P energy: -20.022 tors. eta vs tors. theta energy: -30.603 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 123 Temperature: 1.050000 Total energy: -345.621143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.621143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.621143 (E_RNA) where: Base-Base interactions energy: -227.595 where: short stacking energy: -111.048 Base-Backbone interact. energy: -0.297 local terms energy: -117.728588 where: bonds (distance) C4'-P energy: -25.752 bonds (distance) P-C4' energy: -22.416 flat angles C4'-P-C4' energy: -22.926 flat angles P-C4'-P energy: -18.760 tors. eta vs tors. theta energy: -27.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 123 Temperature: 1.100000 Total energy: -337.380139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.380139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.435460 (E_RNA) where: Base-Base interactions energy: -222.210 where: short stacking energy: -104.540 Base-Backbone interact. energy: -0.739 local terms energy: -114.486348 where: bonds (distance) C4'-P energy: -21.231 bonds (distance) P-C4' energy: -22.759 flat angles C4'-P-C4' energy: -27.760 flat angles P-C4'-P energy: -14.408 tors. eta vs tors. theta energy: -28.329 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 123 Temperature: 1.150000 Total energy: -251.611032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.611032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.658832 (E_RNA) where: Base-Base interactions energy: -157.774 where: short stacking energy: -81.432 Base-Backbone interact. energy: -0.265 local terms energy: -93.620254 where: bonds (distance) C4'-P energy: -16.940 bonds (distance) P-C4' energy: -18.316 flat angles C4'-P-C4' energy: -24.012 flat angles P-C4'-P energy: -15.471 tors. eta vs tors. theta energy: -18.881 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 123 Temperature: 1.200000 Total energy: -238.324625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.324625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.369849 (E_RNA) where: Base-Base interactions energy: -140.072 where: short stacking energy: -81.825 Base-Backbone interact. energy: 1.041 local terms energy: -99.339553 where: bonds (distance) C4'-P energy: -17.417 bonds (distance) P-C4' energy: -24.957 flat angles C4'-P-C4' energy: -25.164 flat angles P-C4'-P energy: -11.508 tors. eta vs tors. theta energy: -20.294 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 123 Temperature: 1.250000 Total energy: -228.084005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.084005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.084005 (E_RNA) where: Base-Base interactions energy: -137.720 where: short stacking energy: -76.133 Base-Backbone interact. energy: 1.268 local terms energy: -91.631518 where: bonds (distance) C4'-P energy: -17.371 bonds (distance) P-C4' energy: -19.561 flat angles C4'-P-C4' energy: -24.063 flat angles P-C4'-P energy: -16.389 tors. eta vs tors. theta energy: -14.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 123 Temperature: 1.300000 Total energy: -254.055646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.055646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.269648 (E_RNA) where: Base-Base interactions energy: -159.182 where: short stacking energy: -82.288 Base-Backbone interact. energy: -1.259 local terms energy: -93.827842 where: bonds (distance) C4'-P energy: -16.896 bonds (distance) P-C4' energy: -24.528 flat angles C4'-P-C4' energy: -17.880 flat angles P-C4'-P energy: -13.520 tors. eta vs tors. theta energy: -21.003 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 123 Temperature: 1.350000 Total energy: -199.062466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.062466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.216360 (E_RNA) where: Base-Base interactions energy: -120.517 where: short stacking energy: -70.502 Base-Backbone interact. energy: 0.035 local terms energy: -78.734620 where: bonds (distance) C4'-P energy: -19.906 bonds (distance) P-C4' energy: -21.581 flat angles C4'-P-C4' energy: -15.385 flat angles P-C4'-P energy: -8.236 tors. eta vs tors. theta energy: -13.626 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 124 Temperature: 0.900000 Total energy: -368.961402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.961402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.086229 (E_RNA) where: Base-Base interactions energy: -248.395 where: short stacking energy: -121.043 Base-Backbone interact. energy: 1.028 local terms energy: -121.718311 where: bonds (distance) C4'-P energy: -22.426 bonds (distance) P-C4' energy: -25.670 flat angles C4'-P-C4' energy: -24.214 flat angles P-C4'-P energy: -14.058 tors. eta vs tors. theta energy: -35.351 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 124 Temperature: 0.950000 Total energy: -358.664787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.664787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.712486 (E_RNA) where: Base-Base interactions energy: -239.885 where: short stacking energy: -118.287 Base-Backbone interact. energy: 0.509 local terms energy: -119.336304 where: bonds (distance) C4'-P energy: -22.355 bonds (distance) P-C4' energy: -23.816 flat angles C4'-P-C4' energy: -26.240 flat angles P-C4'-P energy: -16.854 tors. eta vs tors. theta energy: -30.070 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 124 Temperature: 1.000000 Total energy: -340.454951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.454951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.454951 (E_RNA) where: Base-Base interactions energy: -224.292 where: short stacking energy: -108.902 Base-Backbone interact. energy: -1.841 local terms energy: -114.321564 where: bonds (distance) C4'-P energy: -24.998 bonds (distance) P-C4' energy: -19.457 flat angles C4'-P-C4' energy: -23.140 flat angles P-C4'-P energy: -16.668 tors. eta vs tors. theta energy: -30.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 124 Temperature: 1.050000 Total energy: -344.776868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.776868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.798796 (E_RNA) where: Base-Base interactions energy: -231.515 where: short stacking energy: -122.884 Base-Backbone interact. energy: -0.217 local terms energy: -113.067021 where: bonds (distance) C4'-P energy: -22.319 bonds (distance) P-C4' energy: -21.640 flat angles C4'-P-C4' energy: -25.097 flat angles P-C4'-P energy: -12.945 tors. eta vs tors. theta energy: -31.067 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 124 Temperature: 1.100000 Total energy: -324.298629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.298629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.315598 (E_RNA) where: Base-Base interactions energy: -220.310 where: short stacking energy: -107.963 Base-Backbone interact. energy: -0.362 local terms energy: -103.643656 where: bonds (distance) C4'-P energy: -24.812 bonds (distance) P-C4' energy: -18.451 flat angles C4'-P-C4' energy: -22.155 flat angles P-C4'-P energy: -13.824 tors. eta vs tors. theta energy: -24.402 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 124 Temperature: 1.150000 Total energy: -240.052259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.052259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.082819 (E_RNA) where: Base-Base interactions energy: -135.836 where: short stacking energy: -80.211 Base-Backbone interact. energy: -1.536 local terms energy: -102.711288 where: bonds (distance) C4'-P energy: -23.641 bonds (distance) P-C4' energy: -22.210 flat angles C4'-P-C4' energy: -21.911 flat angles P-C4'-P energy: -12.715 tors. eta vs tors. theta energy: -22.234 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 124 Temperature: 1.200000 Total energy: -204.935802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.935802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.015099 (E_RNA) where: Base-Base interactions energy: -112.877 where: short stacking energy: -67.121 Base-Backbone interact. energy: 0.381 local terms energy: -92.518730 where: bonds (distance) C4'-P energy: -21.793 bonds (distance) P-C4' energy: -16.044 flat angles C4'-P-C4' energy: -24.901 flat angles P-C4'-P energy: -13.504 tors. eta vs tors. theta energy: -16.277 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 124 Temperature: 1.250000 Total energy: -231.758317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.758317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.804303 (E_RNA) where: Base-Base interactions energy: -133.596 where: short stacking energy: -76.572 Base-Backbone interact. energy: 0.196 local terms energy: -98.404081 where: bonds (distance) C4'-P energy: -24.307 bonds (distance) P-C4' energy: -25.965 flat angles C4'-P-C4' energy: -14.984 flat angles P-C4'-P energy: -15.736 tors. eta vs tors. theta energy: -17.412 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 124 Temperature: 1.300000 Total energy: -151.724757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.724757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.366266 (E_RNA) where: Base-Base interactions energy: -74.869 where: short stacking energy: -42.891 Base-Backbone interact. energy: -1.692 local terms energy: -75.805438 where: bonds (distance) C4'-P energy: -19.163 bonds (distance) P-C4' energy: -23.820 flat angles C4'-P-C4' energy: -20.480 flat angles P-C4'-P energy: -10.545 tors. eta vs tors. theta energy: -1.797 Dist. restrs. and SS energy: 0.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 124 Temperature: 1.350000 Total energy: -203.312731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.312731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.365091 (E_RNA) where: Base-Base interactions energy: -124.691 where: short stacking energy: -65.385 Base-Backbone interact. energy: -0.123 local terms energy: -78.551082 where: bonds (distance) C4'-P energy: -14.093 bonds (distance) P-C4' energy: -21.458 flat angles C4'-P-C4' energy: -17.223 flat angles P-C4'-P energy: -14.290 tors. eta vs tors. theta energy: -11.487 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 125 Temperature: 0.900000 Total energy: -369.819733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.819733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.819733 (E_RNA) where: Base-Base interactions energy: -248.582 where: short stacking energy: -106.799 Base-Backbone interact. energy: -0.774 local terms energy: -120.463198 where: bonds (distance) C4'-P energy: -25.307 bonds (distance) P-C4' energy: -27.986 flat angles C4'-P-C4' energy: -26.450 flat angles P-C4'-P energy: -17.410 tors. eta vs tors. theta energy: -23.311 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 125 Temperature: 0.950000 Total energy: -344.107205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.107205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.153575 (E_RNA) where: Base-Base interactions energy: -229.647 where: short stacking energy: -115.209 Base-Backbone interact. energy: -0.835 local terms energy: -113.671450 where: bonds (distance) C4'-P energy: -23.061 bonds (distance) P-C4' energy: -23.517 flat angles C4'-P-C4' energy: -28.338 flat angles P-C4'-P energy: -16.046 tors. eta vs tors. theta energy: -22.708 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 125 Temperature: 1.000000 Total energy: -355.375731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.375731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.380192 (E_RNA) where: Base-Base interactions energy: -228.191 where: short stacking energy: -120.830 Base-Backbone interact. energy: -0.949 local terms energy: -126.240365 where: bonds (distance) C4'-P energy: -25.131 bonds (distance) P-C4' energy: -26.790 flat angles C4'-P-C4' energy: -26.452 flat angles P-C4'-P energy: -16.604 tors. eta vs tors. theta energy: -31.263 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 125 Temperature: 1.050000 Total energy: -339.387853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.387853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.565712 (E_RNA) where: Base-Base interactions energy: -226.053 where: short stacking energy: -109.250 Base-Backbone interact. energy: -1.601 local terms energy: -111.911668 where: bonds (distance) C4'-P energy: -23.897 bonds (distance) P-C4' energy: -21.978 flat angles C4'-P-C4' energy: -25.841 flat angles P-C4'-P energy: -11.859 tors. eta vs tors. theta energy: -28.337 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 125 Temperature: 1.100000 Total energy: -324.906778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.906778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.924310 (E_RNA) where: Base-Base interactions energy: -212.230 where: short stacking energy: -106.570 Base-Backbone interact. energy: 0.413 local terms energy: -113.107151 where: bonds (distance) C4'-P energy: -15.829 bonds (distance) P-C4' energy: -25.568 flat angles C4'-P-C4' energy: -25.684 flat angles P-C4'-P energy: -20.265 tors. eta vs tors. theta energy: -25.762 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 125 Temperature: 1.150000 Total energy: -227.385144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.385144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.439329 (E_RNA) where: Base-Base interactions energy: -138.500 where: short stacking energy: -68.057 Base-Backbone interact. energy: -0.569 local terms energy: -88.370238 where: bonds (distance) C4'-P energy: -23.344 bonds (distance) P-C4' energy: -17.393 flat angles C4'-P-C4' energy: -21.068 flat angles P-C4'-P energy: -12.871 tors. eta vs tors. theta energy: -13.695 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 125 Temperature: 1.200000 Total energy: -230.794665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.794665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.204137 (E_RNA) where: Base-Base interactions energy: -142.934 where: short stacking energy: -83.734 Base-Backbone interact. energy: -0.271 local terms energy: -87.999248 where: bonds (distance) C4'-P energy: -23.779 bonds (distance) P-C4' energy: -17.594 flat angles C4'-P-C4' energy: -22.887 flat angles P-C4'-P energy: -14.760 tors. eta vs tors. theta energy: -8.979 Dist. restrs. and SS energy: 0.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 125 Temperature: 1.250000 Total energy: -226.428759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.428759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.436865 (E_RNA) where: Base-Base interactions energy: -135.673 where: short stacking energy: -74.936 Base-Backbone interact. energy: 0.171 local terms energy: -90.934741 where: bonds (distance) C4'-P energy: -20.807 bonds (distance) P-C4' energy: -23.142 flat angles C4'-P-C4' energy: -23.443 flat angles P-C4'-P energy: -13.007 tors. eta vs tors. theta energy: -10.536 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 125 Temperature: 1.300000 Total energy: -191.367409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.367409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.451721 (E_RNA) where: Base-Base interactions energy: -128.847 where: short stacking energy: -64.756 Base-Backbone interact. energy: 8.340 local terms energy: -70.944800 where: bonds (distance) C4'-P energy: -17.526 bonds (distance) P-C4' energy: -18.826 flat angles C4'-P-C4' energy: -17.348 flat angles P-C4'-P energy: -9.702 tors. eta vs tors. theta energy: -7.543 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 125 Temperature: 1.350000 Total energy: -197.076282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.076282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.106439 (E_RNA) where: Base-Base interactions energy: -111.784 where: short stacking energy: -58.952 Base-Backbone interact. energy: -0.055 local terms energy: -85.267809 where: bonds (distance) C4'-P energy: -14.117 bonds (distance) P-C4' energy: -22.285 flat angles C4'-P-C4' energy: -19.411 flat angles P-C4'-P energy: -20.084 tors. eta vs tors. theta energy: -9.372 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 126 Temperature: 0.900000 Total energy: -354.556399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.556399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.556399 (E_RNA) where: Base-Base interactions energy: -233.998 where: short stacking energy: -110.520 Base-Backbone interact. energy: -0.833 local terms energy: -119.725271 where: bonds (distance) C4'-P energy: -22.610 bonds (distance) P-C4' energy: -23.117 flat angles C4'-P-C4' energy: -27.471 flat angles P-C4'-P energy: -18.231 tors. eta vs tors. theta energy: -28.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 126 Temperature: 0.950000 Total energy: -360.681998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.681998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.681998 (E_RNA) where: Base-Base interactions energy: -254.776 where: short stacking energy: -114.169 Base-Backbone interact. energy: -0.174 local terms energy: -105.731483 where: bonds (distance) C4'-P energy: -24.219 bonds (distance) P-C4' energy: -15.916 flat angles C4'-P-C4' energy: -24.173 flat angles P-C4'-P energy: -12.944 tors. eta vs tors. theta energy: -28.479 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 126 Temperature: 1.000000 Total energy: -361.121882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.121882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.140693 (E_RNA) where: Base-Base interactions energy: -243.294 where: short stacking energy: -121.084 Base-Backbone interact. energy: 1.060 local terms energy: -118.906903 where: bonds (distance) C4'-P energy: -25.071 bonds (distance) P-C4' energy: -20.958 flat angles C4'-P-C4' energy: -26.982 flat angles P-C4'-P energy: -15.715 tors. eta vs tors. theta energy: -30.180 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 126 Temperature: 1.050000 Total energy: -333.241467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.241467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.241467 (E_RNA) where: Base-Base interactions energy: -218.725 where: short stacking energy: -100.232 Base-Backbone interact. energy: -0.675 local terms energy: -113.841899 where: bonds (distance) C4'-P energy: -21.048 bonds (distance) P-C4' energy: -25.394 flat angles C4'-P-C4' energy: -22.819 flat angles P-C4'-P energy: -16.668 tors. eta vs tors. theta energy: -27.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 126 Temperature: 1.100000 Total energy: -327.637002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.637002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.654689 (E_RNA) where: Base-Base interactions energy: -218.710 where: short stacking energy: -100.043 Base-Backbone interact. energy: -0.201 local terms energy: -108.743480 where: bonds (distance) C4'-P energy: -23.334 bonds (distance) P-C4' energy: -21.189 flat angles C4'-P-C4' energy: -24.762 flat angles P-C4'-P energy: -17.011 tors. eta vs tors. theta energy: -22.446 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 126 Temperature: 1.150000 Total energy: -249.301838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.301838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.471560 (E_RNA) where: Base-Base interactions energy: -154.206 where: short stacking energy: -76.358 Base-Backbone interact. energy: -0.721 local terms energy: -94.544601 where: bonds (distance) C4'-P energy: -25.619 bonds (distance) P-C4' energy: -14.621 flat angles C4'-P-C4' energy: -24.190 flat angles P-C4'-P energy: -16.919 tors. eta vs tors. theta energy: -13.196 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 126 Temperature: 1.200000 Total energy: -227.942696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.942696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.078023 (E_RNA) where: Base-Base interactions energy: -140.372 where: short stacking energy: -72.297 Base-Backbone interact. energy: -0.116 local terms energy: -87.590386 where: bonds (distance) C4'-P energy: -22.680 bonds (distance) P-C4' energy: -22.855 flat angles C4'-P-C4' energy: -17.829 flat angles P-C4'-P energy: -12.362 tors. eta vs tors. theta energy: -11.863 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 126 Temperature: 1.250000 Total energy: -222.862873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.862873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.934903 (E_RNA) where: Base-Base interactions energy: -131.756 where: short stacking energy: -73.902 Base-Backbone interact. energy: -0.255 local terms energy: -90.923596 where: bonds (distance) C4'-P energy: -17.647 bonds (distance) P-C4' energy: -22.289 flat angles C4'-P-C4' energy: -22.937 flat angles P-C4'-P energy: -14.133 tors. eta vs tors. theta energy: -13.918 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 126 Temperature: 1.300000 Total energy: -206.297408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.297408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.297408 (E_RNA) where: Base-Base interactions energy: -129.330 where: short stacking energy: -75.007 Base-Backbone interact. energy: -0.594 local terms energy: -76.373523 where: bonds (distance) C4'-P energy: -15.680 bonds (distance) P-C4' energy: -22.517 flat angles C4'-P-C4' energy: -20.977 flat angles P-C4'-P energy: -11.355 tors. eta vs tors. theta energy: -5.845 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 126 Temperature: 1.350000 Total energy: -207.774088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.774088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.927620 (E_RNA) where: Base-Base interactions energy: -125.411 where: short stacking energy: -73.081 Base-Backbone interact. energy: 3.262 local terms energy: -85.778595 where: bonds (distance) C4'-P energy: -21.002 bonds (distance) P-C4' energy: -17.283 flat angles C4'-P-C4' energy: -19.670 flat angles P-C4'-P energy: -12.091 tors. eta vs tors. theta energy: -15.733 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 127 Temperature: 0.900000 Total energy: -347.262710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.262710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.344680 (E_RNA) where: Base-Base interactions energy: -232.761 where: short stacking energy: -119.100 Base-Backbone interact. energy: -0.546 local terms energy: -114.038404 where: bonds (distance) C4'-P energy: -21.527 bonds (distance) P-C4' energy: -23.288 flat angles C4'-P-C4' energy: -26.030 flat angles P-C4'-P energy: -13.503 tors. eta vs tors. theta energy: -29.690 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 127 Temperature: 0.950000 Total energy: -344.600400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.600400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.626526 (E_RNA) where: Base-Base interactions energy: -229.730 where: short stacking energy: -107.389 Base-Backbone interact. energy: -0.660 local terms energy: -114.236159 where: bonds (distance) C4'-P energy: -18.949 bonds (distance) P-C4' energy: -24.023 flat angles C4'-P-C4' energy: -26.497 flat angles P-C4'-P energy: -16.420 tors. eta vs tors. theta energy: -28.347 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 127 Temperature: 1.000000 Total energy: -359.722845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.722845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.722845 (E_RNA) where: Base-Base interactions energy: -244.322 where: short stacking energy: -113.433 Base-Backbone interact. energy: 0.202 local terms energy: -115.603242 where: bonds (distance) C4'-P energy: -25.947 bonds (distance) P-C4' energy: -22.541 flat angles C4'-P-C4' energy: -21.442 flat angles P-C4'-P energy: -19.867 tors. eta vs tors. theta energy: -25.807 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 127 Temperature: 1.050000 Total energy: -348.384931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.384931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.544647 (E_RNA) where: Base-Base interactions energy: -225.417 where: short stacking energy: -117.903 Base-Backbone interact. energy: -0.843 local terms energy: -122.285273 where: bonds (distance) C4'-P energy: -20.845 bonds (distance) P-C4' energy: -26.707 flat angles C4'-P-C4' energy: -21.883 flat angles P-C4'-P energy: -21.937 tors. eta vs tors. theta energy: -30.913 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 127 Temperature: 1.100000 Total energy: -332.845688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.845688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.923957 (E_RNA) where: Base-Base interactions energy: -229.551 where: short stacking energy: -114.256 Base-Backbone interact. energy: -0.130 local terms energy: -103.242771 where: bonds (distance) C4'-P energy: -13.574 bonds (distance) P-C4' energy: -21.792 flat angles C4'-P-C4' energy: -25.225 flat angles P-C4'-P energy: -16.843 tors. eta vs tors. theta energy: -25.810 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 127 Temperature: 1.150000 Total energy: -232.285357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.285357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.502268 (E_RNA) where: Base-Base interactions energy: -124.970 where: short stacking energy: -68.918 Base-Backbone interact. energy: -1.024 local terms energy: -106.508080 where: bonds (distance) C4'-P energy: -25.142 bonds (distance) P-C4' energy: -24.376 flat angles C4'-P-C4' energy: -24.082 flat angles P-C4'-P energy: -17.061 tors. eta vs tors. theta energy: -15.847 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 127 Temperature: 1.200000 Total energy: -235.206388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.206388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.268395 (E_RNA) where: Base-Base interactions energy: -136.394 where: short stacking energy: -87.682 Base-Backbone interact. energy: -0.049 local terms energy: -98.826147 where: bonds (distance) C4'-P energy: -24.423 bonds (distance) P-C4' energy: -14.607 flat angles C4'-P-C4' energy: -22.098 flat angles P-C4'-P energy: -15.407 tors. eta vs tors. theta energy: -22.292 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 127 Temperature: 1.250000 Total energy: -219.782418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.782418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.803552 (E_RNA) where: Base-Base interactions energy: -137.361 where: short stacking energy: -81.562 Base-Backbone interact. energy: -0.198 local terms energy: -82.244477 where: bonds (distance) C4'-P energy: -10.291 bonds (distance) P-C4' energy: -21.941 flat angles C4'-P-C4' energy: -20.530 flat angles P-C4'-P energy: -12.323 tors. eta vs tors. theta energy: -17.159 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 127 Temperature: 1.300000 Total energy: -213.001819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.001819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.013806 (E_RNA) where: Base-Base interactions energy: -123.687 where: short stacking energy: -60.133 Base-Backbone interact. energy: 0.011 local terms energy: -89.337641 where: bonds (distance) C4'-P energy: -21.409 bonds (distance) P-C4' energy: -26.483 flat angles C4'-P-C4' energy: -18.011 flat angles P-C4'-P energy: -13.604 tors. eta vs tors. theta energy: -9.831 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 127 Temperature: 1.350000 Total energy: -196.882559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.882559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.157612 (E_RNA) where: Base-Base interactions energy: -115.751 where: short stacking energy: -73.376 Base-Backbone interact. energy: -0.911 local terms energy: -80.495956 where: bonds (distance) C4'-P energy: -21.533 bonds (distance) P-C4' energy: -18.655 flat angles C4'-P-C4' energy: -16.257 flat angles P-C4'-P energy: -17.156 tors. eta vs tors. theta energy: -6.895 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 128 Temperature: 0.900000 Total energy: -364.984247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.984247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.021958 (E_RNA) where: Base-Base interactions energy: -246.328 where: short stacking energy: -116.797 Base-Backbone interact. energy: -0.862 local terms energy: -117.831227 where: bonds (distance) C4'-P energy: -21.126 bonds (distance) P-C4' energy: -24.353 flat angles C4'-P-C4' energy: -27.803 flat angles P-C4'-P energy: -16.340 tors. eta vs tors. theta energy: -28.209 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 128 Temperature: 0.950000 Total energy: -353.132062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.132062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.162018 (E_RNA) where: Base-Base interactions energy: -232.992 where: short stacking energy: -125.986 Base-Backbone interact. energy: -0.201 local terms energy: -119.969560 where: bonds (distance) C4'-P energy: -24.111 bonds (distance) P-C4' energy: -23.978 flat angles C4'-P-C4' energy: -24.718 flat angles P-C4'-P energy: -18.168 tors. eta vs tors. theta energy: -28.993 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 128 Temperature: 1.000000 Total energy: -339.529627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.529627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.529627 (E_RNA) where: Base-Base interactions energy: -224.994 where: short stacking energy: -109.745 Base-Backbone interact. energy: -0.520 local terms energy: -114.015609 where: bonds (distance) C4'-P energy: -23.473 bonds (distance) P-C4' energy: -25.913 flat angles C4'-P-C4' energy: -21.616 flat angles P-C4'-P energy: -17.261 tors. eta vs tors. theta energy: -25.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 128 Temperature: 1.050000 Total energy: -353.243720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.243720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.393542 (E_RNA) where: Base-Base interactions energy: -246.519 where: short stacking energy: -95.888 Base-Backbone interact. energy: -1.935 local terms energy: -104.939648 where: bonds (distance) C4'-P energy: -22.431 bonds (distance) P-C4' energy: -19.617 flat angles C4'-P-C4' energy: -24.880 flat angles P-C4'-P energy: -14.920 tors. eta vs tors. theta energy: -23.091 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 128 Temperature: 1.100000 Total energy: -334.630640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.630640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.650395 (E_RNA) where: Base-Base interactions energy: -221.127 where: short stacking energy: -106.346 Base-Backbone interact. energy: -1.351 local terms energy: -112.173218 where: bonds (distance) C4'-P energy: -23.661 bonds (distance) P-C4' energy: -23.202 flat angles C4'-P-C4' energy: -27.578 flat angles P-C4'-P energy: -12.123 tors. eta vs tors. theta energy: -25.609 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 128 Temperature: 1.150000 Total energy: -250.801583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.801583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.813975 (E_RNA) where: Base-Base interactions energy: -154.125 where: short stacking energy: -87.859 Base-Backbone interact. energy: 1.765 local terms energy: -98.453753 where: bonds (distance) C4'-P energy: -13.495 bonds (distance) P-C4' energy: -25.378 flat angles C4'-P-C4' energy: -21.426 flat angles P-C4'-P energy: -17.385 tors. eta vs tors. theta energy: -20.769 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 128 Temperature: 1.200000 Total energy: -249.426844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.426844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.700381 (E_RNA) where: Base-Base interactions energy: -151.208 where: short stacking energy: -86.702 Base-Backbone interact. energy: -0.300 local terms energy: -98.192745 where: bonds (distance) C4'-P energy: -23.677 bonds (distance) P-C4' energy: -24.372 flat angles C4'-P-C4' energy: -21.064 flat angles P-C4'-P energy: -12.441 tors. eta vs tors. theta energy: -16.639 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 128 Temperature: 1.250000 Total energy: -219.468533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.468533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.734272 (E_RNA) where: Base-Base interactions energy: -124.035 where: short stacking energy: -71.452 Base-Backbone interact. energy: 2.322 local terms energy: -98.021105 where: bonds (distance) C4'-P energy: -22.460 bonds (distance) P-C4' energy: -23.888 flat angles C4'-P-C4' energy: -19.613 flat angles P-C4'-P energy: -15.448 tors. eta vs tors. theta energy: -16.612 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 128 Temperature: 1.300000 Total energy: -181.132711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.132711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.192721 (E_RNA) where: Base-Base interactions energy: -104.089 where: short stacking energy: -58.090 Base-Backbone interact. energy: -1.505 local terms energy: -75.599346 where: bonds (distance) C4'-P energy: -18.268 bonds (distance) P-C4' energy: -18.284 flat angles C4'-P-C4' energy: -20.009 flat angles P-C4'-P energy: -11.986 tors. eta vs tors. theta energy: -7.052 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 128 Temperature: 1.350000 Total energy: -212.710472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.710472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.710472 (E_RNA) where: Base-Base interactions energy: -121.124 where: short stacking energy: -67.389 Base-Backbone interact. energy: -0.603 local terms energy: -90.983537 where: bonds (distance) C4'-P energy: -16.846 bonds (distance) P-C4' energy: -24.523 flat angles C4'-P-C4' energy: -17.795 flat angles P-C4'-P energy: -15.629 tors. eta vs tors. theta energy: -16.191 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 129 Temperature: 0.900000 Total energy: -372.104863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.104863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.104863 (E_RNA) where: Base-Base interactions energy: -251.313 where: short stacking energy: -118.290 Base-Backbone interact. energy: -0.231 local terms energy: -120.561543 where: bonds (distance) C4'-P energy: -23.902 bonds (distance) P-C4' energy: -26.870 flat angles C4'-P-C4' energy: -26.843 flat angles P-C4'-P energy: -17.898 tors. eta vs tors. theta energy: -25.049 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 129 Temperature: 0.950000 Total energy: -352.959934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.959934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.969267 (E_RNA) where: Base-Base interactions energy: -238.122 where: short stacking energy: -117.592 Base-Backbone interact. energy: -0.152 local terms energy: -114.695327 where: bonds (distance) C4'-P energy: -20.657 bonds (distance) P-C4' energy: -22.233 flat angles C4'-P-C4' energy: -25.435 flat angles P-C4'-P energy: -19.587 tors. eta vs tors. theta energy: -26.783 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 129 Temperature: 1.000000 Total energy: -345.757521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.757521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.765844 (E_RNA) where: Base-Base interactions energy: -226.543 where: short stacking energy: -102.451 Base-Backbone interact. energy: -2.139 local terms energy: -117.083764 where: bonds (distance) C4'-P energy: -23.863 bonds (distance) P-C4' energy: -23.978 flat angles C4'-P-C4' energy: -24.104 flat angles P-C4'-P energy: -17.730 tors. eta vs tors. theta energy: -27.409 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 129 Temperature: 1.050000 Total energy: -336.440715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.440715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.688541 (E_RNA) where: Base-Base interactions energy: -216.930 where: short stacking energy: -107.086 Base-Backbone interact. energy: -0.904 local terms energy: -118.853849 where: bonds (distance) C4'-P energy: -26.227 bonds (distance) P-C4' energy: -27.013 flat angles C4'-P-C4' energy: -24.104 flat angles P-C4'-P energy: -13.760 tors. eta vs tors. theta energy: -27.750 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 129 Temperature: 1.100000 Total energy: -342.156198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.156198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.278918 (E_RNA) where: Base-Base interactions energy: -239.362 where: short stacking energy: -114.858 Base-Backbone interact. energy: -0.364 local terms energy: -102.553207 where: bonds (distance) C4'-P energy: -22.894 bonds (distance) P-C4' energy: -13.544 flat angles C4'-P-C4' energy: -24.857 flat angles P-C4'-P energy: -12.462 tors. eta vs tors. theta energy: -28.797 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 129 Temperature: 1.150000 Total energy: -234.547937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.547937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.573307 (E_RNA) where: Base-Base interactions energy: -141.100 where: short stacking energy: -70.474 Base-Backbone interact. energy: -0.508 local terms energy: -92.965506 where: bonds (distance) C4'-P energy: -14.978 bonds (distance) P-C4' energy: -27.319 flat angles C4'-P-C4' energy: -27.026 flat angles P-C4'-P energy: -14.308 tors. eta vs tors. theta energy: -9.334 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 129 Temperature: 1.200000 Total energy: -225.370810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.370810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.383952 (E_RNA) where: Base-Base interactions energy: -131.130 where: short stacking energy: -75.256 Base-Backbone interact. energy: 1.113 local terms energy: -95.366924 where: bonds (distance) C4'-P energy: -19.523 bonds (distance) P-C4' energy: -21.198 flat angles C4'-P-C4' energy: -25.424 flat angles P-C4'-P energy: -11.071 tors. eta vs tors. theta energy: -18.151 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 129 Temperature: 1.250000 Total energy: -213.808277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.808277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.834456 (E_RNA) where: Base-Base interactions energy: -136.428 where: short stacking energy: -75.986 Base-Backbone interact. energy: -0.451 local terms energy: -76.955176 where: bonds (distance) C4'-P energy: -23.164 bonds (distance) P-C4' energy: -19.239 flat angles C4'-P-C4' energy: -18.591 flat angles P-C4'-P energy: -4.093 tors. eta vs tors. theta energy: -11.868 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 129 Temperature: 1.300000 Total energy: -231.679670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.679670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.767542 (E_RNA) where: Base-Base interactions energy: -131.120 where: short stacking energy: -72.145 Base-Backbone interact. energy: -1.409 local terms energy: -99.238586 where: bonds (distance) C4'-P energy: -16.888 bonds (distance) P-C4' energy: -21.480 flat angles C4'-P-C4' energy: -21.601 flat angles P-C4'-P energy: -16.285 tors. eta vs tors. theta energy: -22.985 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 129 Temperature: 1.350000 Total energy: -202.523379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.523379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.595536 (E_RNA) where: Base-Base interactions energy: -118.721 where: short stacking energy: -55.872 Base-Backbone interact. energy: -0.173 local terms energy: -83.701895 where: bonds (distance) C4'-P energy: -17.366 bonds (distance) P-C4' energy: -17.698 flat angles C4'-P-C4' energy: -19.185 flat angles P-C4'-P energy: -16.228 tors. eta vs tors. theta energy: -13.224 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 130 Temperature: 0.900000 Total energy: -380.832245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.832245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.869407 (E_RNA) where: Base-Base interactions energy: -250.285 where: short stacking energy: -122.694 Base-Backbone interact. energy: -0.735 local terms energy: -129.848476 where: bonds (distance) C4'-P energy: -25.332 bonds (distance) P-C4' energy: -26.129 flat angles C4'-P-C4' energy: -28.708 flat angles P-C4'-P energy: -15.240 tors. eta vs tors. theta energy: -34.439 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 130 Temperature: 0.950000 Total energy: -352.289776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.289776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.536356 (E_RNA) where: Base-Base interactions energy: -238.900 where: short stacking energy: -115.786 Base-Backbone interact. energy: -0.126 local terms energy: -113.509663 where: bonds (distance) C4'-P energy: -21.033 bonds (distance) P-C4' energy: -26.049 flat angles C4'-P-C4' energy: -27.534 flat angles P-C4'-P energy: -13.863 tors. eta vs tors. theta energy: -25.031 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 130 Temperature: 1.000000 Total energy: -351.215379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.215379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.280308 (E_RNA) where: Base-Base interactions energy: -230.502 where: short stacking energy: -110.616 Base-Backbone interact. energy: -1.403 local terms energy: -119.374902 where: bonds (distance) C4'-P energy: -28.455 bonds (distance) P-C4' energy: -21.283 flat angles C4'-P-C4' energy: -23.616 flat angles P-C4'-P energy: -14.547 tors. eta vs tors. theta energy: -31.474 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 130 Temperature: 1.050000 Total energy: -351.036867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.036867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.097681 (E_RNA) where: Base-Base interactions energy: -240.066 where: short stacking energy: -110.146 Base-Backbone interact. energy: -0.704 local terms energy: -110.327706 where: bonds (distance) C4'-P energy: -27.481 bonds (distance) P-C4' energy: -20.442 flat angles C4'-P-C4' energy: -17.880 flat angles P-C4'-P energy: -14.632 tors. eta vs tors. theta energy: -29.893 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 130 Temperature: 1.100000 Total energy: -349.936213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.936213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.936213 (E_RNA) where: Base-Base interactions energy: -235.393 where: short stacking energy: -111.568 Base-Backbone interact. energy: -0.133 local terms energy: -114.410620 where: bonds (distance) C4'-P energy: -22.350 bonds (distance) P-C4' energy: -24.793 flat angles C4'-P-C4' energy: -19.965 flat angles P-C4'-P energy: -16.372 tors. eta vs tors. theta energy: -30.931 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 130 Temperature: 1.150000 Total energy: -239.277436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.277436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.356321 (E_RNA) where: Base-Base interactions energy: -133.630 where: short stacking energy: -84.343 Base-Backbone interact. energy: -1.046 local terms energy: -104.679834 where: bonds (distance) C4'-P energy: -18.914 bonds (distance) P-C4' energy: -22.312 flat angles C4'-P-C4' energy: -25.288 flat angles P-C4'-P energy: -16.040 tors. eta vs tors. theta energy: -22.126 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 130 Temperature: 1.200000 Total energy: -222.484395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.484395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.945937 (E_RNA) where: Base-Base interactions energy: -127.752 where: short stacking energy: -69.901 Base-Backbone interact. energy: -1.765 local terms energy: -93.429266 where: bonds (distance) C4'-P energy: -23.945 bonds (distance) P-C4' energy: -24.687 flat angles C4'-P-C4' energy: -21.255 flat angles P-C4'-P energy: -11.733 tors. eta vs tors. theta energy: -11.809 Dist. restrs. and SS energy: 0.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 130 Temperature: 1.250000 Total energy: -221.290038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.290038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.290038 (E_RNA) where: Base-Base interactions energy: -130.906 where: short stacking energy: -73.744 Base-Backbone interact. energy: -0.066 local terms energy: -90.318639 where: bonds (distance) C4'-P energy: -25.151 bonds (distance) P-C4' energy: -23.852 flat angles C4'-P-C4' energy: -16.862 flat angles P-C4'-P energy: -8.840 tors. eta vs tors. theta energy: -15.614 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 130 Temperature: 1.300000 Total energy: -216.245881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.245881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.341858 (E_RNA) where: Base-Base interactions energy: -124.819 where: short stacking energy: -57.575 Base-Backbone interact. energy: -1.324 local terms energy: -90.198864 where: bonds (distance) C4'-P energy: -18.184 bonds (distance) P-C4' energy: -19.713 flat angles C4'-P-C4' energy: -22.011 flat angles P-C4'-P energy: -16.176 tors. eta vs tors. theta energy: -14.115 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 130 Temperature: 1.350000 Total energy: -190.684232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.684232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.756178 (E_RNA) where: Base-Base interactions energy: -103.681 where: short stacking energy: -49.655 Base-Backbone interact. energy: -0.056 local terms energy: -87.019467 where: bonds (distance) C4'-P energy: -19.715 bonds (distance) P-C4' energy: -21.581 flat angles C4'-P-C4' energy: -21.749 flat angles P-C4'-P energy: -12.438 tors. eta vs tors. theta energy: -11.536 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 131 Temperature: 0.900000 Total energy: -372.018985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.018985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.018985 (E_RNA) where: Base-Base interactions energy: -250.087 where: short stacking energy: -125.165 Base-Backbone interact. energy: -0.498 local terms energy: -121.433408 where: bonds (distance) C4'-P energy: -26.268 bonds (distance) P-C4' energy: -21.338 flat angles C4'-P-C4' energy: -23.460 flat angles P-C4'-P energy: -19.813 tors. eta vs tors. theta energy: -30.555 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 131 Temperature: 0.950000 Total energy: -351.665034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.665034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.730656 (E_RNA) where: Base-Base interactions energy: -233.025 where: short stacking energy: -114.429 Base-Backbone interact. energy: -0.909 local terms energy: -117.796231 where: bonds (distance) C4'-P energy: -24.219 bonds (distance) P-C4' energy: -26.232 flat angles C4'-P-C4' energy: -26.459 flat angles P-C4'-P energy: -14.541 tors. eta vs tors. theta energy: -26.346 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 131 Temperature: 1.000000 Total energy: -347.923586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.923586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.956789 (E_RNA) where: Base-Base interactions energy: -227.784 where: short stacking energy: -110.617 Base-Backbone interact. energy: -0.892 local terms energy: -119.281058 where: bonds (distance) C4'-P energy: -27.381 bonds (distance) P-C4' energy: -22.336 flat angles C4'-P-C4' energy: -21.325 flat angles P-C4'-P energy: -20.507 tors. eta vs tors. theta energy: -27.732 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 131 Temperature: 1.050000 Total energy: -372.916746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.916746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.149664 (E_RNA) where: Base-Base interactions energy: -255.529 where: short stacking energy: -117.701 Base-Backbone interact. energy: -1.295 local terms energy: -116.326086 where: bonds (distance) C4'-P energy: -23.305 bonds (distance) P-C4' energy: -23.326 flat angles C4'-P-C4' energy: -25.075 flat angles P-C4'-P energy: -12.486 tors. eta vs tors. theta energy: -32.133 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 131 Temperature: 1.100000 Total energy: -342.646496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.646496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.810702 (E_RNA) where: Base-Base interactions energy: -228.485 where: short stacking energy: -104.364 Base-Backbone interact. energy: -1.531 local terms energy: -112.794465 where: bonds (distance) C4'-P energy: -26.276 bonds (distance) P-C4' energy: -26.949 flat angles C4'-P-C4' energy: -20.580 flat angles P-C4'-P energy: -12.023 tors. eta vs tors. theta energy: -26.965 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 131 Temperature: 1.150000 Total energy: -246.287914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.287914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.310736 (E_RNA) where: Base-Base interactions energy: -148.999 where: short stacking energy: -86.744 Base-Backbone interact. energy: -0.256 local terms energy: -97.055842 where: bonds (distance) C4'-P energy: -22.844 bonds (distance) P-C4' energy: -21.386 flat angles C4'-P-C4' energy: -19.772 flat angles P-C4'-P energy: -15.445 tors. eta vs tors. theta energy: -17.609 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 131 Temperature: 1.200000 Total energy: -247.278096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.278096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.323412 (E_RNA) where: Base-Base interactions energy: -148.719 where: short stacking energy: -83.849 Base-Backbone interact. energy: -0.250 local terms energy: -98.354085 where: bonds (distance) C4'-P energy: -22.807 bonds (distance) P-C4' energy: -17.201 flat angles C4'-P-C4' energy: -23.881 flat angles P-C4'-P energy: -9.909 tors. eta vs tors. theta energy: -24.555 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 131 Temperature: 1.250000 Total energy: -207.130658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.130658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.130658 (E_RNA) where: Base-Base interactions energy: -124.940 where: short stacking energy: -62.020 Base-Backbone interact. energy: -0.486 local terms energy: -81.704248 where: bonds (distance) C4'-P energy: -23.290 bonds (distance) P-C4' energy: -25.641 flat angles C4'-P-C4' energy: -17.231 flat angles P-C4'-P energy: -12.065 tors. eta vs tors. theta energy: -3.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 131 Temperature: 1.300000 Total energy: -233.928543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.928543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.942662 (E_RNA) where: Base-Base interactions energy: -139.548 where: short stacking energy: -76.513 Base-Backbone interact. energy: 0.572 local terms energy: -94.966894 where: bonds (distance) C4'-P energy: -18.669 bonds (distance) P-C4' energy: -17.981 flat angles C4'-P-C4' energy: -26.228 flat angles P-C4'-P energy: -10.490 tors. eta vs tors. theta energy: -21.600 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 131 Temperature: 1.350000 Total energy: -192.758750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.758750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.877959 (E_RNA) where: Base-Base interactions energy: -112.334 where: short stacking energy: -52.897 Base-Backbone interact. energy: -0.873 local terms energy: -79.670765 where: bonds (distance) C4'-P energy: -11.280 bonds (distance) P-C4' energy: -20.004 flat angles C4'-P-C4' energy: -28.314 flat angles P-C4'-P energy: -9.105 tors. eta vs tors. theta energy: -10.967 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 132 Temperature: 0.900000 Total energy: -375.679803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.679803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.679803 (E_RNA) where: Base-Base interactions energy: -250.907 where: short stacking energy: -126.011 Base-Backbone interact. energy: -0.177 local terms energy: -124.596513 where: bonds (distance) C4'-P energy: -24.178 bonds (distance) P-C4' energy: -25.805 flat angles C4'-P-C4' energy: -26.536 flat angles P-C4'-P energy: -17.849 tors. eta vs tors. theta energy: -30.229 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 132 Temperature: 0.950000 Total energy: -358.477053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.477053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.643989 (E_RNA) where: Base-Base interactions energy: -232.858 where: short stacking energy: -115.396 Base-Backbone interact. energy: -2.805 local terms energy: -122.980829 where: bonds (distance) C4'-P energy: -24.497 bonds (distance) P-C4' energy: -28.267 flat angles C4'-P-C4' energy: -25.664 flat angles P-C4'-P energy: -16.277 tors. eta vs tors. theta energy: -28.277 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 132 Temperature: 1.000000 Total energy: -356.072569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.072569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.072569 (E_RNA) where: Base-Base interactions energy: -241.506 where: short stacking energy: -112.182 Base-Backbone interact. energy: -2.252 local terms energy: -112.314102 where: bonds (distance) C4'-P energy: -20.151 bonds (distance) P-C4' energy: -19.538 flat angles C4'-P-C4' energy: -22.576 flat angles P-C4'-P energy: -21.087 tors. eta vs tors. theta energy: -28.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 132 Temperature: 1.050000 Total energy: -341.875967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.875967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.928779 (E_RNA) where: Base-Base interactions energy: -222.527 where: short stacking energy: -104.102 Base-Backbone interact. energy: -0.653 local terms energy: -118.748842 where: bonds (distance) C4'-P energy: -21.342 bonds (distance) P-C4' energy: -27.751 flat angles C4'-P-C4' energy: -26.620 flat angles P-C4'-P energy: -15.941 tors. eta vs tors. theta energy: -27.095 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 132 Temperature: 1.100000 Total energy: -321.081550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.081550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.334658 (E_RNA) where: Base-Base interactions energy: -217.472 where: short stacking energy: -109.339 Base-Backbone interact. energy: -0.831 local terms energy: -103.031643 where: bonds (distance) C4'-P energy: -24.255 bonds (distance) P-C4' energy: -19.641 flat angles C4'-P-C4' energy: -24.777 flat angles P-C4'-P energy: -14.023 tors. eta vs tors. theta energy: -20.334 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 132 Temperature: 1.150000 Total energy: -243.473001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.473001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.556340 (E_RNA) where: Base-Base interactions energy: -137.312 where: short stacking energy: -77.783 Base-Backbone interact. energy: -0.222 local terms energy: -106.022569 where: bonds (distance) C4'-P energy: -24.882 bonds (distance) P-C4' energy: -20.487 flat angles C4'-P-C4' energy: -25.279 flat angles P-C4'-P energy: -17.266 tors. eta vs tors. theta energy: -18.108 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 132 Temperature: 1.200000 Total energy: -219.626471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.626471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.644462 (E_RNA) where: Base-Base interactions energy: -127.351 where: short stacking energy: -62.921 Base-Backbone interact. energy: -1.526 local terms energy: -90.767249 where: bonds (distance) C4'-P energy: -22.261 bonds (distance) P-C4' energy: -26.361 flat angles C4'-P-C4' energy: -20.833 flat angles P-C4'-P energy: -12.548 tors. eta vs tors. theta energy: -8.764 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 132 Temperature: 1.250000 Total energy: -210.392204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.392204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.437043 (E_RNA) where: Base-Base interactions energy: -120.013 where: short stacking energy: -66.954 Base-Backbone interact. energy: -0.166 local terms energy: -90.257776 where: bonds (distance) C4'-P energy: -22.305 bonds (distance) P-C4' energy: -22.592 flat angles C4'-P-C4' energy: -17.107 flat angles P-C4'-P energy: -16.776 tors. eta vs tors. theta energy: -11.478 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 132 Temperature: 1.300000 Total energy: -188.741879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.741879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.845122 (E_RNA) where: Base-Base interactions energy: -100.865 where: short stacking energy: -53.683 Base-Backbone interact. energy: -0.104 local terms energy: -87.876346 where: bonds (distance) C4'-P energy: -22.493 bonds (distance) P-C4' energy: -24.857 flat angles C4'-P-C4' energy: -18.864 flat angles P-C4'-P energy: -14.244 tors. eta vs tors. theta energy: -7.418 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 132 Temperature: 1.350000 Total energy: -217.075493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.075493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.150762 (E_RNA) where: Base-Base interactions energy: -132.790 where: short stacking energy: -75.931 Base-Backbone interact. energy: -0.814 local terms energy: -83.546556 where: bonds (distance) C4'-P energy: -18.265 bonds (distance) P-C4' energy: -25.235 flat angles C4'-P-C4' energy: -17.567 flat angles P-C4'-P energy: -9.362 tors. eta vs tors. theta energy: -13.117 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 133 Temperature: 0.900000 Total energy: -376.668641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.668641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.668641 (E_RNA) where: Base-Base interactions energy: -246.371 where: short stacking energy: -128.657 Base-Backbone interact. energy: -1.404 local terms energy: -128.893464 where: bonds (distance) C4'-P energy: -24.128 bonds (distance) P-C4' energy: -23.863 flat angles C4'-P-C4' energy: -28.440 flat angles P-C4'-P energy: -18.881 tors. eta vs tors. theta energy: -33.582 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 133 Temperature: 0.950000 Total energy: -366.042973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.042973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.061451 (E_RNA) where: Base-Base interactions energy: -245.033 where: short stacking energy: -113.539 Base-Backbone interact. energy: -0.545 local terms energy: -120.483604 where: bonds (distance) C4'-P energy: -19.518 bonds (distance) P-C4' energy: -26.409 flat angles C4'-P-C4' energy: -24.402 flat angles P-C4'-P energy: -19.229 tors. eta vs tors. theta energy: -30.926 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 133 Temperature: 1.000000 Total energy: -353.476461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.476461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.476461 (E_RNA) where: Base-Base interactions energy: -228.475 where: short stacking energy: -103.538 Base-Backbone interact. energy: -0.729 local terms energy: -124.271942 where: bonds (distance) C4'-P energy: -24.451 bonds (distance) P-C4' energy: -23.736 flat angles C4'-P-C4' energy: -24.683 flat angles P-C4'-P energy: -23.162 tors. eta vs tors. theta energy: -28.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 133 Temperature: 1.050000 Total energy: -350.124467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.124467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.245596 (E_RNA) where: Base-Base interactions energy: -229.299 where: short stacking energy: -108.525 Base-Backbone interact. energy: -0.386 local terms energy: -120.560348 where: bonds (distance) C4'-P energy: -24.480 bonds (distance) P-C4' energy: -24.574 flat angles C4'-P-C4' energy: -25.389 flat angles P-C4'-P energy: -15.404 tors. eta vs tors. theta energy: -30.713 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 133 Temperature: 1.100000 Total energy: -314.400601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.400601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.421242 (E_RNA) where: Base-Base interactions energy: -201.302 where: short stacking energy: -94.209 Base-Backbone interact. energy: 1.605 local terms energy: -114.724712 where: bonds (distance) C4'-P energy: -27.469 bonds (distance) P-C4' energy: -25.523 flat angles C4'-P-C4' energy: -21.952 flat angles P-C4'-P energy: -18.208 tors. eta vs tors. theta energy: -21.574 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 133 Temperature: 1.150000 Total energy: -234.785262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.785262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.885890 (E_RNA) where: Base-Base interactions energy: -141.945 where: short stacking energy: -78.885 Base-Backbone interact. energy: -0.272 local terms energy: -92.668487 where: bonds (distance) C4'-P energy: -16.841 bonds (distance) P-C4' energy: -24.806 flat angles C4'-P-C4' energy: -16.510 flat angles P-C4'-P energy: -16.956 tors. eta vs tors. theta energy: -17.556 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 133 Temperature: 1.200000 Total energy: -215.080169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.080169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.172297 (E_RNA) where: Base-Base interactions energy: -130.126 where: short stacking energy: -71.179 Base-Backbone interact. energy: -0.638 local terms energy: -84.408411 where: bonds (distance) C4'-P energy: -22.065 bonds (distance) P-C4' energy: -23.641 flat angles C4'-P-C4' energy: -14.777 flat angles P-C4'-P energy: -12.114 tors. eta vs tors. theta energy: -11.811 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 133 Temperature: 1.250000 Total energy: -220.024860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.024860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.115998 (E_RNA) where: Base-Base interactions energy: -134.938 where: short stacking energy: -76.639 Base-Backbone interact. energy: -0.633 local terms energy: -84.544550 where: bonds (distance) C4'-P energy: -18.167 bonds (distance) P-C4' energy: -21.267 flat angles C4'-P-C4' energy: -22.523 flat angles P-C4'-P energy: -16.518 tors. eta vs tors. theta energy: -6.070 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 133 Temperature: 1.300000 Total energy: -218.232843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.232843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.252404 (E_RNA) where: Base-Base interactions energy: -131.704 where: short stacking energy: -72.026 Base-Backbone interact. energy: -0.265 local terms energy: -86.283213 where: bonds (distance) C4'-P energy: -20.207 bonds (distance) P-C4' energy: -24.048 flat angles C4'-P-C4' energy: -16.037 flat angles P-C4'-P energy: -13.057 tors. eta vs tors. theta energy: -12.933 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 133 Temperature: 1.350000 Total energy: -195.334460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.334460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.651688 (E_RNA) where: Base-Base interactions energy: -112.266 where: short stacking energy: -50.949 Base-Backbone interact. energy: -0.382 local terms energy: -83.004210 where: bonds (distance) C4'-P energy: -17.711 bonds (distance) P-C4' energy: -24.360 flat angles C4'-P-C4' energy: -19.370 flat angles P-C4'-P energy: -18.227 tors. eta vs tors. theta energy: -3.337 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 134 Temperature: 0.900000 Total energy: -375.675281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.675281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.726202 (E_RNA) where: Base-Base interactions energy: -264.110 where: short stacking energy: -120.888 Base-Backbone interact. energy: -0.611 local terms energy: -111.005523 where: bonds (distance) C4'-P energy: -14.481 bonds (distance) P-C4' energy: -25.193 flat angles C4'-P-C4' energy: -24.074 flat angles P-C4'-P energy: -16.231 tors. eta vs tors. theta energy: -31.025 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 134 Temperature: 0.950000 Total energy: -357.258684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.258684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.269269 (E_RNA) where: Base-Base interactions energy: -234.431 where: short stacking energy: -117.716 Base-Backbone interact. energy: -0.085 local terms energy: -122.753428 where: bonds (distance) C4'-P energy: -22.726 bonds (distance) P-C4' energy: -25.608 flat angles C4'-P-C4' energy: -22.535 flat angles P-C4'-P energy: -21.004 tors. eta vs tors. theta energy: -30.880 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 134 Temperature: 1.000000 Total energy: -355.264198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.264198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.408427 (E_RNA) where: Base-Base interactions energy: -237.102 where: short stacking energy: -112.290 Base-Backbone interact. energy: -0.348 local terms energy: -117.958564 where: bonds (distance) C4'-P energy: -19.061 bonds (distance) P-C4' energy: -25.092 flat angles C4'-P-C4' energy: -24.400 flat angles P-C4'-P energy: -17.841 tors. eta vs tors. theta energy: -31.564 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 134 Temperature: 1.050000 Total energy: -344.712654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.712654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.744434 (E_RNA) where: Base-Base interactions energy: -227.093 where: short stacking energy: -109.075 Base-Backbone interact. energy: 0.999 local terms energy: -118.650412 where: bonds (distance) C4'-P energy: -21.114 bonds (distance) P-C4' energy: -27.728 flat angles C4'-P-C4' energy: -26.364 flat angles P-C4'-P energy: -16.169 tors. eta vs tors. theta energy: -27.275 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 134 Temperature: 1.100000 Total energy: -322.234386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.234386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.272403 (E_RNA) where: Base-Base interactions energy: -207.137 where: short stacking energy: -103.933 Base-Backbone interact. energy: -0.880 local terms energy: -114.255133 where: bonds (distance) C4'-P energy: -24.799 bonds (distance) P-C4' energy: -25.114 flat angles C4'-P-C4' energy: -26.455 flat angles P-C4'-P energy: -12.650 tors. eta vs tors. theta energy: -25.237 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 134 Temperature: 1.150000 Total energy: -239.559966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.559966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.700065 (E_RNA) where: Base-Base interactions energy: -140.226 where: short stacking energy: -78.566 Base-Backbone interact. energy: -0.755 local terms energy: -98.719574 where: bonds (distance) C4'-P energy: -19.976 bonds (distance) P-C4' energy: -25.611 flat angles C4'-P-C4' energy: -21.276 flat angles P-C4'-P energy: -12.832 tors. eta vs tors. theta energy: -19.024 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 134 Temperature: 1.200000 Total energy: -227.408934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.408934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.462527 (E_RNA) where: Base-Base interactions energy: -131.656 where: short stacking energy: -70.728 Base-Backbone interact. energy: -0.669 local terms energy: -95.136989 where: bonds (distance) C4'-P energy: -24.140 bonds (distance) P-C4' energy: -21.947 flat angles C4'-P-C4' energy: -16.913 flat angles P-C4'-P energy: -17.281 tors. eta vs tors. theta energy: -14.856 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 134 Temperature: 1.250000 Total energy: -216.701633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.701633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.890629 (E_RNA) where: Base-Base interactions energy: -114.930 where: short stacking energy: -61.410 Base-Backbone interact. energy: 0.205 local terms energy: -102.165034 where: bonds (distance) C4'-P energy: -21.098 bonds (distance) P-C4' energy: -25.955 flat angles C4'-P-C4' energy: -26.359 flat angles P-C4'-P energy: -11.964 tors. eta vs tors. theta energy: -16.788 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 134 Temperature: 1.300000 Total energy: -216.342525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.342525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.368614 (E_RNA) where: Base-Base interactions energy: -124.267 where: short stacking energy: -68.962 Base-Backbone interact. energy: -0.312 local terms energy: -91.790476 where: bonds (distance) C4'-P energy: -22.803 bonds (distance) P-C4' energy: -10.377 flat angles C4'-P-C4' energy: -23.185 flat angles P-C4'-P energy: -18.031 tors. eta vs tors. theta energy: -17.396 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 134 Temperature: 1.350000 Total energy: -198.132968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.132968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.561050 (E_RNA) where: Base-Base interactions energy: -121.163 where: short stacking energy: -68.634 Base-Backbone interact. energy: -0.467 local terms energy: -77.931094 where: bonds (distance) C4'-P energy: -20.082 bonds (distance) P-C4' energy: -21.147 flat angles C4'-P-C4' energy: -19.376 flat angles P-C4'-P energy: -6.100 tors. eta vs tors. theta energy: -11.226 Dist. restrs. and SS energy: 1.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 135 Temperature: 0.900000 Total energy: -373.959924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.959924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.975920 (E_RNA) where: Base-Base interactions energy: -248.202 where: short stacking energy: -118.144 Base-Backbone interact. energy: -0.600 local terms energy: -125.173992 where: bonds (distance) C4'-P energy: -25.719 bonds (distance) P-C4' energy: -25.330 flat angles C4'-P-C4' energy: -27.629 flat angles P-C4'-P energy: -17.873 tors. eta vs tors. theta energy: -28.623 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 135 Temperature: 0.950000 Total energy: -361.598931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.598931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.598931 (E_RNA) where: Base-Base interactions energy: -243.717 where: short stacking energy: -125.615 Base-Backbone interact. energy: -0.241 local terms energy: -117.640939 where: bonds (distance) C4'-P energy: -25.215 bonds (distance) P-C4' energy: -20.746 flat angles C4'-P-C4' energy: -25.674 flat angles P-C4'-P energy: -15.798 tors. eta vs tors. theta energy: -30.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 135 Temperature: 1.000000 Total energy: -349.230162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.230162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.230162 (E_RNA) where: Base-Base interactions energy: -234.616 where: short stacking energy: -112.172 Base-Backbone interact. energy: -0.317 local terms energy: -114.297227 where: bonds (distance) C4'-P energy: -22.687 bonds (distance) P-C4' energy: -23.871 flat angles C4'-P-C4' energy: -20.894 flat angles P-C4'-P energy: -18.008 tors. eta vs tors. theta energy: -28.837 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 135 Temperature: 1.050000 Total energy: -348.905889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.905889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.905889 (E_RNA) where: Base-Base interactions energy: -228.046 where: short stacking energy: -103.860 Base-Backbone interact. energy: -0.762 local terms energy: -120.097446 where: bonds (distance) C4'-P energy: -17.780 bonds (distance) P-C4' energy: -25.595 flat angles C4'-P-C4' energy: -26.287 flat angles P-C4'-P energy: -20.968 tors. eta vs tors. theta energy: -29.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 135 Temperature: 1.100000 Total energy: -328.716345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.716345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.732809 (E_RNA) where: Base-Base interactions energy: -218.518 where: short stacking energy: -105.853 Base-Backbone interact. energy: -1.158 local terms energy: -109.057554 where: bonds (distance) C4'-P energy: -20.126 bonds (distance) P-C4' energy: -20.641 flat angles C4'-P-C4' energy: -22.585 flat angles P-C4'-P energy: -18.646 tors. eta vs tors. theta energy: -27.061 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 135 Temperature: 1.150000 Total energy: -249.405316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.405316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.414733 (E_RNA) where: Base-Base interactions energy: -138.758 where: short stacking energy: -87.385 Base-Backbone interact. energy: -1.093 local terms energy: -109.564612 where: bonds (distance) C4'-P energy: -24.754 bonds (distance) P-C4' energy: -20.368 flat angles C4'-P-C4' energy: -23.585 flat angles P-C4'-P energy: -14.889 tors. eta vs tors. theta energy: -25.969 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 135 Temperature: 1.200000 Total energy: -229.662503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.662503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.822115 (E_RNA) where: Base-Base interactions energy: -130.397 where: short stacking energy: -76.194 Base-Backbone interact. energy: -0.222 local terms energy: -99.203773 where: bonds (distance) C4'-P energy: -21.482 bonds (distance) P-C4' energy: -20.214 flat angles C4'-P-C4' energy: -22.176 flat angles P-C4'-P energy: -16.376 tors. eta vs tors. theta energy: -18.956 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 135 Temperature: 1.250000 Total energy: -222.112047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.112047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.112047 (E_RNA) where: Base-Base interactions energy: -128.468 where: short stacking energy: -75.175 Base-Backbone interact. energy: -1.142 local terms energy: -92.501849 where: bonds (distance) C4'-P energy: -19.124 bonds (distance) P-C4' energy: -23.175 flat angles C4'-P-C4' energy: -19.091 flat angles P-C4'-P energy: -14.501 tors. eta vs tors. theta energy: -16.611 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 135 Temperature: 1.300000 Total energy: -190.934586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.934586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.019516 (E_RNA) where: Base-Base interactions energy: -116.396 where: short stacking energy: -65.352 Base-Backbone interact. energy: -0.762 local terms energy: -73.861252 where: bonds (distance) C4'-P energy: -20.975 bonds (distance) P-C4' energy: -22.731 flat angles C4'-P-C4' energy: -17.690 flat angles P-C4'-P energy: -12.900 tors. eta vs tors. theta energy: 0.435 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 135 Temperature: 1.350000 Total energy: -185.832571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.832571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.028026 (E_RNA) where: Base-Base interactions energy: -106.794 where: short stacking energy: -63.022 Base-Backbone interact. energy: -0.155 local terms energy: -79.078952 where: bonds (distance) C4'-P energy: -17.257 bonds (distance) P-C4' energy: -19.016 flat angles C4'-P-C4' energy: -22.129 flat angles P-C4'-P energy: -9.734 tors. eta vs tors. theta energy: -10.944 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 136 Temperature: 0.900000 Total energy: -389.469093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.469093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.484482 (E_RNA) where: Base-Base interactions energy: -261.711 where: short stacking energy: -117.186 Base-Backbone interact. energy: -1.292 local terms energy: -126.481048 where: bonds (distance) C4'-P energy: -22.213 bonds (distance) P-C4' energy: -25.281 flat angles C4'-P-C4' energy: -24.887 flat angles P-C4'-P energy: -19.357 tors. eta vs tors. theta energy: -34.743 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 136 Temperature: 0.950000 Total energy: -368.052373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.052373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.052373 (E_RNA) where: Base-Base interactions energy: -247.284 where: short stacking energy: -108.506 Base-Backbone interact. energy: -1.676 local terms energy: -119.092272 where: bonds (distance) C4'-P energy: -26.202 bonds (distance) P-C4' energy: -22.737 flat angles C4'-P-C4' energy: -21.248 flat angles P-C4'-P energy: -18.783 tors. eta vs tors. theta energy: -30.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 136 Temperature: 1.000000 Total energy: -348.316078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.316078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.316078 (E_RNA) where: Base-Base interactions energy: -223.693 where: short stacking energy: -115.050 Base-Backbone interact. energy: -1.338 local terms energy: -123.284876 where: bonds (distance) C4'-P energy: -25.071 bonds (distance) P-C4' energy: -27.929 flat angles C4'-P-C4' energy: -26.401 flat angles P-C4'-P energy: -16.494 tors. eta vs tors. theta energy: -27.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 136 Temperature: 1.050000 Total energy: -350.666370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.666370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.689430 (E_RNA) where: Base-Base interactions energy: -237.389 where: short stacking energy: -98.743 Base-Backbone interact. energy: -1.824 local terms energy: -111.476466 where: bonds (distance) C4'-P energy: -20.729 bonds (distance) P-C4' energy: -27.192 flat angles C4'-P-C4' energy: -25.247 flat angles P-C4'-P energy: -16.019 tors. eta vs tors. theta energy: -22.289 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 136 Temperature: 1.100000 Total energy: -315.090932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.090932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.161180 (E_RNA) where: Base-Base interactions energy: -211.619 where: short stacking energy: -99.394 Base-Backbone interact. energy: -0.777 local terms energy: -102.764825 where: bonds (distance) C4'-P energy: -15.945 bonds (distance) P-C4' energy: -25.165 flat angles C4'-P-C4' energy: -22.002 flat angles P-C4'-P energy: -17.541 tors. eta vs tors. theta energy: -22.112 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 136 Temperature: 1.150000 Total energy: -237.399863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.399863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.618033 (E_RNA) where: Base-Base interactions energy: -140.675 where: short stacking energy: -76.257 Base-Backbone interact. energy: 0.204 local terms energy: -97.147521 where: bonds (distance) C4'-P energy: -21.313 bonds (distance) P-C4' energy: -19.260 flat angles C4'-P-C4' energy: -22.593 flat angles P-C4'-P energy: -15.867 tors. eta vs tors. theta energy: -18.115 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 136 Temperature: 1.200000 Total energy: -215.050262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.050262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.329315 (E_RNA) where: Base-Base interactions energy: -125.499 where: short stacking energy: -72.366 Base-Backbone interact. energy: 0.217 local terms energy: -90.047225 where: bonds (distance) C4'-P energy: -19.491 bonds (distance) P-C4' energy: -20.310 flat angles C4'-P-C4' energy: -22.349 flat angles P-C4'-P energy: -14.231 tors. eta vs tors. theta energy: -13.667 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 136 Temperature: 1.250000 Total energy: -215.946253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.946253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.017061 (E_RNA) where: Base-Base interactions energy: -130.867 where: short stacking energy: -74.760 Base-Backbone interact. energy: -0.160 local terms energy: -84.989792 where: bonds (distance) C4'-P energy: -21.809 bonds (distance) P-C4' energy: -18.758 flat angles C4'-P-C4' energy: -22.379 flat angles P-C4'-P energy: -6.972 tors. eta vs tors. theta energy: -15.072 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 136 Temperature: 1.300000 Total energy: -214.214018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.214018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.314625 (E_RNA) where: Base-Base interactions energy: -131.345 where: short stacking energy: -70.737 Base-Backbone interact. energy: -0.577 local terms energy: -82.393307 where: bonds (distance) C4'-P energy: -22.302 bonds (distance) P-C4' energy: -20.070 flat angles C4'-P-C4' energy: -18.909 flat angles P-C4'-P energy: -13.725 tors. eta vs tors. theta energy: -7.389 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 136 Temperature: 1.350000 Total energy: -204.928990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.928990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.226457 (E_RNA) where: Base-Base interactions energy: -115.571 where: short stacking energy: -66.168 Base-Backbone interact. energy: -0.027 local terms energy: -89.628268 where: bonds (distance) C4'-P energy: -20.506 bonds (distance) P-C4' energy: -23.470 flat angles C4'-P-C4' energy: -22.272 flat angles P-C4'-P energy: -10.432 tors. eta vs tors. theta energy: -12.949 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 137 Temperature: 0.900000 Total energy: -390.094621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.094621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.113249 (E_RNA) where: Base-Base interactions energy: -254.400 where: short stacking energy: -121.436 Base-Backbone interact. energy: -3.000 local terms energy: -132.713552 where: bonds (distance) C4'-P energy: -25.806 bonds (distance) P-C4' energy: -27.243 flat angles C4'-P-C4' energy: -25.153 flat angles P-C4'-P energy: -20.509 tors. eta vs tors. theta energy: -34.002 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 137 Temperature: 0.950000 Total energy: -349.925221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.925221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.937075 (E_RNA) where: Base-Base interactions energy: -230.149 where: short stacking energy: -119.054 Base-Backbone interact. energy: -0.982 local terms energy: -118.805905 where: bonds (distance) C4'-P energy: -18.577 bonds (distance) P-C4' energy: -25.797 flat angles C4'-P-C4' energy: -26.411 flat angles P-C4'-P energy: -17.756 tors. eta vs tors. theta energy: -30.264 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 137 Temperature: 1.000000 Total energy: -360.916742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.916742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.967273 (E_RNA) where: Base-Base interactions energy: -234.693 where: short stacking energy: -111.900 Base-Backbone interact. energy: -0.678 local terms energy: -125.596219 where: bonds (distance) C4'-P energy: -25.750 bonds (distance) P-C4' energy: -25.056 flat angles C4'-P-C4' energy: -24.712 flat angles P-C4'-P energy: -16.504 tors. eta vs tors. theta energy: -33.574 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 137 Temperature: 1.050000 Total energy: -329.523520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.523520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.539991 (E_RNA) where: Base-Base interactions energy: -221.096 where: short stacking energy: -100.473 Base-Backbone interact. energy: -1.295 local terms energy: -107.148563 where: bonds (distance) C4'-P energy: -24.334 bonds (distance) P-C4' energy: -19.971 flat angles C4'-P-C4' energy: -22.757 flat angles P-C4'-P energy: -15.604 tors. eta vs tors. theta energy: -24.482 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 137 Temperature: 1.100000 Total energy: -296.619822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.619822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.649350 (E_RNA) where: Base-Base interactions energy: -200.248 where: short stacking energy: -90.372 Base-Backbone interact. energy: -0.290 local terms energy: -96.111049 where: bonds (distance) C4'-P energy: -16.533 bonds (distance) P-C4' energy: -21.792 flat angles C4'-P-C4' energy: -25.243 flat angles P-C4'-P energy: -15.828 tors. eta vs tors. theta energy: -16.715 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 137 Temperature: 1.150000 Total energy: -227.089922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.089922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.210658 (E_RNA) where: Base-Base interactions energy: -130.133 where: short stacking energy: -68.560 Base-Backbone interact. energy: -0.565 local terms energy: -96.512301 where: bonds (distance) C4'-P energy: -18.302 bonds (distance) P-C4' energy: -19.425 flat angles C4'-P-C4' energy: -25.828 flat angles P-C4'-P energy: -18.392 tors. eta vs tors. theta energy: -14.565 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 137 Temperature: 1.200000 Total energy: -229.183800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.183800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.295723 (E_RNA) where: Base-Base interactions energy: -133.189 where: short stacking energy: -64.334 Base-Backbone interact. energy: -0.134 local terms energy: -95.972863 where: bonds (distance) C4'-P energy: -20.860 bonds (distance) P-C4' energy: -19.567 flat angles C4'-P-C4' energy: -24.212 flat angles P-C4'-P energy: -15.788 tors. eta vs tors. theta energy: -15.545 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 137 Temperature: 1.250000 Total energy: -227.704186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.704186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.811180 (E_RNA) where: Base-Base interactions energy: -131.515 where: short stacking energy: -81.028 Base-Backbone interact. energy: -0.561 local terms energy: -95.734790 where: bonds (distance) C4'-P energy: -19.453 bonds (distance) P-C4' energy: -24.116 flat angles C4'-P-C4' energy: -19.142 flat angles P-C4'-P energy: -12.517 tors. eta vs tors. theta energy: -20.507 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 137 Temperature: 1.300000 Total energy: -216.658328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.658328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.658328 (E_RNA) where: Base-Base interactions energy: -119.681 where: short stacking energy: -60.728 Base-Backbone interact. energy: -0.610 local terms energy: -96.368222 where: bonds (distance) C4'-P energy: -22.547 bonds (distance) P-C4' energy: -27.478 flat angles C4'-P-C4' energy: -22.771 flat angles P-C4'-P energy: -13.953 tors. eta vs tors. theta energy: -9.619 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 137 Temperature: 1.350000 Total energy: -194.561433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.561433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.618614 (E_RNA) where: Base-Base interactions energy: -109.337 where: short stacking energy: -55.320 Base-Backbone interact. energy: -0.380 local terms energy: -84.900996 where: bonds (distance) C4'-P energy: -22.324 bonds (distance) P-C4' energy: -16.501 flat angles C4'-P-C4' energy: -21.205 flat angles P-C4'-P energy: -13.852 tors. eta vs tors. theta energy: -11.020 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 138 Temperature: 0.900000 Total energy: -392.562887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.562887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.618980 (E_RNA) where: Base-Base interactions energy: -265.374 where: short stacking energy: -120.216 Base-Backbone interact. energy: -1.003 local terms energy: -126.242107 where: bonds (distance) C4'-P energy: -23.381 bonds (distance) P-C4' energy: -27.417 flat angles C4'-P-C4' energy: -25.198 flat angles P-C4'-P energy: -15.460 tors. eta vs tors. theta energy: -34.786 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 138 Temperature: 0.950000 Total energy: -363.302052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.302052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.373116 (E_RNA) where: Base-Base interactions energy: -247.421 where: short stacking energy: -119.273 Base-Backbone interact. energy: 0.093 local terms energy: -116.044988 where: bonds (distance) C4'-P energy: -13.646 bonds (distance) P-C4' energy: -25.083 flat angles C4'-P-C4' energy: -25.423 flat angles P-C4'-P energy: -22.290 tors. eta vs tors. theta energy: -29.602 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 138 Temperature: 1.000000 Total energy: -361.928447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.928447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.928447 (E_RNA) where: Base-Base interactions energy: -249.692 where: short stacking energy: -113.307 Base-Backbone interact. energy: -2.367 local terms energy: -109.868730 where: bonds (distance) C4'-P energy: -18.196 bonds (distance) P-C4' energy: -24.132 flat angles C4'-P-C4' energy: -23.512 flat angles P-C4'-P energy: -14.460 tors. eta vs tors. theta energy: -29.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 138 Temperature: 1.050000 Total energy: -339.115058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.115058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.151665 (E_RNA) where: Base-Base interactions energy: -226.994 where: short stacking energy: -107.689 Base-Backbone interact. energy: -0.535 local terms energy: -111.622307 where: bonds (distance) C4'-P energy: -19.107 bonds (distance) P-C4' energy: -22.458 flat angles C4'-P-C4' energy: -26.233 flat angles P-C4'-P energy: -20.071 tors. eta vs tors. theta energy: -23.754 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 138 Temperature: 1.100000 Total energy: -308.984833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.984833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.087091 (E_RNA) where: Base-Base interactions energy: -198.355 where: short stacking energy: -95.963 Base-Backbone interact. energy: -0.265 local terms energy: -110.467001 where: bonds (distance) C4'-P energy: -21.743 bonds (distance) P-C4' energy: -26.820 flat angles C4'-P-C4' energy: -25.524 flat angles P-C4'-P energy: -15.008 tors. eta vs tors. theta energy: -21.373 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 138 Temperature: 1.150000 Total energy: -232.929559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.929559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.929559 (E_RNA) where: Base-Base interactions energy: -145.674 where: short stacking energy: -83.366 Base-Backbone interact. energy: 1.888 local terms energy: -89.144158 where: bonds (distance) C4'-P energy: -18.737 bonds (distance) P-C4' energy: -22.865 flat angles C4'-P-C4' energy: -20.690 flat angles P-C4'-P energy: -14.858 tors. eta vs tors. theta energy: -11.995 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 138 Temperature: 1.200000 Total energy: -229.861135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.861135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.920252 (E_RNA) where: Base-Base interactions energy: -138.906 where: short stacking energy: -74.415 Base-Backbone interact. energy: -1.332 local terms energy: -89.681962 where: bonds (distance) C4'-P energy: -19.826 bonds (distance) P-C4' energy: -24.567 flat angles C4'-P-C4' energy: -19.583 flat angles P-C4'-P energy: -12.302 tors. eta vs tors. theta energy: -13.404 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 138 Temperature: 1.250000 Total energy: -213.724181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.724181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.834017 (E_RNA) where: Base-Base interactions energy: -127.858 where: short stacking energy: -72.319 Base-Backbone interact. energy: 0.334 local terms energy: -86.309551 where: bonds (distance) C4'-P energy: -19.255 bonds (distance) P-C4' energy: -20.793 flat angles C4'-P-C4' energy: -19.656 flat angles P-C4'-P energy: -10.274 tors. eta vs tors. theta energy: -16.331 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 138 Temperature: 1.300000 Total energy: -200.711273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.711273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.711273 (E_RNA) where: Base-Base interactions energy: -115.498 where: short stacking energy: -58.745 Base-Backbone interact. energy: 1.545 local terms energy: -86.758353 where: bonds (distance) C4'-P energy: -14.447 bonds (distance) P-C4' energy: -18.555 flat angles C4'-P-C4' energy: -24.964 flat angles P-C4'-P energy: -15.835 tors. eta vs tors. theta energy: -12.958 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 138 Temperature: 1.350000 Total energy: -201.571580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.571580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.788955 (E_RNA) where: Base-Base interactions energy: -116.881 where: short stacking energy: -59.080 Base-Backbone interact. energy: -1.190 local terms energy: -83.717767 where: bonds (distance) C4'-P energy: -16.661 bonds (distance) P-C4' energy: -18.963 flat angles C4'-P-C4' energy: -26.271 flat angles P-C4'-P energy: -12.176 tors. eta vs tors. theta energy: -9.647 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 139 Temperature: 0.900000 Total energy: -385.200320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.200320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.256640 (E_RNA) where: Base-Base interactions energy: -255.090 where: short stacking energy: -108.974 Base-Backbone interact. energy: -1.370 local terms energy: -128.796493 where: bonds (distance) C4'-P energy: -26.820 bonds (distance) P-C4' energy: -24.828 flat angles C4'-P-C4' energy: -27.454 flat angles P-C4'-P energy: -17.005 tors. eta vs tors. theta energy: -32.689 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 139 Temperature: 0.950000 Total energy: -357.386506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.386506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.410093 (E_RNA) where: Base-Base interactions energy: -240.428 where: short stacking energy: -109.567 Base-Backbone interact. energy: -1.758 local terms energy: -115.223781 where: bonds (distance) C4'-P energy: -23.917 bonds (distance) P-C4' energy: -21.933 flat angles C4'-P-C4' energy: -23.783 flat angles P-C4'-P energy: -18.444 tors. eta vs tors. theta energy: -27.147 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 139 Temperature: 1.000000 Total energy: -348.905864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.905864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.916396 (E_RNA) where: Base-Base interactions energy: -230.592 where: short stacking energy: -114.996 Base-Backbone interact. energy: -0.673 local terms energy: -117.650943 where: bonds (distance) C4'-P energy: -14.950 bonds (distance) P-C4' energy: -26.063 flat angles C4'-P-C4' energy: -28.016 flat angles P-C4'-P energy: -18.998 tors. eta vs tors. theta energy: -29.624 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 139 Temperature: 1.050000 Total energy: -329.787303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.787303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.800185 (E_RNA) where: Base-Base interactions energy: -206.574 where: short stacking energy: -95.428 Base-Backbone interact. energy: -0.045 local terms energy: -123.181809 where: bonds (distance) C4'-P energy: -24.414 bonds (distance) P-C4' energy: -25.160 flat angles C4'-P-C4' energy: -26.682 flat angles P-C4'-P energy: -20.989 tors. eta vs tors. theta energy: -25.936 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 139 Temperature: 1.100000 Total energy: -334.994565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.994565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.075393 (E_RNA) where: Base-Base interactions energy: -221.543 where: short stacking energy: -114.674 Base-Backbone interact. energy: -0.186 local terms energy: -113.346122 where: bonds (distance) C4'-P energy: -27.403 bonds (distance) P-C4' energy: -21.872 flat angles C4'-P-C4' energy: -19.889 flat angles P-C4'-P energy: -15.388 tors. eta vs tors. theta energy: -28.795 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 139 Temperature: 1.150000 Total energy: -228.787041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.787041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.920208 (E_RNA) where: Base-Base interactions energy: -147.185 where: short stacking energy: -69.389 Base-Backbone interact. energy: -1.130 local terms energy: -80.605515 where: bonds (distance) C4'-P energy: -17.430 bonds (distance) P-C4' energy: -16.003 flat angles C4'-P-C4' energy: -26.313 flat angles P-C4'-P energy: -13.226 tors. eta vs tors. theta energy: -7.633 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 139 Temperature: 1.200000 Total energy: -229.467628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.467628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.521318 (E_RNA) where: Base-Base interactions energy: -132.373 where: short stacking energy: -75.461 Base-Backbone interact. energy: 1.541 local terms energy: -98.689483 where: bonds (distance) C4'-P energy: -19.595 bonds (distance) P-C4' energy: -24.940 flat angles C4'-P-C4' energy: -19.102 flat angles P-C4'-P energy: -18.589 tors. eta vs tors. theta energy: -16.463 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 139 Temperature: 1.250000 Total energy: -210.603428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.603428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.656745 (E_RNA) where: Base-Base interactions energy: -122.292 where: short stacking energy: -66.273 Base-Backbone interact. energy: -0.144 local terms energy: -88.221317 where: bonds (distance) C4'-P energy: -19.491 bonds (distance) P-C4' energy: -23.532 flat angles C4'-P-C4' energy: -17.473 flat angles P-C4'-P energy: -18.086 tors. eta vs tors. theta energy: -9.639 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 139 Temperature: 1.300000 Total energy: -206.927551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.927551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.081178 (E_RNA) where: Base-Base interactions energy: -121.488 where: short stacking energy: -60.253 Base-Backbone interact. energy: -0.473 local terms energy: -85.120305 where: bonds (distance) C4'-P energy: -20.119 bonds (distance) P-C4' energy: -19.951 flat angles C4'-P-C4' energy: -16.353 flat angles P-C4'-P energy: -16.451 tors. eta vs tors. theta energy: -12.247 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 139 Temperature: 1.350000 Total energy: -208.578242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.578242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.633420 (E_RNA) where: Base-Base interactions energy: -125.809 where: short stacking energy: -74.954 Base-Backbone interact. energy: -0.074 local terms energy: -82.750360 where: bonds (distance) C4'-P energy: -13.372 bonds (distance) P-C4' energy: -23.167 flat angles C4'-P-C4' energy: -21.347 flat angles P-C4'-P energy: -12.056 tors. eta vs tors. theta energy: -12.809 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 140 Temperature: 0.900000 Total energy: -392.869174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.869174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.869315 (E_RNA) where: Base-Base interactions energy: -271.945 where: short stacking energy: -119.173 Base-Backbone interact. energy: -0.116 local terms energy: -120.808534 where: bonds (distance) C4'-P energy: -25.342 bonds (distance) P-C4' energy: -23.368 flat angles C4'-P-C4' energy: -22.461 flat angles P-C4'-P energy: -16.226 tors. eta vs tors. theta energy: -33.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 140 Temperature: 0.950000 Total energy: -369.491660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.491660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.537117 (E_RNA) where: Base-Base interactions energy: -250.407 where: short stacking energy: -114.003 Base-Backbone interact. energy: -0.792 local terms energy: -118.337943 where: bonds (distance) C4'-P energy: -26.508 bonds (distance) P-C4' energy: -17.064 flat angles C4'-P-C4' energy: -25.345 flat angles P-C4'-P energy: -17.670 tors. eta vs tors. theta energy: -31.751 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 140 Temperature: 1.000000 Total energy: -363.672762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.672762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.679416 (E_RNA) where: Base-Base interactions energy: -235.123 where: short stacking energy: -120.453 Base-Backbone interact. energy: 0.850 local terms energy: -129.406111 where: bonds (distance) C4'-P energy: -22.858 bonds (distance) P-C4' energy: -22.865 flat angles C4'-P-C4' energy: -28.335 flat angles P-C4'-P energy: -22.362 tors. eta vs tors. theta energy: -32.985 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 140 Temperature: 1.050000 Total energy: -319.579764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.579764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.690993 (E_RNA) where: Base-Base interactions energy: -207.031 where: short stacking energy: -102.607 Base-Backbone interact. energy: -0.309 local terms energy: -112.350629 where: bonds (distance) C4'-P energy: -16.730 bonds (distance) P-C4' energy: -25.693 flat angles C4'-P-C4' energy: -26.621 flat angles P-C4'-P energy: -15.312 tors. eta vs tors. theta energy: -27.994 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 140 Temperature: 1.100000 Total energy: -280.851066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.851066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.862616 (E_RNA) where: Base-Base interactions energy: -180.899 where: short stacking energy: -83.557 Base-Backbone interact. energy: -1.071 local terms energy: -98.892797 where: bonds (distance) C4'-P energy: -24.107 bonds (distance) P-C4' energy: -22.266 flat angles C4'-P-C4' energy: -21.752 flat angles P-C4'-P energy: -11.991 tors. eta vs tors. theta energy: -18.777 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 140 Temperature: 1.150000 Total energy: -317.315492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.315492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.341606 (E_RNA) where: Base-Base interactions energy: -216.924 where: short stacking energy: -107.212 Base-Backbone interact. energy: 0.266 local terms energy: -100.684106 where: bonds (distance) C4'-P energy: -24.911 bonds (distance) P-C4' energy: -19.058 flat angles C4'-P-C4' energy: -23.576 flat angles P-C4'-P energy: -10.377 tors. eta vs tors. theta energy: -22.762 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 140 Temperature: 1.200000 Total energy: -247.641526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.641526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.671231 (E_RNA) where: Base-Base interactions energy: -150.518 where: short stacking energy: -77.991 Base-Backbone interact. energy: -0.931 local terms energy: -96.221906 where: bonds (distance) C4'-P energy: -26.432 bonds (distance) P-C4' energy: -23.417 flat angles C4'-P-C4' energy: -16.234 flat angles P-C4'-P energy: -13.625 tors. eta vs tors. theta energy: -16.515 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 140 Temperature: 1.250000 Total energy: -215.288352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.288352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.312936 (E_RNA) where: Base-Base interactions energy: -128.976 where: short stacking energy: -72.672 Base-Backbone interact. energy: -0.471 local terms energy: -85.865647 where: bonds (distance) C4'-P energy: -22.873 bonds (distance) P-C4' energy: -19.320 flat angles C4'-P-C4' energy: -22.181 flat angles P-C4'-P energy: -11.320 tors. eta vs tors. theta energy: -10.171 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 140 Temperature: 1.300000 Total energy: -214.926271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.926271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.963705 (E_RNA) where: Base-Base interactions energy: -120.066 where: short stacking energy: -65.446 Base-Backbone interact. energy: 1.030 local terms energy: -95.927458 where: bonds (distance) C4'-P energy: -23.475 bonds (distance) P-C4' energy: -20.969 flat angles C4'-P-C4' energy: -20.569 flat angles P-C4'-P energy: -16.099 tors. eta vs tors. theta energy: -14.816 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 140 Temperature: 1.350000 Total energy: -192.678644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.678644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.700012 (E_RNA) where: Base-Base interactions energy: -118.507 where: short stacking energy: -59.755 Base-Backbone interact. energy: 0.556 local terms energy: -74.748759 where: bonds (distance) C4'-P energy: -22.262 bonds (distance) P-C4' energy: -19.789 flat angles C4'-P-C4' energy: -11.586 flat angles P-C4'-P energy: -11.704 tors. eta vs tors. theta energy: -9.408 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 141 Temperature: 0.900000 Total energy: -388.922727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.922727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.922727 (E_RNA) where: Base-Base interactions energy: -253.477 where: short stacking energy: -115.765 Base-Backbone interact. energy: -2.405 local terms energy: -133.041134 where: bonds (distance) C4'-P energy: -28.551 bonds (distance) P-C4' energy: -26.860 flat angles C4'-P-C4' energy: -25.727 flat angles P-C4'-P energy: -18.900 tors. eta vs tors. theta energy: -33.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 141 Temperature: 0.950000 Total energy: -381.069919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.069919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.069919 (E_RNA) where: Base-Base interactions energy: -247.996 where: short stacking energy: -109.300 Base-Backbone interact. energy: -1.339 local terms energy: -131.734958 where: bonds (distance) C4'-P energy: -22.583 bonds (distance) P-C4' energy: -27.661 flat angles C4'-P-C4' energy: -27.697 flat angles P-C4'-P energy: -18.241 tors. eta vs tors. theta energy: -35.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 141 Temperature: 1.000000 Total energy: -353.240426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.240426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.309897 (E_RNA) where: Base-Base interactions energy: -239.631 where: short stacking energy: -114.392 Base-Backbone interact. energy: -0.997 local terms energy: -112.682245 where: bonds (distance) C4'-P energy: -16.602 bonds (distance) P-C4' energy: -26.930 flat angles C4'-P-C4' energy: -22.344 flat angles P-C4'-P energy: -15.547 tors. eta vs tors. theta energy: -31.260 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 141 Temperature: 1.050000 Total energy: -315.360482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.360482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.538532 (E_RNA) where: Base-Base interactions energy: -201.549 where: short stacking energy: -97.705 Base-Backbone interact. energy: -0.203 local terms energy: -113.786439 where: bonds (distance) C4'-P energy: -22.239 bonds (distance) P-C4' energy: -21.791 flat angles C4'-P-C4' energy: -26.583 flat angles P-C4'-P energy: -13.948 tors. eta vs tors. theta energy: -29.226 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 141 Temperature: 1.100000 Total energy: -263.392763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.392763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.412092 (E_RNA) where: Base-Base interactions energy: -165.487 where: short stacking energy: -92.061 Base-Backbone interact. energy: -0.096 local terms energy: -97.828334 where: bonds (distance) C4'-P energy: -21.445 bonds (distance) P-C4' energy: -21.359 flat angles C4'-P-C4' energy: -23.996 flat angles P-C4'-P energy: -11.035 tors. eta vs tors. theta energy: -19.993 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 141 Temperature: 1.150000 Total energy: -312.490723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.490723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.791217 (E_RNA) where: Base-Base interactions energy: -199.859 where: short stacking energy: -98.446 Base-Backbone interact. energy: -0.340 local terms energy: -112.592132 where: bonds (distance) C4'-P energy: -20.100 bonds (distance) P-C4' energy: -26.387 flat angles C4'-P-C4' energy: -25.387 flat angles P-C4'-P energy: -17.539 tors. eta vs tors. theta energy: -23.179 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 141 Temperature: 1.200000 Total energy: -219.867691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.867691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.946765 (E_RNA) where: Base-Base interactions energy: -123.682 where: short stacking energy: -66.129 Base-Backbone interact. energy: -0.370 local terms energy: -95.895233 where: bonds (distance) C4'-P energy: -25.055 bonds (distance) P-C4' energy: -26.265 flat angles C4'-P-C4' energy: -23.109 flat angles P-C4'-P energy: -7.780 tors. eta vs tors. theta energy: -13.686 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 141 Temperature: 1.250000 Total energy: -223.701083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.701083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.840418 (E_RNA) where: Base-Base interactions energy: -141.154 where: short stacking energy: -68.275 Base-Backbone interact. energy: -1.042 local terms energy: -81.643913 where: bonds (distance) C4'-P energy: -19.400 bonds (distance) P-C4' energy: -19.144 flat angles C4'-P-C4' energy: -19.974 flat angles P-C4'-P energy: -13.258 tors. eta vs tors. theta energy: -9.868 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 141 Temperature: 1.300000 Total energy: -224.348874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.348874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.348874 (E_RNA) where: Base-Base interactions energy: -129.888 where: short stacking energy: -74.453 Base-Backbone interact. energy: 0.152 local terms energy: -94.613318 where: bonds (distance) C4'-P energy: -23.893 bonds (distance) P-C4' energy: -18.686 flat angles C4'-P-C4' energy: -21.467 flat angles P-C4'-P energy: -14.425 tors. eta vs tors. theta energy: -16.142 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 141 Temperature: 1.350000 Total energy: -186.539259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.539259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.905810 (E_RNA) where: Base-Base interactions energy: -107.331 where: short stacking energy: -55.134 Base-Backbone interact. energy: -0.272 local terms energy: -79.303284 where: bonds (distance) C4'-P energy: -22.410 bonds (distance) P-C4' energy: -27.090 flat angles C4'-P-C4' energy: -12.302 flat angles P-C4'-P energy: -8.629 tors. eta vs tors. theta energy: -8.872 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 142 Temperature: 0.900000 Total energy: -393.398531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.398531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.425109 (E_RNA) where: Base-Base interactions energy: -265.377 where: short stacking energy: -121.920 Base-Backbone interact. energy: -1.855 local terms energy: -126.193367 where: bonds (distance) C4'-P energy: -23.229 bonds (distance) P-C4' energy: -25.870 flat angles C4'-P-C4' energy: -27.987 flat angles P-C4'-P energy: -18.508 tors. eta vs tors. theta energy: -30.599 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 142 Temperature: 0.950000 Total energy: -385.202650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.202650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.216784 (E_RNA) where: Base-Base interactions energy: -262.024 where: short stacking energy: -119.751 Base-Backbone interact. energy: -1.072 local terms energy: -122.120598 where: bonds (distance) C4'-P energy: -21.465 bonds (distance) P-C4' energy: -27.154 flat angles C4'-P-C4' energy: -28.719 flat angles P-C4'-P energy: -12.894 tors. eta vs tors. theta energy: -31.888 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 142 Temperature: 1.000000 Total energy: -345.522991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.522991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.564015 (E_RNA) where: Base-Base interactions energy: -224.847 where: short stacking energy: -107.792 Base-Backbone interact. energy: -0.442 local terms energy: -120.275109 where: bonds (distance) C4'-P energy: -25.082 bonds (distance) P-C4' energy: -23.098 flat angles C4'-P-C4' energy: -24.897 flat angles P-C4'-P energy: -16.311 tors. eta vs tors. theta energy: -30.887 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 142 Temperature: 1.050000 Total energy: -342.990754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.990754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.997249 (E_RNA) where: Base-Base interactions energy: -225.057 where: short stacking energy: -112.708 Base-Backbone interact. energy: -2.788 local terms energy: -115.152577 where: bonds (distance) C4'-P energy: -20.817 bonds (distance) P-C4' energy: -22.121 flat angles C4'-P-C4' energy: -22.736 flat angles P-C4'-P energy: -20.248 tors. eta vs tors. theta energy: -29.231 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 142 Temperature: 1.100000 Total energy: -333.425482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.425482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.527366 (E_RNA) where: Base-Base interactions energy: -218.593 where: short stacking energy: -110.768 Base-Backbone interact. energy: -0.107 local terms energy: -114.828141 where: bonds (distance) C4'-P energy: -20.627 bonds (distance) P-C4' energy: -26.291 flat angles C4'-P-C4' energy: -20.589 flat angles P-C4'-P energy: -18.903 tors. eta vs tors. theta energy: -28.418 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 142 Temperature: 1.150000 Total energy: -281.140159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.140159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.153241 (E_RNA) where: Base-Base interactions energy: -179.371 where: short stacking energy: -93.666 Base-Backbone interact. energy: -0.958 local terms energy: -100.824043 where: bonds (distance) C4'-P energy: -17.439 bonds (distance) P-C4' energy: -24.418 flat angles C4'-P-C4' energy: -27.856 flat angles P-C4'-P energy: -12.655 tors. eta vs tors. theta energy: -18.456 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 142 Temperature: 1.200000 Total energy: -235.110365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.110365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.155930 (E_RNA) where: Base-Base interactions energy: -137.095 where: short stacking energy: -82.247 Base-Backbone interact. energy: 0.626 local terms energy: -98.687617 where: bonds (distance) C4'-P energy: -18.490 bonds (distance) P-C4' energy: -24.771 flat angles C4'-P-C4' energy: -22.955 flat angles P-C4'-P energy: -17.595 tors. eta vs tors. theta energy: -14.877 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 142 Temperature: 1.250000 Total energy: -208.415582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.415582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.497913 (E_RNA) where: Base-Base interactions energy: -117.289 where: short stacking energy: -70.038 Base-Backbone interact. energy: -0.325 local terms energy: -90.884298 where: bonds (distance) C4'-P energy: -20.795 bonds (distance) P-C4' energy: -21.304 flat angles C4'-P-C4' energy: -24.788 flat angles P-C4'-P energy: -10.403 tors. eta vs tors. theta energy: -13.594 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 142 Temperature: 1.300000 Total energy: -211.596964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.596964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.747234 (E_RNA) where: Base-Base interactions energy: -120.411 where: short stacking energy: -71.495 Base-Backbone interact. energy: -0.231 local terms energy: -91.104912 where: bonds (distance) C4'-P energy: -17.983 bonds (distance) P-C4' energy: -24.993 flat angles C4'-P-C4' energy: -18.235 flat angles P-C4'-P energy: -11.516 tors. eta vs tors. theta energy: -18.377 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 142 Temperature: 1.350000 Total energy: -214.031998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.031998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.077233 (E_RNA) where: Base-Base interactions energy: -121.130 where: short stacking energy: -63.136 Base-Backbone interact. energy: -0.063 local terms energy: -92.884517 where: bonds (distance) C4'-P energy: -25.161 bonds (distance) P-C4' energy: -15.922 flat angles C4'-P-C4' energy: -22.088 flat angles P-C4'-P energy: -17.428 tors. eta vs tors. theta energy: -12.284 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 143 Temperature: 0.900000 Total energy: -392.922583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.922583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.947842 (E_RNA) where: Base-Base interactions energy: -258.257 where: short stacking energy: -123.319 Base-Backbone interact. energy: -2.705 local terms energy: -131.985944 where: bonds (distance) C4'-P energy: -24.576 bonds (distance) P-C4' energy: -25.805 flat angles C4'-P-C4' energy: -27.251 flat angles P-C4'-P energy: -19.387 tors. eta vs tors. theta energy: -34.967 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 143 Temperature: 0.950000 Total energy: -347.094742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.094742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.175069 (E_RNA) where: Base-Base interactions energy: -234.705 where: short stacking energy: -108.527 Base-Backbone interact. energy: -0.263 local terms energy: -112.207223 where: bonds (distance) C4'-P energy: -21.525 bonds (distance) P-C4' energy: -27.254 flat angles C4'-P-C4' energy: -24.452 flat angles P-C4'-P energy: -11.189 tors. eta vs tors. theta energy: -27.786 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 143 Temperature: 1.000000 Total energy: -370.655969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.655969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.843499 (E_RNA) where: Base-Base interactions energy: -252.642 where: short stacking energy: -109.896 Base-Backbone interact. energy: -0.627 local terms energy: -117.574768 where: bonds (distance) C4'-P energy: -20.212 bonds (distance) P-C4' energy: -19.280 flat angles C4'-P-C4' energy: -28.175 flat angles P-C4'-P energy: -18.058 tors. eta vs tors. theta energy: -31.851 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 143 Temperature: 1.050000 Total energy: -343.183418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.183418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.330379 (E_RNA) where: Base-Base interactions energy: -229.334 where: short stacking energy: -108.100 Base-Backbone interact. energy: 0.417 local terms energy: -114.412909 where: bonds (distance) C4'-P energy: -27.582 bonds (distance) P-C4' energy: -20.448 flat angles C4'-P-C4' energy: -23.928 flat angles P-C4'-P energy: -12.435 tors. eta vs tors. theta energy: -30.020 Dist. restrs. and SS energy: 0.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 143 Temperature: 1.100000 Total energy: -316.982058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.982058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.069252 (E_RNA) where: Base-Base interactions energy: -208.096 where: short stacking energy: -100.320 Base-Backbone interact. energy: 0.063 local terms energy: -109.036359 where: bonds (distance) C4'-P energy: -17.555 bonds (distance) P-C4' energy: -25.433 flat angles C4'-P-C4' energy: -24.939 flat angles P-C4'-P energy: -18.565 tors. eta vs tors. theta energy: -22.545 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 143 Temperature: 1.150000 Total energy: -240.825380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.825380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.037737 (E_RNA) where: Base-Base interactions energy: -151.127 where: short stacking energy: -86.418 Base-Backbone interact. energy: -0.141 local terms energy: -89.769998 where: bonds (distance) C4'-P energy: -21.405 bonds (distance) P-C4' energy: -20.659 flat angles C4'-P-C4' energy: -17.041 flat angles P-C4'-P energy: -14.024 tors. eta vs tors. theta energy: -16.640 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 143 Temperature: 1.200000 Total energy: -230.310779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.310779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.394946 (E_RNA) where: Base-Base interactions energy: -142.757 where: short stacking energy: -76.211 Base-Backbone interact. energy: -1.306 local terms energy: -86.331688 where: bonds (distance) C4'-P energy: -15.671 bonds (distance) P-C4' energy: -24.328 flat angles C4'-P-C4' energy: -22.310 flat angles P-C4'-P energy: -10.571 tors. eta vs tors. theta energy: -13.451 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 143 Temperature: 1.250000 Total energy: -217.560548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.560548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.664311 (E_RNA) where: Base-Base interactions energy: -125.168 where: short stacking energy: -73.110 Base-Backbone interact. energy: 0.127 local terms energy: -92.623163 where: bonds (distance) C4'-P energy: -19.282 bonds (distance) P-C4' energy: -25.068 flat angles C4'-P-C4' energy: -15.859 flat angles P-C4'-P energy: -11.930 tors. eta vs tors. theta energy: -20.484 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 143 Temperature: 1.300000 Total energy: -202.011179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.011179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.011179 (E_RNA) where: Base-Base interactions energy: -122.256 where: short stacking energy: -63.229 Base-Backbone interact. energy: -0.542 local terms energy: -79.212526 where: bonds (distance) C4'-P energy: -14.544 bonds (distance) P-C4' energy: -23.975 flat angles C4'-P-C4' energy: -15.538 flat angles P-C4'-P energy: -15.354 tors. eta vs tors. theta energy: -9.801 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 143 Temperature: 1.350000 Total energy: -202.366152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.366152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.751531 (E_RNA) where: Base-Base interactions energy: -122.365 where: short stacking energy: -72.643 Base-Backbone interact. energy: -0.283 local terms energy: -80.103426 where: bonds (distance) C4'-P energy: -16.310 bonds (distance) P-C4' energy: -15.898 flat angles C4'-P-C4' energy: -19.164 flat angles P-C4'-P energy: -15.641 tors. eta vs tors. theta energy: -13.091 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 144 Temperature: 0.900000 Total energy: -352.627125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.627125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.627125 (E_RNA) where: Base-Base interactions energy: -229.425 where: short stacking energy: -111.470 Base-Backbone interact. energy: -0.607 local terms energy: -122.595040 where: bonds (distance) C4'-P energy: -23.578 bonds (distance) P-C4' energy: -24.533 flat angles C4'-P-C4' energy: -26.347 flat angles P-C4'-P energy: -18.681 tors. eta vs tors. theta energy: -29.456 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 144 Temperature: 0.950000 Total energy: -375.164312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.164312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.174301 (E_RNA) where: Base-Base interactions energy: -246.414 where: short stacking energy: -112.576 Base-Backbone interact. energy: -0.195 local terms energy: -128.565057 where: bonds (distance) C4'-P energy: -23.061 bonds (distance) P-C4' energy: -25.386 flat angles C4'-P-C4' energy: -29.306 flat angles P-C4'-P energy: -18.429 tors. eta vs tors. theta energy: -32.384 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 144 Temperature: 1.000000 Total energy: -354.502011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.502011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.507143 (E_RNA) where: Base-Base interactions energy: -236.700 where: short stacking energy: -110.803 Base-Backbone interact. energy: 1.070 local terms energy: -118.876647 where: bonds (distance) C4'-P energy: -24.782 bonds (distance) P-C4' energy: -21.631 flat angles C4'-P-C4' energy: -24.416 flat angles P-C4'-P energy: -17.249 tors. eta vs tors. theta energy: -30.798 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 144 Temperature: 1.050000 Total energy: -339.294176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.294176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.334447 (E_RNA) where: Base-Base interactions energy: -232.440 where: short stacking energy: -104.850 Base-Backbone interact. energy: -4.091 local terms energy: -102.803109 where: bonds (distance) C4'-P energy: -22.951 bonds (distance) P-C4' energy: -19.470 flat angles C4'-P-C4' energy: -25.635 flat angles P-C4'-P energy: -12.791 tors. eta vs tors. theta energy: -21.957 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 144 Temperature: 1.100000 Total energy: -340.078433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.078433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.146353 (E_RNA) where: Base-Base interactions energy: -220.808 where: short stacking energy: -99.747 Base-Backbone interact. energy: -1.633 local terms energy: -117.705128 where: bonds (distance) C4'-P energy: -24.108 bonds (distance) P-C4' energy: -26.648 flat angles C4'-P-C4' energy: -23.659 flat angles P-C4'-P energy: -18.449 tors. eta vs tors. theta energy: -24.840 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 144 Temperature: 1.150000 Total energy: -241.109308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.109308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.160993 (E_RNA) where: Base-Base interactions energy: -142.789 where: short stacking energy: -73.321 Base-Backbone interact. energy: -1.206 local terms energy: -97.166601 where: bonds (distance) C4'-P energy: -25.018 bonds (distance) P-C4' energy: -17.997 flat angles C4'-P-C4' energy: -24.169 flat angles P-C4'-P energy: -19.862 tors. eta vs tors. theta energy: -10.119 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 144 Temperature: 1.200000 Total energy: -232.783868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.783868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.889948 (E_RNA) where: Base-Base interactions energy: -139.625 where: short stacking energy: -76.758 Base-Backbone interact. energy: -1.295 local terms energy: -91.970630 where: bonds (distance) C4'-P energy: -15.698 bonds (distance) P-C4' energy: -26.254 flat angles C4'-P-C4' energy: -21.186 flat angles P-C4'-P energy: -10.986 tors. eta vs tors. theta energy: -17.846 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 144 Temperature: 1.250000 Total energy: -209.675474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.675474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.677708 (E_RNA) where: Base-Base interactions energy: -122.799 where: short stacking energy: -61.725 Base-Backbone interact. energy: -1.102 local terms energy: -85.776936 where: bonds (distance) C4'-P energy: -16.930 bonds (distance) P-C4' energy: -27.376 flat angles C4'-P-C4' energy: -14.240 flat angles P-C4'-P energy: -14.369 tors. eta vs tors. theta energy: -12.862 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 144 Temperature: 1.300000 Total energy: -214.647791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.647791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.667248 (E_RNA) where: Base-Base interactions energy: -139.132 where: short stacking energy: -69.770 Base-Backbone interact. energy: 2.074 local terms energy: -77.608793 where: bonds (distance) C4'-P energy: -16.125 bonds (distance) P-C4' energy: -22.171 flat angles C4'-P-C4' energy: -18.128 flat angles P-C4'-P energy: -9.884 tors. eta vs tors. theta energy: -11.300 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 144 Temperature: 1.350000 Total energy: -218.005642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.005642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.066345 (E_RNA) where: Base-Base interactions energy: -130.887 where: short stacking energy: -75.277 Base-Backbone interact. energy: -0.936 local terms energy: -86.243727 where: bonds (distance) C4'-P energy: -20.810 bonds (distance) P-C4' energy: -22.858 flat angles C4'-P-C4' energy: -19.281 flat angles P-C4'-P energy: -13.554 tors. eta vs tors. theta energy: -9.740 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 145 Temperature: 0.900000 Total energy: -354.630763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.630763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.664446 (E_RNA) where: Base-Base interactions energy: -235.486 where: short stacking energy: -118.349 Base-Backbone interact. energy: -0.117 local terms energy: -119.060660 where: bonds (distance) C4'-P energy: -19.772 bonds (distance) P-C4' energy: -27.808 flat angles C4'-P-C4' energy: -27.692 flat angles P-C4'-P energy: -16.486 tors. eta vs tors. theta energy: -27.302 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 145 Temperature: 0.950000 Total energy: -376.122276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.122276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.145911 (E_RNA) where: Base-Base interactions energy: -249.795 where: short stacking energy: -110.740 Base-Backbone interact. energy: -1.656 local terms energy: -124.694471 where: bonds (distance) C4'-P energy: -21.368 bonds (distance) P-C4' energy: -26.772 flat angles C4'-P-C4' energy: -26.758 flat angles P-C4'-P energy: -18.520 tors. eta vs tors. theta energy: -31.276 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 145 Temperature: 1.000000 Total energy: -371.137294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.137294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.439749 (E_RNA) where: Base-Base interactions energy: -244.250 where: short stacking energy: -117.168 Base-Backbone interact. energy: -0.750 local terms energy: -126.439396 where: bonds (distance) C4'-P energy: -23.335 bonds (distance) P-C4' energy: -21.098 flat angles C4'-P-C4' energy: -27.970 flat angles P-C4'-P energy: -17.468 tors. eta vs tors. theta energy: -36.568 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 145 Temperature: 1.050000 Total energy: -336.221514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.221514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.622208 (E_RNA) where: Base-Base interactions energy: -232.672 where: short stacking energy: -114.213 Base-Backbone interact. energy: -0.178 local terms energy: -103.771365 where: bonds (distance) C4'-P energy: -16.963 bonds (distance) P-C4' energy: -21.875 flat angles C4'-P-C4' energy: -24.273 flat angles P-C4'-P energy: -15.605 tors. eta vs tors. theta energy: -25.056 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 145 Temperature: 1.100000 Total energy: -341.386742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.386742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.532190 (E_RNA) where: Base-Base interactions energy: -226.485 where: short stacking energy: -105.246 Base-Backbone interact. energy: -0.162 local terms energy: -114.885626 where: bonds (distance) C4'-P energy: -26.127 bonds (distance) P-C4' energy: -24.076 flat angles C4'-P-C4' energy: -23.736 flat angles P-C4'-P energy: -17.770 tors. eta vs tors. theta energy: -23.177 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 145 Temperature: 1.150000 Total energy: -250.730389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.730389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.766558 (E_RNA) where: Base-Base interactions energy: -149.846 where: short stacking energy: -86.848 Base-Backbone interact. energy: -1.339 local terms energy: -99.582287 where: bonds (distance) C4'-P energy: -19.973 bonds (distance) P-C4' energy: -22.489 flat angles C4'-P-C4' energy: -23.115 flat angles P-C4'-P energy: -19.288 tors. eta vs tors. theta energy: -14.717 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 145 Temperature: 1.200000 Total energy: -223.794178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.794178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.810274 (E_RNA) where: Base-Base interactions energy: -135.439 where: short stacking energy: -70.581 Base-Backbone interact. energy: -0.490 local terms energy: -87.881876 where: bonds (distance) C4'-P energy: -23.190 bonds (distance) P-C4' energy: -14.518 flat angles C4'-P-C4' energy: -24.673 flat angles P-C4'-P energy: -13.134 tors. eta vs tors. theta energy: -12.366 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 145 Temperature: 1.250000 Total energy: -206.322358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.322358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.432919 (E_RNA) where: Base-Base interactions energy: -111.390 where: short stacking energy: -63.125 Base-Backbone interact. energy: -0.078 local terms energy: -94.964435 where: bonds (distance) C4'-P energy: -24.683 bonds (distance) P-C4' energy: -29.299 flat angles C4'-P-C4' energy: -22.771 flat angles P-C4'-P energy: -10.344 tors. eta vs tors. theta energy: -7.867 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 145 Temperature: 1.300000 Total energy: -221.003077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.003077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.003077 (E_RNA) where: Base-Base interactions energy: -125.118 where: short stacking energy: -68.470 Base-Backbone interact. energy: -0.262 local terms energy: -95.623588 where: bonds (distance) C4'-P energy: -23.582 bonds (distance) P-C4' energy: -20.752 flat angles C4'-P-C4' energy: -23.289 flat angles P-C4'-P energy: -12.420 tors. eta vs tors. theta energy: -15.581 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 145 Temperature: 1.350000 Total energy: -207.350264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.350264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.483017 (E_RNA) where: Base-Base interactions energy: -114.761 where: short stacking energy: -62.611 Base-Backbone interact. energy: 0.052 local terms energy: -92.773959 where: bonds (distance) C4'-P energy: -24.256 bonds (distance) P-C4' energy: -24.043 flat angles C4'-P-C4' energy: -20.116 flat angles P-C4'-P energy: -15.632 tors. eta vs tors. theta energy: -8.727 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 146 Temperature: 0.900000 Total energy: -387.884802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.884802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.884802 (E_RNA) where: Base-Base interactions energy: -255.238 where: short stacking energy: -115.496 Base-Backbone interact. energy: -1.005 local terms energy: -131.641292 where: bonds (distance) C4'-P energy: -26.818 bonds (distance) P-C4' energy: -23.892 flat angles C4'-P-C4' energy: -24.436 flat angles P-C4'-P energy: -22.503 tors. eta vs tors. theta energy: -33.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 146 Temperature: 0.950000 Total energy: -344.985601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.985601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.156218 (E_RNA) where: Base-Base interactions energy: -222.576 where: short stacking energy: -111.367 Base-Backbone interact. energy: -0.276 local terms energy: -122.304145 where: bonds (distance) C4'-P energy: -23.986 bonds (distance) P-C4' energy: -22.958 flat angles C4'-P-C4' energy: -24.926 flat angles P-C4'-P energy: -17.576 tors. eta vs tors. theta energy: -32.857 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 146 Temperature: 1.000000 Total energy: -349.262444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.262444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.305087 (E_RNA) where: Base-Base interactions energy: -238.276 where: short stacking energy: -118.589 Base-Backbone interact. energy: -0.994 local terms energy: -110.035535 where: bonds (distance) C4'-P energy: -18.862 bonds (distance) P-C4' energy: -22.956 flat angles C4'-P-C4' energy: -26.380 flat angles P-C4'-P energy: -9.746 tors. eta vs tors. theta energy: -32.091 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 146 Temperature: 1.050000 Total energy: -358.247894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.247894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.283748 (E_RNA) where: Base-Base interactions energy: -236.429 where: short stacking energy: -113.627 Base-Backbone interact. energy: -1.674 local terms energy: -120.180409 where: bonds (distance) C4'-P energy: -19.699 bonds (distance) P-C4' energy: -27.272 flat angles C4'-P-C4' energy: -28.044 flat angles P-C4'-P energy: -14.073 tors. eta vs tors. theta energy: -31.093 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 146 Temperature: 1.100000 Total energy: -323.811418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.811418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.895441 (E_RNA) where: Base-Base interactions energy: -218.820 where: short stacking energy: -111.846 Base-Backbone interact. energy: -0.184 local terms energy: -104.891751 where: bonds (distance) C4'-P energy: -21.925 bonds (distance) P-C4' energy: -15.507 flat angles C4'-P-C4' energy: -23.251 flat angles P-C4'-P energy: -16.168 tors. eta vs tors. theta energy: -28.041 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 146 Temperature: 1.150000 Total energy: -240.673538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.673538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.706552 (E_RNA) where: Base-Base interactions energy: -140.193 where: short stacking energy: -84.059 Base-Backbone interact. energy: -0.080 local terms energy: -100.433797 where: bonds (distance) C4'-P energy: -25.800 bonds (distance) P-C4' energy: -17.188 flat angles C4'-P-C4' energy: -23.180 flat angles P-C4'-P energy: -15.381 tors. eta vs tors. theta energy: -18.884 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 146 Temperature: 1.200000 Total energy: -222.202423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.202423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.425968 (E_RNA) where: Base-Base interactions energy: -124.088 where: short stacking energy: -74.021 Base-Backbone interact. energy: 1.885 local terms energy: -100.223878 where: bonds (distance) C4'-P energy: -26.274 bonds (distance) P-C4' energy: -27.838 flat angles C4'-P-C4' energy: -19.759 flat angles P-C4'-P energy: -12.951 tors. eta vs tors. theta energy: -13.403 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 146 Temperature: 1.250000 Total energy: -209.163233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.163233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.179123 (E_RNA) where: Base-Base interactions energy: -130.717 where: short stacking energy: -65.472 Base-Backbone interact. energy: -0.534 local terms energy: -77.928201 where: bonds (distance) C4'-P energy: -15.765 bonds (distance) P-C4' energy: -22.736 flat angles C4'-P-C4' energy: -16.456 flat angles P-C4'-P energy: -11.902 tors. eta vs tors. theta energy: -11.069 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 146 Temperature: 1.300000 Total energy: -210.350659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.350659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.350659 (E_RNA) where: Base-Base interactions energy: -121.536 where: short stacking energy: -66.094 Base-Backbone interact. energy: -0.008 local terms energy: -88.807493 where: bonds (distance) C4'-P energy: -20.900 bonds (distance) P-C4' energy: -21.889 flat angles C4'-P-C4' energy: -21.599 flat angles P-C4'-P energy: -9.617 tors. eta vs tors. theta energy: -14.802 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 146 Temperature: 1.350000 Total energy: -201.450121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.450121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.830783 (E_RNA) where: Base-Base interactions energy: -118.786 where: short stacking energy: -64.850 Base-Backbone interact. energy: -0.199 local terms energy: -82.845908 where: bonds (distance) C4'-P energy: -20.219 bonds (distance) P-C4' energy: -19.550 flat angles C4'-P-C4' energy: -23.089 flat angles P-C4'-P energy: -8.143 tors. eta vs tors. theta energy: -11.845 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 147 Temperature: 0.900000 Total energy: -388.506259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.506259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.606587 (E_RNA) where: Base-Base interactions energy: -260.244 where: short stacking energy: -117.349 Base-Backbone interact. energy: -0.819 local terms energy: -127.542745 where: bonds (distance) C4'-P energy: -26.996 bonds (distance) P-C4' energy: -27.244 flat angles C4'-P-C4' energy: -26.275 flat angles P-C4'-P energy: -15.496 tors. eta vs tors. theta energy: -31.531 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 147 Temperature: 0.950000 Total energy: -353.895457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.895457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.895457 (E_RNA) where: Base-Base interactions energy: -230.832 where: short stacking energy: -115.590 Base-Backbone interact. energy: -0.590 local terms energy: -122.473966 where: bonds (distance) C4'-P energy: -20.074 bonds (distance) P-C4' energy: -22.988 flat angles C4'-P-C4' energy: -27.997 flat angles P-C4'-P energy: -23.091 tors. eta vs tors. theta energy: -28.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 147 Temperature: 1.000000 Total energy: -328.552870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.552870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.682063 (E_RNA) where: Base-Base interactions energy: -210.948 where: short stacking energy: -107.646 Base-Backbone interact. energy: -0.271 local terms energy: -117.463865 where: bonds (distance) C4'-P energy: -21.289 bonds (distance) P-C4' energy: -27.219 flat angles C4'-P-C4' energy: -26.787 flat angles P-C4'-P energy: -14.461 tors. eta vs tors. theta energy: -27.709 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 147 Temperature: 1.050000 Total energy: -345.564649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.564649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.585568 (E_RNA) where: Base-Base interactions energy: -232.532 where: short stacking energy: -105.457 Base-Backbone interact. energy: -2.809 local terms energy: -110.244498 where: bonds (distance) C4'-P energy: -21.744 bonds (distance) P-C4' energy: -19.285 flat angles C4'-P-C4' energy: -25.554 flat angles P-C4'-P energy: -17.387 tors. eta vs tors. theta energy: -26.276 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 147 Temperature: 1.100000 Total energy: -335.713455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.713455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.806209 (E_RNA) where: Base-Base interactions energy: -233.046 where: short stacking energy: -116.835 Base-Backbone interact. energy: -0.080 local terms energy: -102.680266 where: bonds (distance) C4'-P energy: -16.523 bonds (distance) P-C4' energy: -19.942 flat angles C4'-P-C4' energy: -23.210 flat angles P-C4'-P energy: -15.404 tors. eta vs tors. theta energy: -27.602 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 147 Temperature: 1.150000 Total energy: -231.320643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.320643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.353142 (E_RNA) where: Base-Base interactions energy: -140.986 where: short stacking energy: -77.559 Base-Backbone interact. energy: -0.058 local terms energy: -90.308457 where: bonds (distance) C4'-P energy: -15.521 bonds (distance) P-C4' energy: -21.864 flat angles C4'-P-C4' energy: -25.467 flat angles P-C4'-P energy: -16.896 tors. eta vs tors. theta energy: -10.561 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 147 Temperature: 1.200000 Total energy: -238.767336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.767336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.988398 (E_RNA) where: Base-Base interactions energy: -140.143 where: short stacking energy: -88.125 Base-Backbone interact. energy: -0.318 local terms energy: -98.527245 where: bonds (distance) C4'-P energy: -18.592 bonds (distance) P-C4' energy: -23.109 flat angles C4'-P-C4' energy: -20.862 flat angles P-C4'-P energy: -10.502 tors. eta vs tors. theta energy: -25.462 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 147 Temperature: 1.250000 Total energy: -237.765870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.765870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.941290 (E_RNA) where: Base-Base interactions energy: -132.331 where: short stacking energy: -78.144 Base-Backbone interact. energy: -1.080 local terms energy: -104.529778 where: bonds (distance) C4'-P energy: -19.324 bonds (distance) P-C4' energy: -22.079 flat angles C4'-P-C4' energy: -23.504 flat angles P-C4'-P energy: -21.757 tors. eta vs tors. theta energy: -17.866 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 147 Temperature: 1.300000 Total energy: -199.109950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.109950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.109950 (E_RNA) where: Base-Base interactions energy: -110.674 where: short stacking energy: -59.093 Base-Backbone interact. energy: 0.047 local terms energy: -88.482303 where: bonds (distance) C4'-P energy: -21.417 bonds (distance) P-C4' energy: -24.387 flat angles C4'-P-C4' energy: -18.735 flat angles P-C4'-P energy: -14.446 tors. eta vs tors. theta energy: -9.498 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 147 Temperature: 1.350000 Total energy: -208.545163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.545163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.550489 (E_RNA) where: Base-Base interactions energy: -117.880 where: short stacking energy: -62.842 Base-Backbone interact. energy: -0.105 local terms energy: -90.565844 where: bonds (distance) C4'-P energy: -22.211 bonds (distance) P-C4' energy: -13.733 flat angles C4'-P-C4' energy: -25.704 flat angles P-C4'-P energy: -16.807 tors. eta vs tors. theta energy: -12.111 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 148 Temperature: 0.900000 Total energy: -388.595638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.595638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.612913 (E_RNA) where: Base-Base interactions energy: -263.925 where: short stacking energy: -120.403 Base-Backbone interact. energy: -2.392 local terms energy: -122.295785 where: bonds (distance) C4'-P energy: -25.158 bonds (distance) P-C4' energy: -26.570 flat angles C4'-P-C4' energy: -22.953 flat angles P-C4'-P energy: -16.905 tors. eta vs tors. theta energy: -30.711 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 148 Temperature: 0.950000 Total energy: -359.120129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.120129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.174371 (E_RNA) where: Base-Base interactions energy: -238.096 where: short stacking energy: -117.336 Base-Backbone interact. energy: -0.031 local terms energy: -121.046887 where: bonds (distance) C4'-P energy: -22.777 bonds (distance) P-C4' energy: -25.748 flat angles C4'-P-C4' energy: -26.975 flat angles P-C4'-P energy: -15.600 tors. eta vs tors. theta energy: -29.947 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 148 Temperature: 1.000000 Total energy: -353.582001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.582001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.736188 (E_RNA) where: Base-Base interactions energy: -241.393 where: short stacking energy: -106.635 Base-Backbone interact. energy: -0.579 local terms energy: -111.763563 where: bonds (distance) C4'-P energy: -23.387 bonds (distance) P-C4' energy: -23.819 flat angles C4'-P-C4' energy: -19.390 flat angles P-C4'-P energy: -15.603 tors. eta vs tors. theta energy: -29.565 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 148 Temperature: 1.050000 Total energy: -322.100977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.100977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.148441 (E_RNA) where: Base-Base interactions energy: -215.205 where: short stacking energy: -106.395 Base-Backbone interact. energy: -0.786 local terms energy: -106.158012 where: bonds (distance) C4'-P energy: -26.429 bonds (distance) P-C4' energy: -18.614 flat angles C4'-P-C4' energy: -25.207 flat angles P-C4'-P energy: -12.974 tors. eta vs tors. theta energy: -22.935 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 148 Temperature: 1.100000 Total energy: -328.508053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.508053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.822242 (E_RNA) where: Base-Base interactions energy: -222.719 where: short stacking energy: -104.572 Base-Backbone interact. energy: -0.310 local terms energy: -105.793815 where: bonds (distance) C4'-P energy: -15.501 bonds (distance) P-C4' energy: -21.206 flat angles C4'-P-C4' energy: -25.616 flat angles P-C4'-P energy: -17.930 tors. eta vs tors. theta energy: -25.541 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 148 Temperature: 1.150000 Total energy: -228.555294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.555294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.584896 (E_RNA) where: Base-Base interactions energy: -129.704 where: short stacking energy: -73.897 Base-Backbone interact. energy: 1.101 local terms energy: -99.982584 where: bonds (distance) C4'-P energy: -23.288 bonds (distance) P-C4' energy: -25.683 flat angles C4'-P-C4' energy: -20.938 flat angles P-C4'-P energy: -17.218 tors. eta vs tors. theta energy: -12.857 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 148 Temperature: 1.200000 Total energy: -219.967484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.967484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.967484 (E_RNA) where: Base-Base interactions energy: -123.769 where: short stacking energy: -68.951 Base-Backbone interact. energy: -0.469 local terms energy: -95.729494 where: bonds (distance) C4'-P energy: -21.767 bonds (distance) P-C4' energy: -23.937 flat angles C4'-P-C4' energy: -27.195 flat angles P-C4'-P energy: -12.103 tors. eta vs tors. theta energy: -10.728 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 148 Temperature: 1.250000 Total energy: -222.202117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.202117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.365776 (E_RNA) where: Base-Base interactions energy: -131.296 where: short stacking energy: -62.364 Base-Backbone interact. energy: -1.286 local terms energy: -89.783652 where: bonds (distance) C4'-P energy: -20.116 bonds (distance) P-C4' energy: -23.104 flat angles C4'-P-C4' energy: -18.288 flat angles P-C4'-P energy: -11.866 tors. eta vs tors. theta energy: -16.410 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 148 Temperature: 1.300000 Total energy: -205.604464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.604464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.707057 (E_RNA) where: Base-Base interactions energy: -120.359 where: short stacking energy: -57.117 Base-Backbone interact. energy: -0.700 local terms energy: -84.648303 where: bonds (distance) C4'-P energy: -25.912 bonds (distance) P-C4' energy: -15.799 flat angles C4'-P-C4' energy: -19.489 flat angles P-C4'-P energy: -14.971 tors. eta vs tors. theta energy: -8.477 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 148 Temperature: 1.350000 Total energy: -190.871450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.871450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.991186 (E_RNA) where: Base-Base interactions energy: -103.468 where: short stacking energy: -60.585 Base-Backbone interact. energy: -1.101 local terms energy: -86.422568 where: bonds (distance) C4'-P energy: -13.153 bonds (distance) P-C4' energy: -20.990 flat angles C4'-P-C4' energy: -22.892 flat angles P-C4'-P energy: -17.651 tors. eta vs tors. theta energy: -11.737 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 149 Temperature: 0.900000 Total energy: -392.367998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.367998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.412885 (E_RNA) where: Base-Base interactions energy: -262.182 where: short stacking energy: -120.522 Base-Backbone interact. energy: -1.156 local terms energy: -129.074072 where: bonds (distance) C4'-P energy: -27.556 bonds (distance) P-C4' energy: -22.856 flat angles C4'-P-C4' energy: -29.828 flat angles P-C4'-P energy: -14.559 tors. eta vs tors. theta energy: -34.275 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 149 Temperature: 0.950000 Total energy: -358.578611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.578611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.716995 (E_RNA) where: Base-Base interactions energy: -235.176 where: short stacking energy: -113.192 Base-Backbone interact. energy: -1.631 local terms energy: -121.909140 where: bonds (distance) C4'-P energy: -21.562 bonds (distance) P-C4' energy: -25.512 flat angles C4'-P-C4' energy: -27.887 flat angles P-C4'-P energy: -15.695 tors. eta vs tors. theta energy: -31.253 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 149 Temperature: 1.000000 Total energy: -343.695682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.695682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.707003 (E_RNA) where: Base-Base interactions energy: -225.821 where: short stacking energy: -112.121 Base-Backbone interact. energy: -0.114 local terms energy: -117.772223 where: bonds (distance) C4'-P energy: -21.293 bonds (distance) P-C4' energy: -24.508 flat angles C4'-P-C4' energy: -23.505 flat angles P-C4'-P energy: -16.087 tors. eta vs tors. theta energy: -32.379 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 149 Temperature: 1.050000 Total energy: -321.337356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.337356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.337356 (E_RNA) where: Base-Base interactions energy: -208.717 where: short stacking energy: -102.994 Base-Backbone interact. energy: -1.586 local terms energy: -111.035029 where: bonds (distance) C4'-P energy: -22.928 bonds (distance) P-C4' energy: -24.754 flat angles C4'-P-C4' energy: -24.791 flat angles P-C4'-P energy: -12.072 tors. eta vs tors. theta energy: -26.491 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 149 Temperature: 1.100000 Total energy: -340.589923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.589923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.889654 (E_RNA) where: Base-Base interactions energy: -227.108 where: short stacking energy: -119.522 Base-Backbone interact. energy: -1.517 local terms energy: -112.264532 where: bonds (distance) C4'-P energy: -17.805 bonds (distance) P-C4' energy: -18.966 flat angles C4'-P-C4' energy: -28.538 flat angles P-C4'-P energy: -16.204 tors. eta vs tors. theta energy: -30.751 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 149 Temperature: 1.150000 Total energy: -244.989911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.989911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.997436 (E_RNA) where: Base-Base interactions energy: -148.604 where: short stacking energy: -72.624 Base-Backbone interact. energy: -1.655 local terms energy: -94.737553 where: bonds (distance) C4'-P energy: -25.558 bonds (distance) P-C4' energy: -14.175 flat angles C4'-P-C4' energy: -22.559 flat angles P-C4'-P energy: -17.747 tors. eta vs tors. theta energy: -14.699 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 149 Temperature: 1.200000 Total energy: -226.703941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.703941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.815571 (E_RNA) where: Base-Base interactions energy: -141.245 where: short stacking energy: -74.514 Base-Backbone interact. energy: -1.428 local terms energy: -84.142930 where: bonds (distance) C4'-P energy: -18.867 bonds (distance) P-C4' energy: -17.154 flat angles C4'-P-C4' energy: -24.521 flat angles P-C4'-P energy: -14.141 tors. eta vs tors. theta energy: -9.459 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 149 Temperature: 1.250000 Total energy: -209.402000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.402000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.444225 (E_RNA) where: Base-Base interactions energy: -119.658 where: short stacking energy: -64.159 Base-Backbone interact. energy: -0.486 local terms energy: -89.300879 where: bonds (distance) C4'-P energy: -22.579 bonds (distance) P-C4' energy: -26.054 flat angles C4'-P-C4' energy: -22.047 flat angles P-C4'-P energy: -9.897 tors. eta vs tors. theta energy: -8.724 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 149 Temperature: 1.300000 Total energy: -215.162172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.162172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.189521 (E_RNA) where: Base-Base interactions energy: -129.604 where: short stacking energy: -61.164 Base-Backbone interact. energy: 0.198 local terms energy: -85.783772 where: bonds (distance) C4'-P energy: -23.513 bonds (distance) P-C4' energy: -20.946 flat angles C4'-P-C4' energy: -17.464 flat angles P-C4'-P energy: -13.901 tors. eta vs tors. theta energy: -9.960 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 149 Temperature: 1.350000 Total energy: -196.935862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.935862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.944031 (E_RNA) where: Base-Base interactions energy: -131.248 where: short stacking energy: -71.454 Base-Backbone interact. energy: -0.396 local terms energy: -65.299975 where: bonds (distance) C4'-P energy: -16.910 bonds (distance) P-C4' energy: -17.939 flat angles C4'-P-C4' energy: -11.286 flat angles P-C4'-P energy: -8.174 tors. eta vs tors. theta energy: -10.991 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 150 Temperature: 0.900000 Total energy: -386.953969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.953969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.989363 (E_RNA) where: Base-Base interactions energy: -264.095 where: short stacking energy: -116.749 Base-Backbone interact. energy: -3.798 local terms energy: -119.097134 where: bonds (distance) C4'-P energy: -19.606 bonds (distance) P-C4' energy: -27.265 flat angles C4'-P-C4' energy: -23.724 flat angles P-C4'-P energy: -17.223 tors. eta vs tors. theta energy: -31.279 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 150 Temperature: 0.950000 Total energy: -348.739938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.739938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.848424 (E_RNA) where: Base-Base interactions energy: -222.873 where: short stacking energy: -104.994 Base-Backbone interact. energy: -0.749 local terms energy: -125.227143 where: bonds (distance) C4'-P energy: -23.313 bonds (distance) P-C4' energy: -29.439 flat angles C4'-P-C4' energy: -27.582 flat angles P-C4'-P energy: -15.590 tors. eta vs tors. theta energy: -29.303 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 150 Temperature: 1.000000 Total energy: -349.547722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.547722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.547722 (E_RNA) where: Base-Base interactions energy: -227.792 where: short stacking energy: -110.584 Base-Backbone interact. energy: -0.670 local terms energy: -121.086556 where: bonds (distance) C4'-P energy: -21.975 bonds (distance) P-C4' energy: -24.087 flat angles C4'-P-C4' energy: -24.006 flat angles P-C4'-P energy: -17.951 tors. eta vs tors. theta energy: -33.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 150 Temperature: 1.050000 Total energy: -326.308872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.308872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.332207 (E_RNA) where: Base-Base interactions energy: -216.112 where: short stacking energy: -107.394 Base-Backbone interact. energy: -0.310 local terms energy: -109.909551 where: bonds (distance) C4'-P energy: -20.200 bonds (distance) P-C4' energy: -27.214 flat angles C4'-P-C4' energy: -23.439 flat angles P-C4'-P energy: -12.023 tors. eta vs tors. theta energy: -27.034 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 150 Temperature: 1.100000 Total energy: -322.435284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.435284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.435403 (E_RNA) where: Base-Base interactions energy: -214.222 where: short stacking energy: -101.709 Base-Backbone interact. energy: -0.599 local terms energy: -107.614341 where: bonds (distance) C4'-P energy: -22.655 bonds (distance) P-C4' energy: -25.086 flat angles C4'-P-C4' energy: -19.791 flat angles P-C4'-P energy: -12.453 tors. eta vs tors. theta energy: -27.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 150 Temperature: 1.150000 Total energy: -235.631508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.631508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.631508 (E_RNA) where: Base-Base interactions energy: -135.507 where: short stacking energy: -83.788 Base-Backbone interact. energy: -0.281 local terms energy: -99.844062 where: bonds (distance) C4'-P energy: -21.322 bonds (distance) P-C4' energy: -23.430 flat angles C4'-P-C4' energy: -23.111 flat angles P-C4'-P energy: -17.327 tors. eta vs tors. theta energy: -14.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 150 Temperature: 1.200000 Total energy: -237.581263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.581263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.008496 (E_RNA) where: Base-Base interactions energy: -146.203 where: short stacking energy: -83.292 Base-Backbone interact. energy: -0.262 local terms energy: -91.543995 where: bonds (distance) C4'-P energy: -19.715 bonds (distance) P-C4' energy: -20.851 flat angles C4'-P-C4' energy: -17.877 flat angles P-C4'-P energy: -15.572 tors. eta vs tors. theta energy: -17.529 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 150 Temperature: 1.250000 Total energy: -227.281276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.281276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.368149 (E_RNA) where: Base-Base interactions energy: -133.792 where: short stacking energy: -77.676 Base-Backbone interact. energy: -0.189 local terms energy: -93.387476 where: bonds (distance) C4'-P energy: -19.395 bonds (distance) P-C4' energy: -24.048 flat angles C4'-P-C4' energy: -17.472 flat angles P-C4'-P energy: -15.754 tors. eta vs tors. theta energy: -16.719 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 150 Temperature: 1.300000 Total energy: -211.886277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.886277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.940320 (E_RNA) where: Base-Base interactions energy: -132.512 where: short stacking energy: -71.783 Base-Backbone interact. energy: -0.275 local terms energy: -79.153478 where: bonds (distance) C4'-P energy: -16.349 bonds (distance) P-C4' energy: -20.373 flat angles C4'-P-C4' energy: -21.886 flat angles P-C4'-P energy: -7.364 tors. eta vs tors. theta energy: -13.180 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 150 Temperature: 1.350000 Total energy: -204.782937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.782937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.831383 (E_RNA) where: Base-Base interactions energy: -118.102 where: short stacking energy: -59.391 Base-Backbone interact. energy: 0.504 local terms energy: -87.232872 where: bonds (distance) C4'-P energy: -21.855 bonds (distance) P-C4' energy: -19.871 flat angles C4'-P-C4' energy: -19.750 flat angles P-C4'-P energy: -14.397 tors. eta vs tors. theta energy: -11.359 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 151 Temperature: 0.900000 Total energy: -387.468328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.468328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.474888 (E_RNA) where: Base-Base interactions energy: -260.680 where: short stacking energy: -118.804 Base-Backbone interact. energy: -1.686 local terms energy: -125.109333 where: bonds (distance) C4'-P energy: -22.369 bonds (distance) P-C4' energy: -29.231 flat angles C4'-P-C4' energy: -27.534 flat angles P-C4'-P energy: -18.235 tors. eta vs tors. theta energy: -27.740 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 151 Temperature: 0.950000 Total energy: -347.495011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.495011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.517574 (E_RNA) where: Base-Base interactions energy: -230.809 where: short stacking energy: -114.510 Base-Backbone interact. energy: -0.344 local terms energy: -116.365033 where: bonds (distance) C4'-P energy: -24.804 bonds (distance) P-C4' energy: -24.315 flat angles C4'-P-C4' energy: -27.359 flat angles P-C4'-P energy: -12.208 tors. eta vs tors. theta energy: -27.680 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 151 Temperature: 1.000000 Total energy: -350.650944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.650944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.661111 (E_RNA) where: Base-Base interactions energy: -233.556 where: short stacking energy: -108.442 Base-Backbone interact. energy: -0.023 local terms energy: -117.082642 where: bonds (distance) C4'-P energy: -24.076 bonds (distance) P-C4' energy: -17.879 flat angles C4'-P-C4' energy: -29.599 flat angles P-C4'-P energy: -17.989 tors. eta vs tors. theta energy: -27.540 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 151 Temperature: 1.050000 Total energy: -325.236625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.236625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.277275 (E_RNA) where: Base-Base interactions energy: -205.822 where: short stacking energy: -102.890 Base-Backbone interact. energy: -0.378 local terms energy: -119.077432 where: bonds (distance) C4'-P energy: -24.220 bonds (distance) P-C4' energy: -22.643 flat angles C4'-P-C4' energy: -26.865 flat angles P-C4'-P energy: -16.111 tors. eta vs tors. theta energy: -29.238 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 151 Temperature: 1.100000 Total energy: -324.190553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.190553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.318215 (E_RNA) where: Base-Base interactions energy: -214.337 where: short stacking energy: -103.100 Base-Backbone interact. energy: 0.363 local terms energy: -110.344623 where: bonds (distance) C4'-P energy: -22.111 bonds (distance) P-C4' energy: -26.335 flat angles C4'-P-C4' energy: -22.600 flat angles P-C4'-P energy: -13.359 tors. eta vs tors. theta energy: -25.940 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 151 Temperature: 1.150000 Total energy: -233.637397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.637397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.778564 (E_RNA) where: Base-Base interactions energy: -140.967 where: short stacking energy: -78.605 Base-Backbone interact. energy: -0.063 local terms energy: -92.748108 where: bonds (distance) C4'-P energy: -20.336 bonds (distance) P-C4' energy: -22.621 flat angles C4'-P-C4' energy: -20.859 flat angles P-C4'-P energy: -11.239 tors. eta vs tors. theta energy: -17.692 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 151 Temperature: 1.200000 Total energy: -206.975391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.975391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.995899 (E_RNA) where: Base-Base interactions energy: -109.776 where: short stacking energy: -56.285 Base-Backbone interact. energy: -0.218 local terms energy: -97.001419 where: bonds (distance) C4'-P energy: -27.830 bonds (distance) P-C4' energy: -21.993 flat angles C4'-P-C4' energy: -21.492 flat angles P-C4'-P energy: -14.777 tors. eta vs tors. theta energy: -10.910 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 151 Temperature: 1.250000 Total energy: -223.858654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.858654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.915974 (E_RNA) where: Base-Base interactions energy: -135.258 where: short stacking energy: -75.280 Base-Backbone interact. energy: -0.432 local terms energy: -88.225495 where: bonds (distance) C4'-P energy: -18.141 bonds (distance) P-C4' energy: -24.587 flat angles C4'-P-C4' energy: -16.448 flat angles P-C4'-P energy: -15.062 tors. eta vs tors. theta energy: -13.987 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 151 Temperature: 1.300000 Total energy: -224.897938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.897938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.976281 (E_RNA) where: Base-Base interactions energy: -122.095 where: short stacking energy: -59.472 Base-Backbone interact. energy: -1.184 local terms energy: -101.697719 where: bonds (distance) C4'-P energy: -22.049 bonds (distance) P-C4' energy: -24.157 flat angles C4'-P-C4' energy: -26.509 flat angles P-C4'-P energy: -16.349 tors. eta vs tors. theta energy: -12.635 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 151 Temperature: 1.350000 Total energy: -191.274883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.274883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.304903 (E_RNA) where: Base-Base interactions energy: -104.467 where: short stacking energy: -58.942 Base-Backbone interact. energy: -0.309 local terms energy: -86.529396 where: bonds (distance) C4'-P energy: -20.827 bonds (distance) P-C4' energy: -16.336 flat angles C4'-P-C4' energy: -22.915 flat angles P-C4'-P energy: -17.291 tors. eta vs tors. theta energy: -9.161 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 152 Temperature: 0.900000 Total energy: -388.833304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.833304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.833304 (E_RNA) where: Base-Base interactions energy: -264.456 where: short stacking energy: -117.457 Base-Backbone interact. energy: -1.039 local terms energy: -123.337785 where: bonds (distance) C4'-P energy: -19.586 bonds (distance) P-C4' energy: -27.799 flat angles C4'-P-C4' energy: -25.024 flat angles P-C4'-P energy: -19.789 tors. eta vs tors. theta energy: -31.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 152 Temperature: 0.950000 Total energy: -346.538621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.538621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.907445 (E_RNA) where: Base-Base interactions energy: -228.325 where: short stacking energy: -117.959 Base-Backbone interact. energy: -0.976 local terms energy: -117.605792 where: bonds (distance) C4'-P energy: -20.879 bonds (distance) P-C4' energy: -24.096 flat angles C4'-P-C4' energy: -24.038 flat angles P-C4'-P energy: -18.394 tors. eta vs tors. theta energy: -30.199 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 152 Temperature: 1.000000 Total energy: -335.572264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.572264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.614460 (E_RNA) where: Base-Base interactions energy: -212.499 where: short stacking energy: -101.272 Base-Backbone interact. energy: -0.471 local terms energy: -122.645435 where: bonds (distance) C4'-P energy: -28.536 bonds (distance) P-C4' energy: -26.269 flat angles C4'-P-C4' energy: -20.756 flat angles P-C4'-P energy: -19.807 tors. eta vs tors. theta energy: -27.278 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 152 Temperature: 1.050000 Total energy: -329.699506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.699506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.773341 (E_RNA) where: Base-Base interactions energy: -218.631 where: short stacking energy: -96.719 Base-Backbone interact. energy: -0.278 local terms energy: -110.864722 where: bonds (distance) C4'-P energy: -20.013 bonds (distance) P-C4' energy: -24.559 flat angles C4'-P-C4' energy: -25.475 flat angles P-C4'-P energy: -16.222 tors. eta vs tors. theta energy: -24.595 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 152 Temperature: 1.100000 Total energy: -328.151296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.151296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.275340 (E_RNA) where: Base-Base interactions energy: -216.224 where: short stacking energy: -111.655 Base-Backbone interact. energy: -0.075 local terms energy: -111.975956 where: bonds (distance) C4'-P energy: -23.047 bonds (distance) P-C4' energy: -21.881 flat angles C4'-P-C4' energy: -28.198 flat angles P-C4'-P energy: -13.488 tors. eta vs tors. theta energy: -25.363 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 152 Temperature: 1.150000 Total energy: -241.445648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.445648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.550848 (E_RNA) where: Base-Base interactions energy: -139.289 where: short stacking energy: -83.811 Base-Backbone interact. energy: -0.725 local terms energy: -101.536243 where: bonds (distance) C4'-P energy: -23.759 bonds (distance) P-C4' energy: -27.628 flat angles C4'-P-C4' energy: -17.929 flat angles P-C4'-P energy: -13.780 tors. eta vs tors. theta energy: -18.440 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 152 Temperature: 1.200000 Total energy: -234.966051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.966051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.069104 (E_RNA) where: Base-Base interactions energy: -141.386 where: short stacking energy: -83.266 Base-Backbone interact. energy: 0.077 local terms energy: -93.759651 where: bonds (distance) C4'-P energy: -15.209 bonds (distance) P-C4' energy: -23.725 flat angles C4'-P-C4' energy: -22.921 flat angles P-C4'-P energy: -12.263 tors. eta vs tors. theta energy: -19.642 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 152 Temperature: 1.250000 Total energy: -211.736328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.736328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.771707 (E_RNA) where: Base-Base interactions energy: -128.319 where: short stacking energy: -66.589 Base-Backbone interact. energy: 0.375 local terms energy: -83.827263 where: bonds (distance) C4'-P energy: -18.866 bonds (distance) P-C4' energy: -18.569 flat angles C4'-P-C4' energy: -18.718 flat angles P-C4'-P energy: -17.004 tors. eta vs tors. theta energy: -10.670 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 152 Temperature: 1.300000 Total energy: -238.333858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.333858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.383293 (E_RNA) where: Base-Base interactions energy: -143.515 where: short stacking energy: -79.980 Base-Backbone interact. energy: -0.714 local terms energy: -94.154049 where: bonds (distance) C4'-P energy: -18.400 bonds (distance) P-C4' energy: -24.641 flat angles C4'-P-C4' energy: -21.252 flat angles P-C4'-P energy: -16.371 tors. eta vs tors. theta energy: -13.491 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 152 Temperature: 1.350000 Total energy: -202.917712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.917712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.940681 (E_RNA) where: Base-Base interactions energy: -120.391 where: short stacking energy: -60.686 Base-Backbone interact. energy: -1.259 local terms energy: -81.290552 where: bonds (distance) C4'-P energy: -21.102 bonds (distance) P-C4' energy: -19.085 flat angles C4'-P-C4' energy: -20.123 flat angles P-C4'-P energy: -8.259 tors. eta vs tors. theta energy: -12.722 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 153 Temperature: 0.900000 Total energy: -390.292033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.292033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.336505 (E_RNA) where: Base-Base interactions energy: -261.017 where: short stacking energy: -123.214 Base-Backbone interact. energy: -0.925 local terms energy: -128.394843 where: bonds (distance) C4'-P energy: -26.050 bonds (distance) P-C4' energy: -24.471 flat angles C4'-P-C4' energy: -25.977 flat angles P-C4'-P energy: -17.416 tors. eta vs tors. theta energy: -34.481 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 153 Temperature: 0.950000 Total energy: -355.717126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.717126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.717126 (E_RNA) where: Base-Base interactions energy: -234.702 where: short stacking energy: -119.276 Base-Backbone interact. energy: -0.371 local terms energy: -120.644211 where: bonds (distance) C4'-P energy: -21.777 bonds (distance) P-C4' energy: -22.661 flat angles C4'-P-C4' energy: -26.468 flat angles P-C4'-P energy: -17.367 tors. eta vs tors. theta energy: -32.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 153 Temperature: 1.000000 Total energy: -324.110587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.110587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.191184 (E_RNA) where: Base-Base interactions energy: -221.980 where: short stacking energy: -96.011 Base-Backbone interact. energy: -0.311 local terms energy: -101.900247 where: bonds (distance) C4'-P energy: -20.350 bonds (distance) P-C4' energy: -20.995 flat angles C4'-P-C4' energy: -21.842 flat angles P-C4'-P energy: -15.435 tors. eta vs tors. theta energy: -23.278 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 153 Temperature: 1.050000 Total energy: -328.068220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.068220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.142239 (E_RNA) where: Base-Base interactions energy: -218.351 where: short stacking energy: -105.802 Base-Backbone interact. energy: -0.662 local terms energy: -109.128806 where: bonds (distance) C4'-P energy: -16.883 bonds (distance) P-C4' energy: -24.222 flat angles C4'-P-C4' energy: -23.534 flat angles P-C4'-P energy: -15.582 tors. eta vs tors. theta energy: -28.907 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 153 Temperature: 1.100000 Total energy: -327.965076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.965076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.070820 (E_RNA) where: Base-Base interactions energy: -215.303 where: short stacking energy: -109.204 Base-Backbone interact. energy: -0.831 local terms energy: -111.936151 where: bonds (distance) C4'-P energy: -22.099 bonds (distance) P-C4' energy: -19.690 flat angles C4'-P-C4' energy: -23.192 flat angles P-C4'-P energy: -17.380 tors. eta vs tors. theta energy: -29.575 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 153 Temperature: 1.150000 Total energy: -232.397695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.397695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.416218 (E_RNA) where: Base-Base interactions energy: -133.143 where: short stacking energy: -77.857 Base-Backbone interact. energy: -0.381 local terms energy: -98.891465 where: bonds (distance) C4'-P energy: -21.600 bonds (distance) P-C4' energy: -26.074 flat angles C4'-P-C4' energy: -21.975 flat angles P-C4'-P energy: -17.684 tors. eta vs tors. theta energy: -11.559 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 153 Temperature: 1.200000 Total energy: -231.226214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.226214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.247255 (E_RNA) where: Base-Base interactions energy: -139.930 where: short stacking energy: -83.942 Base-Backbone interact. energy: -0.165 local terms energy: -91.153017 where: bonds (distance) C4'-P energy: -10.539 bonds (distance) P-C4' energy: -23.202 flat angles C4'-P-C4' energy: -20.633 flat angles P-C4'-P energy: -17.002 tors. eta vs tors. theta energy: -19.777 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 153 Temperature: 1.250000 Total energy: -214.957719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.957719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.962367 (E_RNA) where: Base-Base interactions energy: -139.532 where: short stacking energy: -76.259 Base-Backbone interact. energy: -0.583 local terms energy: -74.847147 where: bonds (distance) C4'-P energy: -19.058 bonds (distance) P-C4' energy: -12.850 flat angles C4'-P-C4' energy: -17.153 flat angles P-C4'-P energy: -11.531 tors. eta vs tors. theta energy: -14.255 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 153 Temperature: 1.300000 Total energy: -213.210936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.210936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.210936 (E_RNA) where: Base-Base interactions energy: -121.474 where: short stacking energy: -68.778 Base-Backbone interact. energy: -0.379 local terms energy: -91.358572 where: bonds (distance) C4'-P energy: -24.926 bonds (distance) P-C4' energy: -20.555 flat angles C4'-P-C4' energy: -20.662 flat angles P-C4'-P energy: -17.683 tors. eta vs tors. theta energy: -7.532 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 153 Temperature: 1.350000 Total energy: -201.380185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.380185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.410515 (E_RNA) where: Base-Base interactions energy: -127.554 where: short stacking energy: -69.369 Base-Backbone interact. energy: -0.440 local terms energy: -73.416675 where: bonds (distance) C4'-P energy: -21.582 bonds (distance) P-C4' energy: -17.216 flat angles C4'-P-C4' energy: -16.095 flat angles P-C4'-P energy: -11.408 tors. eta vs tors. theta energy: -7.116 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 154 Temperature: 0.900000 Total energy: -356.709199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.709199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.709199 (E_RNA) where: Base-Base interactions energy: -234.445 where: short stacking energy: -117.910 Base-Backbone interact. energy: 0.481 local terms energy: -122.745624 where: bonds (distance) C4'-P energy: -23.233 bonds (distance) P-C4' energy: -24.702 flat angles C4'-P-C4' energy: -25.827 flat angles P-C4'-P energy: -18.897 tors. eta vs tors. theta energy: -30.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 154 Temperature: 0.950000 Total energy: -369.309965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.309965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.397633 (E_RNA) where: Base-Base interactions energy: -256.992 where: short stacking energy: -114.945 Base-Backbone interact. energy: -1.195 local terms energy: -111.211520 where: bonds (distance) C4'-P energy: -18.005 bonds (distance) P-C4' energy: -23.756 flat angles C4'-P-C4' energy: -24.002 flat angles P-C4'-P energy: -14.749 tors. eta vs tors. theta energy: -30.699 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 154 Temperature: 1.000000 Total energy: -332.655924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.655924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.655924 (E_RNA) where: Base-Base interactions energy: -220.541 where: short stacking energy: -109.847 Base-Backbone interact. energy: -0.578 local terms energy: -111.536128 where: bonds (distance) C4'-P energy: -24.145 bonds (distance) P-C4' energy: -20.604 flat angles C4'-P-C4' energy: -22.564 flat angles P-C4'-P energy: -14.544 tors. eta vs tors. theta energy: -29.679 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 154 Temperature: 1.050000 Total energy: -322.819354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.819354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.010680 (E_RNA) where: Base-Base interactions energy: -208.707 where: short stacking energy: -107.156 Base-Backbone interact. energy: -0.456 local terms energy: -113.848131 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -22.788 flat angles C4'-P-C4' energy: -25.336 flat angles P-C4'-P energy: -10.813 tors. eta vs tors. theta energy: -30.447 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 154 Temperature: 1.100000 Total energy: -329.835871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.835871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.900012 (E_RNA) where: Base-Base interactions energy: -223.119 where: short stacking energy: -101.516 Base-Backbone interact. energy: -0.167 local terms energy: -106.614358 where: bonds (distance) C4'-P energy: -20.246 bonds (distance) P-C4' energy: -25.595 flat angles C4'-P-C4' energy: -19.252 flat angles P-C4'-P energy: -18.575 tors. eta vs tors. theta energy: -22.946 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 154 Temperature: 1.150000 Total energy: -245.752216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.752216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.782122 (E_RNA) where: Base-Base interactions energy: -152.060 where: short stacking energy: -94.755 Base-Backbone interact. energy: -0.225 local terms energy: -93.496717 where: bonds (distance) C4'-P energy: -22.083 bonds (distance) P-C4' energy: -14.898 flat angles C4'-P-C4' energy: -25.958 flat angles P-C4'-P energy: -15.133 tors. eta vs tors. theta energy: -15.426 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 154 Temperature: 1.200000 Total energy: -237.848772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.848772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.848772 (E_RNA) where: Base-Base interactions energy: -147.593 where: short stacking energy: -74.177 Base-Backbone interact. energy: 0.039 local terms energy: -90.294686 where: bonds (distance) C4'-P energy: -20.644 bonds (distance) P-C4' energy: -22.814 flat angles C4'-P-C4' energy: -25.211 flat angles P-C4'-P energy: -10.241 tors. eta vs tors. theta energy: -11.384 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 154 Temperature: 1.250000 Total energy: -222.749756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.749756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.831822 (E_RNA) where: Base-Base interactions energy: -138.256 where: short stacking energy: -74.711 Base-Backbone interact. energy: -0.488 local terms energy: -84.087756 where: bonds (distance) C4'-P energy: -19.401 bonds (distance) P-C4' energy: -17.349 flat angles C4'-P-C4' energy: -23.226 flat angles P-C4'-P energy: -12.646 tors. eta vs tors. theta energy: -11.466 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 154 Temperature: 1.300000 Total energy: -209.001079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.001079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.216302 (E_RNA) where: Base-Base interactions energy: -124.982 where: short stacking energy: -68.637 Base-Backbone interact. energy: 0.873 local terms energy: -85.107021 where: bonds (distance) C4'-P energy: -21.551 bonds (distance) P-C4' energy: -21.911 flat angles C4'-P-C4' energy: -19.566 flat angles P-C4'-P energy: -10.212 tors. eta vs tors. theta energy: -11.866 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 154 Temperature: 1.350000 Total energy: -201.131788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.131788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.937584 (E_RNA) where: Base-Base interactions energy: -123.065 where: short stacking energy: -59.733 Base-Backbone interact. energy: -0.508 local terms energy: -78.365134 where: bonds (distance) C4'-P energy: -22.148 bonds (distance) P-C4' energy: -15.292 flat angles C4'-P-C4' energy: -24.022 flat angles P-C4'-P energy: -10.134 tors. eta vs tors. theta energy: -6.770 Dist. restrs. and SS energy: 0.806 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 155 Temperature: 0.900000 Total energy: -362.344457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.344457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.394941 (E_RNA) where: Base-Base interactions energy: -229.978 where: short stacking energy: -115.924 Base-Backbone interact. energy: -0.160 local terms energy: -132.256364 where: bonds (distance) C4'-P energy: -26.230 bonds (distance) P-C4' energy: -26.929 flat angles C4'-P-C4' energy: -26.252 flat angles P-C4'-P energy: -17.998 tors. eta vs tors. theta energy: -34.847 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 155 Temperature: 0.950000 Total energy: -377.346622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.346622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.346622 (E_RNA) where: Base-Base interactions energy: -255.674 where: short stacking energy: -113.982 Base-Backbone interact. energy: -1.221 local terms energy: -120.450949 where: bonds (distance) C4'-P energy: -23.065 bonds (distance) P-C4' energy: -24.993 flat angles C4'-P-C4' energy: -26.576 flat angles P-C4'-P energy: -17.060 tors. eta vs tors. theta energy: -28.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 155 Temperature: 1.000000 Total energy: -334.198285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.198285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.292990 (E_RNA) where: Base-Base interactions energy: -208.600 where: short stacking energy: -103.557 Base-Backbone interact. energy: -0.683 local terms energy: -125.010013 where: bonds (distance) C4'-P energy: -29.812 bonds (distance) P-C4' energy: -26.346 flat angles C4'-P-C4' energy: -23.875 flat angles P-C4'-P energy: -17.245 tors. eta vs tors. theta energy: -27.732 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 155 Temperature: 1.050000 Total energy: -336.836685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.836685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.858320 (E_RNA) where: Base-Base interactions energy: -219.263 where: short stacking energy: -102.975 Base-Backbone interact. energy: -1.184 local terms energy: -116.411309 where: bonds (distance) C4'-P energy: -18.821 bonds (distance) P-C4' energy: -27.756 flat angles C4'-P-C4' energy: -28.791 flat angles P-C4'-P energy: -16.378 tors. eta vs tors. theta energy: -24.666 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 155 Temperature: 1.100000 Total energy: -317.869243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.869243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.869243 (E_RNA) where: Base-Base interactions energy: -213.557 where: short stacking energy: -104.015 Base-Backbone interact. energy: -1.438 local terms energy: -102.874580 where: bonds (distance) C4'-P energy: -18.862 bonds (distance) P-C4' energy: -18.371 flat angles C4'-P-C4' energy: -26.187 flat angles P-C4'-P energy: -12.775 tors. eta vs tors. theta energy: -26.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 155 Temperature: 1.150000 Total energy: -236.181251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.181251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.307620 (E_RNA) where: Base-Base interactions energy: -146.437 where: short stacking energy: -84.918 Base-Backbone interact. energy: -0.165 local terms energy: -89.705766 where: bonds (distance) C4'-P energy: -18.721 bonds (distance) P-C4' energy: -22.999 flat angles C4'-P-C4' energy: -21.486 flat angles P-C4'-P energy: -9.636 tors. eta vs tors. theta energy: -16.862 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 155 Temperature: 1.200000 Total energy: -240.301551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.301551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.327077 (E_RNA) where: Base-Base interactions energy: -144.630 where: short stacking energy: -85.186 Base-Backbone interact. energy: 0.235 local terms energy: -95.931977 where: bonds (distance) C4'-P energy: -24.854 bonds (distance) P-C4' energy: -21.164 flat angles C4'-P-C4' energy: -19.823 flat angles P-C4'-P energy: -12.017 tors. eta vs tors. theta energy: -18.075 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 155 Temperature: 1.250000 Total energy: -221.190715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.190715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.190715 (E_RNA) where: Base-Base interactions energy: -123.199 where: short stacking energy: -68.091 Base-Backbone interact. energy: -0.046 local terms energy: -97.945932 where: bonds (distance) C4'-P energy: -25.681 bonds (distance) P-C4' energy: -19.975 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -14.196 tors. eta vs tors. theta energy: -14.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 155 Temperature: 1.300000 Total energy: -209.255570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.255570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.259757 (E_RNA) where: Base-Base interactions energy: -116.321 where: short stacking energy: -61.914 Base-Backbone interact. energy: 1.659 local terms energy: -94.597982 where: bonds (distance) C4'-P energy: -21.577 bonds (distance) P-C4' energy: -25.005 flat angles C4'-P-C4' energy: -23.462 flat angles P-C4'-P energy: -13.375 tors. eta vs tors. theta energy: -11.179 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 155 Temperature: 1.350000 Total energy: -198.834469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.834469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.917280 (E_RNA) where: Base-Base interactions energy: -115.279 where: short stacking energy: -60.922 Base-Backbone interact. energy: -0.500 local terms energy: -83.138167 where: bonds (distance) C4'-P energy: -17.322 bonds (distance) P-C4' energy: -22.769 flat angles C4'-P-C4' energy: -22.667 flat angles P-C4'-P energy: -9.680 tors. eta vs tors. theta energy: -10.700 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 156 Temperature: 0.900000 Total energy: -384.120506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.120506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.120506 (E_RNA) where: Base-Base interactions energy: -272.673 where: short stacking energy: -116.756 Base-Backbone interact. energy: -0.895 local terms energy: -110.551950 where: bonds (distance) C4'-P energy: -19.736 bonds (distance) P-C4' energy: -18.591 flat angles C4'-P-C4' energy: -30.111 flat angles P-C4'-P energy: -12.778 tors. eta vs tors. theta energy: -29.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 156 Temperature: 0.950000 Total energy: -360.772220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.772220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.800097 (E_RNA) where: Base-Base interactions energy: -233.391 where: short stacking energy: -121.650 Base-Backbone interact. energy: -0.463 local terms energy: -126.946031 where: bonds (distance) C4'-P energy: -26.285 bonds (distance) P-C4' energy: -24.527 flat angles C4'-P-C4' energy: -21.944 flat angles P-C4'-P energy: -21.570 tors. eta vs tors. theta energy: -32.620 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 156 Temperature: 1.000000 Total energy: -342.708956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.708956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.793755 (E_RNA) where: Base-Base interactions energy: -226.831 where: short stacking energy: -100.280 Base-Backbone interact. energy: -1.165 local terms energy: -114.798445 where: bonds (distance) C4'-P energy: -21.073 bonds (distance) P-C4' energy: -22.252 flat angles C4'-P-C4' energy: -26.642 flat angles P-C4'-P energy: -17.823 tors. eta vs tors. theta energy: -27.008 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 156 Temperature: 1.050000 Total energy: -315.580511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.580511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.604675 (E_RNA) where: Base-Base interactions energy: -204.329 where: short stacking energy: -88.950 Base-Backbone interact. energy: -0.426 local terms energy: -110.849413 where: bonds (distance) C4'-P energy: -21.714 bonds (distance) P-C4' energy: -27.673 flat angles C4'-P-C4' energy: -25.598 flat angles P-C4'-P energy: -14.196 tors. eta vs tors. theta energy: -21.669 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 156 Temperature: 1.100000 Total energy: -319.465415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.465415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.778577 (E_RNA) where: Base-Base interactions energy: -196.074 where: short stacking energy: -98.128 Base-Backbone interact. energy: -1.038 local terms energy: -122.667140 where: bonds (distance) C4'-P energy: -24.376 bonds (distance) P-C4' energy: -24.049 flat angles C4'-P-C4' energy: -26.900 flat angles P-C4'-P energy: -19.050 tors. eta vs tors. theta energy: -28.293 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 156 Temperature: 1.150000 Total energy: -248.723307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.723307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.723307 (E_RNA) where: Base-Base interactions energy: -154.056 where: short stacking energy: -73.294 Base-Backbone interact. energy: -0.051 local terms energy: -94.615504 where: bonds (distance) C4'-P energy: -25.924 bonds (distance) P-C4' energy: -26.499 flat angles C4'-P-C4' energy: -18.164 flat angles P-C4'-P energy: -14.319 tors. eta vs tors. theta energy: -9.710 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 156 Temperature: 1.200000 Total energy: -227.770286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.770286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.833290 (E_RNA) where: Base-Base interactions energy: -135.711 where: short stacking energy: -72.300 Base-Backbone interact. energy: -2.230 local terms energy: -89.891795 where: bonds (distance) C4'-P energy: -17.094 bonds (distance) P-C4' energy: -20.260 flat angles C4'-P-C4' energy: -18.231 flat angles P-C4'-P energy: -13.875 tors. eta vs tors. theta energy: -20.432 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 156 Temperature: 1.250000 Total energy: -211.740989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.740989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.145151 (E_RNA) where: Base-Base interactions energy: -119.476 where: short stacking energy: -70.225 Base-Backbone interact. energy: -0.256 local terms energy: -92.413089 where: bonds (distance) C4'-P energy: -23.087 bonds (distance) P-C4' energy: -20.963 flat angles C4'-P-C4' energy: -17.220 flat angles P-C4'-P energy: -14.787 tors. eta vs tors. theta energy: -16.356 Dist. restrs. and SS energy: 0.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 156 Temperature: 1.300000 Total energy: -213.237264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.237264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.499791 (E_RNA) where: Base-Base interactions energy: -114.549 where: short stacking energy: -63.677 Base-Backbone interact. energy: -0.274 local terms energy: -98.676837 where: bonds (distance) C4'-P energy: -22.567 bonds (distance) P-C4' energy: -22.562 flat angles C4'-P-C4' energy: -21.262 flat angles P-C4'-P energy: -19.347 tors. eta vs tors. theta energy: -12.938 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 156 Temperature: 1.350000 Total energy: -192.489402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.489402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.489402 (E_RNA) where: Base-Base interactions energy: -114.328 where: short stacking energy: -54.125 Base-Backbone interact. energy: -0.470 local terms energy: -77.691634 where: bonds (distance) C4'-P energy: -21.918 bonds (distance) P-C4' energy: -14.724 flat angles C4'-P-C4' energy: -14.372 flat angles P-C4'-P energy: -9.835 tors. eta vs tors. theta energy: -16.844 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 157 Temperature: 0.900000 Total energy: -392.099723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.099723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.400430 (E_RNA) where: Base-Base interactions energy: -263.984 where: short stacking energy: -124.291 Base-Backbone interact. energy: -0.433 local terms energy: -127.983177 where: bonds (distance) C4'-P energy: -27.313 bonds (distance) P-C4' energy: -22.330 flat angles C4'-P-C4' energy: -26.039 flat angles P-C4'-P energy: -16.463 tors. eta vs tors. theta energy: -35.838 Dist. restrs. and SS energy: 0.301 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 157 Temperature: 0.950000 Total energy: -351.934400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.934400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.934400 (E_RNA) where: Base-Base interactions energy: -232.814 where: short stacking energy: -112.145 Base-Backbone interact. energy: -0.317 local terms energy: -118.803783 where: bonds (distance) C4'-P energy: -25.233 bonds (distance) P-C4' energy: -26.191 flat angles C4'-P-C4' energy: -25.019 flat angles P-C4'-P energy: -17.117 tors. eta vs tors. theta energy: -25.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 157 Temperature: 1.000000 Total energy: -352.222945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.222945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.315392 (E_RNA) where: Base-Base interactions energy: -231.645 where: short stacking energy: -115.000 Base-Backbone interact. energy: -0.506 local terms energy: -120.164785 where: bonds (distance) C4'-P energy: -24.603 bonds (distance) P-C4' energy: -24.147 flat angles C4'-P-C4' energy: -24.572 flat angles P-C4'-P energy: -14.073 tors. eta vs tors. theta energy: -32.770 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 157 Temperature: 1.050000 Total energy: -344.335184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.335184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.387611 (E_RNA) where: Base-Base interactions energy: -235.684 where: short stacking energy: -112.951 Base-Backbone interact. energy: -0.299 local terms energy: -108.403963 where: bonds (distance) C4'-P energy: -21.578 bonds (distance) P-C4' energy: -26.754 flat angles C4'-P-C4' energy: -26.483 flat angles P-C4'-P energy: -4.867 tors. eta vs tors. theta energy: -28.723 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 157 Temperature: 1.100000 Total energy: -305.144693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.144693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.272823 (E_RNA) where: Base-Base interactions energy: -199.672 where: short stacking energy: -93.418 Base-Backbone interact. energy: 0.735 local terms energy: -106.336148 where: bonds (distance) C4'-P energy: -22.879 bonds (distance) P-C4' energy: -23.524 flat angles C4'-P-C4' energy: -24.788 flat angles P-C4'-P energy: -13.287 tors. eta vs tors. theta energy: -21.858 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 157 Temperature: 1.150000 Total energy: -227.882913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.882913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.893586 (E_RNA) where: Base-Base interactions energy: -126.282 where: short stacking energy: -65.454 Base-Backbone interact. energy: 0.385 local terms energy: -101.996209 where: bonds (distance) C4'-P energy: -25.179 bonds (distance) P-C4' energy: -25.674 flat angles C4'-P-C4' energy: -22.450 flat angles P-C4'-P energy: -13.669 tors. eta vs tors. theta energy: -15.024 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 157 Temperature: 1.200000 Total energy: -227.026714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.026714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.406351 (E_RNA) where: Base-Base interactions energy: -154.776 where: short stacking energy: -75.474 Base-Backbone interact. energy: -0.665 local terms energy: -71.965863 where: bonds (distance) C4'-P energy: -13.986 bonds (distance) P-C4' energy: -16.968 flat angles C4'-P-C4' energy: -16.149 flat angles P-C4'-P energy: -9.900 tors. eta vs tors. theta energy: -14.963 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 157 Temperature: 1.250000 Total energy: -214.911163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.911163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.970860 (E_RNA) where: Base-Base interactions energy: -128.198 where: short stacking energy: -71.669 Base-Backbone interact. energy: 0.577 local terms energy: -87.348971 where: bonds (distance) C4'-P energy: -20.713 bonds (distance) P-C4' energy: -17.235 flat angles C4'-P-C4' energy: -21.410 flat angles P-C4'-P energy: -8.452 tors. eta vs tors. theta energy: -19.539 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 157 Temperature: 1.300000 Total energy: -220.640984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.640984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.670767 (E_RNA) where: Base-Base interactions energy: -126.155 where: short stacking energy: -71.201 Base-Backbone interact. energy: -0.033 local terms energy: -94.481891 where: bonds (distance) C4'-P energy: -23.326 bonds (distance) P-C4' energy: -18.130 flat angles C4'-P-C4' energy: -26.184 flat angles P-C4'-P energy: -16.650 tors. eta vs tors. theta energy: -10.192 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 157 Temperature: 1.350000 Total energy: -190.681104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.681104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.742293 (E_RNA) where: Base-Base interactions energy: -118.870 where: short stacking energy: -63.484 Base-Backbone interact. energy: -0.541 local terms energy: -71.330838 where: bonds (distance) C4'-P energy: -15.573 bonds (distance) P-C4' energy: -12.382 flat angles C4'-P-C4' energy: -19.977 flat angles P-C4'-P energy: -13.675 tors. eta vs tors. theta energy: -9.723 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 158 Temperature: 0.900000 Total energy: -384.258711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.258711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.266668 (E_RNA) where: Base-Base interactions energy: -264.248 where: short stacking energy: -117.442 Base-Backbone interact. energy: -2.311 local terms energy: -117.707566 where: bonds (distance) C4'-P energy: -21.352 bonds (distance) P-C4' energy: -23.072 flat angles C4'-P-C4' energy: -25.502 flat angles P-C4'-P energy: -18.072 tors. eta vs tors. theta energy: -29.709 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 158 Temperature: 0.950000 Total energy: -363.356643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.356643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.401994 (E_RNA) where: Base-Base interactions energy: -239.768 where: short stacking energy: -114.713 Base-Backbone interact. energy: -0.370 local terms energy: -123.264293 where: bonds (distance) C4'-P energy: -18.263 bonds (distance) P-C4' energy: -25.073 flat angles C4'-P-C4' energy: -27.934 flat angles P-C4'-P energy: -20.822 tors. eta vs tors. theta energy: -31.172 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 158 Temperature: 1.000000 Total energy: -357.537243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.537243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.560720 (E_RNA) where: Base-Base interactions energy: -242.102 where: short stacking energy: -119.955 Base-Backbone interact. energy: -0.786 local terms energy: -114.672070 where: bonds (distance) C4'-P energy: -19.247 bonds (distance) P-C4' energy: -23.863 flat angles C4'-P-C4' energy: -27.383 flat angles P-C4'-P energy: -16.978 tors. eta vs tors. theta energy: -27.201 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 158 Temperature: 1.050000 Total energy: -338.185744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.185744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.206916 (E_RNA) where: Base-Base interactions energy: -234.452 where: short stacking energy: -103.601 Base-Backbone interact. energy: -1.428 local terms energy: -102.327260 where: bonds (distance) C4'-P energy: -20.157 bonds (distance) P-C4' energy: -20.245 flat angles C4'-P-C4' energy: -19.535 flat angles P-C4'-P energy: -15.316 tors. eta vs tors. theta energy: -27.074 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 158 Temperature: 1.100000 Total energy: -317.469475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.469475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.671393 (E_RNA) where: Base-Base interactions energy: -204.551 where: short stacking energy: -91.493 Base-Backbone interact. energy: -0.050 local terms energy: -113.070397 where: bonds (distance) C4'-P energy: -25.193 bonds (distance) P-C4' energy: -24.032 flat angles C4'-P-C4' energy: -22.855 flat angles P-C4'-P energy: -18.130 tors. eta vs tors. theta energy: -22.861 Dist. restrs. and SS energy: 0.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 158 Temperature: 1.150000 Total energy: -245.450400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.450400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.499053 (E_RNA) where: Base-Base interactions energy: -152.534 where: short stacking energy: -89.512 Base-Backbone interact. energy: -0.421 local terms energy: -92.543309 where: bonds (distance) C4'-P energy: -19.280 bonds (distance) P-C4' energy: -23.830 flat angles C4'-P-C4' energy: -19.769 flat angles P-C4'-P energy: -10.297 tors. eta vs tors. theta energy: -19.367 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 158 Temperature: 1.200000 Total energy: -219.283997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.283997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.363523 (E_RNA) where: Base-Base interactions energy: -126.426 where: short stacking energy: -75.437 Base-Backbone interact. energy: -0.384 local terms energy: -92.553966 where: bonds (distance) C4'-P energy: -20.717 bonds (distance) P-C4' energy: -22.533 flat angles C4'-P-C4' energy: -26.387 flat angles P-C4'-P energy: -12.810 tors. eta vs tors. theta energy: -10.107 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 158 Temperature: 1.250000 Total energy: -254.725296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.725296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.876016 (E_RNA) where: Base-Base interactions energy: -167.424 where: short stacking energy: -71.435 Base-Backbone interact. energy: -1.385 local terms energy: -86.066737 where: bonds (distance) C4'-P energy: -21.151 bonds (distance) P-C4' energy: -18.615 flat angles C4'-P-C4' energy: -22.238 flat angles P-C4'-P energy: -11.001 tors. eta vs tors. theta energy: -13.062 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 158 Temperature: 1.300000 Total energy: -196.749118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.749118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.783934 (E_RNA) where: Base-Base interactions energy: -108.234 where: short stacking energy: -66.890 Base-Backbone interact. energy: -0.015 local terms energy: -88.534639 where: bonds (distance) C4'-P energy: -20.043 bonds (distance) P-C4' energy: -25.733 flat angles C4'-P-C4' energy: -20.758 flat angles P-C4'-P energy: -14.292 tors. eta vs tors. theta energy: -7.709 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 158 Temperature: 1.350000 Total energy: -199.317086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.317086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.398483 (E_RNA) where: Base-Base interactions energy: -117.234 where: short stacking energy: -63.321 Base-Backbone interact. energy: -0.169 local terms energy: -81.995195 where: bonds (distance) C4'-P energy: -13.834 bonds (distance) P-C4' energy: -22.589 flat angles C4'-P-C4' energy: -17.200 flat angles P-C4'-P energy: -14.102 tors. eta vs tors. theta energy: -14.271 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 159 Temperature: 0.900000 Total energy: -378.649139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.649139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.654245 (E_RNA) where: Base-Base interactions energy: -244.776 where: short stacking energy: -118.250 Base-Backbone interact. energy: -1.205 local terms energy: -132.673149 where: bonds (distance) C4'-P energy: -29.176 bonds (distance) P-C4' energy: -23.325 flat angles C4'-P-C4' energy: -27.311 flat angles P-C4'-P energy: -20.820 tors. eta vs tors. theta energy: -32.042 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 159 Temperature: 0.950000 Total energy: -374.125135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.125135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.311528 (E_RNA) where: Base-Base interactions energy: -243.859 where: short stacking energy: -120.983 Base-Backbone interact. energy: -0.730 local terms energy: -129.722696 where: bonds (distance) C4'-P energy: -24.645 bonds (distance) P-C4' energy: -26.381 flat angles C4'-P-C4' energy: -27.541 flat angles P-C4'-P energy: -20.813 tors. eta vs tors. theta energy: -30.343 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 159 Temperature: 1.000000 Total energy: -352.279637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.279637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.454034 (E_RNA) where: Base-Base interactions energy: -230.543 where: short stacking energy: -107.641 Base-Backbone interact. energy: -0.356 local terms energy: -121.554951 where: bonds (distance) C4'-P energy: -20.533 bonds (distance) P-C4' energy: -23.121 flat angles C4'-P-C4' energy: -27.940 flat angles P-C4'-P energy: -20.986 tors. eta vs tors. theta energy: -28.975 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 159 Temperature: 1.050000 Total energy: -339.341363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.341363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.720475 (E_RNA) where: Base-Base interactions energy: -222.235 where: short stacking energy: -101.855 Base-Backbone interact. energy: -0.330 local terms energy: -117.155081 where: bonds (distance) C4'-P energy: -24.534 bonds (distance) P-C4' energy: -22.633 flat angles C4'-P-C4' energy: -28.651 flat angles P-C4'-P energy: -17.425 tors. eta vs tors. theta energy: -23.912 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 159 Temperature: 1.100000 Total energy: -307.454189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.454189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.724477 (E_RNA) where: Base-Base interactions energy: -202.172 where: short stacking energy: -103.860 Base-Backbone interact. energy: -0.533 local terms energy: -105.019972 where: bonds (distance) C4'-P energy: -16.617 bonds (distance) P-C4' energy: -24.344 flat angles C4'-P-C4' energy: -24.982 flat angles P-C4'-P energy: -15.754 tors. eta vs tors. theta energy: -23.323 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 159 Temperature: 1.150000 Total energy: -234.263242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.263242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.266055 (E_RNA) where: Base-Base interactions energy: -140.489 where: short stacking energy: -76.647 Base-Backbone interact. energy: -0.480 local terms energy: -93.296443 where: bonds (distance) C4'-P energy: -20.659 bonds (distance) P-C4' energy: -24.393 flat angles C4'-P-C4' energy: -18.199 flat angles P-C4'-P energy: -15.897 tors. eta vs tors. theta energy: -14.148 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 159 Temperature: 1.200000 Total energy: -233.521400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.521400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.592572 (E_RNA) where: Base-Base interactions energy: -129.420 where: short stacking energy: -74.911 Base-Backbone interact. energy: -0.841 local terms energy: -103.332272 where: bonds (distance) C4'-P energy: -21.996 bonds (distance) P-C4' energy: -25.717 flat angles C4'-P-C4' energy: -24.206 flat angles P-C4'-P energy: -12.683 tors. eta vs tors. theta energy: -18.731 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 159 Temperature: 1.250000 Total energy: -218.873069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.873069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.882778 (E_RNA) where: Base-Base interactions energy: -129.248 where: short stacking energy: -67.737 Base-Backbone interact. energy: -0.484 local terms energy: -89.150622 where: bonds (distance) C4'-P energy: -19.407 bonds (distance) P-C4' energy: -18.781 flat angles C4'-P-C4' energy: -23.723 flat angles P-C4'-P energy: -13.983 tors. eta vs tors. theta energy: -13.257 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 159 Temperature: 1.300000 Total energy: -205.292354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.292354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.292354 (E_RNA) where: Base-Base interactions energy: -122.361 where: short stacking energy: -61.616 Base-Backbone interact. energy: -0.663 local terms energy: -82.267729 where: bonds (distance) C4'-P energy: -11.654 bonds (distance) P-C4' energy: -23.580 flat angles C4'-P-C4' energy: -21.585 flat angles P-C4'-P energy: -13.669 tors. eta vs tors. theta energy: -11.780 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 159 Temperature: 1.350000 Total energy: -209.026296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.026296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.145728 (E_RNA) where: Base-Base interactions energy: -109.005 where: short stacking energy: -61.314 Base-Backbone interact. energy: -0.730 local terms energy: -99.410423 where: bonds (distance) C4'-P energy: -23.748 bonds (distance) P-C4' energy: -26.340 flat angles C4'-P-C4' energy: -21.630 flat angles P-C4'-P energy: -14.714 tors. eta vs tors. theta energy: -12.979 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 160 Temperature: 0.900000 Total energy: -384.148375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.148375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.288191 (E_RNA) where: Base-Base interactions energy: -256.921 where: short stacking energy: -111.102 Base-Backbone interact. energy: -1.637 local terms energy: -125.730375 where: bonds (distance) C4'-P energy: -23.905 bonds (distance) P-C4' energy: -24.781 flat angles C4'-P-C4' energy: -25.627 flat angles P-C4'-P energy: -18.493 tors. eta vs tors. theta energy: -32.925 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 160 Temperature: 0.950000 Total energy: -370.295362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.295362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.295362 (E_RNA) where: Base-Base interactions energy: -244.187 where: short stacking energy: -121.613 Base-Backbone interact. energy: -1.017 local terms energy: -125.091843 where: bonds (distance) C4'-P energy: -21.636 bonds (distance) P-C4' energy: -26.329 flat angles C4'-P-C4' energy: -27.800 flat angles P-C4'-P energy: -16.594 tors. eta vs tors. theta energy: -32.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 160 Temperature: 1.000000 Total energy: -359.281576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.281576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.316794 (E_RNA) where: Base-Base interactions energy: -237.241 where: short stacking energy: -97.904 Base-Backbone interact. energy: -1.776 local terms energy: -120.300335 where: bonds (distance) C4'-P energy: -25.491 bonds (distance) P-C4' energy: -26.332 flat angles C4'-P-C4' energy: -23.150 flat angles P-C4'-P energy: -17.699 tors. eta vs tors. theta energy: -27.628 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 160 Temperature: 1.050000 Total energy: -334.101931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.101931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.101931 (E_RNA) where: Base-Base interactions energy: -218.945 where: short stacking energy: -105.589 Base-Backbone interact. energy: -0.401 local terms energy: -114.755819 where: bonds (distance) C4'-P energy: -19.994 bonds (distance) P-C4' energy: -27.103 flat angles C4'-P-C4' energy: -24.579 flat angles P-C4'-P energy: -19.028 tors. eta vs tors. theta energy: -24.053 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 160 Temperature: 1.100000 Total energy: -235.835022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.835022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.988855 (E_RNA) where: Base-Base interactions energy: -130.850 where: short stacking energy: -81.688 Base-Backbone interact. energy: -1.003 local terms energy: -104.135801 where: bonds (distance) C4'-P energy: -19.351 bonds (distance) P-C4' energy: -22.635 flat angles C4'-P-C4' energy: -25.399 flat angles P-C4'-P energy: -19.184 tors. eta vs tors. theta energy: -17.568 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 160 Temperature: 1.150000 Total energy: -307.108571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.108571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.155192 (E_RNA) where: Base-Base interactions energy: -200.381 where: short stacking energy: -89.743 Base-Backbone interact. energy: -0.975 local terms energy: -105.799568 where: bonds (distance) C4'-P energy: -19.110 bonds (distance) P-C4' energy: -25.594 flat angles C4'-P-C4' energy: -26.432 flat angles P-C4'-P energy: -12.583 tors. eta vs tors. theta energy: -22.080 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 160 Temperature: 1.200000 Total energy: -222.471822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.471822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.562200 (E_RNA) where: Base-Base interactions energy: -129.422 where: short stacking energy: -74.669 Base-Backbone interact. energy: -0.012 local terms energy: -93.128127 where: bonds (distance) C4'-P energy: -19.808 bonds (distance) P-C4' energy: -23.309 flat angles C4'-P-C4' energy: -20.058 flat angles P-C4'-P energy: -17.105 tors. eta vs tors. theta energy: -12.847 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 160 Temperature: 1.250000 Total energy: -219.147928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.147928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.311283 (E_RNA) where: Base-Base interactions energy: -128.724 where: short stacking energy: -63.919 Base-Backbone interact. energy: -2.229 local terms energy: -88.358440 where: bonds (distance) C4'-P energy: -20.532 bonds (distance) P-C4' energy: -19.806 flat angles C4'-P-C4' energy: -21.311 flat angles P-C4'-P energy: -11.604 tors. eta vs tors. theta energy: -15.106 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 160 Temperature: 1.300000 Total energy: -212.802950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.802950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.850049 (E_RNA) where: Base-Base interactions energy: -129.755 where: short stacking energy: -66.561 Base-Backbone interact. energy: -0.247 local terms energy: -82.847955 where: bonds (distance) C4'-P energy: -21.057 bonds (distance) P-C4' energy: -13.461 flat angles C4'-P-C4' energy: -21.574 flat angles P-C4'-P energy: -15.963 tors. eta vs tors. theta energy: -10.793 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 160 Temperature: 1.350000 Total energy: -199.316502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.316502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.345689 (E_RNA) where: Base-Base interactions energy: -124.273 where: short stacking energy: -64.412 Base-Backbone interact. energy: -0.788 local terms energy: -74.285040 where: bonds (distance) C4'-P energy: -22.400 bonds (distance) P-C4' energy: -16.688 flat angles C4'-P-C4' energy: -14.902 flat angles P-C4'-P energy: -9.975 tors. eta vs tors. theta energy: -10.321 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 161 Temperature: 0.900000 Total energy: -389.007888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.007888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.053927 (E_RNA) where: Base-Base interactions energy: -264.069 where: short stacking energy: -122.734 Base-Backbone interact. energy: -0.727 local terms energy: -124.258445 where: bonds (distance) C4'-P energy: -24.007 bonds (distance) P-C4' energy: -22.526 flat angles C4'-P-C4' energy: -25.973 flat angles P-C4'-P energy: -17.455 tors. eta vs tors. theta energy: -34.297 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 161 Temperature: 0.950000 Total energy: -367.131917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.131917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.167874 (E_RNA) where: Base-Base interactions energy: -243.576 where: short stacking energy: -109.118 Base-Backbone interact. energy: -1.624 local terms energy: -121.967654 where: bonds (distance) C4'-P energy: -21.467 bonds (distance) P-C4' energy: -24.322 flat angles C4'-P-C4' energy: -26.336 flat angles P-C4'-P energy: -22.632 tors. eta vs tors. theta energy: -27.210 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 161 Temperature: 1.000000 Total energy: -355.189721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.189721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.241223 (E_RNA) where: Base-Base interactions energy: -246.424 where: short stacking energy: -123.996 Base-Backbone interact. energy: 1.532 local terms energy: -110.348823 where: bonds (distance) C4'-P energy: -18.991 bonds (distance) P-C4' energy: -23.046 flat angles C4'-P-C4' energy: -22.902 flat angles P-C4'-P energy: -18.330 tors. eta vs tors. theta energy: -27.079 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 161 Temperature: 1.050000 Total energy: -264.024783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.024783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.133310 (E_RNA) where: Base-Base interactions energy: -156.138 where: short stacking energy: -85.296 Base-Backbone interact. energy: -0.242 local terms energy: -107.753710 where: bonds (distance) C4'-P energy: -23.883 bonds (distance) P-C4' energy: -24.645 flat angles C4'-P-C4' energy: -27.533 flat angles P-C4'-P energy: -14.474 tors. eta vs tors. theta energy: -17.219 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 161 Temperature: 1.100000 Total energy: -330.708544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.708544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.833496 (E_RNA) where: Base-Base interactions energy: -221.316 where: short stacking energy: -101.516 Base-Backbone interact. energy: -1.904 local terms energy: -107.614026 where: bonds (distance) C4'-P energy: -21.450 bonds (distance) P-C4' energy: -25.054 flat angles C4'-P-C4' energy: -19.873 flat angles P-C4'-P energy: -16.422 tors. eta vs tors. theta energy: -24.816 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 161 Temperature: 1.150000 Total energy: -309.354485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.354485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.423529 (E_RNA) where: Base-Base interactions energy: -197.183 where: short stacking energy: -97.703 Base-Backbone interact. energy: -1.136 local terms energy: -111.104358 where: bonds (distance) C4'-P energy: -21.086 bonds (distance) P-C4' energy: -23.187 flat angles C4'-P-C4' energy: -27.033 flat angles P-C4'-P energy: -17.564 tors. eta vs tors. theta energy: -22.235 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 161 Temperature: 1.200000 Total energy: -233.848179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.848179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.032731 (E_RNA) where: Base-Base interactions energy: -142.326 where: short stacking energy: -89.087 Base-Backbone interact. energy: 0.373 local terms energy: -92.079193 where: bonds (distance) C4'-P energy: -21.791 bonds (distance) P-C4' energy: -13.684 flat angles C4'-P-C4' energy: -26.404 flat angles P-C4'-P energy: -10.900 tors. eta vs tors. theta energy: -19.299 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 161 Temperature: 1.250000 Total energy: -218.505928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.505928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.505928 (E_RNA) where: Base-Base interactions energy: -126.835 where: short stacking energy: -73.452 Base-Backbone interact. energy: -1.086 local terms energy: -90.584638 where: bonds (distance) C4'-P energy: -22.352 bonds (distance) P-C4' energy: -23.481 flat angles C4'-P-C4' energy: -21.506 flat angles P-C4'-P energy: -5.990 tors. eta vs tors. theta energy: -17.257 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 161 Temperature: 1.300000 Total energy: -216.108789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.108789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.294934 (E_RNA) where: Base-Base interactions energy: -120.454 where: short stacking energy: -71.704 Base-Backbone interact. energy: -0.642 local terms energy: -95.198839 where: bonds (distance) C4'-P energy: -14.694 bonds (distance) P-C4' energy: -28.486 flat angles C4'-P-C4' energy: -24.066 flat angles P-C4'-P energy: -11.466 tors. eta vs tors. theta energy: -16.486 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 161 Temperature: 1.350000 Total energy: -193.380849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.380849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.387996 (E_RNA) where: Base-Base interactions energy: -114.904 where: short stacking energy: -64.995 Base-Backbone interact. energy: 0.337 local terms energy: -78.821242 where: bonds (distance) C4'-P energy: -19.711 bonds (distance) P-C4' energy: -19.636 flat angles C4'-P-C4' energy: -15.008 flat angles P-C4'-P energy: -11.330 tors. eta vs tors. theta energy: -13.136 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 162 Temperature: 0.900000 Total energy: -373.706604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.706604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.811942 (E_RNA) where: Base-Base interactions energy: -256.261 where: short stacking energy: -119.550 Base-Backbone interact. energy: 1.300 local terms energy: -118.851443 where: bonds (distance) C4'-P energy: -20.633 bonds (distance) P-C4' energy: -25.667 flat angles C4'-P-C4' energy: -27.978 flat angles P-C4'-P energy: -14.651 tors. eta vs tors. theta energy: -29.922 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 162 Temperature: 0.950000 Total energy: -369.789635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.789635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.804130 (E_RNA) where: Base-Base interactions energy: -250.588 where: short stacking energy: -122.974 Base-Backbone interact. energy: -0.571 local terms energy: -118.644221 where: bonds (distance) C4'-P energy: -24.593 bonds (distance) P-C4' energy: -22.105 flat angles C4'-P-C4' energy: -25.117 flat angles P-C4'-P energy: -13.339 tors. eta vs tors. theta energy: -33.491 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 162 Temperature: 1.000000 Total energy: -344.968339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.968339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.988231 (E_RNA) where: Base-Base interactions energy: -235.743 where: short stacking energy: -105.176 Base-Backbone interact. energy: -0.404 local terms energy: -108.840677 where: bonds (distance) C4'-P energy: -21.148 bonds (distance) P-C4' energy: -25.565 flat angles C4'-P-C4' energy: -23.407 flat angles P-C4'-P energy: -14.351 tors. eta vs tors. theta energy: -24.370 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 162 Temperature: 1.050000 Total energy: -291.669572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.669572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.764142 (E_RNA) where: Base-Base interactions energy: -187.632 where: short stacking energy: -96.312 Base-Backbone interact. energy: -0.477 local terms energy: -103.655330 where: bonds (distance) C4'-P energy: -23.945 bonds (distance) P-C4' energy: -22.529 flat angles C4'-P-C4' energy: -23.557 flat angles P-C4'-P energy: -9.924 tors. eta vs tors. theta energy: -23.700 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 162 Temperature: 1.100000 Total energy: -321.503487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.503487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.905993 (E_RNA) where: Base-Base interactions energy: -202.768 where: short stacking energy: -98.134 Base-Backbone interact. energy: -0.538 local terms energy: -118.599270 where: bonds (distance) C4'-P energy: -25.297 bonds (distance) P-C4' energy: -26.512 flat angles C4'-P-C4' energy: -26.280 flat angles P-C4'-P energy: -15.359 tors. eta vs tors. theta energy: -25.151 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 162 Temperature: 1.150000 Total energy: -310.741840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.741840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.891123 (E_RNA) where: Base-Base interactions energy: -208.694 where: short stacking energy: -102.806 Base-Backbone interact. energy: -0.443 local terms energy: -101.754039 where: bonds (distance) C4'-P energy: -14.764 bonds (distance) P-C4' energy: -21.327 flat angles C4'-P-C4' energy: -18.891 flat angles P-C4'-P energy: -19.287 tors. eta vs tors. theta energy: -27.485 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 162 Temperature: 1.200000 Total energy: -222.234666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.234666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.460831 (E_RNA) where: Base-Base interactions energy: -140.761 where: short stacking energy: -71.536 Base-Backbone interact. energy: -0.473 local terms energy: -81.227406 where: bonds (distance) C4'-P energy: -18.026 bonds (distance) P-C4' energy: -23.145 flat angles C4'-P-C4' energy: -16.301 flat angles P-C4'-P energy: -11.253 tors. eta vs tors. theta energy: -12.503 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 162 Temperature: 1.250000 Total energy: -220.022672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.022672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.110762 (E_RNA) where: Base-Base interactions energy: -127.816 where: short stacking energy: -68.332 Base-Backbone interact. energy: 0.732 local terms energy: -93.027583 where: bonds (distance) C4'-P energy: -15.222 bonds (distance) P-C4' energy: -25.691 flat angles C4'-P-C4' energy: -20.244 flat angles P-C4'-P energy: -13.953 tors. eta vs tors. theta energy: -17.917 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 162 Temperature: 1.300000 Total energy: -200.093464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.093464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.339513 (E_RNA) where: Base-Base interactions energy: -116.979 where: short stacking energy: -64.044 Base-Backbone interact. energy: -0.545 local terms energy: -82.814920 where: bonds (distance) C4'-P energy: -21.871 bonds (distance) P-C4' energy: -24.842 flat angles C4'-P-C4' energy: -13.779 flat angles P-C4'-P energy: -13.538 tors. eta vs tors. theta energy: -8.784 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 162 Temperature: 1.350000 Total energy: -202.932689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.932689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.983166 (E_RNA) where: Base-Base interactions energy: -119.491 where: short stacking energy: -65.320 Base-Backbone interact. energy: -0.995 local terms energy: -82.497066 where: bonds (distance) C4'-P energy: -20.080 bonds (distance) P-C4' energy: -20.471 flat angles C4'-P-C4' energy: -19.396 flat angles P-C4'-P energy: -18.010 tors. eta vs tors. theta energy: -4.541 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 163 Temperature: 0.900000 Total energy: -373.620907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.620907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.712521 (E_RNA) where: Base-Base interactions energy: -254.566 where: short stacking energy: -121.718 Base-Backbone interact. energy: -0.316 local terms energy: -118.831063 where: bonds (distance) C4'-P energy: -26.498 bonds (distance) P-C4' energy: -23.000 flat angles C4'-P-C4' energy: -28.392 flat angles P-C4'-P energy: -12.275 tors. eta vs tors. theta energy: -28.667 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 163 Temperature: 0.950000 Total energy: -364.747809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.747809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.790254 (E_RNA) where: Base-Base interactions energy: -237.001 where: short stacking energy: -116.861 Base-Backbone interact. energy: -0.206 local terms energy: -127.583133 where: bonds (distance) C4'-P energy: -22.662 bonds (distance) P-C4' energy: -29.138 flat angles C4'-P-C4' energy: -26.845 flat angles P-C4'-P energy: -20.442 tors. eta vs tors. theta energy: -28.496 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 163 Temperature: 1.000000 Total energy: -344.820406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.820406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.845310 (E_RNA) where: Base-Base interactions energy: -222.746 where: short stacking energy: -109.570 Base-Backbone interact. energy: -0.439 local terms energy: -121.660556 where: bonds (distance) C4'-P energy: -24.828 bonds (distance) P-C4' energy: -27.173 flat angles C4'-P-C4' energy: -21.733 flat angles P-C4'-P energy: -18.629 tors. eta vs tors. theta energy: -29.297 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 163 Temperature: 1.050000 Total energy: -322.201061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.201061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.219925 (E_RNA) where: Base-Base interactions energy: -218.297 where: short stacking energy: -110.044 Base-Backbone interact. energy: -0.103 local terms energy: -103.819975 where: bonds (distance) C4'-P energy: -17.364 bonds (distance) P-C4' energy: -21.773 flat angles C4'-P-C4' energy: -18.796 flat angles P-C4'-P energy: -20.356 tors. eta vs tors. theta energy: -25.531 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 163 Temperature: 1.100000 Total energy: -284.368657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.368657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.374414 (E_RNA) where: Base-Base interactions energy: -175.945 where: short stacking energy: -98.333 Base-Backbone interact. energy: -0.439 local terms energy: -107.990066 where: bonds (distance) C4'-P energy: -21.987 bonds (distance) P-C4' energy: -22.801 flat angles C4'-P-C4' energy: -24.152 flat angles P-C4'-P energy: -15.419 tors. eta vs tors. theta energy: -23.632 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 163 Temperature: 1.150000 Total energy: -322.083007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.083007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.083007 (E_RNA) where: Base-Base interactions energy: -215.052 where: short stacking energy: -106.167 Base-Backbone interact. energy: -0.836 local terms energy: -106.194637 where: bonds (distance) C4'-P energy: -25.510 bonds (distance) P-C4' energy: -16.346 flat angles C4'-P-C4' energy: -22.959 flat angles P-C4'-P energy: -12.461 tors. eta vs tors. theta energy: -28.918 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 163 Temperature: 1.200000 Total energy: -223.575001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.575001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.615051 (E_RNA) where: Base-Base interactions energy: -136.385 where: short stacking energy: -74.209 Base-Backbone interact. energy: 0.156 local terms energy: -87.386349 where: bonds (distance) C4'-P energy: -18.040 bonds (distance) P-C4' energy: -18.825 flat angles C4'-P-C4' energy: -22.428 flat angles P-C4'-P energy: -18.004 tors. eta vs tors. theta energy: -10.089 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 163 Temperature: 1.250000 Total energy: -207.879419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.879419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.968881 (E_RNA) where: Base-Base interactions energy: -113.802 where: short stacking energy: -66.408 Base-Backbone interact. energy: -0.217 local terms energy: -93.949740 where: bonds (distance) C4'-P energy: -19.110 bonds (distance) P-C4' energy: -23.447 flat angles C4'-P-C4' energy: -20.531 flat angles P-C4'-P energy: -12.849 tors. eta vs tors. theta energy: -18.013 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 163 Temperature: 1.300000 Total energy: -216.464762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.464762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.475039 (E_RNA) where: Base-Base interactions energy: -119.049 where: short stacking energy: -68.227 Base-Backbone interact. energy: -0.104 local terms energy: -97.322205 where: bonds (distance) C4'-P energy: -25.094 bonds (distance) P-C4' energy: -26.505 flat angles C4'-P-C4' energy: -16.261 flat angles P-C4'-P energy: -15.033 tors. eta vs tors. theta energy: -14.430 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 163 Temperature: 1.350000 Total energy: -208.296390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.296390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.419386 (E_RNA) where: Base-Base interactions energy: -118.185 where: short stacking energy: -59.877 Base-Backbone interact. energy: 0.219 local terms energy: -90.453070 where: bonds (distance) C4'-P energy: -22.927 bonds (distance) P-C4' energy: -25.038 flat angles C4'-P-C4' energy: -21.846 flat angles P-C4'-P energy: -14.054 tors. eta vs tors. theta energy: -6.587 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 164 Temperature: 0.900000 Total energy: -370.990622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.990622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.990622 (E_RNA) where: Base-Base interactions energy: -258.111 where: short stacking energy: -126.579 Base-Backbone interact. energy: 3.114 local terms energy: -115.993664 where: bonds (distance) C4'-P energy: -19.425 bonds (distance) P-C4' energy: -19.975 flat angles C4'-P-C4' energy: -25.238 flat angles P-C4'-P energy: -19.870 tors. eta vs tors. theta energy: -31.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 164 Temperature: 0.950000 Total energy: -366.637955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.637955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.655270 (E_RNA) where: Base-Base interactions energy: -248.672 where: short stacking energy: -110.985 Base-Backbone interact. energy: -0.259 local terms energy: -117.724385 where: bonds (distance) C4'-P energy: -22.058 bonds (distance) P-C4' energy: -23.967 flat angles C4'-P-C4' energy: -25.544 flat angles P-C4'-P energy: -20.967 tors. eta vs tors. theta energy: -25.187 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 164 Temperature: 1.000000 Total energy: -364.100558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.100558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.181096 (E_RNA) where: Base-Base interactions energy: -239.975 where: short stacking energy: -112.266 Base-Backbone interact. energy: -0.865 local terms energy: -123.341216 where: bonds (distance) C4'-P energy: -28.401 bonds (distance) P-C4' energy: -26.996 flat angles C4'-P-C4' energy: -25.848 flat angles P-C4'-P energy: -15.563 tors. eta vs tors. theta energy: -26.533 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 164 Temperature: 1.050000 Total energy: -321.430757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.430757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.481955 (E_RNA) where: Base-Base interactions energy: -207.963 where: short stacking energy: -107.121 Base-Backbone interact. energy: -0.522 local terms energy: -112.996800 where: bonds (distance) C4'-P energy: -23.999 bonds (distance) P-C4' energy: -26.602 flat angles C4'-P-C4' energy: -23.942 flat angles P-C4'-P energy: -11.187 tors. eta vs tors. theta energy: -27.266 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 164 Temperature: 1.100000 Total energy: -342.876816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.876816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.941929 (E_RNA) where: Base-Base interactions energy: -228.190 where: short stacking energy: -107.775 Base-Backbone interact. energy: -0.211 local terms energy: -114.540444 where: bonds (distance) C4'-P energy: -23.499 bonds (distance) P-C4' energy: -23.853 flat angles C4'-P-C4' energy: -26.399 flat angles P-C4'-P energy: -11.626 tors. eta vs tors. theta energy: -29.164 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 164 Temperature: 1.150000 Total energy: -248.036449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.036449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.038755 (E_RNA) where: Base-Base interactions energy: -144.130 where: short stacking energy: -86.629 Base-Backbone interact. energy: -1.114 local terms energy: -102.794399 where: bonds (distance) C4'-P energy: -22.555 bonds (distance) P-C4' energy: -18.400 flat angles C4'-P-C4' energy: -21.220 flat angles P-C4'-P energy: -20.380 tors. eta vs tors. theta energy: -20.240 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 164 Temperature: 1.200000 Total energy: -237.557570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.557570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.626906 (E_RNA) where: Base-Base interactions energy: -138.975 where: short stacking energy: -85.313 Base-Backbone interact. energy: 1.637 local terms energy: -100.289077 where: bonds (distance) C4'-P energy: -17.185 bonds (distance) P-C4' energy: -19.384 flat angles C4'-P-C4' energy: -27.961 flat angles P-C4'-P energy: -13.832 tors. eta vs tors. theta energy: -21.926 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 164 Temperature: 1.250000 Total energy: -224.437515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.437515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.437515 (E_RNA) where: Base-Base interactions energy: -142.789 where: short stacking energy: -82.143 Base-Backbone interact. energy: -0.485 local terms energy: -81.163882 where: bonds (distance) C4'-P energy: -17.637 bonds (distance) P-C4' energy: -17.627 flat angles C4'-P-C4' energy: -15.115 flat angles P-C4'-P energy: -14.618 tors. eta vs tors. theta energy: -16.166 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 164 Temperature: 1.300000 Total energy: -212.065684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.065684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.099736 (E_RNA) where: Base-Base interactions energy: -131.710 where: short stacking energy: -75.215 Base-Backbone interact. energy: -0.445 local terms energy: -79.944876 where: bonds (distance) C4'-P energy: -6.364 bonds (distance) P-C4' energy: -25.157 flat angles C4'-P-C4' energy: -21.672 flat angles P-C4'-P energy: -11.893 tors. eta vs tors. theta energy: -14.860 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 164 Temperature: 1.350000 Total energy: -206.654993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.654993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.654993 (E_RNA) where: Base-Base interactions energy: -131.881 where: short stacking energy: -79.206 Base-Backbone interact. energy: -0.041 local terms energy: -74.732525 where: bonds (distance) C4'-P energy: -14.424 bonds (distance) P-C4' energy: -11.409 flat angles C4'-P-C4' energy: -24.030 flat angles P-C4'-P energy: -15.080 tors. eta vs tors. theta energy: -9.789 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 165 Temperature: 0.900000 Total energy: -379.027728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.027728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.027728 (E_RNA) where: Base-Base interactions energy: -256.012 where: short stacking energy: -117.444 Base-Backbone interact. energy: -1.463 local terms energy: -121.552572 where: bonds (distance) C4'-P energy: -23.693 bonds (distance) P-C4' energy: -22.949 flat angles C4'-P-C4' energy: -28.704 flat angles P-C4'-P energy: -18.216 tors. eta vs tors. theta energy: -27.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 165 Temperature: 0.950000 Total energy: -363.291037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.291037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.309174 (E_RNA) where: Base-Base interactions energy: -240.400 where: short stacking energy: -113.846 Base-Backbone interact. energy: -1.011 local terms energy: -121.898556 where: bonds (distance) C4'-P energy: -25.181 bonds (distance) P-C4' energy: -21.001 flat angles C4'-P-C4' energy: -28.862 flat angles P-C4'-P energy: -15.443 tors. eta vs tors. theta energy: -31.412 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 165 Temperature: 1.000000 Total energy: -355.620012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.620012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.643192 (E_RNA) where: Base-Base interactions energy: -247.107 where: short stacking energy: -109.742 Base-Backbone interact. energy: -1.291 local terms energy: -107.244771 where: bonds (distance) C4'-P energy: -16.081 bonds (distance) P-C4' energy: -21.147 flat angles C4'-P-C4' energy: -28.075 flat angles P-C4'-P energy: -15.261 tors. eta vs tors. theta energy: -26.680 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 165 Temperature: 1.050000 Total energy: -353.578550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.578550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.654801 (E_RNA) where: Base-Base interactions energy: -230.681 where: short stacking energy: -115.315 Base-Backbone interact. energy: -0.451 local terms energy: -122.522555 where: bonds (distance) C4'-P energy: -26.415 bonds (distance) P-C4' energy: -28.454 flat angles C4'-P-C4' energy: -25.433 flat angles P-C4'-P energy: -15.389 tors. eta vs tors. theta energy: -26.831 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 165 Temperature: 1.100000 Total energy: -305.470299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.470299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.518503 (E_RNA) where: Base-Base interactions energy: -205.554 where: short stacking energy: -97.857 Base-Backbone interact. energy: -0.129 local terms energy: -99.834571 where: bonds (distance) C4'-P energy: -17.066 bonds (distance) P-C4' energy: -22.890 flat angles C4'-P-C4' energy: -20.818 flat angles P-C4'-P energy: -14.497 tors. eta vs tors. theta energy: -24.564 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 165 Temperature: 1.150000 Total energy: -231.856468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.856468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.861349 (E_RNA) where: Base-Base interactions energy: -141.436 where: short stacking energy: -82.369 Base-Backbone interact. energy: 0.137 local terms energy: -90.562443 where: bonds (distance) C4'-P energy: -19.720 bonds (distance) P-C4' energy: -25.085 flat angles C4'-P-C4' energy: -20.390 flat angles P-C4'-P energy: -6.992 tors. eta vs tors. theta energy: -18.376 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 165 Temperature: 1.200000 Total energy: -229.328596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.328596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.498839 (E_RNA) where: Base-Base interactions energy: -129.213 where: short stacking energy: -77.771 Base-Backbone interact. energy: -0.543 local terms energy: -99.742356 where: bonds (distance) C4'-P energy: -17.605 bonds (distance) P-C4' energy: -28.580 flat angles C4'-P-C4' energy: -21.649 flat angles P-C4'-P energy: -16.240 tors. eta vs tors. theta energy: -15.669 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 165 Temperature: 1.250000 Total energy: -214.661768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.661768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.726463 (E_RNA) where: Base-Base interactions energy: -132.017 where: short stacking energy: -74.982 Base-Backbone interact. energy: 0.094 local terms energy: -82.802935 where: bonds (distance) C4'-P energy: -21.887 bonds (distance) P-C4' energy: -19.393 flat angles C4'-P-C4' energy: -22.179 flat angles P-C4'-P energy: -4.839 tors. eta vs tors. theta energy: -14.505 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 165 Temperature: 1.300000 Total energy: -206.469066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.469066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.597041 (E_RNA) where: Base-Base interactions energy: -125.148 where: short stacking energy: -68.062 Base-Backbone interact. energy: -1.175 local terms energy: -80.274665 where: bonds (distance) C4'-P energy: -13.934 bonds (distance) P-C4' energy: -19.112 flat angles C4'-P-C4' energy: -16.081 flat angles P-C4'-P energy: -18.662 tors. eta vs tors. theta energy: -12.485 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 165 Temperature: 1.350000 Total energy: -209.788057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.788057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.864397 (E_RNA) where: Base-Base interactions energy: -115.285 where: short stacking energy: -61.310 Base-Backbone interact. energy: -2.119 local terms energy: -92.460763 where: bonds (distance) C4'-P energy: -24.453 bonds (distance) P-C4' energy: -20.826 flat angles C4'-P-C4' energy: -25.141 flat angles P-C4'-P energy: -12.489 tors. eta vs tors. theta energy: -9.551 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 166 Temperature: 0.900000 Total energy: -371.756040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.756040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.792942 (E_RNA) where: Base-Base interactions energy: -248.639 where: short stacking energy: -114.835 Base-Backbone interact. energy: -0.633 local terms energy: -122.520156 where: bonds (distance) C4'-P energy: -23.904 bonds (distance) P-C4' energy: -24.903 flat angles C4'-P-C4' energy: -26.029 flat angles P-C4'-P energy: -19.667 tors. eta vs tors. theta energy: -28.017 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 166 Temperature: 0.950000 Total energy: -369.130403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.130403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.171273 (E_RNA) where: Base-Base interactions energy: -237.141 where: short stacking energy: -130.175 Base-Backbone interact. energy: -0.567 local terms energy: -131.463149 where: bonds (distance) C4'-P energy: -22.460 bonds (distance) P-C4' energy: -27.043 flat angles C4'-P-C4' energy: -30.349 flat angles P-C4'-P energy: -18.560 tors. eta vs tors. theta energy: -33.051 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 166 Temperature: 1.000000 Total energy: -360.279197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.279197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.295578 (E_RNA) where: Base-Base interactions energy: -248.130 where: short stacking energy: -109.374 Base-Backbone interact. energy: -0.750 local terms energy: -111.415358 where: bonds (distance) C4'-P energy: -21.479 bonds (distance) P-C4' energy: -22.603 flat angles C4'-P-C4' energy: -26.959 flat angles P-C4'-P energy: -16.875 tors. eta vs tors. theta energy: -23.500 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 166 Temperature: 1.050000 Total energy: -332.493638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.493638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.505270 (E_RNA) where: Base-Base interactions energy: -212.760 where: short stacking energy: -108.406 Base-Backbone interact. energy: -1.407 local terms energy: -118.338452 where: bonds (distance) C4'-P energy: -21.089 bonds (distance) P-C4' energy: -24.852 flat angles C4'-P-C4' energy: -23.177 flat angles P-C4'-P energy: -18.870 tors. eta vs tors. theta energy: -30.351 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 166 Temperature: 1.100000 Total energy: -295.404675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.404675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.404675 (E_RNA) where: Base-Base interactions energy: -185.052 where: short stacking energy: -90.240 Base-Backbone interact. energy: -0.749 local terms energy: -109.603892 where: bonds (distance) C4'-P energy: -24.484 bonds (distance) P-C4' energy: -25.977 flat angles C4'-P-C4' energy: -22.958 flat angles P-C4'-P energy: -14.969 tors. eta vs tors. theta energy: -21.216 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 166 Temperature: 1.150000 Total energy: -240.631840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.631840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.658118 (E_RNA) where: Base-Base interactions energy: -153.764 where: short stacking energy: -92.041 Base-Backbone interact. energy: -1.314 local terms energy: -85.580222 where: bonds (distance) C4'-P energy: -24.361 bonds (distance) P-C4' energy: -17.409 flat angles C4'-P-C4' energy: -17.073 flat angles P-C4'-P energy: -8.295 tors. eta vs tors. theta energy: -18.442 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 166 Temperature: 1.200000 Total energy: -230.848013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.848013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.999025 (E_RNA) where: Base-Base interactions energy: -141.692 where: short stacking energy: -76.999 Base-Backbone interact. energy: -0.938 local terms energy: -88.369280 where: bonds (distance) C4'-P energy: -16.639 bonds (distance) P-C4' energy: -22.068 flat angles C4'-P-C4' energy: -22.157 flat angles P-C4'-P energy: -9.918 tors. eta vs tors. theta energy: -17.587 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 166 Temperature: 1.250000 Total energy: -218.561686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.561686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.572314 (E_RNA) where: Base-Base interactions energy: -128.713 where: short stacking energy: -70.536 Base-Backbone interact. energy: -0.129 local terms energy: -89.730789 where: bonds (distance) C4'-P energy: -23.580 bonds (distance) P-C4' energy: -24.572 flat angles C4'-P-C4' energy: -18.882 flat angles P-C4'-P energy: -13.331 tors. eta vs tors. theta energy: -9.366 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 166 Temperature: 1.300000 Total energy: -205.374900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.374900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.397027 (E_RNA) where: Base-Base interactions energy: -119.726 where: short stacking energy: -62.958 Base-Backbone interact. energy: 0.515 local terms energy: -86.185257 where: bonds (distance) C4'-P energy: -18.548 bonds (distance) P-C4' energy: -25.963 flat angles C4'-P-C4' energy: -19.421 flat angles P-C4'-P energy: -15.381 tors. eta vs tors. theta energy: -6.871 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 166 Temperature: 1.350000 Total energy: -194.947713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.947713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.076166 (E_RNA) where: Base-Base interactions energy: -116.625 where: short stacking energy: -71.203 Base-Backbone interact. energy: 0.457 local terms energy: -78.907918 where: bonds (distance) C4'-P energy: -14.902 bonds (distance) P-C4' energy: -23.841 flat angles C4'-P-C4' energy: -19.209 flat angles P-C4'-P energy: -9.865 tors. eta vs tors. theta energy: -11.091 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 167 Temperature: 0.900000 Total energy: -372.794189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.794189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.846280 (E_RNA) where: Base-Base interactions energy: -247.311 where: short stacking energy: -123.770 Base-Backbone interact. energy: 0.076 local terms energy: -125.610423 where: bonds (distance) C4'-P energy: -25.076 bonds (distance) P-C4' energy: -27.874 flat angles C4'-P-C4' energy: -23.837 flat angles P-C4'-P energy: -17.090 tors. eta vs tors. theta energy: -31.733 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 167 Temperature: 0.950000 Total energy: -357.755202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.755202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.827801 (E_RNA) where: Base-Base interactions energy: -234.713 where: short stacking energy: -118.832 Base-Backbone interact. energy: -0.858 local terms energy: -122.256367 where: bonds (distance) C4'-P energy: -21.240 bonds (distance) P-C4' energy: -22.930 flat angles C4'-P-C4' energy: -29.254 flat angles P-C4'-P energy: -16.089 tors. eta vs tors. theta energy: -32.744 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 167 Temperature: 1.000000 Total energy: -367.204686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.204686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.211660 (E_RNA) where: Base-Base interactions energy: -252.880 where: short stacking energy: -106.372 Base-Backbone interact. energy: -0.349 local terms energy: -113.982766 where: bonds (distance) C4'-P energy: -21.873 bonds (distance) P-C4' energy: -26.710 flat angles C4'-P-C4' energy: -24.110 flat angles P-C4'-P energy: -16.557 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 167 Temperature: 1.050000 Total energy: -341.806617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.806617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.849188 (E_RNA) where: Base-Base interactions energy: -227.201 where: short stacking energy: -109.438 Base-Backbone interact. energy: -0.866 local terms energy: -113.782147 where: bonds (distance) C4'-P energy: -20.183 bonds (distance) P-C4' energy: -22.449 flat angles C4'-P-C4' energy: -23.187 flat angles P-C4'-P energy: -19.923 tors. eta vs tors. theta energy: -28.040 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 167 Temperature: 1.100000 Total energy: -305.652909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.652909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.772735 (E_RNA) where: Base-Base interactions energy: -198.899 where: short stacking energy: -101.419 Base-Backbone interact. energy: -0.471 local terms energy: -106.402126 where: bonds (distance) C4'-P energy: -20.291 bonds (distance) P-C4' energy: -24.404 flat angles C4'-P-C4' energy: -19.719 flat angles P-C4'-P energy: -14.964 tors. eta vs tors. theta energy: -27.024 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 167 Temperature: 1.150000 Total energy: -238.008644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.008644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.020748 (E_RNA) where: Base-Base interactions energy: -145.205 where: short stacking energy: -88.191 Base-Backbone interact. energy: -0.078 local terms energy: -92.738401 where: bonds (distance) C4'-P energy: -15.941 bonds (distance) P-C4' energy: -25.813 flat angles C4'-P-C4' energy: -21.601 flat angles P-C4'-P energy: -11.831 tors. eta vs tors. theta energy: -17.552 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 167 Temperature: 1.200000 Total energy: -236.097954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.097954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.209874 (E_RNA) where: Base-Base interactions energy: -145.608 where: short stacking energy: -83.638 Base-Backbone interact. energy: -0.127 local terms energy: -90.475419 where: bonds (distance) C4'-P energy: -16.609 bonds (distance) P-C4' energy: -17.762 flat angles C4'-P-C4' energy: -24.629 flat angles P-C4'-P energy: -10.601 tors. eta vs tors. theta energy: -20.876 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 167 Temperature: 1.250000 Total energy: -211.505275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.505275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.548202 (E_RNA) where: Base-Base interactions energy: -130.472 where: short stacking energy: -68.058 Base-Backbone interact. energy: -0.960 local terms energy: -80.115895 where: bonds (distance) C4'-P energy: -22.469 bonds (distance) P-C4' energy: -20.551 flat angles C4'-P-C4' energy: -16.660 flat angles P-C4'-P energy: -13.243 tors. eta vs tors. theta energy: -7.193 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 167 Temperature: 1.300000 Total energy: -215.844186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.844186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.001989 (E_RNA) where: Base-Base interactions energy: -126.378 where: short stacking energy: -72.239 Base-Backbone interact. energy: -0.493 local terms energy: -89.130780 where: bonds (distance) C4'-P energy: -15.552 bonds (distance) P-C4' energy: -23.532 flat angles C4'-P-C4' energy: -25.404 flat angles P-C4'-P energy: -8.559 tors. eta vs tors. theta energy: -16.083 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 167 Temperature: 1.350000 Total energy: -204.025384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.025384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.149061 (E_RNA) where: Base-Base interactions energy: -124.942 where: short stacking energy: -67.947 Base-Backbone interact. energy: -0.051 local terms energy: -79.156205 where: bonds (distance) C4'-P energy: -21.543 bonds (distance) P-C4' energy: -15.754 flat angles C4'-P-C4' energy: -17.610 flat angles P-C4'-P energy: -13.597 tors. eta vs tors. theta energy: -10.652 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 168 Temperature: 0.900000 Total energy: -373.944558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.944558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.987796 (E_RNA) where: Base-Base interactions energy: -246.451 where: short stacking energy: -122.937 Base-Backbone interact. energy: -0.602 local terms energy: -126.934145 where: bonds (distance) C4'-P energy: -24.446 bonds (distance) P-C4' energy: -29.371 flat angles C4'-P-C4' energy: -27.269 flat angles P-C4'-P energy: -17.331 tors. eta vs tors. theta energy: -28.517 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 168 Temperature: 0.950000 Total energy: -361.490436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.490436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.570941 (E_RNA) where: Base-Base interactions energy: -225.260 where: short stacking energy: -110.844 Base-Backbone interact. energy: -0.360 local terms energy: -135.950413 where: bonds (distance) C4'-P energy: -24.671 bonds (distance) P-C4' energy: -24.092 flat angles C4'-P-C4' energy: -28.865 flat angles P-C4'-P energy: -20.506 tors. eta vs tors. theta energy: -37.817 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 168 Temperature: 1.000000 Total energy: -380.614503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.614503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.706076 (E_RNA) where: Base-Base interactions energy: -264.318 where: short stacking energy: -112.001 Base-Backbone interact. energy: -0.372 local terms energy: -116.015611 where: bonds (distance) C4'-P energy: -22.898 bonds (distance) P-C4' energy: -22.733 flat angles C4'-P-C4' energy: -26.762 flat angles P-C4'-P energy: -10.990 tors. eta vs tors. theta energy: -32.632 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 168 Temperature: 1.050000 Total energy: -342.069617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.069617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.089578 (E_RNA) where: Base-Base interactions energy: -220.913 where: short stacking energy: -105.434 Base-Backbone interact. energy: 1.834 local terms energy: -123.009697 where: bonds (distance) C4'-P energy: -22.015 bonds (distance) P-C4' energy: -25.520 flat angles C4'-P-C4' energy: -27.409 flat angles P-C4'-P energy: -16.070 tors. eta vs tors. theta energy: -31.995 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 168 Temperature: 1.100000 Total energy: -321.234520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.234520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.343463 (E_RNA) where: Base-Base interactions energy: -215.113 where: short stacking energy: -108.167 Base-Backbone interact. energy: -0.134 local terms energy: -106.096462 where: bonds (distance) C4'-P energy: -23.470 bonds (distance) P-C4' energy: -21.280 flat angles C4'-P-C4' energy: -19.669 flat angles P-C4'-P energy: -16.569 tors. eta vs tors. theta energy: -25.108 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 168 Temperature: 1.150000 Total energy: -231.458350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.458350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.468417 (E_RNA) where: Base-Base interactions energy: -131.376 where: short stacking energy: -81.347 Base-Backbone interact. energy: -0.605 local terms energy: -99.487071 where: bonds (distance) C4'-P energy: -20.700 bonds (distance) P-C4' energy: -25.436 flat angles C4'-P-C4' energy: -20.463 flat angles P-C4'-P energy: -12.169 tors. eta vs tors. theta energy: -20.720 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 168 Temperature: 1.200000 Total energy: -221.604917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.604917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.655317 (E_RNA) where: Base-Base interactions energy: -129.955 where: short stacking energy: -71.421 Base-Backbone interact. energy: -0.482 local terms energy: -91.218727 where: bonds (distance) C4'-P energy: -19.856 bonds (distance) P-C4' energy: -25.945 flat angles C4'-P-C4' energy: -20.172 flat angles P-C4'-P energy: -12.487 tors. eta vs tors. theta energy: -12.758 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 168 Temperature: 1.250000 Total energy: -219.269966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.269966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.295875 (E_RNA) where: Base-Base interactions energy: -120.308 where: short stacking energy: -68.565 Base-Backbone interact. energy: -1.736 local terms energy: -97.252376 where: bonds (distance) C4'-P energy: -22.104 bonds (distance) P-C4' energy: -22.179 flat angles C4'-P-C4' energy: -23.964 flat angles P-C4'-P energy: -13.485 tors. eta vs tors. theta energy: -15.521 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 168 Temperature: 1.300000 Total energy: -222.745314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.745314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.942280 (E_RNA) where: Base-Base interactions energy: -128.292 where: short stacking energy: -73.789 Base-Backbone interact. energy: -3.162 local terms energy: -91.488687 where: bonds (distance) C4'-P energy: -21.133 bonds (distance) P-C4' energy: -19.405 flat angles C4'-P-C4' energy: -23.447 flat angles P-C4'-P energy: -12.401 tors. eta vs tors. theta energy: -15.103 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 168 Temperature: 1.350000 Total energy: -187.938997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.938997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.049818 (E_RNA) where: Base-Base interactions energy: -113.219 where: short stacking energy: -65.810 Base-Backbone interact. energy: -1.680 local terms energy: -73.151023 where: bonds (distance) C4'-P energy: -19.483 bonds (distance) P-C4' energy: -11.749 flat angles C4'-P-C4' energy: -21.482 flat angles P-C4'-P energy: -12.698 tors. eta vs tors. theta energy: -7.738 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 169 Temperature: 0.900000 Total energy: -363.604917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.604917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.604917 (E_RNA) where: Base-Base interactions energy: -248.374 where: short stacking energy: -116.349 Base-Backbone interact. energy: -0.808 local terms energy: -114.422480 where: bonds (distance) C4'-P energy: -21.706 bonds (distance) P-C4' energy: -25.775 flat angles C4'-P-C4' energy: -24.527 flat angles P-C4'-P energy: -13.658 tors. eta vs tors. theta energy: -28.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 169 Temperature: 0.950000 Total energy: -375.836707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.836707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.879124 (E_RNA) where: Base-Base interactions energy: -258.061 where: short stacking energy: -124.879 Base-Backbone interact. energy: -1.110 local terms energy: -116.708706 where: bonds (distance) C4'-P energy: -26.099 bonds (distance) P-C4' energy: -20.808 flat angles C4'-P-C4' energy: -25.196 flat angles P-C4'-P energy: -11.805 tors. eta vs tors. theta energy: -32.801 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 169 Temperature: 1.000000 Total energy: -349.153697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.153697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.228200 (E_RNA) where: Base-Base interactions energy: -225.919 where: short stacking energy: -118.136 Base-Backbone interact. energy: -1.173 local terms energy: -122.136798 where: bonds (distance) C4'-P energy: -21.256 bonds (distance) P-C4' energy: -25.385 flat angles C4'-P-C4' energy: -25.531 flat angles P-C4'-P energy: -15.654 tors. eta vs tors. theta energy: -34.312 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 169 Temperature: 1.050000 Total energy: -319.682315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.682315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.807752 (E_RNA) where: Base-Base interactions energy: -202.573 where: short stacking energy: -99.104 Base-Backbone interact. energy: -0.131 local terms energy: -117.104013 where: bonds (distance) C4'-P energy: -25.365 bonds (distance) P-C4' energy: -25.960 flat angles C4'-P-C4' energy: -25.704 flat angles P-C4'-P energy: -13.917 tors. eta vs tors. theta energy: -26.159 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 169 Temperature: 1.100000 Total energy: -324.719658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.719658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.738886 (E_RNA) where: Base-Base interactions energy: -214.488 where: short stacking energy: -102.725 Base-Backbone interact. energy: -0.841 local terms energy: -109.409680 where: bonds (distance) C4'-P energy: -25.362 bonds (distance) P-C4' energy: -19.931 flat angles C4'-P-C4' energy: -22.563 flat angles P-C4'-P energy: -15.593 tors. eta vs tors. theta energy: -25.960 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 169 Temperature: 1.150000 Total energy: -240.085296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.085296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.515093 (E_RNA) where: Base-Base interactions energy: -141.336 where: short stacking energy: -83.979 Base-Backbone interact. energy: -0.545 local terms energy: -98.634452 where: bonds (distance) C4'-P energy: -20.473 bonds (distance) P-C4' energy: -23.636 flat angles C4'-P-C4' energy: -18.666 flat angles P-C4'-P energy: -16.775 tors. eta vs tors. theta energy: -19.084 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 169 Temperature: 1.200000 Total energy: -235.770763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.770763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.858142 (E_RNA) where: Base-Base interactions energy: -139.262 where: short stacking energy: -73.339 Base-Backbone interact. energy: -0.606 local terms energy: -95.990076 where: bonds (distance) C4'-P energy: -19.131 bonds (distance) P-C4' energy: -24.225 flat angles C4'-P-C4' energy: -24.413 flat angles P-C4'-P energy: -12.496 tors. eta vs tors. theta energy: -15.725 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 169 Temperature: 1.250000 Total energy: -248.242441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.242441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.280962 (E_RNA) where: Base-Base interactions energy: -161.560 where: short stacking energy: -80.380 Base-Backbone interact. energy: -0.060 local terms energy: -86.660739 where: bonds (distance) C4'-P energy: -10.644 bonds (distance) P-C4' energy: -24.870 flat angles C4'-P-C4' energy: -23.295 flat angles P-C4'-P energy: -10.871 tors. eta vs tors. theta energy: -16.980 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 169 Temperature: 1.300000 Total energy: -215.236506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.236506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.252026 (E_RNA) where: Base-Base interactions energy: -128.308 where: short stacking energy: -70.956 Base-Backbone interact. energy: -0.212 local terms energy: -86.731177 where: bonds (distance) C4'-P energy: -23.980 bonds (distance) P-C4' energy: -19.384 flat angles C4'-P-C4' energy: -16.061 flat angles P-C4'-P energy: -13.308 tors. eta vs tors. theta energy: -13.999 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 169 Temperature: 1.350000 Total energy: -204.703596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.703596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.822233 (E_RNA) where: Base-Base interactions energy: -115.179 where: short stacking energy: -58.225 Base-Backbone interact. energy: -0.171 local terms energy: -89.471851 where: bonds (distance) C4'-P energy: -18.676 bonds (distance) P-C4' energy: -22.712 flat angles C4'-P-C4' energy: -24.485 flat angles P-C4'-P energy: -12.134 tors. eta vs tors. theta energy: -11.465 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 170 Temperature: 0.900000 Total energy: -379.231953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.231953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.295673 (E_RNA) where: Base-Base interactions energy: -264.867 where: short stacking energy: -109.259 Base-Backbone interact. energy: -0.934 local terms energy: -113.494684 where: bonds (distance) C4'-P energy: -21.220 bonds (distance) P-C4' energy: -25.694 flat angles C4'-P-C4' energy: -26.256 flat angles P-C4'-P energy: -14.854 tors. eta vs tors. theta energy: -25.471 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 170 Temperature: 0.950000 Total energy: -363.701307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.701307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.701307 (E_RNA) where: Base-Base interactions energy: -244.663 where: short stacking energy: -121.350 Base-Backbone interact. energy: -0.323 local terms energy: -118.714532 where: bonds (distance) C4'-P energy: -25.093 bonds (distance) P-C4' energy: -25.105 flat angles C4'-P-C4' energy: -26.279 flat angles P-C4'-P energy: -15.287 tors. eta vs tors. theta energy: -26.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 170 Temperature: 1.000000 Total energy: -350.576834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.576834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.797364 (E_RNA) where: Base-Base interactions energy: -235.109 where: short stacking energy: -107.836 Base-Backbone interact. energy: -0.255 local terms energy: -115.433087 where: bonds (distance) C4'-P energy: -18.418 bonds (distance) P-C4' energy: -20.975 flat angles C4'-P-C4' energy: -27.508 flat angles P-C4'-P energy: -18.164 tors. eta vs tors. theta energy: -30.368 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 170 Temperature: 1.050000 Total energy: -325.713693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.713693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.771095 (E_RNA) where: Base-Base interactions energy: -207.956 where: short stacking energy: -105.822 Base-Backbone interact. energy: -0.289 local terms energy: -117.526090 where: bonds (distance) C4'-P energy: -23.767 bonds (distance) P-C4' energy: -27.174 flat angles C4'-P-C4' energy: -22.092 flat angles P-C4'-P energy: -16.475 tors. eta vs tors. theta energy: -28.018 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 170 Temperature: 1.100000 Total energy: -322.473276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.473276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.529582 (E_RNA) where: Base-Base interactions energy: -213.859 where: short stacking energy: -101.039 Base-Backbone interact. energy: -0.476 local terms energy: -108.193865 where: bonds (distance) C4'-P energy: -18.635 bonds (distance) P-C4' energy: -24.058 flat angles C4'-P-C4' energy: -23.614 flat angles P-C4'-P energy: -14.263 tors. eta vs tors. theta energy: -27.623 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 170 Temperature: 1.150000 Total energy: -236.410543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.410543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.410543 (E_RNA) where: Base-Base interactions energy: -145.445 where: short stacking energy: -88.345 Base-Backbone interact. energy: -2.530 local terms energy: -88.435688 where: bonds (distance) C4'-P energy: -16.125 bonds (distance) P-C4' energy: -21.104 flat angles C4'-P-C4' energy: -22.645 flat angles P-C4'-P energy: -14.053 tors. eta vs tors. theta energy: -14.509 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 170 Temperature: 1.200000 Total energy: -208.487933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.487933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.500011 (E_RNA) where: Base-Base interactions energy: -130.027 where: short stacking energy: -60.412 Base-Backbone interact. energy: -0.880 local terms energy: -77.593473 where: bonds (distance) C4'-P energy: -15.670 bonds (distance) P-C4' energy: -19.669 flat angles C4'-P-C4' energy: -17.263 flat angles P-C4'-P energy: -12.019 tors. eta vs tors. theta energy: -12.973 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 170 Temperature: 1.250000 Total energy: -240.437935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.437935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.550100 (E_RNA) where: Base-Base interactions energy: -141.972 where: short stacking energy: -78.396 Base-Backbone interact. energy: -0.979 local terms energy: -97.598728 where: bonds (distance) C4'-P energy: -19.933 bonds (distance) P-C4' energy: -19.666 flat angles C4'-P-C4' energy: -24.906 flat angles P-C4'-P energy: -17.482 tors. eta vs tors. theta energy: -15.613 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 170 Temperature: 1.300000 Total energy: -198.525769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.525769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.576259 (E_RNA) where: Base-Base interactions energy: -109.702 where: short stacking energy: -64.210 Base-Backbone interact. energy: -0.247 local terms energy: -88.627237 where: bonds (distance) C4'-P energy: -23.048 bonds (distance) P-C4' energy: -22.261 flat angles C4'-P-C4' energy: -23.473 flat angles P-C4'-P energy: -12.586 tors. eta vs tors. theta energy: -7.259 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 170 Temperature: 1.350000 Total energy: -196.399929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.399929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.421928 (E_RNA) where: Base-Base interactions energy: -123.370 where: short stacking energy: -62.392 Base-Backbone interact. energy: 0.975 local terms energy: -74.027198 where: bonds (distance) C4'-P energy: -20.820 bonds (distance) P-C4' energy: -18.883 flat angles C4'-P-C4' energy: -15.872 flat angles P-C4'-P energy: -12.256 tors. eta vs tors. theta energy: -6.196 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 171 Temperature: 0.900000 Total energy: -395.961783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.961783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.961783 (E_RNA) where: Base-Base interactions energy: -273.503 where: short stacking energy: -114.534 Base-Backbone interact. energy: -0.549 local terms energy: -121.909599 where: bonds (distance) C4'-P energy: -20.165 bonds (distance) P-C4' energy: -23.911 flat angles C4'-P-C4' energy: -28.112 flat angles P-C4'-P energy: -19.631 tors. eta vs tors. theta energy: -30.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 171 Temperature: 0.950000 Total energy: -364.873339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.873339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.940523 (E_RNA) where: Base-Base interactions energy: -255.773 where: short stacking energy: -118.692 Base-Backbone interact. energy: -0.384 local terms energy: -108.783392 where: bonds (distance) C4'-P energy: -19.305 bonds (distance) P-C4' energy: -23.471 flat angles C4'-P-C4' energy: -25.303 flat angles P-C4'-P energy: -12.480 tors. eta vs tors. theta energy: -28.224 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 171 Temperature: 1.000000 Total energy: -359.726755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.726755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.726755 (E_RNA) where: Base-Base interactions energy: -241.542 where: short stacking energy: -107.616 Base-Backbone interact. energy: -1.339 local terms energy: -116.845802 where: bonds (distance) C4'-P energy: -23.266 bonds (distance) P-C4' energy: -27.427 flat angles C4'-P-C4' energy: -19.235 flat angles P-C4'-P energy: -14.631 tors. eta vs tors. theta energy: -32.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 171 Temperature: 1.050000 Total energy: -351.697476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.697476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.751906 (E_RNA) where: Base-Base interactions energy: -236.812 where: short stacking energy: -114.822 Base-Backbone interact. energy: -0.197 local terms energy: -114.743394 where: bonds (distance) C4'-P energy: -20.791 bonds (distance) P-C4' energy: -22.049 flat angles C4'-P-C4' energy: -25.881 flat angles P-C4'-P energy: -16.074 tors. eta vs tors. theta energy: -29.949 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 171 Temperature: 1.100000 Total energy: -300.920193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.920193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.923571 (E_RNA) where: Base-Base interactions energy: -187.948 where: short stacking energy: -96.262 Base-Backbone interact. energy: -0.429 local terms energy: -112.546620 where: bonds (distance) C4'-P energy: -22.605 bonds (distance) P-C4' energy: -24.906 flat angles C4'-P-C4' energy: -24.221 flat angles P-C4'-P energy: -10.713 tors. eta vs tors. theta energy: -30.100 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 171 Temperature: 1.150000 Total energy: -214.833186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.833186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.839549 (E_RNA) where: Base-Base interactions energy: -123.957 where: short stacking energy: -74.878 Base-Backbone interact. energy: -0.635 local terms energy: -90.247076 where: bonds (distance) C4'-P energy: -22.883 bonds (distance) P-C4' energy: -22.571 flat angles C4'-P-C4' energy: -20.613 flat angles P-C4'-P energy: -12.158 tors. eta vs tors. theta energy: -12.022 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 171 Temperature: 1.200000 Total energy: -217.436737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.436737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.528572 (E_RNA) where: Base-Base interactions energy: -125.553 where: short stacking energy: -74.989 Base-Backbone interact. energy: -0.403 local terms energy: -91.572194 where: bonds (distance) C4'-P energy: -19.906 bonds (distance) P-C4' energy: -24.284 flat angles C4'-P-C4' energy: -22.120 flat angles P-C4'-P energy: -13.169 tors. eta vs tors. theta energy: -12.094 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 171 Temperature: 1.250000 Total energy: -222.718040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.718040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.815961 (E_RNA) where: Base-Base interactions energy: -131.331 where: short stacking energy: -76.152 Base-Backbone interact. energy: 0.924 local terms energy: -92.408810 where: bonds (distance) C4'-P energy: -15.950 bonds (distance) P-C4' energy: -23.187 flat angles C4'-P-C4' energy: -24.526 flat angles P-C4'-P energy: -17.093 tors. eta vs tors. theta energy: -11.652 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 171 Temperature: 1.300000 Total energy: -237.397669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.397669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.421836 (E_RNA) where: Base-Base interactions energy: -141.816 where: short stacking energy: -81.813 Base-Backbone interact. energy: -0.291 local terms energy: -95.314939 where: bonds (distance) C4'-P energy: -26.783 bonds (distance) P-C4' energy: -21.096 flat angles C4'-P-C4' energy: -20.591 flat angles P-C4'-P energy: -5.167 tors. eta vs tors. theta energy: -21.679 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 171 Temperature: 1.350000 Total energy: -185.983982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.983982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.019577 (E_RNA) where: Base-Base interactions energy: -96.053 where: short stacking energy: -51.255 Base-Backbone interact. energy: -0.889 local terms energy: -89.078288 where: bonds (distance) C4'-P energy: -25.233 bonds (distance) P-C4' energy: -25.979 flat angles C4'-P-C4' energy: -20.391 flat angles P-C4'-P energy: -10.446 tors. eta vs tors. theta energy: -7.029 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 172 Temperature: 0.900000 Total energy: -389.985512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.985512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.985512 (E_RNA) where: Base-Base interactions energy: -260.714 where: short stacking energy: -111.170 Base-Backbone interact. energy: -1.326 local terms energy: -127.945593 where: bonds (distance) C4'-P energy: -22.248 bonds (distance) P-C4' energy: -28.845 flat angles C4'-P-C4' energy: -26.295 flat angles P-C4'-P energy: -21.148 tors. eta vs tors. theta energy: -29.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 172 Temperature: 0.950000 Total energy: -386.328922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.328922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.367675 (E_RNA) where: Base-Base interactions energy: -252.138 where: short stacking energy: -123.158 Base-Backbone interact. energy: -1.891 local terms energy: -132.338504 where: bonds (distance) C4'-P energy: -26.086 bonds (distance) P-C4' energy: -24.782 flat angles C4'-P-C4' energy: -27.391 flat angles P-C4'-P energy: -19.752 tors. eta vs tors. theta energy: -34.327 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 172 Temperature: 1.000000 Total energy: -353.258546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.258546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.264062 (E_RNA) where: Base-Base interactions energy: -233.053 where: short stacking energy: -116.049 Base-Backbone interact. energy: -0.407 local terms energy: -119.804041 where: bonds (distance) C4'-P energy: -21.596 bonds (distance) P-C4' energy: -20.734 flat angles C4'-P-C4' energy: -26.913 flat angles P-C4'-P energy: -21.562 tors. eta vs tors. theta energy: -28.999 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 172 Temperature: 1.050000 Total energy: -323.911544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.911544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.970178 (E_RNA) where: Base-Base interactions energy: -214.880 where: short stacking energy: -99.373 Base-Backbone interact. energy: -1.100 local terms energy: -107.989891 where: bonds (distance) C4'-P energy: -23.912 bonds (distance) P-C4' energy: -18.315 flat angles C4'-P-C4' energy: -22.276 flat angles P-C4'-P energy: -18.940 tors. eta vs tors. theta energy: -24.547 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 172 Temperature: 1.100000 Total energy: -289.364046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.364046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.386654 (E_RNA) where: Base-Base interactions energy: -182.043 where: short stacking energy: -84.701 Base-Backbone interact. energy: 0.421 local terms energy: -107.764450 where: bonds (distance) C4'-P energy: -24.343 bonds (distance) P-C4' energy: -22.204 flat angles C4'-P-C4' energy: -23.685 flat angles P-C4'-P energy: -14.356 tors. eta vs tors. theta energy: -23.177 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 172 Temperature: 1.150000 Total energy: -234.108304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.108304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.184309 (E_RNA) where: Base-Base interactions energy: -137.180 where: short stacking energy: -84.831 Base-Backbone interact. energy: -0.021 local terms energy: -96.983880 where: bonds (distance) C4'-P energy: -16.087 bonds (distance) P-C4' energy: -27.577 flat angles C4'-P-C4' energy: -21.394 flat angles P-C4'-P energy: -13.585 tors. eta vs tors. theta energy: -18.342 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 172 Temperature: 1.200000 Total energy: -248.673897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.673897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.785977 (E_RNA) where: Base-Base interactions energy: -153.916 where: short stacking energy: -98.124 Base-Backbone interact. energy: -0.196 local terms energy: -94.674116 where: bonds (distance) C4'-P energy: -11.227 bonds (distance) P-C4' energy: -22.146 flat angles C4'-P-C4' energy: -23.836 flat angles P-C4'-P energy: -15.081 tors. eta vs tors. theta energy: -22.384 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 172 Temperature: 1.250000 Total energy: -198.465257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.465257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.476689 (E_RNA) where: Base-Base interactions energy: -112.073 where: short stacking energy: -63.714 Base-Backbone interact. energy: -1.161 local terms energy: -85.242423 where: bonds (distance) C4'-P energy: -20.056 bonds (distance) P-C4' energy: -18.993 flat angles C4'-P-C4' energy: -20.024 flat angles P-C4'-P energy: -14.252 tors. eta vs tors. theta energy: -11.917 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 172 Temperature: 1.300000 Total energy: -201.019454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.019454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.068009 (E_RNA) where: Base-Base interactions energy: -121.280 where: short stacking energy: -65.501 Base-Backbone interact. energy: -0.279 local terms energy: -79.509489 where: bonds (distance) C4'-P energy: -20.328 bonds (distance) P-C4' energy: -23.061 flat angles C4'-P-C4' energy: -22.150 flat angles P-C4'-P energy: -7.096 tors. eta vs tors. theta energy: -6.873 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 172 Temperature: 1.350000 Total energy: -206.865922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.865922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.975171 (E_RNA) where: Base-Base interactions energy: -125.633 where: short stacking energy: -73.997 Base-Backbone interact. energy: -0.344 local terms energy: -80.998020 where: bonds (distance) C4'-P energy: -21.773 bonds (distance) P-C4' energy: -22.047 flat angles C4'-P-C4' energy: -13.228 flat angles P-C4'-P energy: -11.206 tors. eta vs tors. theta energy: -12.743 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 173 Temperature: 0.900000 Total energy: -395.478319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.478319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.478319 (E_RNA) where: Base-Base interactions energy: -270.387 where: short stacking energy: -122.323 Base-Backbone interact. energy: -1.053 local terms energy: -124.037602 where: bonds (distance) C4'-P energy: -24.757 bonds (distance) P-C4' energy: -22.141 flat angles C4'-P-C4' energy: -24.024 flat angles P-C4'-P energy: -21.108 tors. eta vs tors. theta energy: -32.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 173 Temperature: 0.950000 Total energy: -356.178483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.178483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.178483 (E_RNA) where: Base-Base interactions energy: -230.377 where: short stacking energy: -111.258 Base-Backbone interact. energy: -1.493 local terms energy: -124.309274 where: bonds (distance) C4'-P energy: -23.695 bonds (distance) P-C4' energy: -22.438 flat angles C4'-P-C4' energy: -26.181 flat angles P-C4'-P energy: -18.538 tors. eta vs tors. theta energy: -33.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 173 Temperature: 1.000000 Total energy: -353.513592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.513592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.762237 (E_RNA) where: Base-Base interactions energy: -230.024 where: short stacking energy: -115.297 Base-Backbone interact. energy: -0.990 local terms energy: -122.747729 where: bonds (distance) C4'-P energy: -23.211 bonds (distance) P-C4' energy: -25.011 flat angles C4'-P-C4' energy: -21.179 flat angles P-C4'-P energy: -15.597 tors. eta vs tors. theta energy: -37.749 Dist. restrs. and SS energy: 0.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 173 Temperature: 1.050000 Total energy: -336.055625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.055625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.059003 (E_RNA) where: Base-Base interactions energy: -226.634 where: short stacking energy: -109.803 Base-Backbone interact. energy: -0.098 local terms energy: -109.326935 where: bonds (distance) C4'-P energy: -23.256 bonds (distance) P-C4' energy: -23.111 flat angles C4'-P-C4' energy: -23.543 flat angles P-C4'-P energy: -10.318 tors. eta vs tors. theta energy: -29.099 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 173 Temperature: 1.100000 Total energy: -303.219296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.219296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.298242 (E_RNA) where: Base-Base interactions energy: -202.387 where: short stacking energy: -96.223 Base-Backbone interact. energy: -0.297 local terms energy: -100.613927 where: bonds (distance) C4'-P energy: -28.806 bonds (distance) P-C4' energy: -21.104 flat angles C4'-P-C4' energy: -19.411 flat angles P-C4'-P energy: -11.759 tors. eta vs tors. theta energy: -19.534 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 173 Temperature: 1.150000 Total energy: -248.166117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.166117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.166117 (E_RNA) where: Base-Base interactions energy: -149.018 where: short stacking energy: -96.310 Base-Backbone interact. energy: -1.284 local terms energy: -97.864547 where: bonds (distance) C4'-P energy: -22.627 bonds (distance) P-C4' energy: -23.678 flat angles C4'-P-C4' energy: -20.046 flat angles P-C4'-P energy: -10.153 tors. eta vs tors. theta energy: -21.360 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 173 Temperature: 1.200000 Total energy: -236.474550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.474550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.681677 (E_RNA) where: Base-Base interactions energy: -136.460 where: short stacking energy: -78.616 Base-Backbone interact. energy: -0.194 local terms energy: -100.026828 where: bonds (distance) C4'-P energy: -20.539 bonds (distance) P-C4' energy: -22.860 flat angles C4'-P-C4' energy: -22.249 flat angles P-C4'-P energy: -19.444 tors. eta vs tors. theta energy: -14.935 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 173 Temperature: 1.250000 Total energy: -203.819686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.819686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.935814 (E_RNA) where: Base-Base interactions energy: -127.327 where: short stacking energy: -62.638 Base-Backbone interact. energy: 2.767 local terms energy: -79.375253 where: bonds (distance) C4'-P energy: -20.021 bonds (distance) P-C4' energy: -20.637 flat angles C4'-P-C4' energy: -22.086 flat angles P-C4'-P energy: -10.849 tors. eta vs tors. theta energy: -5.782 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 173 Temperature: 1.300000 Total energy: -199.652592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.652592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.687853 (E_RNA) where: Base-Base interactions energy: -110.305 where: short stacking energy: -52.595 Base-Backbone interact. energy: -0.448 local terms energy: -88.934405 where: bonds (distance) C4'-P energy: -18.856 bonds (distance) P-C4' energy: -26.128 flat angles C4'-P-C4' energy: -20.311 flat angles P-C4'-P energy: -12.451 tors. eta vs tors. theta energy: -11.188 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 173 Temperature: 1.350000 Total energy: -182.425130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.425130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.462358 (E_RNA) where: Base-Base interactions energy: -98.723 where: short stacking energy: -57.509 Base-Backbone interact. energy: -0.158 local terms energy: -83.581266 where: bonds (distance) C4'-P energy: -19.873 bonds (distance) P-C4' energy: -18.557 flat angles C4'-P-C4' energy: -19.614 flat angles P-C4'-P energy: -12.416 tors. eta vs tors. theta energy: -13.122 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 174 Temperature: 0.900000 Total energy: -395.981948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.981948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.003105 (E_RNA) where: Base-Base interactions energy: -262.641 where: short stacking energy: -124.386 Base-Backbone interact. energy: -0.359 local terms energy: -133.003664 where: bonds (distance) C4'-P energy: -28.532 bonds (distance) P-C4' energy: -25.475 flat angles C4'-P-C4' energy: -26.255 flat angles P-C4'-P energy: -17.193 tors. eta vs tors. theta energy: -35.549 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 174 Temperature: 0.950000 Total energy: -356.599797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.599797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.599797 (E_RNA) where: Base-Base interactions energy: -237.091 where: short stacking energy: -110.557 Base-Backbone interact. energy: -0.729 local terms energy: -118.780306 where: bonds (distance) C4'-P energy: -24.817 bonds (distance) P-C4' energy: -24.544 flat angles C4'-P-C4' energy: -24.477 flat angles P-C4'-P energy: -16.953 tors. eta vs tors. theta energy: -27.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 174 Temperature: 1.000000 Total energy: -339.619491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.619491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.751803 (E_RNA) where: Base-Base interactions energy: -229.421 where: short stacking energy: -109.709 Base-Backbone interact. energy: -0.121 local terms energy: -110.209969 where: bonds (distance) C4'-P energy: -23.698 bonds (distance) P-C4' energy: -20.432 flat angles C4'-P-C4' energy: -25.394 flat angles P-C4'-P energy: -15.462 tors. eta vs tors. theta energy: -25.224 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 174 Temperature: 1.050000 Total energy: -359.221508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.221508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.221508 (E_RNA) where: Base-Base interactions energy: -235.559 where: short stacking energy: -123.358 Base-Backbone interact. energy: -1.920 local terms energy: -121.742833 where: bonds (distance) C4'-P energy: -18.647 bonds (distance) P-C4' energy: -22.509 flat angles C4'-P-C4' energy: -23.830 flat angles P-C4'-P energy: -19.027 tors. eta vs tors. theta energy: -37.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 174 Temperature: 1.100000 Total energy: -322.302088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.302088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.438384 (E_RNA) where: Base-Base interactions energy: -215.774 where: short stacking energy: -95.209 Base-Backbone interact. energy: -0.478 local terms energy: -106.186423 where: bonds (distance) C4'-P energy: -19.835 bonds (distance) P-C4' energy: -18.240 flat angles C4'-P-C4' energy: -22.658 flat angles P-C4'-P energy: -21.007 tors. eta vs tors. theta energy: -24.447 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 174 Temperature: 1.150000 Total energy: -243.130651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.130651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.135590 (E_RNA) where: Base-Base interactions energy: -146.402 where: short stacking energy: -93.271 Base-Backbone interact. energy: -0.024 local terms energy: -96.709323 where: bonds (distance) C4'-P energy: -23.722 bonds (distance) P-C4' energy: -18.866 flat angles C4'-P-C4' energy: -24.093 flat angles P-C4'-P energy: -6.834 tors. eta vs tors. theta energy: -23.194 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 174 Temperature: 1.200000 Total energy: -234.385261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.385261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.542836 (E_RNA) where: Base-Base interactions energy: -131.028 where: short stacking energy: -85.155 Base-Backbone interact. energy: -0.305 local terms energy: -103.209238 where: bonds (distance) C4'-P energy: -26.718 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -20.214 flat angles P-C4'-P energy: -14.773 tors. eta vs tors. theta energy: -17.032 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 174 Temperature: 1.250000 Total energy: -215.400720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.400720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.550503 (E_RNA) where: Base-Base interactions energy: -124.927 where: short stacking energy: -67.088 Base-Backbone interact. energy: -1.549 local terms energy: -89.074719 where: bonds (distance) C4'-P energy: -25.921 bonds (distance) P-C4' energy: -20.269 flat angles C4'-P-C4' energy: -21.121 flat angles P-C4'-P energy: -11.349 tors. eta vs tors. theta energy: -10.414 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 174 Temperature: 1.300000 Total energy: -214.743258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.743258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.885959 (E_RNA) where: Base-Base interactions energy: -128.116 where: short stacking energy: -70.482 Base-Backbone interact. energy: -0.308 local terms energy: -86.461475 where: bonds (distance) C4'-P energy: -21.565 bonds (distance) P-C4' energy: -22.821 flat angles C4'-P-C4' energy: -23.799 flat angles P-C4'-P energy: -10.396 tors. eta vs tors. theta energy: -7.881 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 174 Temperature: 1.350000 Total energy: -198.532351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.532351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.818479 (E_RNA) where: Base-Base interactions energy: -124.285 where: short stacking energy: -58.428 Base-Backbone interact. energy: -1.435 local terms energy: -73.098121 where: bonds (distance) C4'-P energy: -15.881 bonds (distance) P-C4' energy: -17.327 flat angles C4'-P-C4' energy: -22.344 flat angles P-C4'-P energy: -10.552 tors. eta vs tors. theta energy: -6.994 Dist. restrs. and SS energy: 0.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 175 Temperature: 0.900000 Total energy: -388.127463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.127463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.135622 (E_RNA) where: Base-Base interactions energy: -263.993 where: short stacking energy: -111.684 Base-Backbone interact. energy: -1.782 local terms energy: -122.360540 where: bonds (distance) C4'-P energy: -21.189 bonds (distance) P-C4' energy: -25.328 flat angles C4'-P-C4' energy: -23.614 flat angles P-C4'-P energy: -19.389 tors. eta vs tors. theta energy: -32.840 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 175 Temperature: 0.950000 Total energy: -341.221505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.221505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.256473 (E_RNA) where: Base-Base interactions energy: -226.689 where: short stacking energy: -109.275 Base-Backbone interact. energy: -0.594 local terms energy: -113.973443 where: bonds (distance) C4'-P energy: -20.469 bonds (distance) P-C4' energy: -23.723 flat angles C4'-P-C4' energy: -19.190 flat angles P-C4'-P energy: -22.343 tors. eta vs tors. theta energy: -28.248 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 175 Temperature: 1.000000 Total energy: -364.631601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.631601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.688559 (E_RNA) where: Base-Base interactions energy: -237.952 where: short stacking energy: -111.564 Base-Backbone interact. energy: 0.097 local terms energy: -126.833474 where: bonds (distance) C4'-P energy: -25.114 bonds (distance) P-C4' energy: -26.325 flat angles C4'-P-C4' energy: -28.563 flat angles P-C4'-P energy: -17.859 tors. eta vs tors. theta energy: -28.972 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 175 Temperature: 1.050000 Total energy: -345.944005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.944005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.954614 (E_RNA) where: Base-Base interactions energy: -233.978 where: short stacking energy: -113.816 Base-Backbone interact. energy: 1.392 local terms energy: -113.367923 where: bonds (distance) C4'-P energy: -20.242 bonds (distance) P-C4' energy: -20.658 flat angles C4'-P-C4' energy: -25.270 flat angles P-C4'-P energy: -18.221 tors. eta vs tors. theta energy: -28.977 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 175 Temperature: 1.100000 Total energy: -323.040681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.040681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.151156 (E_RNA) where: Base-Base interactions energy: -214.876 where: short stacking energy: -112.399 Base-Backbone interact. energy: 0.493 local terms energy: -108.767985 where: bonds (distance) C4'-P energy: -19.080 bonds (distance) P-C4' energy: -20.938 flat angles C4'-P-C4' energy: -25.845 flat angles P-C4'-P energy: -9.935 tors. eta vs tors. theta energy: -32.970 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 175 Temperature: 1.150000 Total energy: -237.641375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.641375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.641375 (E_RNA) where: Base-Base interactions energy: -146.319 where: short stacking energy: -87.624 Base-Backbone interact. energy: -0.137 local terms energy: -91.186045 where: bonds (distance) C4'-P energy: -19.194 bonds (distance) P-C4' energy: -25.734 flat angles C4'-P-C4' energy: -20.400 flat angles P-C4'-P energy: -7.917 tors. eta vs tors. theta energy: -17.941 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 175 Temperature: 1.200000 Total energy: -231.986370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.986370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.293799 (E_RNA) where: Base-Base interactions energy: -135.058 where: short stacking energy: -70.563 Base-Backbone interact. energy: -0.265 local terms energy: -96.970976 where: bonds (distance) C4'-P energy: -22.583 bonds (distance) P-C4' energy: -17.940 flat angles C4'-P-C4' energy: -20.355 flat angles P-C4'-P energy: -18.928 tors. eta vs tors. theta energy: -17.165 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 175 Temperature: 1.250000 Total energy: -226.380081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.380081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.451389 (E_RNA) where: Base-Base interactions energy: -134.817 where: short stacking energy: -80.859 Base-Backbone interact. energy: -0.892 local terms energy: -90.742611 where: bonds (distance) C4'-P energy: -21.670 bonds (distance) P-C4' energy: -26.090 flat angles C4'-P-C4' energy: -18.520 flat angles P-C4'-P energy: -9.101 tors. eta vs tors. theta energy: -15.361 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 175 Temperature: 1.300000 Total energy: -210.225470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.225470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.244856 (E_RNA) where: Base-Base interactions energy: -121.818 where: short stacking energy: -55.940 Base-Backbone interact. energy: -1.735 local terms energy: -86.691691 where: bonds (distance) C4'-P energy: -20.108 bonds (distance) P-C4' energy: -22.521 flat angles C4'-P-C4' energy: -23.813 flat angles P-C4'-P energy: -12.185 tors. eta vs tors. theta energy: -8.064 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 175 Temperature: 1.350000 Total energy: -189.270736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.270736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.342530 (E_RNA) where: Base-Base interactions energy: -114.940 where: short stacking energy: -58.171 Base-Backbone interact. energy: -0.898 local terms energy: -73.504290 where: bonds (distance) C4'-P energy: -15.081 bonds (distance) P-C4' energy: -17.822 flat angles C4'-P-C4' energy: -23.979 flat angles P-C4'-P energy: -14.735 tors. eta vs tors. theta energy: -1.887 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 176 Temperature: 0.900000 Total energy: -390.425829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.425829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.458870 (E_RNA) where: Base-Base interactions energy: -264.731 where: short stacking energy: -118.175 Base-Backbone interact. energy: -0.179 local terms energy: -125.548961 where: bonds (distance) C4'-P energy: -21.721 bonds (distance) P-C4' energy: -26.745 flat angles C4'-P-C4' energy: -26.618 flat angles P-C4'-P energy: -20.912 tors. eta vs tors. theta energy: -29.553 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 176 Temperature: 0.950000 Total energy: -338.983482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.983482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.986336 (E_RNA) where: Base-Base interactions energy: -221.651 where: short stacking energy: -111.435 Base-Backbone interact. energy: -0.274 local terms energy: -117.061552 where: bonds (distance) C4'-P energy: -22.699 bonds (distance) P-C4' energy: -24.983 flat angles C4'-P-C4' energy: -26.385 flat angles P-C4'-P energy: -18.334 tors. eta vs tors. theta energy: -24.660 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 176 Temperature: 1.000000 Total energy: -356.272590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.272590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.441291 (E_RNA) where: Base-Base interactions energy: -241.867 where: short stacking energy: -117.894 Base-Backbone interact. energy: -1.054 local terms energy: -113.519900 where: bonds (distance) C4'-P energy: -22.481 bonds (distance) P-C4' energy: -18.231 flat angles C4'-P-C4' energy: -28.605 flat angles P-C4'-P energy: -17.402 tors. eta vs tors. theta energy: -26.801 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 176 Temperature: 1.050000 Total energy: -345.364472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.364472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.391262 (E_RNA) where: Base-Base interactions energy: -220.160 where: short stacking energy: -109.889 Base-Backbone interact. energy: 0.019 local terms energy: -125.250587 where: bonds (distance) C4'-P energy: -22.547 bonds (distance) P-C4' energy: -28.928 flat angles C4'-P-C4' energy: -28.527 flat angles P-C4'-P energy: -12.326 tors. eta vs tors. theta energy: -32.923 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 176 Temperature: 1.100000 Total energy: -317.379857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.379857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.543912 (E_RNA) where: Base-Base interactions energy: -209.372 where: short stacking energy: -99.987 Base-Backbone interact. energy: -1.431 local terms energy: -106.740870 where: bonds (distance) C4'-P energy: -20.732 bonds (distance) P-C4' energy: -21.563 flat angles C4'-P-C4' energy: -23.418 flat angles P-C4'-P energy: -13.799 tors. eta vs tors. theta energy: -27.229 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 176 Temperature: 1.150000 Total energy: -240.745953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.745953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.759055 (E_RNA) where: Base-Base interactions energy: -146.196 where: short stacking energy: -74.199 Base-Backbone interact. energy: -0.319 local terms energy: -94.243779 where: bonds (distance) C4'-P energy: -23.586 bonds (distance) P-C4' energy: -19.481 flat angles C4'-P-C4' energy: -22.209 flat angles P-C4'-P energy: -17.221 tors. eta vs tors. theta energy: -11.746 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 176 Temperature: 1.200000 Total energy: -217.609741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.609741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.609741 (E_RNA) where: Base-Base interactions energy: -121.956 where: short stacking energy: -65.806 Base-Backbone interact. energy: -0.178 local terms energy: -95.475084 where: bonds (distance) C4'-P energy: -18.559 bonds (distance) P-C4' energy: -21.737 flat angles C4'-P-C4' energy: -26.794 flat angles P-C4'-P energy: -16.967 tors. eta vs tors. theta energy: -11.417 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 176 Temperature: 1.250000 Total energy: -216.110322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.110322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.164850 (E_RNA) where: Base-Base interactions energy: -120.621 where: short stacking energy: -74.320 Base-Backbone interact. energy: -0.355 local terms energy: -95.188982 where: bonds (distance) C4'-P energy: -23.291 bonds (distance) P-C4' energy: -18.392 flat angles C4'-P-C4' energy: -21.298 flat angles P-C4'-P energy: -17.101 tors. eta vs tors. theta energy: -15.108 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 176 Temperature: 1.300000 Total energy: -208.311326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.311326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.347816 (E_RNA) where: Base-Base interactions energy: -144.626 where: short stacking energy: -65.199 Base-Backbone interact. energy: -0.338 local terms energy: -63.384205 where: bonds (distance) C4'-P energy: -18.340 bonds (distance) P-C4' energy: -17.707 flat angles C4'-P-C4' energy: -12.930 flat angles P-C4'-P energy: -10.257 tors. eta vs tors. theta energy: -4.150 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 176 Temperature: 1.350000 Total energy: -191.376553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.376553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.454351 (E_RNA) where: Base-Base interactions energy: -107.315 where: short stacking energy: -59.764 Base-Backbone interact. energy: -1.277 local terms energy: -82.863113 where: bonds (distance) C4'-P energy: -19.342 bonds (distance) P-C4' energy: -20.748 flat angles C4'-P-C4' energy: -23.598 flat angles P-C4'-P energy: -6.367 tors. eta vs tors. theta energy: -12.809 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 177 Temperature: 0.900000 Total energy: -389.848118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.848118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.891610 (E_RNA) where: Base-Base interactions energy: -269.298 where: short stacking energy: -114.103 Base-Backbone interact. energy: -0.267 local terms energy: -120.326101 where: bonds (distance) C4'-P energy: -19.156 bonds (distance) P-C4' energy: -24.173 flat angles C4'-P-C4' energy: -27.739 flat angles P-C4'-P energy: -16.630 tors. eta vs tors. theta energy: -32.628 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 177 Temperature: 0.950000 Total energy: -368.978757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.978757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.989010 (E_RNA) where: Base-Base interactions energy: -245.186 where: short stacking energy: -118.135 Base-Backbone interact. energy: -0.350 local terms energy: -123.453723 where: bonds (distance) C4'-P energy: -22.501 bonds (distance) P-C4' energy: -26.738 flat angles C4'-P-C4' energy: -25.380 flat angles P-C4'-P energy: -16.727 tors. eta vs tors. theta energy: -32.108 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 177 Temperature: 1.000000 Total energy: -335.150983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.150983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.150983 (E_RNA) where: Base-Base interactions energy: -229.432 where: short stacking energy: -98.994 Base-Backbone interact. energy: -0.839 local terms energy: -104.879871 where: bonds (distance) C4'-P energy: -21.217 bonds (distance) P-C4' energy: -20.431 flat angles C4'-P-C4' energy: -24.219 flat angles P-C4'-P energy: -13.995 tors. eta vs tors. theta energy: -25.017 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 177 Temperature: 1.050000 Total energy: -332.087652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.087652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.235398 (E_RNA) where: Base-Base interactions energy: -215.357 where: short stacking energy: -101.598 Base-Backbone interact. energy: 0.094 local terms energy: -116.972834 where: bonds (distance) C4'-P energy: -22.947 bonds (distance) P-C4' energy: -25.511 flat angles C4'-P-C4' energy: -25.487 flat angles P-C4'-P energy: -16.330 tors. eta vs tors. theta energy: -26.698 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 177 Temperature: 1.100000 Total energy: -324.893827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.893827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.895036 (E_RNA) where: Base-Base interactions energy: -218.780 where: short stacking energy: -107.035 Base-Backbone interact. energy: -0.340 local terms energy: -105.774627 where: bonds (distance) C4'-P energy: -17.963 bonds (distance) P-C4' energy: -23.533 flat angles C4'-P-C4' energy: -20.092 flat angles P-C4'-P energy: -17.734 tors. eta vs tors. theta energy: -26.453 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 177 Temperature: 1.150000 Total energy: -240.688009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.688009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.710161 (E_RNA) where: Base-Base interactions energy: -145.672 where: short stacking energy: -85.870 Base-Backbone interact. energy: -0.029 local terms energy: -95.009238 where: bonds (distance) C4'-P energy: -19.082 bonds (distance) P-C4' energy: -18.900 flat angles C4'-P-C4' energy: -20.494 flat angles P-C4'-P energy: -15.379 tors. eta vs tors. theta energy: -21.155 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 177 Temperature: 1.200000 Total energy: -221.566695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.566695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.586521 (E_RNA) where: Base-Base interactions energy: -126.460 where: short stacking energy: -71.539 Base-Backbone interact. energy: 0.922 local terms energy: -96.048858 where: bonds (distance) C4'-P energy: -16.511 bonds (distance) P-C4' energy: -21.634 flat angles C4'-P-C4' energy: -23.414 flat angles P-C4'-P energy: -19.505 tors. eta vs tors. theta energy: -14.985 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 177 Temperature: 1.250000 Total energy: -208.530751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.530751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.583253 (E_RNA) where: Base-Base interactions energy: -119.312 where: short stacking energy: -63.899 Base-Backbone interact. energy: -1.448 local terms energy: -87.822784 where: bonds (distance) C4'-P energy: -23.773 bonds (distance) P-C4' energy: -18.136 flat angles C4'-P-C4' energy: -16.846 flat angles P-C4'-P energy: -16.796 tors. eta vs tors. theta energy: -12.272 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 177 Temperature: 1.300000 Total energy: -208.350468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.350468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.350468 (E_RNA) where: Base-Base interactions energy: -132.977 where: short stacking energy: -71.452 Base-Backbone interact. energy: -0.276 local terms energy: -75.096717 where: bonds (distance) C4'-P energy: -16.571 bonds (distance) P-C4' energy: -23.397 flat angles C4'-P-C4' energy: -15.989 flat angles P-C4'-P energy: -10.188 tors. eta vs tors. theta energy: -8.951 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 177 Temperature: 1.350000 Total energy: -208.270510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.270510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.273990 (E_RNA) where: Base-Base interactions energy: -123.535 where: short stacking energy: -55.826 Base-Backbone interact. energy: -1.467 local terms energy: -83.272109 where: bonds (distance) C4'-P energy: -24.213 bonds (distance) P-C4' energy: -22.997 flat angles C4'-P-C4' energy: -13.405 flat angles P-C4'-P energy: -14.984 tors. eta vs tors. theta energy: -7.672 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 178 Temperature: 0.900000 Total energy: -383.612670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.612670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.653863 (E_RNA) where: Base-Base interactions energy: -258.925 where: short stacking energy: -105.993 Base-Backbone interact. energy: -0.793 local terms energy: -123.935920 where: bonds (distance) C4'-P energy: -24.993 bonds (distance) P-C4' energy: -24.954 flat angles C4'-P-C4' energy: -28.797 flat angles P-C4'-P energy: -12.937 tors. eta vs tors. theta energy: -32.255 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 178 Temperature: 0.950000 Total energy: -371.211585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.211585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.258555 (E_RNA) where: Base-Base interactions energy: -261.443 where: short stacking energy: -124.328 Base-Backbone interact. energy: 0.270 local terms energy: -110.085651 where: bonds (distance) C4'-P energy: -24.410 bonds (distance) P-C4' energy: -20.076 flat angles C4'-P-C4' energy: -23.810 flat angles P-C4'-P energy: -13.931 tors. eta vs tors. theta energy: -27.859 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 178 Temperature: 1.000000 Total energy: -338.614887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.614887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.910889 (E_RNA) where: Base-Base interactions energy: -245.971 where: short stacking energy: -105.026 Base-Backbone interact. energy: -2.092 local terms energy: -90.847728 where: bonds (distance) C4'-P energy: -15.331 bonds (distance) P-C4' energy: -26.424 flat angles C4'-P-C4' energy: -16.194 flat angles P-C4'-P energy: -10.884 tors. eta vs tors. theta energy: -22.014 Dist. restrs. and SS energy: 0.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 178 Temperature: 1.050000 Total energy: -334.128027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.128027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.128027 (E_RNA) where: Base-Base interactions energy: -216.399 where: short stacking energy: -97.046 Base-Backbone interact. energy: -1.285 local terms energy: -116.444019 where: bonds (distance) C4'-P energy: -24.862 bonds (distance) P-C4' energy: -22.695 flat angles C4'-P-C4' energy: -27.568 flat angles P-C4'-P energy: -15.787 tors. eta vs tors. theta energy: -25.531 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 178 Temperature: 1.100000 Total energy: -317.611471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.611471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.714014 (E_RNA) where: Base-Base interactions energy: -205.570 where: short stacking energy: -103.395 Base-Backbone interact. energy: -0.761 local terms energy: -111.383164 where: bonds (distance) C4'-P energy: -21.022 bonds (distance) P-C4' energy: -22.707 flat angles C4'-P-C4' energy: -20.542 flat angles P-C4'-P energy: -17.873 tors. eta vs tors. theta energy: -29.239 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 178 Temperature: 1.150000 Total energy: -239.750984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.750984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.943211 (E_RNA) where: Base-Base interactions energy: -146.541 where: short stacking energy: -85.245 Base-Backbone interact. energy: -0.185 local terms energy: -93.217492 where: bonds (distance) C4'-P energy: -20.982 bonds (distance) P-C4' energy: -13.738 flat angles C4'-P-C4' energy: -24.523 flat angles P-C4'-P energy: -10.615 tors. eta vs tors. theta energy: -23.358 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 178 Temperature: 1.200000 Total energy: -243.769240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.769240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.786517 (E_RNA) where: Base-Base interactions energy: -161.206 where: short stacking energy: -81.163 Base-Backbone interact. energy: -0.293 local terms energy: -82.287550 where: bonds (distance) C4'-P energy: -18.489 bonds (distance) P-C4' energy: -17.319 flat angles C4'-P-C4' energy: -21.980 flat angles P-C4'-P energy: -7.679 tors. eta vs tors. theta energy: -16.821 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 178 Temperature: 1.250000 Total energy: -216.819945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.819945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.852350 (E_RNA) where: Base-Base interactions energy: -122.011 where: short stacking energy: -68.453 Base-Backbone interact. energy: -0.118 local terms energy: -94.723356 where: bonds (distance) C4'-P energy: -21.789 bonds (distance) P-C4' energy: -24.686 flat angles C4'-P-C4' energy: -18.369 flat angles P-C4'-P energy: -15.888 tors. eta vs tors. theta energy: -13.992 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 178 Temperature: 1.300000 Total energy: -220.554244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.554244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.602108 (E_RNA) where: Base-Base interactions energy: -130.429 where: short stacking energy: -75.064 Base-Backbone interact. energy: -0.074 local terms energy: -90.098964 where: bonds (distance) C4'-P energy: -15.843 bonds (distance) P-C4' energy: -25.071 flat angles C4'-P-C4' energy: -20.956 flat angles P-C4'-P energy: -14.198 tors. eta vs tors. theta energy: -14.030 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 178 Temperature: 1.350000 Total energy: -194.331492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.331492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.333424 (E_RNA) where: Base-Base interactions energy: -113.751 where: short stacking energy: -63.910 Base-Backbone interact. energy: 0.996 local terms energy: -81.578527 where: bonds (distance) C4'-P energy: -15.155 bonds (distance) P-C4' energy: -20.836 flat angles C4'-P-C4' energy: -20.674 flat angles P-C4'-P energy: -16.347 tors. eta vs tors. theta energy: -8.566 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 179 Temperature: 0.900000 Total energy: -386.365871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.365871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.393015 (E_RNA) where: Base-Base interactions energy: -261.506 where: short stacking energy: -121.402 Base-Backbone interact. energy: -0.719 local terms energy: -124.168877 where: bonds (distance) C4'-P energy: -26.650 bonds (distance) P-C4' energy: -18.778 flat angles C4'-P-C4' energy: -27.407 flat angles P-C4'-P energy: -16.030 tors. eta vs tors. theta energy: -35.304 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 179 Temperature: 0.950000 Total energy: -361.405927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.405927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.419160 (E_RNA) where: Base-Base interactions energy: -246.410 where: short stacking energy: -120.797 Base-Backbone interact. energy: -2.098 local terms energy: -112.911190 where: bonds (distance) C4'-P energy: -24.459 bonds (distance) P-C4' energy: -23.027 flat angles C4'-P-C4' energy: -23.599 flat angles P-C4'-P energy: -10.149 tors. eta vs tors. theta energy: -31.677 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 179 Temperature: 1.000000 Total energy: -343.804326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.804326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.812999 (E_RNA) where: Base-Base interactions energy: -226.171 where: short stacking energy: -108.544 Base-Backbone interact. energy: -1.846 local terms energy: -115.795823 where: bonds (distance) C4'-P energy: -25.467 bonds (distance) P-C4' energy: -24.031 flat angles C4'-P-C4' energy: -22.357 flat angles P-C4'-P energy: -14.621 tors. eta vs tors. theta energy: -29.321 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 179 Temperature: 1.050000 Total energy: -337.869298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.869298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.869298 (E_RNA) where: Base-Base interactions energy: -220.563 where: short stacking energy: -106.342 Base-Backbone interact. energy: -0.891 local terms energy: -116.415072 where: bonds (distance) C4'-P energy: -23.426 bonds (distance) P-C4' energy: -23.227 flat angles C4'-P-C4' energy: -26.118 flat angles P-C4'-P energy: -15.410 tors. eta vs tors. theta energy: -28.234 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 179 Temperature: 1.100000 Total energy: -318.183118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.183118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.208659 (E_RNA) where: Base-Base interactions energy: -215.563 where: short stacking energy: -98.815 Base-Backbone interact. energy: -0.352 local terms energy: -102.294031 where: bonds (distance) C4'-P energy: -20.154 bonds (distance) P-C4' energy: -21.708 flat angles C4'-P-C4' energy: -27.013 flat angles P-C4'-P energy: -8.754 tors. eta vs tors. theta energy: -24.666 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 179 Temperature: 1.150000 Total energy: -238.126975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.126975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.126975 (E_RNA) where: Base-Base interactions energy: -134.463 where: short stacking energy: -73.133 Base-Backbone interact. energy: 0.072 local terms energy: -103.735679 where: bonds (distance) C4'-P energy: -19.035 bonds (distance) P-C4' energy: -17.959 flat angles C4'-P-C4' energy: -25.805 flat angles P-C4'-P energy: -21.104 tors. eta vs tors. theta energy: -19.832 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 179 Temperature: 1.200000 Total energy: -220.166292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.166292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.279081 (E_RNA) where: Base-Base interactions energy: -125.405 where: short stacking energy: -75.755 Base-Backbone interact. energy: -0.154 local terms energy: -94.719997 where: bonds (distance) C4'-P energy: -22.468 bonds (distance) P-C4' energy: -23.951 flat angles C4'-P-C4' energy: -23.511 flat angles P-C4'-P energy: -14.038 tors. eta vs tors. theta energy: -10.752 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 179 Temperature: 1.250000 Total energy: -219.590644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.590644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.699889 (E_RNA) where: Base-Base interactions energy: -138.228 where: short stacking energy: -63.717 Base-Backbone interact. energy: -0.268 local terms energy: -81.204581 where: bonds (distance) C4'-P energy: -10.464 bonds (distance) P-C4' energy: -20.541 flat angles C4'-P-C4' energy: -16.761 flat angles P-C4'-P energy: -19.936 tors. eta vs tors. theta energy: -13.503 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 179 Temperature: 1.300000 Total energy: -180.403282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.403282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.190061 (E_RNA) where: Base-Base interactions energy: -103.308 where: short stacking energy: -61.965 Base-Backbone interact. energy: -0.702 local terms energy: -77.179872 where: bonds (distance) C4'-P energy: -16.714 bonds (distance) P-C4' energy: -23.302 flat angles C4'-P-C4' energy: -12.850 flat angles P-C4'-P energy: -17.644 tors. eta vs tors. theta energy: -6.670 Dist. restrs. and SS energy: 0.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 179 Temperature: 1.350000 Total energy: -186.899808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.899808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.139266 (E_RNA) where: Base-Base interactions energy: -105.291 where: short stacking energy: -48.699 Base-Backbone interact. energy: -0.335 local terms energy: -81.513310 where: bonds (distance) C4'-P energy: -26.099 bonds (distance) P-C4' energy: -20.358 flat angles C4'-P-C4' energy: -17.285 flat angles P-C4'-P energy: -15.305 tors. eta vs tors. theta energy: -2.467 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 180 Temperature: 0.900000 Total energy: -398.021279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.021279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.038841 (E_RNA) where: Base-Base interactions energy: -266.097 where: short stacking energy: -121.032 Base-Backbone interact. energy: -1.373 local terms energy: -130.568548 where: bonds (distance) C4'-P energy: -25.437 bonds (distance) P-C4' energy: -26.242 flat angles C4'-P-C4' energy: -28.229 flat angles P-C4'-P energy: -18.197 tors. eta vs tors. theta energy: -32.463 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 180 Temperature: 0.950000 Total energy: -364.207125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.207125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.242868 (E_RNA) where: Base-Base interactions energy: -247.012 where: short stacking energy: -122.205 Base-Backbone interact. energy: -1.388 local terms energy: -115.842848 where: bonds (distance) C4'-P energy: -17.981 bonds (distance) P-C4' energy: -22.669 flat angles C4'-P-C4' energy: -24.362 flat angles P-C4'-P energy: -19.151 tors. eta vs tors. theta energy: -31.680 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 180 Temperature: 1.000000 Total energy: -342.363319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.363319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.684877 (E_RNA) where: Base-Base interactions energy: -228.614 where: short stacking energy: -113.173 Base-Backbone interact. energy: -0.343 local terms energy: -113.727689 where: bonds (distance) C4'-P energy: -23.346 bonds (distance) P-C4' energy: -23.556 flat angles C4'-P-C4' energy: -21.192 flat angles P-C4'-P energy: -15.190 tors. eta vs tors. theta energy: -30.444 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 180 Temperature: 1.050000 Total energy: -342.544911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.544911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.579207 (E_RNA) where: Base-Base interactions energy: -225.296 where: short stacking energy: -109.454 Base-Backbone interact. energy: -0.292 local terms energy: -116.991186 where: bonds (distance) C4'-P energy: -18.746 bonds (distance) P-C4' energy: -21.759 flat angles C4'-P-C4' energy: -28.223 flat angles P-C4'-P energy: -16.639 tors. eta vs tors. theta energy: -31.624 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 180 Temperature: 1.100000 Total energy: -313.845200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.845200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.910293 (E_RNA) where: Base-Base interactions energy: -210.195 where: short stacking energy: -96.125 Base-Backbone interact. energy: -0.102 local terms energy: -103.612917 where: bonds (distance) C4'-P energy: -20.985 bonds (distance) P-C4' energy: -25.020 flat angles C4'-P-C4' energy: -25.637 flat angles P-C4'-P energy: -14.472 tors. eta vs tors. theta energy: -17.499 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 180 Temperature: 1.150000 Total energy: -236.363354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.363354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.373310 (E_RNA) where: Base-Base interactions energy: -142.549 where: short stacking energy: -73.792 Base-Backbone interact. energy: -1.184 local terms energy: -92.640481 where: bonds (distance) C4'-P energy: -24.208 bonds (distance) P-C4' energy: -20.608 flat angles C4'-P-C4' energy: -19.817 flat angles P-C4'-P energy: -15.253 tors. eta vs tors. theta energy: -12.754 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 180 Temperature: 1.200000 Total energy: -226.061634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.061634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.061634 (E_RNA) where: Base-Base interactions energy: -127.738 where: short stacking energy: -75.783 Base-Backbone interact. energy: 0.151 local terms energy: -98.474647 where: bonds (distance) C4'-P energy: -22.637 bonds (distance) P-C4' energy: -24.251 flat angles C4'-P-C4' energy: -21.027 flat angles P-C4'-P energy: -16.796 tors. eta vs tors. theta energy: -13.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 180 Temperature: 1.250000 Total energy: -219.525418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.525418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.525418 (E_RNA) where: Base-Base interactions energy: -130.754 where: short stacking energy: -72.485 Base-Backbone interact. energy: -0.080 local terms energy: -88.691755 where: bonds (distance) C4'-P energy: -20.514 bonds (distance) P-C4' energy: -19.756 flat angles C4'-P-C4' energy: -16.720 flat angles P-C4'-P energy: -19.550 tors. eta vs tors. theta energy: -12.152 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 180 Temperature: 1.300000 Total energy: -207.405078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.405078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.515797 (E_RNA) where: Base-Base interactions energy: -127.212 where: short stacking energy: -69.504 Base-Backbone interact. energy: 0.447 local terms energy: -80.751443 where: bonds (distance) C4'-P energy: -16.747 bonds (distance) P-C4' energy: -20.877 flat angles C4'-P-C4' energy: -18.377 flat angles P-C4'-P energy: -14.697 tors. eta vs tors. theta energy: -10.054 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 180 Temperature: 1.350000 Total energy: -193.699982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.699982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.814200 (E_RNA) where: Base-Base interactions energy: -116.087 where: short stacking energy: -58.945 Base-Backbone interact. energy: -0.611 local terms energy: -77.115621 where: bonds (distance) C4'-P energy: -20.393 bonds (distance) P-C4' energy: -20.615 flat angles C4'-P-C4' energy: -16.403 flat angles P-C4'-P energy: -6.271 tors. eta vs tors. theta energy: -13.434 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 181 Temperature: 0.900000 Total energy: -395.302259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.302259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.302259 (E_RNA) where: Base-Base interactions energy: -266.712 where: short stacking energy: -121.485 Base-Backbone interact. energy: -2.297 local terms energy: -126.292731 where: bonds (distance) C4'-P energy: -20.532 bonds (distance) P-C4' energy: -28.070 flat angles C4'-P-C4' energy: -27.035 flat angles P-C4'-P energy: -17.215 tors. eta vs tors. theta energy: -33.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 181 Temperature: 0.950000 Total energy: -340.759553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.759553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.805233 (E_RNA) where: Base-Base interactions energy: -220.302 where: short stacking energy: -112.828 Base-Backbone interact. energy: -0.015 local terms energy: -120.488768 where: bonds (distance) C4'-P energy: -20.836 bonds (distance) P-C4' energy: -22.540 flat angles C4'-P-C4' energy: -27.885 flat angles P-C4'-P energy: -17.438 tors. eta vs tors. theta energy: -31.789 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 181 Temperature: 1.000000 Total energy: -361.030864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.030864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.094196 (E_RNA) where: Base-Base interactions energy: -237.963 where: short stacking energy: -111.997 Base-Backbone interact. energy: 1.011 local terms energy: -124.141954 where: bonds (distance) C4'-P energy: -23.971 bonds (distance) P-C4' energy: -24.193 flat angles C4'-P-C4' energy: -25.326 flat angles P-C4'-P energy: -17.479 tors. eta vs tors. theta energy: -33.173 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 181 Temperature: 1.050000 Total energy: -343.399463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.399463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.507446 (E_RNA) where: Base-Base interactions energy: -224.115 where: short stacking energy: -120.159 Base-Backbone interact. energy: -0.690 local terms energy: -118.701922 where: bonds (distance) C4'-P energy: -21.393 bonds (distance) P-C4' energy: -26.296 flat angles C4'-P-C4' energy: -22.543 flat angles P-C4'-P energy: -17.840 tors. eta vs tors. theta energy: -30.630 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 181 Temperature: 1.100000 Total energy: -341.194843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.194843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.211610 (E_RNA) where: Base-Base interactions energy: -223.302 where: short stacking energy: -104.525 Base-Backbone interact. energy: -0.442 local terms energy: -117.468117 where: bonds (distance) C4'-P energy: -23.488 bonds (distance) P-C4' energy: -22.942 flat angles C4'-P-C4' energy: -26.010 flat angles P-C4'-P energy: -14.927 tors. eta vs tors. theta energy: -30.102 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 181 Temperature: 1.150000 Total energy: -234.211125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.211125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.454108 (E_RNA) where: Base-Base interactions energy: -140.668 where: short stacking energy: -81.988 Base-Backbone interact. energy: -0.512 local terms energy: -93.273947 where: bonds (distance) C4'-P energy: -24.444 bonds (distance) P-C4' energy: -18.121 flat angles C4'-P-C4' energy: -18.644 flat angles P-C4'-P energy: -14.609 tors. eta vs tors. theta energy: -17.456 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 181 Temperature: 1.200000 Total energy: -244.602409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.602409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.642839 (E_RNA) where: Base-Base interactions energy: -135.980 where: short stacking energy: -78.231 Base-Backbone interact. energy: -1.019 local terms energy: -107.644217 where: bonds (distance) C4'-P energy: -22.910 bonds (distance) P-C4' energy: -28.788 flat angles C4'-P-C4' energy: -20.821 flat angles P-C4'-P energy: -16.682 tors. eta vs tors. theta energy: -18.443 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 181 Temperature: 1.250000 Total energy: -223.448306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.448306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.501315 (E_RNA) where: Base-Base interactions energy: -144.775 where: short stacking energy: -69.792 Base-Backbone interact. energy: 5.462 local terms energy: -84.187983 where: bonds (distance) C4'-P energy: -20.998 bonds (distance) P-C4' energy: -17.414 flat angles C4'-P-C4' energy: -20.735 flat angles P-C4'-P energy: -13.071 tors. eta vs tors. theta energy: -11.970 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 181 Temperature: 1.300000 Total energy: -210.417999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.417999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.509219 (E_RNA) where: Base-Base interactions energy: -118.618 where: short stacking energy: -62.624 Base-Backbone interact. energy: -0.673 local terms energy: -91.218769 where: bonds (distance) C4'-P energy: -26.510 bonds (distance) P-C4' energy: -25.817 flat angles C4'-P-C4' energy: -21.591 flat angles P-C4'-P energy: -8.253 tors. eta vs tors. theta energy: -9.048 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 181 Temperature: 1.350000 Total energy: -180.247506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.247506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.467039 (E_RNA) where: Base-Base interactions energy: -102.709 where: short stacking energy: -56.746 Base-Backbone interact. energy: -0.568 local terms energy: -77.190123 where: bonds (distance) C4'-P energy: -24.294 bonds (distance) P-C4' energy: -18.432 flat angles C4'-P-C4' energy: -16.732 flat angles P-C4'-P energy: -12.240 tors. eta vs tors. theta energy: -5.493 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 182 Temperature: 0.900000 Total energy: -336.951604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.951604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.951604 (E_RNA) where: Base-Base interactions energy: -220.564 where: short stacking energy: -110.962 Base-Backbone interact. energy: -0.064 local terms energy: -116.323977 where: bonds (distance) C4'-P energy: -20.762 bonds (distance) P-C4' energy: -24.674 flat angles C4'-P-C4' energy: -25.135 flat angles P-C4'-P energy: -15.894 tors. eta vs tors. theta energy: -29.858 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 182 Temperature: 0.950000 Total energy: -382.556670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.556670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.560146 (E_RNA) where: Base-Base interactions energy: -256.501 where: short stacking energy: -113.685 Base-Backbone interact. energy: -0.284 local terms energy: -125.775715 where: bonds (distance) C4'-P energy: -21.939 bonds (distance) P-C4' energy: -27.153 flat angles C4'-P-C4' energy: -25.860 flat angles P-C4'-P energy: -19.466 tors. eta vs tors. theta energy: -31.358 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 182 Temperature: 1.000000 Total energy: -349.999617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.999617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.999617 (E_RNA) where: Base-Base interactions energy: -241.362 where: short stacking energy: -109.811 Base-Backbone interact. energy: -0.338 local terms energy: -108.298985 where: bonds (distance) C4'-P energy: -17.565 bonds (distance) P-C4' energy: -23.754 flat angles C4'-P-C4' energy: -23.208 flat angles P-C4'-P energy: -15.008 tors. eta vs tors. theta energy: -28.764 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 182 Temperature: 1.050000 Total energy: -347.736393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.736393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.770170 (E_RNA) where: Base-Base interactions energy: -231.690 where: short stacking energy: -116.343 Base-Backbone interact. energy: -0.356 local terms energy: -115.724361 where: bonds (distance) C4'-P energy: -19.495 bonds (distance) P-C4' energy: -20.914 flat angles C4'-P-C4' energy: -26.080 flat angles P-C4'-P energy: -16.583 tors. eta vs tors. theta energy: -32.652 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 182 Temperature: 1.100000 Total energy: -348.567675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.567675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.567675 (E_RNA) where: Base-Base interactions energy: -227.992 where: short stacking energy: -108.882 Base-Backbone interact. energy: -0.662 local terms energy: -119.913728 where: bonds (distance) C4'-P energy: -26.885 bonds (distance) P-C4' energy: -22.626 flat angles C4'-P-C4' energy: -20.087 flat angles P-C4'-P energy: -17.436 tors. eta vs tors. theta energy: -32.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 182 Temperature: 1.150000 Total energy: -247.534575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.534575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.535618 (E_RNA) where: Base-Base interactions energy: -148.731 where: short stacking energy: -85.000 Base-Backbone interact. energy: 0.588 local terms energy: -99.392167 where: bonds (distance) C4'-P energy: -21.599 bonds (distance) P-C4' energy: -25.129 flat angles C4'-P-C4' energy: -21.678 flat angles P-C4'-P energy: -13.386 tors. eta vs tors. theta energy: -17.602 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 182 Temperature: 1.200000 Total energy: -221.218085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.218085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.243591 (E_RNA) where: Base-Base interactions energy: -128.397 where: short stacking energy: -73.115 Base-Backbone interact. energy: -0.541 local terms energy: -92.305668 where: bonds (distance) C4'-P energy: -20.956 bonds (distance) P-C4' energy: -21.262 flat angles C4'-P-C4' energy: -22.383 flat angles P-C4'-P energy: -13.836 tors. eta vs tors. theta energy: -13.869 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 182 Temperature: 1.250000 Total energy: -208.590381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.590381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.618697 (E_RNA) where: Base-Base interactions energy: -137.828 where: short stacking energy: -77.922 Base-Backbone interact. energy: -0.605 local terms energy: -70.185286 where: bonds (distance) C4'-P energy: -14.909 bonds (distance) P-C4' energy: -24.794 flat angles C4'-P-C4' energy: -12.800 flat angles P-C4'-P energy: -6.559 tors. eta vs tors. theta energy: -11.124 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 182 Temperature: 1.300000 Total energy: -225.666716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.666716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.707394 (E_RNA) where: Base-Base interactions energy: -125.779 where: short stacking energy: -65.882 Base-Backbone interact. energy: -0.767 local terms energy: -99.161314 where: bonds (distance) C4'-P energy: -25.034 bonds (distance) P-C4' energy: -25.666 flat angles C4'-P-C4' energy: -21.456 flat angles P-C4'-P energy: -12.614 tors. eta vs tors. theta energy: -14.391 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 182 Temperature: 1.350000 Total energy: -194.696071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.696071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.707762 (E_RNA) where: Base-Base interactions energy: -119.312 where: short stacking energy: -62.605 Base-Backbone interact. energy: -0.891 local terms energy: -74.505107 where: bonds (distance) C4'-P energy: -16.370 bonds (distance) P-C4' energy: -22.292 flat angles C4'-P-C4' energy: -14.004 flat angles P-C4'-P energy: -16.756 tors. eta vs tors. theta energy: -5.083 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 183 Temperature: 0.900000 Total energy: -367.982755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.982755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.050439 (E_RNA) where: Base-Base interactions energy: -254.454 where: short stacking energy: -117.942 Base-Backbone interact. energy: -0.074 local terms energy: -113.522262 where: bonds (distance) C4'-P energy: -24.134 bonds (distance) P-C4' energy: -20.182 flat angles C4'-P-C4' energy: -26.117 flat angles P-C4'-P energy: -11.454 tors. eta vs tors. theta energy: -31.635 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 183 Temperature: 0.950000 Total energy: -368.019290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.019290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.089734 (E_RNA) where: Base-Base interactions energy: -244.719 where: short stacking energy: -110.123 Base-Backbone interact. energy: -2.665 local terms energy: -120.705874 where: bonds (distance) C4'-P energy: -27.623 bonds (distance) P-C4' energy: -27.416 flat angles C4'-P-C4' energy: -27.234 flat angles P-C4'-P energy: -14.292 tors. eta vs tors. theta energy: -24.141 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 183 Temperature: 1.000000 Total energy: -375.314767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.314767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.342627 (E_RNA) where: Base-Base interactions energy: -257.514 where: short stacking energy: -119.699 Base-Backbone interact. energy: -1.250 local terms energy: -116.578625 where: bonds (distance) C4'-P energy: -24.484 bonds (distance) P-C4' energy: -23.606 flat angles C4'-P-C4' energy: -20.307 flat angles P-C4'-P energy: -19.310 tors. eta vs tors. theta energy: -28.872 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 183 Temperature: 1.050000 Total energy: -348.334994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.334994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.586238 (E_RNA) where: Base-Base interactions energy: -226.644 where: short stacking energy: -99.938 Base-Backbone interact. energy: -1.127 local terms energy: -120.814848 where: bonds (distance) C4'-P energy: -24.191 bonds (distance) P-C4' energy: -22.116 flat angles C4'-P-C4' energy: -25.819 flat angles P-C4'-P energy: -16.849 tors. eta vs tors. theta energy: -31.840 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 183 Temperature: 1.100000 Total energy: -338.338763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.338763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.489560 (E_RNA) where: Base-Base interactions energy: -222.418 where: short stacking energy: -107.456 Base-Backbone interact. energy: 0.034 local terms energy: -116.105449 where: bonds (distance) C4'-P energy: -17.823 bonds (distance) P-C4' energy: -24.336 flat angles C4'-P-C4' energy: -27.651 flat angles P-C4'-P energy: -16.840 tors. eta vs tors. theta energy: -29.455 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 183 Temperature: 1.150000 Total energy: -214.013622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.013622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.119053 (E_RNA) where: Base-Base interactions energy: -125.166 where: short stacking energy: -57.308 Base-Backbone interact. energy: -0.569 local terms energy: -88.384363 where: bonds (distance) C4'-P energy: -22.485 bonds (distance) P-C4' energy: -23.522 flat angles C4'-P-C4' energy: -19.702 flat angles P-C4'-P energy: -13.069 tors. eta vs tors. theta energy: -9.607 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 183 Temperature: 1.200000 Total energy: -244.808568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.808568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.919281 (E_RNA) where: Base-Base interactions energy: -141.482 where: short stacking energy: -82.702 Base-Backbone interact. energy: -0.116 local terms energy: -103.320848 where: bonds (distance) C4'-P energy: -27.296 bonds (distance) P-C4' energy: -15.845 flat angles C4'-P-C4' energy: -23.614 flat angles P-C4'-P energy: -18.440 tors. eta vs tors. theta energy: -18.126 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 183 Temperature: 1.250000 Total energy: -208.550708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.550708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.637968 (E_RNA) where: Base-Base interactions energy: -122.752 where: short stacking energy: -69.877 Base-Backbone interact. energy: -0.925 local terms energy: -84.961020 where: bonds (distance) C4'-P energy: -20.775 bonds (distance) P-C4' energy: -21.347 flat angles C4'-P-C4' energy: -24.843 flat angles P-C4'-P energy: -10.702 tors. eta vs tors. theta energy: -7.294 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 183 Temperature: 1.300000 Total energy: -196.652262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.652262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.783006 (E_RNA) where: Base-Base interactions energy: -124.468 where: short stacking energy: -62.385 Base-Backbone interact. energy: 1.154 local terms energy: -73.469041 where: bonds (distance) C4'-P energy: -22.940 bonds (distance) P-C4' energy: -21.871 flat angles C4'-P-C4' energy: -15.139 flat angles P-C4'-P energy: -4.471 tors. eta vs tors. theta energy: -9.047 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 183 Temperature: 1.350000 Total energy: -217.390746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.390746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.465274 (E_RNA) where: Base-Base interactions energy: -131.684 where: short stacking energy: -75.541 Base-Backbone interact. energy: -0.636 local terms energy: -85.144450 where: bonds (distance) C4'-P energy: -10.565 bonds (distance) P-C4' energy: -23.910 flat angles C4'-P-C4' energy: -16.238 flat angles P-C4'-P energy: -14.957 tors. eta vs tors. theta energy: -19.474 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 184 Temperature: 0.900000 Total energy: -367.038570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.038570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.052833 (E_RNA) where: Base-Base interactions energy: -245.882 where: short stacking energy: -119.277 Base-Backbone interact. energy: -1.229 local terms energy: -119.941011 where: bonds (distance) C4'-P energy: -23.512 bonds (distance) P-C4' energy: -27.244 flat angles C4'-P-C4' energy: -22.253 flat angles P-C4'-P energy: -14.883 tors. eta vs tors. theta energy: -32.049 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 184 Temperature: 0.950000 Total energy: -356.456279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.456279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.456279 (E_RNA) where: Base-Base interactions energy: -228.528 where: short stacking energy: -109.670 Base-Backbone interact. energy: -1.519 local terms energy: -126.408727 where: bonds (distance) C4'-P energy: -25.159 bonds (distance) P-C4' energy: -26.560 flat angles C4'-P-C4' energy: -26.572 flat angles P-C4'-P energy: -19.848 tors. eta vs tors. theta energy: -28.269 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 184 Temperature: 1.000000 Total energy: -376.089403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.089403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.101696 (E_RNA) where: Base-Base interactions energy: -256.611 where: short stacking energy: -115.836 Base-Backbone interact. energy: -0.812 local terms energy: -118.679529 where: bonds (distance) C4'-P energy: -22.229 bonds (distance) P-C4' energy: -24.475 flat angles C4'-P-C4' energy: -23.695 flat angles P-C4'-P energy: -15.695 tors. eta vs tors. theta energy: -32.585 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 184 Temperature: 1.050000 Total energy: -336.978975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.978975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.009806 (E_RNA) where: Base-Base interactions energy: -221.086 where: short stacking energy: -101.216 Base-Backbone interact. energy: -0.586 local terms energy: -115.337371 where: bonds (distance) C4'-P energy: -20.116 bonds (distance) P-C4' energy: -23.811 flat angles C4'-P-C4' energy: -24.130 flat angles P-C4'-P energy: -18.671 tors. eta vs tors. theta energy: -28.609 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 184 Temperature: 1.100000 Total energy: -315.960466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.960466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.960466 (E_RNA) where: Base-Base interactions energy: -215.635 where: short stacking energy: -100.058 Base-Backbone interact. energy: -1.189 local terms energy: -99.136592 where: bonds (distance) C4'-P energy: -22.105 bonds (distance) P-C4' energy: -24.824 flat angles C4'-P-C4' energy: -14.603 flat angles P-C4'-P energy: -15.006 tors. eta vs tors. theta energy: -22.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 184 Temperature: 1.150000 Total energy: -242.200901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.200901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.369303 (E_RNA) where: Base-Base interactions energy: -143.614 where: short stacking energy: -85.915 Base-Backbone interact. energy: -1.362 local terms energy: -97.393352 where: bonds (distance) C4'-P energy: -25.048 bonds (distance) P-C4' energy: -23.102 flat angles C4'-P-C4' energy: -20.137 flat angles P-C4'-P energy: -7.767 tors. eta vs tors. theta energy: -21.340 Dist. restrs. and SS energy: 0.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 184 Temperature: 1.200000 Total energy: -235.320212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.320212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.329846 (E_RNA) where: Base-Base interactions energy: -133.474 where: short stacking energy: -76.844 Base-Backbone interact. energy: -0.653 local terms energy: -101.203351 where: bonds (distance) C4'-P energy: -22.551 bonds (distance) P-C4' energy: -25.117 flat angles C4'-P-C4' energy: -26.448 flat angles P-C4'-P energy: -10.272 tors. eta vs tors. theta energy: -16.815 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 184 Temperature: 1.250000 Total energy: -211.000224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.000224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.000224 (E_RNA) where: Base-Base interactions energy: -123.614 where: short stacking energy: -66.352 Base-Backbone interact. energy: -0.384 local terms energy: -87.002346 where: bonds (distance) C4'-P energy: -20.631 bonds (distance) P-C4' energy: -24.683 flat angles C4'-P-C4' energy: -18.255 flat angles P-C4'-P energy: -14.119 tors. eta vs tors. theta energy: -9.316 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 184 Temperature: 1.300000 Total energy: -225.231843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.231843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.304413 (E_RNA) where: Base-Base interactions energy: -137.636 where: short stacking energy: -86.927 Base-Backbone interact. energy: -0.545 local terms energy: -87.123429 where: bonds (distance) C4'-P energy: -17.166 bonds (distance) P-C4' energy: -21.294 flat angles C4'-P-C4' energy: -22.395 flat angles P-C4'-P energy: -4.337 tors. eta vs tors. theta energy: -21.932 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 184 Temperature: 1.350000 Total energy: -195.433212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.433212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.452995 (E_RNA) where: Base-Base interactions energy: -107.338 where: short stacking energy: -59.098 Base-Backbone interact. energy: -0.236 local terms energy: -87.879829 where: bonds (distance) C4'-P energy: -19.740 bonds (distance) P-C4' energy: -24.784 flat angles C4'-P-C4' energy: -16.592 flat angles P-C4'-P energy: -18.111 tors. eta vs tors. theta energy: -8.653 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 185 Temperature: 0.900000 Total energy: -352.208409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.208409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.286985 (E_RNA) where: Base-Base interactions energy: -233.231 where: short stacking energy: -113.869 Base-Backbone interact. energy: -0.052 local terms energy: -119.003478 where: bonds (distance) C4'-P energy: -26.616 bonds (distance) P-C4' energy: -18.912 flat angles C4'-P-C4' energy: -27.312 flat angles P-C4'-P energy: -15.339 tors. eta vs tors. theta energy: -30.824 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 185 Temperature: 0.950000 Total energy: -382.993364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.993364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.015969 (E_RNA) where: Base-Base interactions energy: -256.547 where: short stacking energy: -118.887 Base-Backbone interact. energy: -1.050 local terms energy: -125.419211 where: bonds (distance) C4'-P energy: -23.568 bonds (distance) P-C4' energy: -23.760 flat angles C4'-P-C4' energy: -27.410 flat angles P-C4'-P energy: -17.948 tors. eta vs tors. theta energy: -32.733 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 185 Temperature: 1.000000 Total energy: -342.704916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.704916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.704916 (E_RNA) where: Base-Base interactions energy: -224.196 where: short stacking energy: -111.909 Base-Backbone interact. energy: -0.694 local terms energy: -117.815192 where: bonds (distance) C4'-P energy: -20.323 bonds (distance) P-C4' energy: -24.288 flat angles C4'-P-C4' energy: -24.455 flat angles P-C4'-P energy: -15.990 tors. eta vs tors. theta energy: -32.760 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 185 Temperature: 1.050000 Total energy: -342.043615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.043615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.044213 (E_RNA) where: Base-Base interactions energy: -222.553 where: short stacking energy: -105.131 Base-Backbone interact. energy: -0.626 local terms energy: -118.864608 where: bonds (distance) C4'-P energy: -24.454 bonds (distance) P-C4' energy: -25.186 flat angles C4'-P-C4' energy: -24.286 flat angles P-C4'-P energy: -16.823 tors. eta vs tors. theta energy: -28.115 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 185 Temperature: 1.100000 Total energy: -330.741672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.741672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.987318 (E_RNA) where: Base-Base interactions energy: -222.886 where: short stacking energy: -114.641 Base-Backbone interact. energy: -0.398 local terms energy: -107.702978 where: bonds (distance) C4'-P energy: -24.625 bonds (distance) P-C4' energy: -20.322 flat angles C4'-P-C4' energy: -21.048 flat angles P-C4'-P energy: -12.721 tors. eta vs tors. theta energy: -28.987 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 185 Temperature: 1.150000 Total energy: -245.933439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.933439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.066540 (E_RNA) where: Base-Base interactions energy: -158.604 where: short stacking energy: -90.378 Base-Backbone interact. energy: 1.204 local terms energy: -88.667133 where: bonds (distance) C4'-P energy: -14.601 bonds (distance) P-C4' energy: -18.531 flat angles C4'-P-C4' energy: -20.823 flat angles P-C4'-P energy: -14.803 tors. eta vs tors. theta energy: -19.910 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 185 Temperature: 1.200000 Total energy: -241.384278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.384278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.424717 (E_RNA) where: Base-Base interactions energy: -149.693 where: short stacking energy: -74.063 Base-Backbone interact. energy: -0.193 local terms energy: -91.537986 where: bonds (distance) C4'-P energy: -19.712 bonds (distance) P-C4' energy: -22.340 flat angles C4'-P-C4' energy: -18.389 flat angles P-C4'-P energy: -15.119 tors. eta vs tors. theta energy: -15.979 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 185 Temperature: 1.250000 Total energy: -196.436304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.436304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.543813 (E_RNA) where: Base-Base interactions energy: -108.399 where: short stacking energy: -64.832 Base-Backbone interact. energy: -0.529 local terms energy: -87.615461 where: bonds (distance) C4'-P energy: -15.116 bonds (distance) P-C4' energy: -21.564 flat angles C4'-P-C4' energy: -23.672 flat angles P-C4'-P energy: -14.751 tors. eta vs tors. theta energy: -12.512 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 185 Temperature: 1.300000 Total energy: -188.817012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.817012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.848553 (E_RNA) where: Base-Base interactions energy: -113.717 where: short stacking energy: -51.533 Base-Backbone interact. energy: -0.195 local terms energy: -74.936921 where: bonds (distance) C4'-P energy: -20.887 bonds (distance) P-C4' energy: -19.061 flat angles C4'-P-C4' energy: -13.843 flat angles P-C4'-P energy: -14.528 tors. eta vs tors. theta energy: -6.618 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 185 Temperature: 1.350000 Total energy: -210.248083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.248083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.497731 (E_RNA) where: Base-Base interactions energy: -120.169 where: short stacking energy: -67.828 Base-Backbone interact. energy: 1.113 local terms energy: -91.441801 where: bonds (distance) C4'-P energy: -25.617 bonds (distance) P-C4' energy: -16.409 flat angles C4'-P-C4' energy: -25.246 flat angles P-C4'-P energy: -14.515 tors. eta vs tors. theta energy: -9.655 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 186 Temperature: 0.900000 Total energy: -386.067059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.067059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.067059 (E_RNA) where: Base-Base interactions energy: -264.848 where: short stacking energy: -127.070 Base-Backbone interact. energy: -0.379 local terms energy: -120.840029 where: bonds (distance) C4'-P energy: -21.074 bonds (distance) P-C4' energy: -22.817 flat angles C4'-P-C4' energy: -25.429 flat angles P-C4'-P energy: -16.824 tors. eta vs tors. theta energy: -34.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 186 Temperature: 0.950000 Total energy: -349.284330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.284330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.286927 (E_RNA) where: Base-Base interactions energy: -230.573 where: short stacking energy: -117.936 Base-Backbone interact. energy: 0.937 local terms energy: -119.651027 where: bonds (distance) C4'-P energy: -22.939 bonds (distance) P-C4' energy: -25.598 flat angles C4'-P-C4' energy: -26.904 flat angles P-C4'-P energy: -15.698 tors. eta vs tors. theta energy: -28.513 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 186 Temperature: 1.000000 Total energy: -358.828421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.828421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.898152 (E_RNA) where: Base-Base interactions energy: -240.010 where: short stacking energy: -119.994 Base-Backbone interact. energy: 1.875 local terms energy: -120.763022 where: bonds (distance) C4'-P energy: -21.400 bonds (distance) P-C4' energy: -26.766 flat angles C4'-P-C4' energy: -26.424 flat angles P-C4'-P energy: -17.049 tors. eta vs tors. theta energy: -29.124 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 186 Temperature: 1.050000 Total energy: -336.941499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.941499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.979029 (E_RNA) where: Base-Base interactions energy: -217.178 where: short stacking energy: -107.426 Base-Backbone interact. energy: -0.677 local terms energy: -119.123438 where: bonds (distance) C4'-P energy: -24.146 bonds (distance) P-C4' energy: -19.664 flat angles C4'-P-C4' energy: -26.660 flat angles P-C4'-P energy: -21.337 tors. eta vs tors. theta energy: -27.317 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 186 Temperature: 1.100000 Total energy: -327.433322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.433322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.679918 (E_RNA) where: Base-Base interactions energy: -214.639 where: short stacking energy: -106.058 Base-Backbone interact. energy: -0.235 local terms energy: -112.805626 where: bonds (distance) C4'-P energy: -23.057 bonds (distance) P-C4' energy: -19.821 flat angles C4'-P-C4' energy: -24.464 flat angles P-C4'-P energy: -15.992 tors. eta vs tors. theta energy: -29.471 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 186 Temperature: 1.150000 Total energy: -245.078927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.078927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.343690 (E_RNA) where: Base-Base interactions energy: -150.264 where: short stacking energy: -80.198 Base-Backbone interact. energy: -0.176 local terms energy: -94.903957 where: bonds (distance) C4'-P energy: -24.244 bonds (distance) P-C4' energy: -21.226 flat angles C4'-P-C4' energy: -21.733 flat angles P-C4'-P energy: -12.414 tors. eta vs tors. theta energy: -15.288 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 186 Temperature: 1.200000 Total energy: -220.727882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.727882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.772898 (E_RNA) where: Base-Base interactions energy: -133.124 where: short stacking energy: -90.128 Base-Backbone interact. energy: -0.126 local terms energy: -87.523291 where: bonds (distance) C4'-P energy: -18.887 bonds (distance) P-C4' energy: -17.978 flat angles C4'-P-C4' energy: -22.374 flat angles P-C4'-P energy: -13.198 tors. eta vs tors. theta energy: -15.087 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 186 Temperature: 1.250000 Total energy: -215.852057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.852057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.852057 (E_RNA) where: Base-Base interactions energy: -129.240 where: short stacking energy: -70.560 Base-Backbone interact. energy: -0.363 local terms energy: -86.249445 where: bonds (distance) C4'-P energy: -19.805 bonds (distance) P-C4' energy: -21.818 flat angles C4'-P-C4' energy: -19.035 flat angles P-C4'-P energy: -15.138 tors. eta vs tors. theta energy: -10.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 186 Temperature: 1.300000 Total energy: -210.939964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.939964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.969044 (E_RNA) where: Base-Base interactions energy: -122.933 where: short stacking energy: -69.442 Base-Backbone interact. energy: -0.371 local terms energy: -87.665260 where: bonds (distance) C4'-P energy: -15.383 bonds (distance) P-C4' energy: -20.289 flat angles C4'-P-C4' energy: -20.911 flat angles P-C4'-P energy: -16.884 tors. eta vs tors. theta energy: -14.197 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 186 Temperature: 1.350000 Total energy: -195.708275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.708275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.793000 (E_RNA) where: Base-Base interactions energy: -120.524 where: short stacking energy: -64.195 Base-Backbone interact. energy: -0.379 local terms energy: -74.889782 where: bonds (distance) C4'-P energy: -16.438 bonds (distance) P-C4' energy: -15.758 flat angles C4'-P-C4' energy: -21.837 flat angles P-C4'-P energy: -12.304 tors. eta vs tors. theta energy: -8.553 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 187 Temperature: 0.900000 Total energy: -377.571857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.571857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.803697 (E_RNA) where: Base-Base interactions energy: -248.892 where: short stacking energy: -120.143 Base-Backbone interact. energy: -0.605 local terms energy: -128.306502 where: bonds (distance) C4'-P energy: -24.029 bonds (distance) P-C4' energy: -25.629 flat angles C4'-P-C4' energy: -26.144 flat angles P-C4'-P energy: -19.955 tors. eta vs tors. theta energy: -32.550 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 187 Temperature: 0.950000 Total energy: -368.328289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.328289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.500099 (E_RNA) where: Base-Base interactions energy: -233.169 where: short stacking energy: -121.738 Base-Backbone interact. energy: -1.437 local terms energy: -133.894522 where: bonds (distance) C4'-P energy: -23.708 bonds (distance) P-C4' energy: -29.324 flat angles C4'-P-C4' energy: -28.423 flat angles P-C4'-P energy: -19.485 tors. eta vs tors. theta energy: -32.955 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 187 Temperature: 1.000000 Total energy: -344.133579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.133579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.133579 (E_RNA) where: Base-Base interactions energy: -226.144 where: short stacking energy: -110.250 Base-Backbone interact. energy: -0.272 local terms energy: -117.717487 where: bonds (distance) C4'-P energy: -22.059 bonds (distance) P-C4' energy: -26.452 flat angles C4'-P-C4' energy: -23.848 flat angles P-C4'-P energy: -15.407 tors. eta vs tors. theta energy: -29.952 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 187 Temperature: 1.050000 Total energy: -329.693185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.693185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.693185 (E_RNA) where: Base-Base interactions energy: -215.059 where: short stacking energy: -101.861 Base-Backbone interact. energy: -0.841 local terms energy: -113.792397 where: bonds (distance) C4'-P energy: -25.945 bonds (distance) P-C4' energy: -26.075 flat angles C4'-P-C4' energy: -22.384 flat angles P-C4'-P energy: -13.161 tors. eta vs tors. theta energy: -26.227 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 187 Temperature: 1.100000 Total energy: -338.937611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.937611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.285840 (E_RNA) where: Base-Base interactions energy: -217.965 where: short stacking energy: -109.976 Base-Backbone interact. energy: -0.126 local terms energy: -121.195009 where: bonds (distance) C4'-P energy: -21.901 bonds (distance) P-C4' energy: -24.663 flat angles C4'-P-C4' energy: -25.997 flat angles P-C4'-P energy: -15.285 tors. eta vs tors. theta energy: -33.350 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 187 Temperature: 1.150000 Total energy: -234.720426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.720426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.743769 (E_RNA) where: Base-Base interactions energy: -137.210 where: short stacking energy: -78.378 Base-Backbone interact. energy: 0.079 local terms energy: -97.612141 where: bonds (distance) C4'-P energy: -24.527 bonds (distance) P-C4' energy: -23.758 flat angles C4'-P-C4' energy: -23.164 flat angles P-C4'-P energy: -11.205 tors. eta vs tors. theta energy: -14.958 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 187 Temperature: 1.200000 Total energy: -223.637070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.637070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.662310 (E_RNA) where: Base-Base interactions energy: -130.701 where: short stacking energy: -71.545 Base-Backbone interact. energy: 0.002 local terms energy: -92.962771 where: bonds (distance) C4'-P energy: -18.597 bonds (distance) P-C4' energy: -18.774 flat angles C4'-P-C4' energy: -23.398 flat angles P-C4'-P energy: -16.706 tors. eta vs tors. theta energy: -15.488 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 187 Temperature: 1.250000 Total energy: -199.416698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.416698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.481837 (E_RNA) where: Base-Base interactions energy: -119.341 where: short stacking energy: -62.663 Base-Backbone interact. energy: 2.591 local terms energy: -82.732189 where: bonds (distance) C4'-P energy: -20.439 bonds (distance) P-C4' energy: -17.877 flat angles C4'-P-C4' energy: -23.770 flat angles P-C4'-P energy: -14.732 tors. eta vs tors. theta energy: -5.914 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 187 Temperature: 1.300000 Total energy: -215.444178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.444178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.444178 (E_RNA) where: Base-Base interactions energy: -117.175 where: short stacking energy: -63.741 Base-Backbone interact. energy: -0.754 local terms energy: -97.515685 where: bonds (distance) C4'-P energy: -27.424 bonds (distance) P-C4' energy: -25.500 flat angles C4'-P-C4' energy: -18.901 flat angles P-C4'-P energy: -11.948 tors. eta vs tors. theta energy: -13.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 187 Temperature: 1.350000 Total energy: -210.028589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.028589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.116871 (E_RNA) where: Base-Base interactions energy: -117.766 where: short stacking energy: -68.178 Base-Backbone interact. energy: -0.195 local terms energy: -92.156046 where: bonds (distance) C4'-P energy: -22.191 bonds (distance) P-C4' energy: -16.510 flat angles C4'-P-C4' energy: -24.381 flat angles P-C4'-P energy: -11.191 tors. eta vs tors. theta energy: -17.884 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 188 Temperature: 0.900000 Total energy: -370.919609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.919609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.932289 (E_RNA) where: Base-Base interactions energy: -240.154 where: short stacking energy: -118.684 Base-Backbone interact. energy: -3.196 local terms energy: -127.582483 where: bonds (distance) C4'-P energy: -23.877 bonds (distance) P-C4' energy: -27.049 flat angles C4'-P-C4' energy: -27.507 flat angles P-C4'-P energy: -18.816 tors. eta vs tors. theta energy: -30.335 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 188 Temperature: 0.950000 Total energy: -374.979694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.979694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.979694 (E_RNA) where: Base-Base interactions energy: -254.437 where: short stacking energy: -109.251 Base-Backbone interact. energy: -1.269 local terms energy: -119.272789 where: bonds (distance) C4'-P energy: -22.940 bonds (distance) P-C4' energy: -24.656 flat angles C4'-P-C4' energy: -27.179 flat angles P-C4'-P energy: -14.257 tors. eta vs tors. theta energy: -30.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 188 Temperature: 1.000000 Total energy: -350.099973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.099973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.160220 (E_RNA) where: Base-Base interactions energy: -222.504 where: short stacking energy: -110.339 Base-Backbone interact. energy: -0.520 local terms energy: -127.136114 where: bonds (distance) C4'-P energy: -27.546 bonds (distance) P-C4' energy: -22.446 flat angles C4'-P-C4' energy: -29.784 flat angles P-C4'-P energy: -15.769 tors. eta vs tors. theta energy: -31.590 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 188 Temperature: 1.050000 Total energy: -342.136531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.136531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.159482 (E_RNA) where: Base-Base interactions energy: -223.543 where: short stacking energy: -111.614 Base-Backbone interact. energy: -0.360 local terms energy: -118.256578 where: bonds (distance) C4'-P energy: -24.794 bonds (distance) P-C4' energy: -22.151 flat angles C4'-P-C4' energy: -23.262 flat angles P-C4'-P energy: -18.502 tors. eta vs tors. theta energy: -29.548 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 188 Temperature: 1.100000 Total energy: -322.094933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.094933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.240866 (E_RNA) where: Base-Base interactions energy: -213.186 where: short stacking energy: -94.249 Base-Backbone interact. energy: -0.389 local terms energy: -108.665563 where: bonds (distance) C4'-P energy: -23.595 bonds (distance) P-C4' energy: -19.566 flat angles C4'-P-C4' energy: -21.427 flat angles P-C4'-P energy: -16.629 tors. eta vs tors. theta energy: -27.449 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 188 Temperature: 1.150000 Total energy: -272.524751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.524751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.567989 (E_RNA) where: Base-Base interactions energy: -172.122 where: short stacking energy: -93.960 Base-Backbone interact. energy: -0.181 local terms energy: -100.264956 where: bonds (distance) C4'-P energy: -22.729 bonds (distance) P-C4' energy: -20.742 flat angles C4'-P-C4' energy: -24.885 flat angles P-C4'-P energy: -11.331 tors. eta vs tors. theta energy: -20.578 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 188 Temperature: 1.200000 Total energy: -219.641733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.641733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.807433 (E_RNA) where: Base-Base interactions energy: -130.143 where: short stacking energy: -74.049 Base-Backbone interact. energy: -0.258 local terms energy: -89.406190 where: bonds (distance) C4'-P energy: -15.844 bonds (distance) P-C4' energy: -24.249 flat angles C4'-P-C4' energy: -18.958 flat angles P-C4'-P energy: -14.200 tors. eta vs tors. theta energy: -16.156 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 188 Temperature: 1.250000 Total energy: -221.014100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.014100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.289466 (E_RNA) where: Base-Base interactions energy: -133.029 where: short stacking energy: -78.309 Base-Backbone interact. energy: 0.336 local terms energy: -88.595903 where: bonds (distance) C4'-P energy: -21.263 bonds (distance) P-C4' energy: -15.931 flat angles C4'-P-C4' energy: -21.320 flat angles P-C4'-P energy: -13.165 tors. eta vs tors. theta energy: -16.916 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 188 Temperature: 1.300000 Total energy: -191.979596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.979596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.988629 (E_RNA) where: Base-Base interactions energy: -104.439 where: short stacking energy: -49.602 Base-Backbone interact. energy: -0.608 local terms energy: -86.942104 where: bonds (distance) C4'-P energy: -17.559 bonds (distance) P-C4' energy: -25.413 flat angles C4'-P-C4' energy: -18.147 flat angles P-C4'-P energy: -14.151 tors. eta vs tors. theta energy: -11.673 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 188 Temperature: 1.350000 Total energy: -204.946668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.946668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.954440 (E_RNA) where: Base-Base interactions energy: -113.974 where: short stacking energy: -52.197 Base-Backbone interact. energy: -0.342 local terms energy: -90.638087 where: bonds (distance) C4'-P energy: -22.361 bonds (distance) P-C4' energy: -26.464 flat angles C4'-P-C4' energy: -18.740 flat angles P-C4'-P energy: -14.237 tors. eta vs tors. theta energy: -8.836 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 189 Temperature: 0.900000 Total energy: -367.555112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.555112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.555112 (E_RNA) where: Base-Base interactions energy: -242.190 where: short stacking energy: -123.577 Base-Backbone interact. energy: -0.678 local terms energy: -124.687505 where: bonds (distance) C4'-P energy: -15.583 bonds (distance) P-C4' energy: -26.935 flat angles C4'-P-C4' energy: -28.900 flat angles P-C4'-P energy: -19.897 tors. eta vs tors. theta energy: -33.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 189 Temperature: 0.950000 Total energy: -380.267282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.267282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.275990 (E_RNA) where: Base-Base interactions energy: -260.925 where: short stacking energy: -114.465 Base-Backbone interact. energy: -0.901 local terms energy: -118.449772 where: bonds (distance) C4'-P energy: -23.365 bonds (distance) P-C4' energy: -25.040 flat angles C4'-P-C4' energy: -29.291 flat angles P-C4'-P energy: -13.606 tors. eta vs tors. theta energy: -27.147 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 189 Temperature: 1.000000 Total energy: -356.276611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.276611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.454864 (E_RNA) where: Base-Base interactions energy: -230.691 where: short stacking energy: -121.111 Base-Backbone interact. energy: -0.933 local terms energy: -124.830986 where: bonds (distance) C4'-P energy: -23.825 bonds (distance) P-C4' energy: -21.804 flat angles C4'-P-C4' energy: -26.633 flat angles P-C4'-P energy: -22.577 tors. eta vs tors. theta energy: -29.994 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 189 Temperature: 1.050000 Total energy: -328.834516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.834516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.834516 (E_RNA) where: Base-Base interactions energy: -218.790 where: short stacking energy: -110.358 Base-Backbone interact. energy: -0.465 local terms energy: -109.579881 where: bonds (distance) C4'-P energy: -23.248 bonds (distance) P-C4' energy: -21.598 flat angles C4'-P-C4' energy: -19.616 flat angles P-C4'-P energy: -16.943 tors. eta vs tors. theta energy: -28.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 189 Temperature: 1.100000 Total energy: -323.222606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.222606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.222606 (E_RNA) where: Base-Base interactions energy: -212.942 where: short stacking energy: -94.824 Base-Backbone interact. energy: -0.206 local terms energy: -110.074535 where: bonds (distance) C4'-P energy: -26.016 bonds (distance) P-C4' energy: -23.412 flat angles C4'-P-C4' energy: -26.264 flat angles P-C4'-P energy: -14.048 tors. eta vs tors. theta energy: -20.333 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 189 Temperature: 1.150000 Total energy: -235.331630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.331630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.344116 (E_RNA) where: Base-Base interactions energy: -131.041 where: short stacking energy: -77.995 Base-Backbone interact. energy: -0.886 local terms energy: -103.417831 where: bonds (distance) C4'-P energy: -21.658 bonds (distance) P-C4' energy: -28.102 flat angles C4'-P-C4' energy: -21.424 flat angles P-C4'-P energy: -17.463 tors. eta vs tors. theta energy: -14.771 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 189 Temperature: 1.200000 Total energy: -217.605824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.605824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.656071 (E_RNA) where: Base-Base interactions energy: -130.518 where: short stacking energy: -67.419 Base-Backbone interact. energy: -1.101 local terms energy: -86.036438 where: bonds (distance) C4'-P energy: -21.687 bonds (distance) P-C4' energy: -24.284 flat angles C4'-P-C4' energy: -23.127 flat angles P-C4'-P energy: -8.499 tors. eta vs tors. theta energy: -8.440 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 189 Temperature: 1.250000 Total energy: -205.360447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.360447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.887426 (E_RNA) where: Base-Base interactions energy: -113.949 where: short stacking energy: -71.669 Base-Backbone interact. energy: -0.302 local terms energy: -91.637181 where: bonds (distance) C4'-P energy: -21.069 bonds (distance) P-C4' energy: -20.299 flat angles C4'-P-C4' energy: -26.075 flat angles P-C4'-P energy: -13.850 tors. eta vs tors. theta energy: -10.345 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 189 Temperature: 1.300000 Total energy: -205.144030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.144030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.161369 (E_RNA) where: Base-Base interactions energy: -121.042 where: short stacking energy: -69.350 Base-Backbone interact. energy: -0.252 local terms energy: -83.867671 where: bonds (distance) C4'-P energy: -17.447 bonds (distance) P-C4' energy: -16.152 flat angles C4'-P-C4' energy: -22.839 flat angles P-C4'-P energy: -17.244 tors. eta vs tors. theta energy: -10.186 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 189 Temperature: 1.350000 Total energy: -203.521885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.521885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.565593 (E_RNA) where: Base-Base interactions energy: -128.361 where: short stacking energy: -78.682 Base-Backbone interact. energy: -0.646 local terms energy: -74.558781 where: bonds (distance) C4'-P energy: -21.570 bonds (distance) P-C4' energy: -14.739 flat angles C4'-P-C4' energy: -17.145 flat angles P-C4'-P energy: -8.931 tors. eta vs tors. theta energy: -12.174 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 190 Temperature: 0.900000 Total energy: -369.844799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.844799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.850851 (E_RNA) where: Base-Base interactions energy: -241.281 where: short stacking energy: -122.551 Base-Backbone interact. energy: -0.067 local terms energy: -128.503122 where: bonds (distance) C4'-P energy: -22.377 bonds (distance) P-C4' energy: -24.951 flat angles C4'-P-C4' energy: -28.663 flat angles P-C4'-P energy: -19.450 tors. eta vs tors. theta energy: -33.062 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 190 Temperature: 0.950000 Total energy: -375.460313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.460313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.461880 (E_RNA) where: Base-Base interactions energy: -251.738 where: short stacking energy: -112.778 Base-Backbone interact. energy: -3.476 local terms energy: -120.248410 where: bonds (distance) C4'-P energy: -22.486 bonds (distance) P-C4' energy: -22.443 flat angles C4'-P-C4' energy: -27.047 flat angles P-C4'-P energy: -17.088 tors. eta vs tors. theta energy: -31.184 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 190 Temperature: 1.000000 Total energy: -344.211695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.211695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.216099 (E_RNA) where: Base-Base interactions energy: -235.748 where: short stacking energy: -107.618 Base-Backbone interact. energy: -2.065 local terms energy: -106.403249 where: bonds (distance) C4'-P energy: -22.727 bonds (distance) P-C4' energy: -24.121 flat angles C4'-P-C4' energy: -19.800 flat angles P-C4'-P energy: -14.151 tors. eta vs tors. theta energy: -25.604 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 190 Temperature: 1.050000 Total energy: -327.900376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.900376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.954905 (E_RNA) where: Base-Base interactions energy: -219.786 where: short stacking energy: -105.865 Base-Backbone interact. energy: -0.329 local terms energy: -107.839659 where: bonds (distance) C4'-P energy: -19.466 bonds (distance) P-C4' energy: -16.577 flat angles C4'-P-C4' energy: -24.430 flat angles P-C4'-P energy: -18.200 tors. eta vs tors. theta energy: -29.166 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 190 Temperature: 1.100000 Total energy: -324.167036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.167036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.245011 (E_RNA) where: Base-Base interactions energy: -217.480 where: short stacking energy: -101.045 Base-Backbone interact. energy: -0.876 local terms energy: -105.888532 where: bonds (distance) C4'-P energy: -24.578 bonds (distance) P-C4' energy: -14.351 flat angles C4'-P-C4' energy: -24.934 flat angles P-C4'-P energy: -15.691 tors. eta vs tors. theta energy: -26.335 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 190 Temperature: 1.150000 Total energy: -228.632141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.632141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.748297 (E_RNA) where: Base-Base interactions energy: -131.161 where: short stacking energy: -69.682 Base-Backbone interact. energy: -0.277 local terms energy: -97.310759 where: bonds (distance) C4'-P energy: -20.372 bonds (distance) P-C4' energy: -19.450 flat angles C4'-P-C4' energy: -25.722 flat angles P-C4'-P energy: -14.727 tors. eta vs tors. theta energy: -17.040 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 190 Temperature: 1.200000 Total energy: -212.139070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.139070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.142763 (E_RNA) where: Base-Base interactions energy: -121.856 where: short stacking energy: -69.552 Base-Backbone interact. energy: -0.198 local terms energy: -90.088416 where: bonds (distance) C4'-P energy: -20.552 bonds (distance) P-C4' energy: -24.203 flat angles C4'-P-C4' energy: -17.681 flat angles P-C4'-P energy: -11.700 tors. eta vs tors. theta energy: -15.952 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 190 Temperature: 1.250000 Total energy: -228.986394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.986394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.141013 (E_RNA) where: Base-Base interactions energy: -139.857 where: short stacking energy: -82.603 Base-Backbone interact. energy: 0.084 local terms energy: -89.368435 where: bonds (distance) C4'-P energy: -18.956 bonds (distance) P-C4' energy: -22.225 flat angles C4'-P-C4' energy: -17.320 flat angles P-C4'-P energy: -11.919 tors. eta vs tors. theta energy: -18.949 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 190 Temperature: 1.300000 Total energy: -208.853040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.853040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.126688 (E_RNA) where: Base-Base interactions energy: -117.843 where: short stacking energy: -70.941 Base-Backbone interact. energy: 1.824 local terms energy: -93.108284 where: bonds (distance) C4'-P energy: -15.727 bonds (distance) P-C4' energy: -24.151 flat angles C4'-P-C4' energy: -25.807 flat angles P-C4'-P energy: -15.221 tors. eta vs tors. theta energy: -12.203 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 190 Temperature: 1.350000 Total energy: -189.210009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.210009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.272171 (E_RNA) where: Base-Base interactions energy: -110.760 where: short stacking energy: -59.312 Base-Backbone interact. energy: -0.298 local terms energy: -78.214191 where: bonds (distance) C4'-P energy: -23.164 bonds (distance) P-C4' energy: -20.775 flat angles C4'-P-C4' energy: -16.707 flat angles P-C4'-P energy: -13.499 tors. eta vs tors. theta energy: -4.069 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 191 Temperature: 0.900000 Total energy: -366.013031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.013031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.038988 (E_RNA) where: Base-Base interactions energy: -243.875 where: short stacking energy: -113.497 Base-Backbone interact. energy: -0.250 local terms energy: -121.913643 where: bonds (distance) C4'-P energy: -26.040 bonds (distance) P-C4' energy: -24.137 flat angles C4'-P-C4' energy: -22.366 flat angles P-C4'-P energy: -21.060 tors. eta vs tors. theta energy: -28.310 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 191 Temperature: 0.950000 Total energy: -361.265462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.265462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.265462 (E_RNA) where: Base-Base interactions energy: -251.232 where: short stacking energy: -107.670 Base-Backbone interact. energy: -0.630 local terms energy: -109.402613 where: bonds (distance) C4'-P energy: -25.093 bonds (distance) P-C4' energy: -19.574 flat angles C4'-P-C4' energy: -26.224 flat angles P-C4'-P energy: -17.045 tors. eta vs tors. theta energy: -21.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 191 Temperature: 1.000000 Total energy: -353.947395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.947395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.960922 (E_RNA) where: Base-Base interactions energy: -230.809 where: short stacking energy: -111.790 Base-Backbone interact. energy: 1.908 local terms energy: -125.060110 where: bonds (distance) C4'-P energy: -24.869 bonds (distance) P-C4' energy: -27.987 flat angles C4'-P-C4' energy: -25.329 flat angles P-C4'-P energy: -20.369 tors. eta vs tors. theta energy: -26.506 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 191 Temperature: 1.050000 Total energy: -325.960629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.960629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.969290 (E_RNA) where: Base-Base interactions energy: -220.235 where: short stacking energy: -107.680 Base-Backbone interact. energy: -0.080 local terms energy: -105.654722 where: bonds (distance) C4'-P energy: -18.066 bonds (distance) P-C4' energy: -20.384 flat angles C4'-P-C4' energy: -21.612 flat angles P-C4'-P energy: -18.939 tors. eta vs tors. theta energy: -26.654 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 191 Temperature: 1.100000 Total energy: -314.877121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.877121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.972712 (E_RNA) where: Base-Base interactions energy: -194.826 where: short stacking energy: -108.218 Base-Backbone interact. energy: -1.266 local terms energy: -118.880491 where: bonds (distance) C4'-P energy: -23.739 bonds (distance) P-C4' energy: -27.262 flat angles C4'-P-C4' energy: -21.740 flat angles P-C4'-P energy: -19.636 tors. eta vs tors. theta energy: -26.504 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 191 Temperature: 1.150000 Total energy: -255.899525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.899525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.925349 (E_RNA) where: Base-Base interactions energy: -151.442 where: short stacking energy: -90.721 Base-Backbone interact. energy: -0.580 local terms energy: -103.903011 where: bonds (distance) C4'-P energy: -20.356 bonds (distance) P-C4' energy: -19.962 flat angles C4'-P-C4' energy: -19.604 flat angles P-C4'-P energy: -22.264 tors. eta vs tors. theta energy: -21.716 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 191 Temperature: 1.200000 Total energy: -254.312028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.312028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.803037 (E_RNA) where: Base-Base interactions energy: -149.009 where: short stacking energy: -88.895 Base-Backbone interact. energy: 0.246 local terms energy: -106.039628 where: bonds (distance) C4'-P energy: -26.222 bonds (distance) P-C4' energy: -23.591 flat angles C4'-P-C4' energy: -22.635 flat angles P-C4'-P energy: -15.323 tors. eta vs tors. theta energy: -18.268 Dist. restrs. and SS energy: 0.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 191 Temperature: 1.250000 Total energy: -225.476095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.476095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.489052 (E_RNA) where: Base-Base interactions energy: -137.479 where: short stacking energy: -84.566 Base-Backbone interact. energy: -0.110 local terms energy: -87.900387 where: bonds (distance) C4'-P energy: -23.448 bonds (distance) P-C4' energy: -19.693 flat angles C4'-P-C4' energy: -19.038 flat angles P-C4'-P energy: -9.754 tors. eta vs tors. theta energy: -15.968 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 191 Temperature: 1.300000 Total energy: -209.512613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.512613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.553793 (E_RNA) where: Base-Base interactions energy: -122.024 where: short stacking energy: -65.471 Base-Backbone interact. energy: -0.875 local terms energy: -86.654603 where: bonds (distance) C4'-P energy: -19.972 bonds (distance) P-C4' energy: -24.928 flat angles C4'-P-C4' energy: -23.842 flat angles P-C4'-P energy: -10.542 tors. eta vs tors. theta energy: -7.371 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 191 Temperature: 1.350000 Total energy: -204.555646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.555646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.708261 (E_RNA) where: Base-Base interactions energy: -119.756 where: short stacking energy: -68.991 Base-Backbone interact. energy: -0.648 local terms energy: -84.303927 where: bonds (distance) C4'-P energy: -19.032 bonds (distance) P-C4' energy: -25.075 flat angles C4'-P-C4' energy: -17.872 flat angles P-C4'-P energy: -8.651 tors. eta vs tors. theta energy: -13.674 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 192 Temperature: 0.900000 Total energy: -371.867501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.867501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.867501 (E_RNA) where: Base-Base interactions energy: -250.278 where: short stacking energy: -128.516 Base-Backbone interact. energy: -1.527 local terms energy: -120.062086 where: bonds (distance) C4'-P energy: -21.533 bonds (distance) P-C4' energy: -23.951 flat angles C4'-P-C4' energy: -23.951 flat angles P-C4'-P energy: -17.672 tors. eta vs tors. theta energy: -32.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 192 Temperature: 0.950000 Total energy: -376.693363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.693363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.696980 (E_RNA) where: Base-Base interactions energy: -260.686 where: short stacking energy: -114.414 Base-Backbone interact. energy: -0.659 local terms energy: -115.351410 where: bonds (distance) C4'-P energy: -20.082 bonds (distance) P-C4' energy: -26.493 flat angles C4'-P-C4' energy: -23.840 flat angles P-C4'-P energy: -17.750 tors. eta vs tors. theta energy: -27.187 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 192 Temperature: 1.000000 Total energy: -341.552705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.552705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.562299 (E_RNA) where: Base-Base interactions energy: -228.816 where: short stacking energy: -112.231 Base-Backbone interact. energy: 0.291 local terms energy: -113.037311 where: bonds (distance) C4'-P energy: -23.372 bonds (distance) P-C4' energy: -21.290 flat angles C4'-P-C4' energy: -24.186 flat angles P-C4'-P energy: -13.686 tors. eta vs tors. theta energy: -30.504 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 192 Temperature: 1.050000 Total energy: -339.621848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.621848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.773363 (E_RNA) where: Base-Base interactions energy: -221.015 where: short stacking energy: -107.308 Base-Backbone interact. energy: -0.268 local terms energy: -118.490499 where: bonds (distance) C4'-P energy: -19.323 bonds (distance) P-C4' energy: -26.836 flat angles C4'-P-C4' energy: -22.046 flat angles P-C4'-P energy: -21.512 tors. eta vs tors. theta energy: -28.774 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 192 Temperature: 1.100000 Total energy: -316.316283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.316283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.387396 (E_RNA) where: Base-Base interactions energy: -202.291 where: short stacking energy: -97.367 Base-Backbone interact. energy: -0.359 local terms energy: -113.737443 where: bonds (distance) C4'-P energy: -25.792 bonds (distance) P-C4' energy: -23.318 flat angles C4'-P-C4' energy: -23.531 flat angles P-C4'-P energy: -14.645 tors. eta vs tors. theta energy: -26.452 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 192 Temperature: 1.150000 Total energy: -241.386834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.386834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.386834 (E_RNA) where: Base-Base interactions energy: -147.452 where: short stacking energy: -88.199 Base-Backbone interact. energy: -0.268 local terms energy: -93.667407 where: bonds (distance) C4'-P energy: -21.948 bonds (distance) P-C4' energy: -21.651 flat angles C4'-P-C4' energy: -12.972 flat angles P-C4'-P energy: -14.084 tors. eta vs tors. theta energy: -23.013 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 192 Temperature: 1.200000 Total energy: -224.012062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.012062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.178642 (E_RNA) where: Base-Base interactions energy: -127.111 where: short stacking energy: -74.229 Base-Backbone interact. energy: 0.382 local terms energy: -97.449487 where: bonds (distance) C4'-P energy: -23.023 bonds (distance) P-C4' energy: -22.628 flat angles C4'-P-C4' energy: -23.733 flat angles P-C4'-P energy: -14.593 tors. eta vs tors. theta energy: -13.473 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 192 Temperature: 1.250000 Total energy: -225.320128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.320128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.399157 (E_RNA) where: Base-Base interactions energy: -117.551 where: short stacking energy: -66.688 Base-Backbone interact. energy: -1.365 local terms energy: -106.483729 where: bonds (distance) C4'-P energy: -23.123 bonds (distance) P-C4' energy: -23.386 flat angles C4'-P-C4' energy: -24.920 flat angles P-C4'-P energy: -16.732 tors. eta vs tors. theta energy: -18.323 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 192 Temperature: 1.300000 Total energy: -208.370565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.370565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.466496 (E_RNA) where: Base-Base interactions energy: -122.362 where: short stacking energy: -74.045 Base-Backbone interact. energy: -0.213 local terms energy: -85.891743 where: bonds (distance) C4'-P energy: -16.835 bonds (distance) P-C4' energy: -24.872 flat angles C4'-P-C4' energy: -18.468 flat angles P-C4'-P energy: -13.691 tors. eta vs tors. theta energy: -12.025 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 192 Temperature: 1.350000 Total energy: -180.946914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.946914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.946914 (E_RNA) where: Base-Base interactions energy: -110.132 where: short stacking energy: -63.840 Base-Backbone interact. energy: -1.113 local terms energy: -69.701279 where: bonds (distance) C4'-P energy: -20.054 bonds (distance) P-C4' energy: -19.247 flat angles C4'-P-C4' energy: -18.739 flat angles P-C4'-P energy: -6.067 tors. eta vs tors. theta energy: -5.594 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 193 Temperature: 0.900000 Total energy: -383.206493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.206493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.269732 (E_RNA) where: Base-Base interactions energy: -249.189 where: short stacking energy: -132.934 Base-Backbone interact. energy: -0.748 local terms energy: -133.332536 where: bonds (distance) C4'-P energy: -26.874 bonds (distance) P-C4' energy: -26.919 flat angles C4'-P-C4' energy: -26.801 flat angles P-C4'-P energy: -20.784 tors. eta vs tors. theta energy: -31.955 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 193 Temperature: 0.950000 Total energy: -370.677885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.677885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.712392 (E_RNA) where: Base-Base interactions energy: -253.209 where: short stacking energy: -117.164 Base-Backbone interact. energy: -0.986 local terms energy: -116.517414 where: bonds (distance) C4'-P energy: -19.189 bonds (distance) P-C4' energy: -25.976 flat angles C4'-P-C4' energy: -24.750 flat angles P-C4'-P energy: -19.032 tors. eta vs tors. theta energy: -27.570 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 193 Temperature: 1.000000 Total energy: -333.771901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.771901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.771901 (E_RNA) where: Base-Base interactions energy: -207.123 where: short stacking energy: -103.434 Base-Backbone interact. energy: -0.936 local terms energy: -125.712170 where: bonds (distance) C4'-P energy: -27.610 bonds (distance) P-C4' energy: -27.949 flat angles C4'-P-C4' energy: -26.094 flat angles P-C4'-P energy: -17.976 tors. eta vs tors. theta energy: -26.084 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 193 Temperature: 1.050000 Total energy: -287.438031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.438031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.476241 (E_RNA) where: Base-Base interactions energy: -183.580 where: short stacking energy: -101.463 Base-Backbone interact. energy: -0.035 local terms energy: -103.860800 where: bonds (distance) C4'-P energy: -24.112 bonds (distance) P-C4' energy: -22.588 flat angles C4'-P-C4' energy: -21.410 flat angles P-C4'-P energy: -17.385 tors. eta vs tors. theta energy: -18.366 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 193 Temperature: 1.100000 Total energy: -329.927675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.927675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.927675 (E_RNA) where: Base-Base interactions energy: -220.204 where: short stacking energy: -109.577 Base-Backbone interact. energy: -1.192 local terms energy: -108.532196 where: bonds (distance) C4'-P energy: -13.191 bonds (distance) P-C4' energy: -23.758 flat angles C4'-P-C4' energy: -23.945 flat angles P-C4'-P energy: -20.163 tors. eta vs tors. theta energy: -27.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 193 Temperature: 1.150000 Total energy: -237.639309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.639309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.651418 (E_RNA) where: Base-Base interactions energy: -134.257 where: short stacking energy: -71.851 Base-Backbone interact. energy: -0.050 local terms energy: -103.344509 where: bonds (distance) C4'-P energy: -22.564 bonds (distance) P-C4' energy: -27.878 flat angles C4'-P-C4' energy: -19.965 flat angles P-C4'-P energy: -14.608 tors. eta vs tors. theta energy: -18.330 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 193 Temperature: 1.200000 Total energy: -218.080239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.080239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.333485 (E_RNA) where: Base-Base interactions energy: -128.601 where: short stacking energy: -72.164 Base-Backbone interact. energy: 0.894 local terms energy: -90.626809 where: bonds (distance) C4'-P energy: -20.514 bonds (distance) P-C4' energy: -23.603 flat angles C4'-P-C4' energy: -21.969 flat angles P-C4'-P energy: -13.033 tors. eta vs tors. theta energy: -11.507 Dist. restrs. and SS energy: 0.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 193 Temperature: 1.250000 Total energy: -221.324107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.324107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.475568 (E_RNA) where: Base-Base interactions energy: -123.625 where: short stacking energy: -72.626 Base-Backbone interact. energy: 0.757 local terms energy: -98.607848 where: bonds (distance) C4'-P energy: -19.624 bonds (distance) P-C4' energy: -25.729 flat angles C4'-P-C4' energy: -23.484 flat angles P-C4'-P energy: -13.379 tors. eta vs tors. theta energy: -16.392 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 193 Temperature: 1.300000 Total energy: -211.707943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.707943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.756782 (E_RNA) where: Base-Base interactions energy: -132.323 where: short stacking energy: -74.888 Base-Backbone interact. energy: -1.221 local terms energy: -78.213246 where: bonds (distance) C4'-P energy: -18.162 bonds (distance) P-C4' energy: -18.294 flat angles C4'-P-C4' energy: -17.581 flat angles P-C4'-P energy: -13.408 tors. eta vs tors. theta energy: -10.768 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 193 Temperature: 1.350000 Total energy: -195.295247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.295247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.295247 (E_RNA) where: Base-Base interactions energy: -115.192 where: short stacking energy: -61.193 Base-Backbone interact. energy: -0.238 local terms energy: -79.864682 where: bonds (distance) C4'-P energy: -16.755 bonds (distance) P-C4' energy: -21.495 flat angles C4'-P-C4' energy: -21.822 flat angles P-C4'-P energy: -9.190 tors. eta vs tors. theta energy: -10.603 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 194 Temperature: 0.900000 Total energy: -365.237986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.237986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.237986 (E_RNA) where: Base-Base interactions energy: -246.226 where: short stacking energy: -124.311 Base-Backbone interact. energy: -0.971 local terms energy: -118.041001 where: bonds (distance) C4'-P energy: -19.548 bonds (distance) P-C4' energy: -25.054 flat angles C4'-P-C4' energy: -27.906 flat angles P-C4'-P energy: -17.255 tors. eta vs tors. theta energy: -28.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 194 Temperature: 0.950000 Total energy: -371.395054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.395054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.434187 (E_RNA) where: Base-Base interactions energy: -253.460 where: short stacking energy: -114.734 Base-Backbone interact. energy: -0.524 local terms energy: -117.450433 where: bonds (distance) C4'-P energy: -21.061 bonds (distance) P-C4' energy: -23.542 flat angles C4'-P-C4' energy: -28.608 flat angles P-C4'-P energy: -14.795 tors. eta vs tors. theta energy: -29.445 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 194 Temperature: 1.000000 Total energy: -335.665823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.665823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.790300 (E_RNA) where: Base-Base interactions energy: -229.439 where: short stacking energy: -100.083 Base-Backbone interact. energy: 2.598 local terms energy: -108.948990 where: bonds (distance) C4'-P energy: -24.864 bonds (distance) P-C4' energy: -17.799 flat angles C4'-P-C4' energy: -26.885 flat angles P-C4'-P energy: -16.657 tors. eta vs tors. theta energy: -22.744 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 194 Temperature: 1.050000 Total energy: -290.835107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.835107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.005005 (E_RNA) where: Base-Base interactions energy: -185.490 where: short stacking energy: -97.574 Base-Backbone interact. energy: 1.046 local terms energy: -106.560602 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -25.893 flat angles C4'-P-C4' energy: -19.974 flat angles P-C4'-P energy: -20.797 tors. eta vs tors. theta energy: -20.464 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 194 Temperature: 1.100000 Total energy: -335.698141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.698141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.000567 (E_RNA) where: Base-Base interactions energy: -215.505 where: short stacking energy: -100.808 Base-Backbone interact. energy: -1.718 local terms energy: -118.778377 where: bonds (distance) C4'-P energy: -24.844 bonds (distance) P-C4' energy: -21.935 flat angles C4'-P-C4' energy: -21.407 flat angles P-C4'-P energy: -20.644 tors. eta vs tors. theta energy: -29.948 Dist. restrs. and SS energy: 0.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 194 Temperature: 1.150000 Total energy: -239.367333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.367333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.579089 (E_RNA) where: Base-Base interactions energy: -139.551 where: short stacking energy: -88.885 Base-Backbone interact. energy: 3.741 local terms energy: -103.769674 where: bonds (distance) C4'-P energy: -22.316 bonds (distance) P-C4' energy: -19.982 flat angles C4'-P-C4' energy: -19.836 flat angles P-C4'-P energy: -21.555 tors. eta vs tors. theta energy: -20.081 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 194 Temperature: 1.200000 Total energy: -235.055005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.055005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.072694 (E_RNA) where: Base-Base interactions energy: -143.335 where: short stacking energy: -80.345 Base-Backbone interact. energy: -0.312 local terms energy: -91.425028 where: bonds (distance) C4'-P energy: -18.511 bonds (distance) P-C4' energy: -23.815 flat angles C4'-P-C4' energy: -16.238 flat angles P-C4'-P energy: -17.107 tors. eta vs tors. theta energy: -15.753 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 194 Temperature: 1.250000 Total energy: -212.885567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.885567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.890147 (E_RNA) where: Base-Base interactions energy: -126.765 where: short stacking energy: -72.113 Base-Backbone interact. energy: -0.250 local terms energy: -85.875889 where: bonds (distance) C4'-P energy: -17.649 bonds (distance) P-C4' energy: -22.434 flat angles C4'-P-C4' energy: -16.165 flat angles P-C4'-P energy: -13.614 tors. eta vs tors. theta energy: -16.014 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 194 Temperature: 1.300000 Total energy: -200.324326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.324326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.388646 (E_RNA) where: Base-Base interactions energy: -118.846 where: short stacking energy: -70.039 Base-Backbone interact. energy: -0.640 local terms energy: -80.903061 where: bonds (distance) C4'-P energy: -15.061 bonds (distance) P-C4' energy: -28.682 flat angles C4'-P-C4' energy: -13.977 flat angles P-C4'-P energy: -9.332 tors. eta vs tors. theta energy: -13.851 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 194 Temperature: 1.350000 Total energy: -194.967234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.967234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.967234 (E_RNA) where: Base-Base interactions energy: -112.949 where: short stacking energy: -62.738 Base-Backbone interact. energy: -0.507 local terms energy: -81.510814 where: bonds (distance) C4'-P energy: -21.354 bonds (distance) P-C4' energy: -22.739 flat angles C4'-P-C4' energy: -22.228 flat angles P-C4'-P energy: -7.163 tors. eta vs tors. theta energy: -8.026 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 195 Temperature: 0.900000 Total energy: -370.753795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.753795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.849638 (E_RNA) where: Base-Base interactions energy: -252.337 where: short stacking energy: -128.865 Base-Backbone interact. energy: -0.265 local terms energy: -118.247622 where: bonds (distance) C4'-P energy: -23.043 bonds (distance) P-C4' energy: -22.276 flat angles C4'-P-C4' energy: -28.159 flat angles P-C4'-P energy: -13.923 tors. eta vs tors. theta energy: -30.847 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 195 Temperature: 0.950000 Total energy: -374.661123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.661123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.661123 (E_RNA) where: Base-Base interactions energy: -253.153 where: short stacking energy: -114.241 Base-Backbone interact. energy: -0.564 local terms energy: -120.943646 where: bonds (distance) C4'-P energy: -23.446 bonds (distance) P-C4' energy: -27.351 flat angles C4'-P-C4' energy: -27.207 flat angles P-C4'-P energy: -16.510 tors. eta vs tors. theta energy: -26.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 195 Temperature: 1.000000 Total energy: -333.106197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.106197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.152611 (E_RNA) where: Base-Base interactions energy: -220.636 where: short stacking energy: -98.378 Base-Backbone interact. energy: -0.478 local terms energy: -112.038943 where: bonds (distance) C4'-P energy: -23.086 bonds (distance) P-C4' energy: -24.023 flat angles C4'-P-C4' energy: -23.277 flat angles P-C4'-P energy: -15.287 tors. eta vs tors. theta energy: -26.366 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 195 Temperature: 1.050000 Total energy: -330.868924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.868924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.901590 (E_RNA) where: Base-Base interactions energy: -215.084 where: short stacking energy: -99.160 Base-Backbone interact. energy: -0.808 local terms energy: -115.009994 where: bonds (distance) C4'-P energy: -17.189 bonds (distance) P-C4' energy: -26.448 flat angles C4'-P-C4' energy: -24.080 flat angles P-C4'-P energy: -19.961 tors. eta vs tors. theta energy: -27.332 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 195 Temperature: 1.100000 Total energy: -267.017967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.017967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.017967 (E_RNA) where: Base-Base interactions energy: -166.036 where: short stacking energy: -92.390 Base-Backbone interact. energy: 0.308 local terms energy: -101.289904 where: bonds (distance) C4'-P energy: -21.952 bonds (distance) P-C4' energy: -25.172 flat angles C4'-P-C4' energy: -23.884 flat angles P-C4'-P energy: -16.792 tors. eta vs tors. theta energy: -13.490 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 195 Temperature: 1.150000 Total energy: -240.162216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.162216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.253992 (E_RNA) where: Base-Base interactions energy: -142.578 where: short stacking energy: -88.911 Base-Backbone interact. energy: -0.057 local terms energy: -97.619107 where: bonds (distance) C4'-P energy: -17.586 bonds (distance) P-C4' energy: -24.460 flat angles C4'-P-C4' energy: -23.121 flat angles P-C4'-P energy: -14.769 tors. eta vs tors. theta energy: -17.684 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 195 Temperature: 1.200000 Total energy: -229.369002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.369002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.370852 (E_RNA) where: Base-Base interactions energy: -134.732 where: short stacking energy: -82.346 Base-Backbone interact. energy: -0.083 local terms energy: -94.555279 where: bonds (distance) C4'-P energy: -23.622 bonds (distance) P-C4' energy: -23.373 flat angles C4'-P-C4' energy: -21.386 flat angles P-C4'-P energy: -11.672 tors. eta vs tors. theta energy: -14.502 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 195 Temperature: 1.250000 Total energy: -215.577957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.577957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.623679 (E_RNA) where: Base-Base interactions energy: -136.266 where: short stacking energy: -73.853 Base-Backbone interact. energy: 1.309 local terms energy: -80.666884 where: bonds (distance) C4'-P energy: -11.650 bonds (distance) P-C4' energy: -17.716 flat angles C4'-P-C4' energy: -20.966 flat angles P-C4'-P energy: -12.054 tors. eta vs tors. theta energy: -18.281 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 195 Temperature: 1.300000 Total energy: -211.700658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.700658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.291250 (E_RNA) where: Base-Base interactions energy: -127.950 where: short stacking energy: -64.530 Base-Backbone interact. energy: -0.890 local terms energy: -83.451976 where: bonds (distance) C4'-P energy: -17.570 bonds (distance) P-C4' energy: -17.138 flat angles C4'-P-C4' energy: -23.132 flat angles P-C4'-P energy: -14.414 tors. eta vs tors. theta energy: -11.198 Dist. restrs. and SS energy: 0.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 195 Temperature: 1.350000 Total energy: -198.498190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.498190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.934025 (E_RNA) where: Base-Base interactions energy: -115.640 where: short stacking energy: -65.406 Base-Backbone interact. energy: -0.211 local terms energy: -83.083055 where: bonds (distance) C4'-P energy: -19.581 bonds (distance) P-C4' energy: -19.686 flat angles C4'-P-C4' energy: -16.843 flat angles P-C4'-P energy: -14.980 tors. eta vs tors. theta energy: -11.993 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 196 Temperature: 0.900000 Total energy: -372.065818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.065818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.068501 (E_RNA) where: Base-Base interactions energy: -256.749 where: short stacking energy: -110.237 Base-Backbone interact. energy: -0.696 local terms energy: -114.623685 where: bonds (distance) C4'-P energy: -18.049 bonds (distance) P-C4' energy: -27.156 flat angles C4'-P-C4' energy: -24.021 flat angles P-C4'-P energy: -16.763 tors. eta vs tors. theta energy: -28.634 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 196 Temperature: 0.950000 Total energy: -356.021441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.021441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.042246 (E_RNA) where: Base-Base interactions energy: -237.496 where: short stacking energy: -121.890 Base-Backbone interact. energy: -0.366 local terms energy: -118.179629 where: bonds (distance) C4'-P energy: -22.339 bonds (distance) P-C4' energy: -21.949 flat angles C4'-P-C4' energy: -28.471 flat angles P-C4'-P energy: -14.484 tors. eta vs tors. theta energy: -30.936 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 196 Temperature: 1.000000 Total energy: -363.619365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.619365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.697606 (E_RNA) where: Base-Base interactions energy: -243.022 where: short stacking energy: -111.342 Base-Backbone interact. energy: -0.406 local terms energy: -120.268781 where: bonds (distance) C4'-P energy: -28.132 bonds (distance) P-C4' energy: -25.288 flat angles C4'-P-C4' energy: -24.825 flat angles P-C4'-P energy: -12.576 tors. eta vs tors. theta energy: -29.448 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 196 Temperature: 1.050000 Total energy: -341.898220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.898220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.943052 (E_RNA) where: Base-Base interactions energy: -223.966 where: short stacking energy: -110.227 Base-Backbone interact. energy: -1.254 local terms energy: -116.723258 where: bonds (distance) C4'-P energy: -23.999 bonds (distance) P-C4' energy: -27.713 flat angles C4'-P-C4' energy: -26.186 flat angles P-C4'-P energy: -12.540 tors. eta vs tors. theta energy: -26.285 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 196 Temperature: 1.100000 Total energy: -257.177262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.177262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.193484 (E_RNA) where: Base-Base interactions energy: -154.402 where: short stacking energy: -92.631 Base-Backbone interact. energy: -0.126 local terms energy: -102.665252 where: bonds (distance) C4'-P energy: -20.393 bonds (distance) P-C4' energy: -23.913 flat angles C4'-P-C4' energy: -21.269 flat angles P-C4'-P energy: -16.031 tors. eta vs tors. theta energy: -21.060 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 196 Temperature: 1.150000 Total energy: -240.319403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.319403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.334388 (E_RNA) where: Base-Base interactions energy: -137.401 where: short stacking energy: -87.173 Base-Backbone interact. energy: -0.083 local terms energy: -102.850578 where: bonds (distance) C4'-P energy: -23.274 bonds (distance) P-C4' energy: -16.302 flat angles C4'-P-C4' energy: -22.052 flat angles P-C4'-P energy: -21.981 tors. eta vs tors. theta energy: -19.240 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 196 Temperature: 1.200000 Total energy: -232.406917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.406917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.497511 (E_RNA) where: Base-Base interactions energy: -131.492 where: short stacking energy: -75.892 Base-Backbone interact. energy: 0.279 local terms energy: -101.284122 where: bonds (distance) C4'-P energy: -21.722 bonds (distance) P-C4' energy: -22.255 flat angles C4'-P-C4' energy: -20.903 flat angles P-C4'-P energy: -16.453 tors. eta vs tors. theta energy: -19.952 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 196 Temperature: 1.250000 Total energy: -224.725911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.725911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.814374 (E_RNA) where: Base-Base interactions energy: -125.318 where: short stacking energy: -75.065 Base-Backbone interact. energy: -0.885 local terms energy: -98.611491 where: bonds (distance) C4'-P energy: -21.024 bonds (distance) P-C4' energy: -26.403 flat angles C4'-P-C4' energy: -25.238 flat angles P-C4'-P energy: -15.383 tors. eta vs tors. theta energy: -10.563 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 196 Temperature: 1.300000 Total energy: -218.196846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.196846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.450972 (E_RNA) where: Base-Base interactions energy: -125.443 where: short stacking energy: -75.334 Base-Backbone interact. energy: -0.305 local terms energy: -92.702652 where: bonds (distance) C4'-P energy: -27.094 bonds (distance) P-C4' energy: -24.319 flat angles C4'-P-C4' energy: -17.164 flat angles P-C4'-P energy: -14.426 tors. eta vs tors. theta energy: -9.701 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 196 Temperature: 1.350000 Total energy: -195.063802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.063802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.109118 (E_RNA) where: Base-Base interactions energy: -118.997 where: short stacking energy: -67.864 Base-Backbone interact. energy: 0.031 local terms energy: -76.143967 where: bonds (distance) C4'-P energy: -16.232 bonds (distance) P-C4' energy: -20.862 flat angles C4'-P-C4' energy: -17.924 flat angles P-C4'-P energy: -11.830 tors. eta vs tors. theta energy: -9.295 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 197 Temperature: 0.900000 Total energy: -367.632295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.632295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.632295 (E_RNA) where: Base-Base interactions energy: -248.919 where: short stacking energy: -120.769 Base-Backbone interact. energy: -0.299 local terms energy: -118.414355 where: bonds (distance) C4'-P energy: -21.839 bonds (distance) P-C4' energy: -22.918 flat angles C4'-P-C4' energy: -26.291 flat angles P-C4'-P energy: -17.577 tors. eta vs tors. theta energy: -29.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 197 Temperature: 0.950000 Total energy: -355.371714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.371714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.403551 (E_RNA) where: Base-Base interactions energy: -237.010 where: short stacking energy: -117.741 Base-Backbone interact. energy: -0.801 local terms energy: -117.592650 where: bonds (distance) C4'-P energy: -25.825 bonds (distance) P-C4' energy: -17.794 flat angles C4'-P-C4' energy: -24.976 flat angles P-C4'-P energy: -20.231 tors. eta vs tors. theta energy: -28.768 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 197 Temperature: 1.000000 Total energy: -341.848284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.848284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.874436 (E_RNA) where: Base-Base interactions energy: -234.544 where: short stacking energy: -111.257 Base-Backbone interact. energy: -0.658 local terms energy: -106.672311 where: bonds (distance) C4'-P energy: -19.733 bonds (distance) P-C4' energy: -23.859 flat angles C4'-P-C4' energy: -20.169 flat angles P-C4'-P energy: -14.884 tors. eta vs tors. theta energy: -28.028 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 197 Temperature: 1.050000 Total energy: -329.666387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.666387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.700579 (E_RNA) where: Base-Base interactions energy: -215.858 where: short stacking energy: -104.523 Base-Backbone interact. energy: -0.242 local terms energy: -113.600462 where: bonds (distance) C4'-P energy: -22.361 bonds (distance) P-C4' energy: -23.396 flat angles C4'-P-C4' energy: -28.058 flat angles P-C4'-P energy: -13.515 tors. eta vs tors. theta energy: -26.270 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 197 Temperature: 1.100000 Total energy: -261.051045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.051045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.069743 (E_RNA) where: Base-Base interactions energy: -161.892 where: short stacking energy: -85.787 Base-Backbone interact. energy: -0.017 local terms energy: -99.160621 where: bonds (distance) C4'-P energy: -19.190 bonds (distance) P-C4' energy: -25.132 flat angles C4'-P-C4' energy: -22.785 flat angles P-C4'-P energy: -13.281 tors. eta vs tors. theta energy: -18.773 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 197 Temperature: 1.150000 Total energy: -226.551500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.551500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.778434 (E_RNA) where: Base-Base interactions energy: -128.843 where: short stacking energy: -74.243 Base-Backbone interact. energy: -0.003 local terms energy: -97.932240 where: bonds (distance) C4'-P energy: -22.676 bonds (distance) P-C4' energy: -25.747 flat angles C4'-P-C4' energy: -19.626 flat angles P-C4'-P energy: -15.594 tors. eta vs tors. theta energy: -14.289 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 197 Temperature: 1.200000 Total energy: -224.811222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.811222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.050744 (E_RNA) where: Base-Base interactions energy: -124.692 where: short stacking energy: -72.840 Base-Backbone interact. energy: -2.794 local terms energy: -97.565304 where: bonds (distance) C4'-P energy: -25.656 bonds (distance) P-C4' energy: -21.455 flat angles C4'-P-C4' energy: -17.738 flat angles P-C4'-P energy: -13.945 tors. eta vs tors. theta energy: -18.770 Dist. restrs. and SS energy: 0.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 197 Temperature: 1.250000 Total energy: -249.468601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.468601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.468601 (E_RNA) where: Base-Base interactions energy: -156.774 where: short stacking energy: -81.293 Base-Backbone interact. energy: -0.690 local terms energy: -92.004356 where: bonds (distance) C4'-P energy: -18.271 bonds (distance) P-C4' energy: -18.245 flat angles C4'-P-C4' energy: -18.511 flat angles P-C4'-P energy: -17.293 tors. eta vs tors. theta energy: -19.684 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 197 Temperature: 1.300000 Total energy: -205.525831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.525831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.583194 (E_RNA) where: Base-Base interactions energy: -118.770 where: short stacking energy: -69.528 Base-Backbone interact. energy: -0.392 local terms energy: -86.420837 where: bonds (distance) C4'-P energy: -23.283 bonds (distance) P-C4' energy: -18.158 flat angles C4'-P-C4' energy: -19.206 flat angles P-C4'-P energy: -16.838 tors. eta vs tors. theta energy: -8.936 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 197 Temperature: 1.350000 Total energy: -195.880216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.880216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.893353 (E_RNA) where: Base-Base interactions energy: -115.835 where: short stacking energy: -54.381 Base-Backbone interact. energy: 1.353 local terms energy: -81.411426 where: bonds (distance) C4'-P energy: -17.443 bonds (distance) P-C4' energy: -23.601 flat angles C4'-P-C4' energy: -14.950 flat angles P-C4'-P energy: -16.453 tors. eta vs tors. theta energy: -8.965 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 198 Temperature: 0.900000 Total energy: -369.320235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.320235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.433105 (E_RNA) where: Base-Base interactions energy: -246.733 where: short stacking energy: -119.557 Base-Backbone interact. energy: -1.134 local terms energy: -121.566018 where: bonds (distance) C4'-P energy: -24.054 bonds (distance) P-C4' energy: -22.943 flat angles C4'-P-C4' energy: -24.957 flat angles P-C4'-P energy: -17.571 tors. eta vs tors. theta energy: -32.042 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 198 Temperature: 0.950000 Total energy: -365.951953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.951953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.012677 (E_RNA) where: Base-Base interactions energy: -253.858 where: short stacking energy: -107.370 Base-Backbone interact. energy: -0.822 local terms energy: -111.332894 where: bonds (distance) C4'-P energy: -22.016 bonds (distance) P-C4' energy: -25.899 flat angles C4'-P-C4' energy: -25.307 flat angles P-C4'-P energy: -14.070 tors. eta vs tors. theta energy: -24.042 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 198 Temperature: 1.000000 Total energy: -338.593336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.593336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.661536 (E_RNA) where: Base-Base interactions energy: -225.805 where: short stacking energy: -101.712 Base-Backbone interact. energy: 0.256 local terms energy: -113.112811 where: bonds (distance) C4'-P energy: -21.576 bonds (distance) P-C4' energy: -28.078 flat angles C4'-P-C4' energy: -26.445 flat angles P-C4'-P energy: -14.105 tors. eta vs tors. theta energy: -22.909 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 198 Temperature: 1.050000 Total energy: -348.076045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.076045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.085190 (E_RNA) where: Base-Base interactions energy: -227.846 where: short stacking energy: -115.185 Base-Backbone interact. energy: -0.282 local terms energy: -119.957252 where: bonds (distance) C4'-P energy: -21.256 bonds (distance) P-C4' energy: -21.697 flat angles C4'-P-C4' energy: -24.589 flat angles P-C4'-P energy: -19.809 tors. eta vs tors. theta energy: -32.606 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 198 Temperature: 1.100000 Total energy: -238.503083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.503083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.709003 (E_RNA) where: Base-Base interactions energy: -141.685 where: short stacking energy: -69.590 Base-Backbone interact. energy: -0.203 local terms energy: -96.820930 where: bonds (distance) C4'-P energy: -21.696 bonds (distance) P-C4' energy: -27.771 flat angles C4'-P-C4' energy: -22.704 flat angles P-C4'-P energy: -12.564 tors. eta vs tors. theta energy: -12.086 Dist. restrs. and SS energy: 0.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 198 Temperature: 1.150000 Total energy: -228.889235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.889235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.900838 (E_RNA) where: Base-Base interactions energy: -128.831 where: short stacking energy: -79.124 Base-Backbone interact. energy: -0.402 local terms energy: -99.667931 where: bonds (distance) C4'-P energy: -24.011 bonds (distance) P-C4' energy: -22.208 flat angles C4'-P-C4' energy: -22.607 flat angles P-C4'-P energy: -15.325 tors. eta vs tors. theta energy: -15.516 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 198 Temperature: 1.200000 Total energy: -233.218911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.218911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.242222 (E_RNA) where: Base-Base interactions energy: -135.836 where: short stacking energy: -79.436 Base-Backbone interact. energy: -0.814 local terms energy: -96.591633 where: bonds (distance) C4'-P energy: -21.359 bonds (distance) P-C4' energy: -24.025 flat angles C4'-P-C4' energy: -21.557 flat angles P-C4'-P energy: -11.077 tors. eta vs tors. theta energy: -18.574 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 198 Temperature: 1.250000 Total energy: -230.239872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.239872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.332338 (E_RNA) where: Base-Base interactions energy: -137.064 where: short stacking energy: -78.117 Base-Backbone interact. energy: -0.739 local terms energy: -92.528870 where: bonds (distance) C4'-P energy: -18.890 bonds (distance) P-C4' energy: -19.900 flat angles C4'-P-C4' energy: -21.169 flat angles P-C4'-P energy: -16.729 tors. eta vs tors. theta energy: -15.840 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 198 Temperature: 1.300000 Total energy: -206.622022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.622022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.622022 (E_RNA) where: Base-Base interactions energy: -119.853 where: short stacking energy: -70.309 Base-Backbone interact. energy: -0.212 local terms energy: -86.557694 where: bonds (distance) C4'-P energy: -23.168 bonds (distance) P-C4' energy: -18.121 flat angles C4'-P-C4' energy: -18.339 flat angles P-C4'-P energy: -19.541 tors. eta vs tors. theta energy: -7.389 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 198 Temperature: 1.350000 Total energy: -200.467344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.467344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.494693 (E_RNA) where: Base-Base interactions energy: -118.424 where: short stacking energy: -58.741 Base-Backbone interact. energy: 0.980 local terms energy: -83.051241 where: bonds (distance) C4'-P energy: -18.339 bonds (distance) P-C4' energy: -23.542 flat angles C4'-P-C4' energy: -21.844 flat angles P-C4'-P energy: -11.263 tors. eta vs tors. theta energy: -8.064 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 199 Temperature: 0.900000 Total energy: -363.322809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.322809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.322809 (E_RNA) where: Base-Base interactions energy: -238.097 where: short stacking energy: -116.493 Base-Backbone interact. energy: -1.431 local terms energy: -123.794237 where: bonds (distance) C4'-P energy: -25.823 bonds (distance) P-C4' energy: -23.877 flat angles C4'-P-C4' energy: -26.369 flat angles P-C4'-P energy: -16.301 tors. eta vs tors. theta energy: -31.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 199 Temperature: 0.950000 Total energy: -360.292369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.292369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.362277 (E_RNA) where: Base-Base interactions energy: -244.757 where: short stacking energy: -112.418 Base-Backbone interact. energy: -0.467 local terms energy: -115.138626 where: bonds (distance) C4'-P energy: -22.906 bonds (distance) P-C4' energy: -23.864 flat angles C4'-P-C4' energy: -25.343 flat angles P-C4'-P energy: -14.148 tors. eta vs tors. theta energy: -28.878 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 199 Temperature: 1.000000 Total energy: -348.979187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.979187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.083098 (E_RNA) where: Base-Base interactions energy: -241.102 where: short stacking energy: -112.744 Base-Backbone interact. energy: -0.052 local terms energy: -107.928815 where: bonds (distance) C4'-P energy: -19.590 bonds (distance) P-C4' energy: -21.134 flat angles C4'-P-C4' energy: -27.542 flat angles P-C4'-P energy: -14.643 tors. eta vs tors. theta energy: -25.019 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 199 Temperature: 1.050000 Total energy: -338.711888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.711888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.848006 (E_RNA) where: Base-Base interactions energy: -221.050 where: short stacking energy: -106.740 Base-Backbone interact. energy: 1.357 local terms energy: -119.154767 where: bonds (distance) C4'-P energy: -23.806 bonds (distance) P-C4' energy: -24.260 flat angles C4'-P-C4' energy: -27.526 flat angles P-C4'-P energy: -14.338 tors. eta vs tors. theta energy: -29.224 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 199 Temperature: 1.100000 Total energy: -246.475103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.475103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.514636 (E_RNA) where: Base-Base interactions energy: -143.042 where: short stacking energy: -89.565 Base-Backbone interact. energy: 1.168 local terms energy: -104.640517 where: bonds (distance) C4'-P energy: -20.179 bonds (distance) P-C4' energy: -23.148 flat angles C4'-P-C4' energy: -19.662 flat angles P-C4'-P energy: -19.507 tors. eta vs tors. theta energy: -22.146 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 199 Temperature: 1.150000 Total energy: -240.950405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.950405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.985042 (E_RNA) where: Base-Base interactions energy: -140.271 where: short stacking energy: -85.251 Base-Backbone interact. energy: -0.487 local terms energy: -100.227086 where: bonds (distance) C4'-P energy: -17.991 bonds (distance) P-C4' energy: -21.739 flat angles C4'-P-C4' energy: -24.277 flat angles P-C4'-P energy: -15.427 tors. eta vs tors. theta energy: -20.793 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 199 Temperature: 1.200000 Total energy: -241.984026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.984026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.002917 (E_RNA) where: Base-Base interactions energy: -143.111 where: short stacking energy: -86.844 Base-Backbone interact. energy: -1.180 local terms energy: -97.711843 where: bonds (distance) C4'-P energy: -22.275 bonds (distance) P-C4' energy: -22.611 flat angles C4'-P-C4' energy: -23.010 flat angles P-C4'-P energy: -11.607 tors. eta vs tors. theta energy: -18.209 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 199 Temperature: 1.250000 Total energy: -224.884591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.884591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.957137 (E_RNA) where: Base-Base interactions energy: -141.430 where: short stacking energy: -75.102 Base-Backbone interact. energy: -0.810 local terms energy: -82.717609 where: bonds (distance) C4'-P energy: -18.883 bonds (distance) P-C4' energy: -21.135 flat angles C4'-P-C4' energy: -20.408 flat angles P-C4'-P energy: -11.882 tors. eta vs tors. theta energy: -10.410 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 199 Temperature: 1.300000 Total energy: -228.107688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.107688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.181272 (E_RNA) where: Base-Base interactions energy: -132.562 where: short stacking energy: -86.328 Base-Backbone interact. energy: -0.247 local terms energy: -95.371951 where: bonds (distance) C4'-P energy: -19.367 bonds (distance) P-C4' energy: -24.219 flat angles C4'-P-C4' energy: -24.682 flat angles P-C4'-P energy: -13.325 tors. eta vs tors. theta energy: -13.779 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 199 Temperature: 1.350000 Total energy: -202.605395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.605395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.744360 (E_RNA) where: Base-Base interactions energy: -124.129 where: short stacking energy: -77.421 Base-Backbone interact. energy: -0.739 local terms energy: -77.876348 where: bonds (distance) C4'-P energy: -18.570 bonds (distance) P-C4' energy: -19.802 flat angles C4'-P-C4' energy: -14.614 flat angles P-C4'-P energy: -14.961 tors. eta vs tors. theta energy: -9.930 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 200 Temperature: 0.900000 Total energy: -371.644987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.644987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.660130 (E_RNA) where: Base-Base interactions energy: -249.495 where: short stacking energy: -110.011 Base-Backbone interact. energy: -0.021 local terms energy: -122.143968 where: bonds (distance) C4'-P energy: -22.762 bonds (distance) P-C4' energy: -26.137 flat angles C4'-P-C4' energy: -22.909 flat angles P-C4'-P energy: -19.868 tors. eta vs tors. theta energy: -30.468 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 200 Temperature: 0.950000 Total energy: -362.167133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.167133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.179968 (E_RNA) where: Base-Base interactions energy: -251.381 where: short stacking energy: -124.643 Base-Backbone interact. energy: -0.856 local terms energy: -109.942383 where: bonds (distance) C4'-P energy: -20.849 bonds (distance) P-C4' energy: -20.110 flat angles C4'-P-C4' energy: -24.813 flat angles P-C4'-P energy: -14.765 tors. eta vs tors. theta energy: -29.405 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 200 Temperature: 1.000000 Total energy: -346.028987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.028987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.165333 (E_RNA) where: Base-Base interactions energy: -224.891 where: short stacking energy: -105.573 Base-Backbone interact. energy: -0.016 local terms energy: -121.257542 where: bonds (distance) C4'-P energy: -24.990 bonds (distance) P-C4' energy: -25.672 flat angles C4'-P-C4' energy: -25.043 flat angles P-C4'-P energy: -15.881 tors. eta vs tors. theta energy: -29.672 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 200 Temperature: 1.050000 Total energy: -338.994006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.994006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.090941 (E_RNA) where: Base-Base interactions energy: -227.021 where: short stacking energy: -116.638 Base-Backbone interact. energy: -0.686 local terms energy: -111.383489 where: bonds (distance) C4'-P energy: -16.486 bonds (distance) P-C4' energy: -23.579 flat angles C4'-P-C4' energy: -28.955 flat angles P-C4'-P energy: -14.497 tors. eta vs tors. theta energy: -27.867 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 200 Temperature: 1.100000 Total energy: -268.751169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.751169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.106564 (E_RNA) where: Base-Base interactions energy: -162.459 where: short stacking energy: -82.451 Base-Backbone interact. energy: -0.448 local terms energy: -106.198955 where: bonds (distance) C4'-P energy: -22.261 bonds (distance) P-C4' energy: -22.768 flat angles C4'-P-C4' energy: -25.929 flat angles P-C4'-P energy: -16.572 tors. eta vs tors. theta energy: -18.668 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 200 Temperature: 1.150000 Total energy: -242.485325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.485325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.485325 (E_RNA) where: Base-Base interactions energy: -159.839 where: short stacking energy: -81.409 Base-Backbone interact. energy: -0.171 local terms energy: -82.475009 where: bonds (distance) C4'-P energy: -16.320 bonds (distance) P-C4' energy: -16.777 flat angles C4'-P-C4' energy: -22.232 flat angles P-C4'-P energy: -12.485 tors. eta vs tors. theta energy: -14.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 200 Temperature: 1.200000 Total energy: -224.650350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.650350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.650350 (E_RNA) where: Base-Base interactions energy: -124.071 where: short stacking energy: -67.071 Base-Backbone interact. energy: -0.083 local terms energy: -100.497014 where: bonds (distance) C4'-P energy: -19.990 bonds (distance) P-C4' energy: -24.664 flat angles C4'-P-C4' energy: -26.450 flat angles P-C4'-P energy: -11.331 tors. eta vs tors. theta energy: -18.063 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 200 Temperature: 1.250000 Total energy: -212.184063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.184063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.327428 (E_RNA) where: Base-Base interactions energy: -133.343 where: short stacking energy: -78.985 Base-Backbone interact. energy: -0.277 local terms energy: -78.707277 where: bonds (distance) C4'-P energy: -19.732 bonds (distance) P-C4' energy: -18.141 flat angles C4'-P-C4' energy: -13.470 flat angles P-C4'-P energy: -10.666 tors. eta vs tors. theta energy: -16.698 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 200 Temperature: 1.300000 Total energy: -216.477696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.477696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.613577 (E_RNA) where: Base-Base interactions energy: -121.463 where: short stacking energy: -68.214 Base-Backbone interact. energy: -0.030 local terms energy: -95.120953 where: bonds (distance) C4'-P energy: -22.857 bonds (distance) P-C4' energy: -18.646 flat angles C4'-P-C4' energy: -19.914 flat angles P-C4'-P energy: -16.380 tors. eta vs tors. theta energy: -17.325 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 200 Temperature: 1.350000 Total energy: -201.549982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.549982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.624946 (E_RNA) where: Base-Base interactions energy: -112.933 where: short stacking energy: -66.141 Base-Backbone interact. energy: -1.121 local terms energy: -87.570911 where: bonds (distance) C4'-P energy: -22.257 bonds (distance) P-C4' energy: -18.952 flat angles C4'-P-C4' energy: -23.614 flat angles P-C4'-P energy: -14.711 tors. eta vs tors. theta energy: -8.037 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)