SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/B23_35_DNA_Mfold4-f6e722e4/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _........((....................))..._ nucl1: 9, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 8, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 31 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -45.499440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -45.499440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 85.832 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -255.424429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.424429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.424429 (E_RNA) where: Base-Base interactions energy: -142.917 where: short stacking energy: -104.623 Base-Backbone interact. energy: -0.060 local terms energy: -112.447702 where: bonds (distance) C4'-P energy: -23.786 bonds (distance) P-C4' energy: -25.624 flat angles C4'-P-C4' energy: -19.809 flat angles P-C4'-P energy: -18.960 tors. eta vs tors. theta energy: -24.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -228.992105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.992105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.088747 (E_RNA) where: Base-Base interactions energy: -128.496 where: short stacking energy: -89.749 Base-Backbone interact. energy: 0.324 local terms energy: -101.917376 where: bonds (distance) C4'-P energy: -22.038 bonds (distance) P-C4' energy: -19.860 flat angles C4'-P-C4' energy: -24.511 flat angles P-C4'-P energy: -16.290 tors. eta vs tors. theta energy: -19.219 Dist. restrs. and SS energy: 1.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -273.044327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.044327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.044327 (E_RNA) where: Base-Base interactions energy: -155.001 where: short stacking energy: -93.486 Base-Backbone interact. energy: -0.511 local terms energy: -117.532354 where: bonds (distance) C4'-P energy: -23.851 bonds (distance) P-C4' energy: -24.517 flat angles C4'-P-C4' energy: -23.938 flat angles P-C4'-P energy: -20.168 tors. eta vs tors. theta energy: -25.057 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -202.827824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.827824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.827824 (E_RNA) where: Base-Base interactions energy: -121.814 where: short stacking energy: -71.070 Base-Backbone interact. energy: -0.129 local terms energy: -80.885064 where: bonds (distance) C4'-P energy: -22.570 bonds (distance) P-C4' energy: -27.182 flat angles C4'-P-C4' energy: -19.705 flat angles P-C4'-P energy: -11.555 tors. eta vs tors. theta energy: 0.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -187.135776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.135776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.190008 (E_RNA) where: Base-Base interactions energy: -94.687 where: short stacking energy: -76.539 Base-Backbone interact. energy: 1.731 local terms energy: -94.233715 where: bonds (distance) C4'-P energy: -21.508 bonds (distance) P-C4' energy: -26.794 flat angles C4'-P-C4' energy: -24.510 flat angles P-C4'-P energy: -9.114 tors. eta vs tors. theta energy: -12.308 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -160.407656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.407656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.413807 (E_RNA) where: Base-Base interactions energy: -79.269 where: short stacking energy: -42.197 Base-Backbone interact. energy: -0.251 local terms energy: -80.893543 where: bonds (distance) C4'-P energy: -23.443 bonds (distance) P-C4' energy: -27.175 flat angles C4'-P-C4' energy: -18.433 flat angles P-C4'-P energy: -9.095 tors. eta vs tors. theta energy: -2.748 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -194.432272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.432272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.432272 (E_RNA) where: Base-Base interactions energy: -107.665 where: short stacking energy: -73.631 Base-Backbone interact. energy: -0.508 local terms energy: -86.259805 where: bonds (distance) C4'-P energy: -13.726 bonds (distance) P-C4' energy: -23.971 flat angles C4'-P-C4' energy: -24.150 flat angles P-C4'-P energy: -8.268 tors. eta vs tors. theta energy: -16.145 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -164.444715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.444715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.518193 (E_RNA) where: Base-Base interactions energy: -91.854 where: short stacking energy: -58.239 Base-Backbone interact. energy: 1.344 local terms energy: -74.008137 where: bonds (distance) C4'-P energy: -21.453 bonds (distance) P-C4' energy: -23.823 flat angles C4'-P-C4' energy: -17.804 flat angles P-C4'-P energy: -5.795 tors. eta vs tors. theta energy: -5.133 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -143.261184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.261184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.271408 (E_RNA) where: Base-Base interactions energy: -80.671 where: short stacking energy: -41.770 Base-Backbone interact. energy: 0.420 local terms energy: -63.020210 where: bonds (distance) C4'-P energy: -18.915 bonds (distance) P-C4' energy: -18.408 flat angles C4'-P-C4' energy: -19.714 flat angles P-C4'-P energy: -7.277 tors. eta vs tors. theta energy: 1.294 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -138.487407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.487407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.487407 (E_RNA) where: Base-Base interactions energy: -77.837 where: short stacking energy: -37.395 Base-Backbone interact. energy: 0.266 local terms energy: -60.916787 where: bonds (distance) C4'-P energy: -17.111 bonds (distance) P-C4' energy: -20.265 flat angles C4'-P-C4' energy: -17.429 flat angles P-C4'-P energy: -8.289 tors. eta vs tors. theta energy: 2.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -317.003506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.003506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.041682 (E_RNA) where: Base-Base interactions energy: -195.200 where: short stacking energy: -101.155 Base-Backbone interact. energy: -0.656 local terms energy: -121.185814 where: bonds (distance) C4'-P energy: -26.649 bonds (distance) P-C4' energy: -23.286 flat angles C4'-P-C4' energy: -26.971 flat angles P-C4'-P energy: -16.133 tors. eta vs tors. theta energy: -28.147 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -265.697852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.697852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.712246 (E_RNA) where: Base-Base interactions energy: -156.730 where: short stacking energy: -88.700 Base-Backbone interact. energy: -0.115 local terms energy: -108.867891 where: bonds (distance) C4'-P energy: -24.579 bonds (distance) P-C4' energy: -21.394 flat angles C4'-P-C4' energy: -28.488 flat angles P-C4'-P energy: -12.084 tors. eta vs tors. theta energy: -22.323 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -209.041850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.041850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.967187 (E_RNA) where: Base-Base interactions energy: -100.004 where: short stacking energy: -83.387 Base-Backbone interact. energy: 1.114 local terms energy: -112.077355 where: bonds (distance) C4'-P energy: -26.998 bonds (distance) P-C4' energy: -24.030 flat angles C4'-P-C4' energy: -27.101 flat angles P-C4'-P energy: -15.489 tors. eta vs tors. theta energy: -18.459 Dist. restrs. and SS energy: 1.925 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -213.918229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.918229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.935694 (E_RNA) where: Base-Base interactions energy: -127.473 where: short stacking energy: -64.727 Base-Backbone interact. energy: -0.621 local terms energy: -85.842225 where: bonds (distance) C4'-P energy: -22.591 bonds (distance) P-C4' energy: -20.313 flat angles C4'-P-C4' energy: -22.214 flat angles P-C4'-P energy: -14.136 tors. eta vs tors. theta energy: -6.588 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -205.948586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.948586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.948586 (E_RNA) where: Base-Base interactions energy: -110.936 where: short stacking energy: -85.568 Base-Backbone interact. energy: -0.462 local terms energy: -94.549941 where: bonds (distance) C4'-P energy: -24.647 bonds (distance) P-C4' energy: -21.636 flat angles C4'-P-C4' energy: -23.138 flat angles P-C4'-P energy: -9.452 tors. eta vs tors. theta energy: -15.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -237.267791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.267791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.267791 (E_RNA) where: Base-Base interactions energy: -154.949 where: short stacking energy: -89.475 Base-Backbone interact. energy: 0.639 local terms energy: -82.957451 where: bonds (distance) C4'-P energy: -12.956 bonds (distance) P-C4' energy: -18.361 flat angles C4'-P-C4' energy: -19.187 flat angles P-C4'-P energy: -9.909 tors. eta vs tors. theta energy: -22.545 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -165.355883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.355883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.398634 (E_RNA) where: Base-Base interactions energy: -83.702 where: short stacking energy: -50.116 Base-Backbone interact. energy: -2.005 local terms energy: -79.691866 where: bonds (distance) C4'-P energy: -23.789 bonds (distance) P-C4' energy: -23.426 flat angles C4'-P-C4' energy: -17.272 flat angles P-C4'-P energy: -13.169 tors. eta vs tors. theta energy: -2.037 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -189.002127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.002127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.002127 (E_RNA) where: Base-Base interactions energy: -112.574 where: short stacking energy: -74.458 Base-Backbone interact. energy: -0.325 local terms energy: -76.102544 where: bonds (distance) C4'-P energy: -14.622 bonds (distance) P-C4' energy: -20.256 flat angles C4'-P-C4' energy: -17.297 flat angles P-C4'-P energy: -12.098 tors. eta vs tors. theta energy: -11.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -182.159078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.159078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.164299 (E_RNA) where: Base-Base interactions energy: -88.317 where: short stacking energy: -63.209 Base-Backbone interact. energy: -0.657 local terms energy: -93.190378 where: bonds (distance) C4'-P energy: -20.683 bonds (distance) P-C4' energy: -24.053 flat angles C4'-P-C4' energy: -22.295 flat angles P-C4'-P energy: -16.207 tors. eta vs tors. theta energy: -9.953 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -145.734786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.734786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.048144 (E_RNA) where: Base-Base interactions energy: -82.666 where: short stacking energy: -56.897 Base-Backbone interact. energy: 3.354 local terms energy: -66.736598 where: bonds (distance) C4'-P energy: -14.825 bonds (distance) P-C4' energy: -21.389 flat angles C4'-P-C4' energy: -16.427 flat angles P-C4'-P energy: -14.798 tors. eta vs tors. theta energy: 0.703 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -334.275474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.275474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.275474 (E_RNA) where: Base-Base interactions energy: -222.520 where: short stacking energy: -102.650 Base-Backbone interact. energy: -1.123 local terms energy: -110.631593 where: bonds (distance) C4'-P energy: -25.047 bonds (distance) P-C4' energy: -22.182 flat angles C4'-P-C4' energy: -22.855 flat angles P-C4'-P energy: -17.940 tors. eta vs tors. theta energy: -22.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -286.175457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.175457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.380733 (E_RNA) where: Base-Base interactions energy: -164.857 where: short stacking energy: -105.831 Base-Backbone interact. energy: -0.709 local terms energy: -120.814828 where: bonds (distance) C4'-P energy: -26.563 bonds (distance) P-C4' energy: -26.460 flat angles C4'-P-C4' energy: -28.175 flat angles P-C4'-P energy: -10.780 tors. eta vs tors. theta energy: -28.838 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -271.239981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.239981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.239981 (E_RNA) where: Base-Base interactions energy: -162.929 where: short stacking energy: -99.860 Base-Backbone interact. energy: -0.268 local terms energy: -108.043285 where: bonds (distance) C4'-P energy: -23.980 bonds (distance) P-C4' energy: -25.905 flat angles C4'-P-C4' energy: -26.526 flat angles P-C4'-P energy: -10.562 tors. eta vs tors. theta energy: -21.070 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -208.439104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.439104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.074660 (E_RNA) where: Base-Base interactions energy: -105.956 where: short stacking energy: -79.303 Base-Backbone interact. energy: -0.390 local terms energy: -103.728742 where: bonds (distance) C4'-P energy: -21.967 bonds (distance) P-C4' energy: -28.974 flat angles C4'-P-C4' energy: -17.980 flat angles P-C4'-P energy: -13.428 tors. eta vs tors. theta energy: -21.380 Dist. restrs. and SS energy: 1.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -221.585935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.585935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.598497 (E_RNA) where: Base-Base interactions energy: -127.330 where: short stacking energy: -74.781 Base-Backbone interact. energy: -0.168 local terms energy: -94.100696 where: bonds (distance) C4'-P energy: -22.509 bonds (distance) P-C4' energy: -20.361 flat angles C4'-P-C4' energy: -21.326 flat angles P-C4'-P energy: -17.326 tors. eta vs tors. theta energy: -12.579 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -185.258519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.258519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.258519 (E_RNA) where: Base-Base interactions energy: -96.006 where: short stacking energy: -58.946 Base-Backbone interact. energy: -0.437 local terms energy: -88.815204 where: bonds (distance) C4'-P energy: -21.706 bonds (distance) P-C4' energy: -26.138 flat angles C4'-P-C4' energy: -22.906 flat angles P-C4'-P energy: -10.724 tors. eta vs tors. theta energy: -7.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -168.725450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.725450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.725450 (E_RNA) where: Base-Base interactions energy: -86.137 where: short stacking energy: -59.941 Base-Backbone interact. energy: -0.116 local terms energy: -82.472646 where: bonds (distance) C4'-P energy: -20.902 bonds (distance) P-C4' energy: -18.677 flat angles C4'-P-C4' energy: -17.974 flat angles P-C4'-P energy: -16.766 tors. eta vs tors. theta energy: -8.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -169.782896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.782896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.857981 (E_RNA) where: Base-Base interactions energy: -95.579 where: short stacking energy: -59.827 Base-Backbone interact. energy: -0.776 local terms energy: -73.502963 where: bonds (distance) C4'-P energy: -21.559 bonds (distance) P-C4' energy: -17.895 flat angles C4'-P-C4' energy: -13.720 flat angles P-C4'-P energy: -17.511 tors. eta vs tors. theta energy: -2.818 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -195.421508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.421508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.456615 (E_RNA) where: Base-Base interactions energy: -108.945 where: short stacking energy: -68.554 Base-Backbone interact. energy: -0.781 local terms energy: -85.730595 where: bonds (distance) C4'-P energy: -18.929 bonds (distance) P-C4' energy: -23.755 flat angles C4'-P-C4' energy: -19.853 flat angles P-C4'-P energy: -13.508 tors. eta vs tors. theta energy: -9.686 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -148.513541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.513541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.538585 (E_RNA) where: Base-Base interactions energy: -59.822 where: short stacking energy: -36.315 Base-Backbone interact. energy: -0.193 local terms energy: -88.523698 where: bonds (distance) C4'-P energy: -22.869 bonds (distance) P-C4' energy: -28.481 flat angles C4'-P-C4' energy: -21.573 flat angles P-C4'-P energy: -13.719 tors. eta vs tors. theta energy: -1.882 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -332.803420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.803420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.803420 (E_RNA) where: Base-Base interactions energy: -209.626 where: short stacking energy: -112.733 Base-Backbone interact. energy: -0.630 local terms energy: -122.547417 where: bonds (distance) C4'-P energy: -23.283 bonds (distance) P-C4' energy: -23.856 flat angles C4'-P-C4' energy: -23.573 flat angles P-C4'-P energy: -19.596 tors. eta vs tors. theta energy: -32.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -316.763965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.763965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.763965 (E_RNA) where: Base-Base interactions energy: -210.033 where: short stacking energy: -100.465 Base-Backbone interact. energy: -0.784 local terms energy: -105.946365 where: bonds (distance) C4'-P energy: -21.555 bonds (distance) P-C4' energy: -23.643 flat angles C4'-P-C4' energy: -19.396 flat angles P-C4'-P energy: -20.197 tors. eta vs tors. theta energy: -21.155 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -266.363405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.363405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.380515 (E_RNA) where: Base-Base interactions energy: -154.983 where: short stacking energy: -87.702 Base-Backbone interact. energy: -0.026 local terms energy: -111.372004 where: bonds (distance) C4'-P energy: -24.558 bonds (distance) P-C4' energy: -24.781 flat angles C4'-P-C4' energy: -22.626 flat angles P-C4'-P energy: -16.494 tors. eta vs tors. theta energy: -22.912 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -252.792666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.792666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.803784 (E_RNA) where: Base-Base interactions energy: -146.698 where: short stacking energy: -80.740 Base-Backbone interact. energy: 0.178 local terms energy: -106.284095 where: bonds (distance) C4'-P energy: -20.954 bonds (distance) P-C4' energy: -25.956 flat angles C4'-P-C4' energy: -24.618 flat angles P-C4'-P energy: -18.583 tors. eta vs tors. theta energy: -16.174 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -185.801425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.801425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.711626 (E_RNA) where: Base-Base interactions energy: -92.818 where: short stacking energy: -62.375 Base-Backbone interact. energy: -0.098 local terms energy: -94.795738 where: bonds (distance) C4'-P energy: -16.770 bonds (distance) P-C4' energy: -22.303 flat angles C4'-P-C4' energy: -26.719 flat angles P-C4'-P energy: -10.043 tors. eta vs tors. theta energy: -18.960 Dist. restrs. and SS energy: 1.910 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -198.588473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.588473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.693597 (E_RNA) where: Base-Base interactions energy: -105.834 where: short stacking energy: -58.400 Base-Backbone interact. energy: 0.074 local terms energy: -92.934028 where: bonds (distance) C4'-P energy: -17.041 bonds (distance) P-C4' energy: -28.111 flat angles C4'-P-C4' energy: -25.313 flat angles P-C4'-P energy: -14.143 tors. eta vs tors. theta energy: -8.326 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -172.083843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.083843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.083843 (E_RNA) where: Base-Base interactions energy: -87.437 where: short stacking energy: -50.583 Base-Backbone interact. energy: -0.803 local terms energy: -83.843870 where: bonds (distance) C4'-P energy: -21.156 bonds (distance) P-C4' energy: -21.149 flat angles C4'-P-C4' energy: -23.154 flat angles P-C4'-P energy: -14.895 tors. eta vs tors. theta energy: -3.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -173.450727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.450727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.494425 (E_RNA) where: Base-Base interactions energy: -88.340 where: short stacking energy: -54.312 Base-Backbone interact. energy: -0.163 local terms energy: -84.991755 where: bonds (distance) C4'-P energy: -22.903 bonds (distance) P-C4' energy: -24.930 flat angles C4'-P-C4' energy: -14.224 flat angles P-C4'-P energy: -9.415 tors. eta vs tors. theta energy: -13.520 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -165.461459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.461459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.463090 (E_RNA) where: Base-Base interactions energy: -84.263 where: short stacking energy: -59.472 Base-Backbone interact. energy: -0.546 local terms energy: -80.654780 where: bonds (distance) C4'-P energy: -17.373 bonds (distance) P-C4' energy: -24.870 flat angles C4'-P-C4' energy: -22.969 flat angles P-C4'-P energy: -8.168 tors. eta vs tors. theta energy: -7.276 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -149.725126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.725126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.730150 (E_RNA) where: Base-Base interactions energy: -85.464 where: short stacking energy: -53.612 Base-Backbone interact. energy: -0.451 local terms energy: -63.815039 where: bonds (distance) C4'-P energy: -20.493 bonds (distance) P-C4' energy: -15.189 flat angles C4'-P-C4' energy: -15.244 flat angles P-C4'-P energy: -11.390 tors. eta vs tors. theta energy: -1.500 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -337.652365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.652365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.747555 (E_RNA) where: Base-Base interactions energy: -217.039 where: short stacking energy: -107.456 Base-Backbone interact. energy: -1.420 local terms energy: -119.288501 where: bonds (distance) C4'-P energy: -23.835 bonds (distance) P-C4' energy: -28.816 flat angles C4'-P-C4' energy: -22.620 flat angles P-C4'-P energy: -18.422 tors. eta vs tors. theta energy: -25.597 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -335.924068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.924068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.924068 (E_RNA) where: Base-Base interactions energy: -218.888 where: short stacking energy: -114.323 Base-Backbone interact. energy: -3.159 local terms energy: -113.876496 where: bonds (distance) C4'-P energy: -22.529 bonds (distance) P-C4' energy: -22.136 flat angles C4'-P-C4' energy: -22.666 flat angles P-C4'-P energy: -19.494 tors. eta vs tors. theta energy: -27.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -261.056182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.056182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.097832 (E_RNA) where: Base-Base interactions energy: -146.397 where: short stacking energy: -91.754 Base-Backbone interact. energy: -1.216 local terms energy: -113.484559 where: bonds (distance) C4'-P energy: -29.904 bonds (distance) P-C4' energy: -26.022 flat angles C4'-P-C4' energy: -20.521 flat angles P-C4'-P energy: -15.894 tors. eta vs tors. theta energy: -21.143 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -268.780610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.780610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.780610 (E_RNA) where: Base-Base interactions energy: -165.095 where: short stacking energy: -89.562 Base-Backbone interact. energy: 0.668 local terms energy: -104.353728 where: bonds (distance) C4'-P energy: -20.116 bonds (distance) P-C4' energy: -22.658 flat angles C4'-P-C4' energy: -24.789 flat angles P-C4'-P energy: -15.406 tors. eta vs tors. theta energy: -21.385 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -228.997438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.997438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.997438 (E_RNA) where: Base-Base interactions energy: -133.455 where: short stacking energy: -72.810 Base-Backbone interact. energy: -0.420 local terms energy: -95.122465 where: bonds (distance) C4'-P energy: -23.920 bonds (distance) P-C4' energy: -20.963 flat angles C4'-P-C4' energy: -22.121 flat angles P-C4'-P energy: -16.119 tors. eta vs tors. theta energy: -12.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -170.203430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.203430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.021331 (E_RNA) where: Base-Base interactions energy: -80.507 where: short stacking energy: -62.817 Base-Backbone interact. energy: -2.090 local terms energy: -88.424285 where: bonds (distance) C4'-P energy: -21.661 bonds (distance) P-C4' energy: -24.008 flat angles C4'-P-C4' energy: -18.852 flat angles P-C4'-P energy: -13.709 tors. eta vs tors. theta energy: -10.195 Dist. restrs. and SS energy: 0.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -222.499790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.499790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.499790 (E_RNA) where: Base-Base interactions energy: -135.797 where: short stacking energy: -73.525 Base-Backbone interact. energy: 1.969 local terms energy: -88.672577 where: bonds (distance) C4'-P energy: -23.447 bonds (distance) P-C4' energy: -16.508 flat angles C4'-P-C4' energy: -18.421 flat angles P-C4'-P energy: -17.517 tors. eta vs tors. theta energy: -12.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -176.557157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.557157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.557157 (E_RNA) where: Base-Base interactions energy: -96.018 where: short stacking energy: -66.476 Base-Backbone interact. energy: -1.244 local terms energy: -79.295008 where: bonds (distance) C4'-P energy: -24.728 bonds (distance) P-C4' energy: -17.739 flat angles C4'-P-C4' energy: -17.916 flat angles P-C4'-P energy: -7.835 tors. eta vs tors. theta energy: -11.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -159.804629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.804629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.804629 (E_RNA) where: Base-Base interactions energy: -92.275 where: short stacking energy: -58.555 Base-Backbone interact. energy: 0.132 local terms energy: -67.661434 where: bonds (distance) C4'-P energy: -16.509 bonds (distance) P-C4' energy: -17.723 flat angles C4'-P-C4' energy: -18.668 flat angles P-C4'-P energy: -6.040 tors. eta vs tors. theta energy: -8.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -179.096842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.096842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.261494 (E_RNA) where: Base-Base interactions energy: -90.707 where: short stacking energy: -62.917 Base-Backbone interact. energy: -1.055 local terms energy: -87.499276 where: bonds (distance) C4'-P energy: -18.893 bonds (distance) P-C4' energy: -22.348 flat angles C4'-P-C4' energy: -22.755 flat angles P-C4'-P energy: -9.338 tors. eta vs tors. theta energy: -14.166 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -361.773028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.773028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.773028 (E_RNA) where: Base-Base interactions energy: -243.901 where: short stacking energy: -108.549 Base-Backbone interact. energy: 0.265 local terms energy: -118.137542 where: bonds (distance) C4'-P energy: -24.645 bonds (distance) P-C4' energy: -25.446 flat angles C4'-P-C4' energy: -25.061 flat angles P-C4'-P energy: -17.957 tors. eta vs tors. theta energy: -25.028 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -335.137775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.137775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.137775 (E_RNA) where: Base-Base interactions energy: -219.318 where: short stacking energy: -105.454 Base-Backbone interact. energy: -0.852 local terms energy: -114.967388 where: bonds (distance) C4'-P energy: -23.429 bonds (distance) P-C4' energy: -24.289 flat angles C4'-P-C4' energy: -23.408 flat angles P-C4'-P energy: -14.458 tors. eta vs tors. theta energy: -29.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -253.953089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.953089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.134826 (E_RNA) where: Base-Base interactions energy: -149.462 where: short stacking energy: -98.115 Base-Backbone interact. energy: -1.347 local terms energy: -103.325875 where: bonds (distance) C4'-P energy: -23.362 bonds (distance) P-C4' energy: -21.405 flat angles C4'-P-C4' energy: -22.828 flat angles P-C4'-P energy: -17.554 tors. eta vs tors. theta energy: -18.177 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -288.594174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.594174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.594174 (E_RNA) where: Base-Base interactions energy: -190.491 where: short stacking energy: -99.853 Base-Backbone interact. energy: -0.543 local terms energy: -97.560520 where: bonds (distance) C4'-P energy: -18.684 bonds (distance) P-C4' energy: -19.474 flat angles C4'-P-C4' energy: -23.450 flat angles P-C4'-P energy: -13.688 tors. eta vs tors. theta energy: -22.265 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -216.410877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.410877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.661583 (E_RNA) where: Base-Base interactions energy: -127.286 where: short stacking energy: -76.303 Base-Backbone interact. energy: -0.765 local terms energy: -88.610647 where: bonds (distance) C4'-P energy: -22.576 bonds (distance) P-C4' energy: -23.504 flat angles C4'-P-C4' energy: -23.163 flat angles P-C4'-P energy: -8.101 tors. eta vs tors. theta energy: -11.268 Dist. restrs. and SS energy: 0.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -199.726543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.726543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.801873 (E_RNA) where: Base-Base interactions energy: -111.927 where: short stacking energy: -68.928 Base-Backbone interact. energy: 0.668 local terms energy: -88.542551 where: bonds (distance) C4'-P energy: -16.234 bonds (distance) P-C4' energy: -21.730 flat angles C4'-P-C4' energy: -24.112 flat angles P-C4'-P energy: -14.542 tors. eta vs tors. theta energy: -11.925 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -156.627922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.627922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.609033 (E_RNA) where: Base-Base interactions energy: -92.459 where: short stacking energy: -63.850 Base-Backbone interact. energy: 2.288 local terms energy: -68.437699 where: bonds (distance) C4'-P energy: -14.765 bonds (distance) P-C4' energy: -20.613 flat angles C4'-P-C4' energy: -23.526 flat angles P-C4'-P energy: -9.381 tors. eta vs tors. theta energy: -0.153 Dist. restrs. and SS energy: 1.981 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -170.899862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.899862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.911407 (E_RNA) where: Base-Base interactions energy: -93.369 where: short stacking energy: -49.405 Base-Backbone interact. energy: -0.904 local terms energy: -76.638391 where: bonds (distance) C4'-P energy: -22.256 bonds (distance) P-C4' energy: -19.220 flat angles C4'-P-C4' energy: -15.143 flat angles P-C4'-P energy: -16.009 tors. eta vs tors. theta energy: -4.011 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -170.398181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.398181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.398181 (E_RNA) where: Base-Base interactions energy: -90.139 where: short stacking energy: -53.355 Base-Backbone interact. energy: 0.404 local terms energy: -80.663779 where: bonds (distance) C4'-P energy: -22.791 bonds (distance) P-C4' energy: -26.185 flat angles C4'-P-C4' energy: -16.492 flat angles P-C4'-P energy: -11.642 tors. eta vs tors. theta energy: -3.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -159.580490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.580490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.739984 (E_RNA) where: Base-Base interactions energy: -74.203 where: short stacking energy: -48.398 Base-Backbone interact. energy: -0.383 local terms energy: -85.154063 where: bonds (distance) C4'-P energy: -21.122 bonds (distance) P-C4' energy: -26.653 flat angles C4'-P-C4' energy: -23.305 flat angles P-C4'-P energy: -16.159 tors. eta vs tors. theta energy: 2.086 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -364.918934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.918934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.918934 (E_RNA) where: Base-Base interactions energy: -244.650 where: short stacking energy: -106.481 Base-Backbone interact. energy: -1.478 local terms energy: -118.791039 where: bonds (distance) C4'-P energy: -23.413 bonds (distance) P-C4' energy: -27.537 flat angles C4'-P-C4' energy: -26.724 flat angles P-C4'-P energy: -15.967 tors. eta vs tors. theta energy: -25.150 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -326.216269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.216269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.321374 (E_RNA) where: Base-Base interactions energy: -206.920 where: short stacking energy: -105.278 Base-Backbone interact. energy: -0.423 local terms energy: -118.978014 where: bonds (distance) C4'-P energy: -22.907 bonds (distance) P-C4' energy: -22.266 flat angles C4'-P-C4' energy: -23.754 flat angles P-C4'-P energy: -19.498 tors. eta vs tors. theta energy: -30.553 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -312.605158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.605158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.648831 (E_RNA) where: Base-Base interactions energy: -190.088 where: short stacking energy: -100.510 Base-Backbone interact. energy: -0.298 local terms energy: -122.263338 where: bonds (distance) C4'-P energy: -22.278 bonds (distance) P-C4' energy: -26.649 flat angles C4'-P-C4' energy: -25.581 flat angles P-C4'-P energy: -16.819 tors. eta vs tors. theta energy: -30.936 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -260.652561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.652561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.652561 (E_RNA) where: Base-Base interactions energy: -150.225 where: short stacking energy: -93.775 Base-Backbone interact. energy: -0.906 local terms energy: -109.521620 where: bonds (distance) C4'-P energy: -21.287 bonds (distance) P-C4' energy: -23.556 flat angles C4'-P-C4' energy: -26.733 flat angles P-C4'-P energy: -17.616 tors. eta vs tors. theta energy: -20.330 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -236.908923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.908923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.918880 (E_RNA) where: Base-Base interactions energy: -134.098 where: short stacking energy: -80.631 Base-Backbone interact. energy: -0.150 local terms energy: -102.670596 where: bonds (distance) C4'-P energy: -22.437 bonds (distance) P-C4' energy: -24.388 flat angles C4'-P-C4' energy: -24.309 flat angles P-C4'-P energy: -19.076 tors. eta vs tors. theta energy: -12.462 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -226.143189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.143189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.143189 (E_RNA) where: Base-Base interactions energy: -132.120 where: short stacking energy: -72.579 Base-Backbone interact. energy: -1.764 local terms energy: -92.259234 where: bonds (distance) C4'-P energy: -17.413 bonds (distance) P-C4' energy: -24.811 flat angles C4'-P-C4' energy: -21.553 flat angles P-C4'-P energy: -17.080 tors. eta vs tors. theta energy: -11.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -157.880210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.880210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.113078 (E_RNA) where: Base-Base interactions energy: -77.944 where: short stacking energy: -50.725 Base-Backbone interact. energy: -0.410 local terms energy: -79.758759 where: bonds (distance) C4'-P energy: -24.943 bonds (distance) P-C4' energy: -19.855 flat angles C4'-P-C4' energy: -15.448 flat angles P-C4'-P energy: -10.107 tors. eta vs tors. theta energy: -9.406 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -161.482595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.482595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.482595 (E_RNA) where: Base-Base interactions energy: -78.158 where: short stacking energy: -36.358 Base-Backbone interact. energy: -0.887 local terms energy: -82.437722 where: bonds (distance) C4'-P energy: -19.862 bonds (distance) P-C4' energy: -15.788 flat angles C4'-P-C4' energy: -23.062 flat angles P-C4'-P energy: -17.579 tors. eta vs tors. theta energy: -6.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -154.341715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.341715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.452962 (E_RNA) where: Base-Base interactions energy: -86.942 where: short stacking energy: -61.118 Base-Backbone interact. energy: 0.016 local terms energy: -67.526233 where: bonds (distance) C4'-P energy: -12.574 bonds (distance) P-C4' energy: -24.921 flat angles C4'-P-C4' energy: -10.871 flat angles P-C4'-P energy: -9.741 tors. eta vs tors. theta energy: -9.420 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -173.730214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.730214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.730214 (E_RNA) where: Base-Base interactions energy: -90.679 where: short stacking energy: -45.333 Base-Backbone interact. energy: -0.029 local terms energy: -83.022551 where: bonds (distance) C4'-P energy: -21.006 bonds (distance) P-C4' energy: -23.379 flat angles C4'-P-C4' energy: -20.702 flat angles P-C4'-P energy: -13.986 tors. eta vs tors. theta energy: -3.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -359.152425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.152425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.152425 (E_RNA) where: Base-Base interactions energy: -239.530 where: short stacking energy: -103.780 Base-Backbone interact. energy: -1.476 local terms energy: -118.145991 where: bonds (distance) C4'-P energy: -29.323 bonds (distance) P-C4' energy: -20.077 flat angles C4'-P-C4' energy: -20.364 flat angles P-C4'-P energy: -21.960 tors. eta vs tors. theta energy: -26.422 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -319.368890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.368890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.479413 (E_RNA) where: Base-Base interactions energy: -199.029 where: short stacking energy: -97.697 Base-Backbone interact. energy: -0.049 local terms energy: -120.401503 where: bonds (distance) C4'-P energy: -22.178 bonds (distance) P-C4' energy: -26.151 flat angles C4'-P-C4' energy: -24.388 flat angles P-C4'-P energy: -19.102 tors. eta vs tors. theta energy: -28.582 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -316.805233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.805233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.010214 (E_RNA) where: Base-Base interactions energy: -200.987 where: short stacking energy: -112.412 Base-Backbone interact. energy: 0.025 local terms energy: -116.048066 where: bonds (distance) C4'-P energy: -22.221 bonds (distance) P-C4' energy: -23.337 flat angles C4'-P-C4' energy: -24.383 flat angles P-C4'-P energy: -18.786 tors. eta vs tors. theta energy: -27.321 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -264.975900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.975900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.975900 (E_RNA) where: Base-Base interactions energy: -163.746 where: short stacking energy: -86.696 Base-Backbone interact. energy: -0.804 local terms energy: -100.426573 where: bonds (distance) C4'-P energy: -22.231 bonds (distance) P-C4' energy: -19.496 flat angles C4'-P-C4' energy: -22.516 flat angles P-C4'-P energy: -17.210 tors. eta vs tors. theta energy: -18.973 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -234.013606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.013606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.059666 (E_RNA) where: Base-Base interactions energy: -147.234 where: short stacking energy: -70.273 Base-Backbone interact. energy: -1.570 local terms energy: -85.256348 where: bonds (distance) C4'-P energy: -23.838 bonds (distance) P-C4' energy: -19.674 flat angles C4'-P-C4' energy: -13.290 flat angles P-C4'-P energy: -16.522 tors. eta vs tors. theta energy: -11.931 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -238.016715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.016715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.016715 (E_RNA) where: Base-Base interactions energy: -135.367 where: short stacking energy: -80.644 Base-Backbone interact. energy: -0.806 local terms energy: -101.843675 where: bonds (distance) C4'-P energy: -24.505 bonds (distance) P-C4' energy: -25.125 flat angles C4'-P-C4' energy: -21.258 flat angles P-C4'-P energy: -14.185 tors. eta vs tors. theta energy: -16.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -203.835471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.835471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.835471 (E_RNA) where: Base-Base interactions energy: -110.202 where: short stacking energy: -69.911 Base-Backbone interact. energy: 0.999 local terms energy: -94.632609 where: bonds (distance) C4'-P energy: -24.802 bonds (distance) P-C4' energy: -21.526 flat angles C4'-P-C4' energy: -21.507 flat angles P-C4'-P energy: -5.719 tors. eta vs tors. theta energy: -21.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -174.361834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.361834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.361834 (E_RNA) where: Base-Base interactions energy: -93.139 where: short stacking energy: -65.351 Base-Backbone interact. energy: -0.154 local terms energy: -81.068807 where: bonds (distance) C4'-P energy: -17.589 bonds (distance) P-C4' energy: -20.091 flat angles C4'-P-C4' energy: -18.260 flat angles P-C4'-P energy: -18.424 tors. eta vs tors. theta energy: -6.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -162.336023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.336023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.336023 (E_RNA) where: Base-Base interactions energy: -96.668 where: short stacking energy: -55.497 Base-Backbone interact. energy: -0.054 local terms energy: -65.613867 where: bonds (distance) C4'-P energy: -18.874 bonds (distance) P-C4' energy: -17.614 flat angles C4'-P-C4' energy: -16.159 flat angles P-C4'-P energy: -7.208 tors. eta vs tors. theta energy: -5.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -158.579805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.579805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.702966 (E_RNA) where: Base-Base interactions energy: -90.652 where: short stacking energy: -41.891 Base-Backbone interact. energy: 0.276 local terms energy: -68.326708 where: bonds (distance) C4'-P energy: -18.472 bonds (distance) P-C4' energy: -20.415 flat angles C4'-P-C4' energy: -13.940 flat angles P-C4'-P energy: -12.069 tors. eta vs tors. theta energy: -3.430 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -354.077040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.077040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.089901 (E_RNA) where: Base-Base interactions energy: -239.860 where: short stacking energy: -111.094 Base-Backbone interact. energy: -1.983 local terms energy: -112.246892 where: bonds (distance) C4'-P energy: -26.110 bonds (distance) P-C4' energy: -26.212 flat angles C4'-P-C4' energy: -24.458 flat angles P-C4'-P energy: -13.695 tors. eta vs tors. theta energy: -21.772 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -330.912090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.912090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.912090 (E_RNA) where: Base-Base interactions energy: -208.020 where: short stacking energy: -97.502 Base-Backbone interact. energy: -1.320 local terms energy: -121.571842 where: bonds (distance) C4'-P energy: -28.021 bonds (distance) P-C4' energy: -24.298 flat angles C4'-P-C4' energy: -26.373 flat angles P-C4'-P energy: -18.306 tors. eta vs tors. theta energy: -24.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -327.187592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.187592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.187592 (E_RNA) where: Base-Base interactions energy: -208.759 where: short stacking energy: -118.647 Base-Backbone interact. energy: 0.691 local terms energy: -119.119791 where: bonds (distance) C4'-P energy: -17.980 bonds (distance) P-C4' energy: -21.099 flat angles C4'-P-C4' energy: -27.446 flat angles P-C4'-P energy: -20.007 tors. eta vs tors. theta energy: -32.589 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -280.212642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.212642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.212642 (E_RNA) where: Base-Base interactions energy: -174.850 where: short stacking energy: -86.243 Base-Backbone interact. energy: -0.859 local terms energy: -104.503320 where: bonds (distance) C4'-P energy: -16.157 bonds (distance) P-C4' energy: -24.557 flat angles C4'-P-C4' energy: -22.301 flat angles P-C4'-P energy: -16.645 tors. eta vs tors. theta energy: -24.845 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -221.004076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.004076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.121780 (E_RNA) where: Base-Base interactions energy: -122.373 where: short stacking energy: -92.094 Base-Backbone interact. energy: 1.374 local terms energy: -100.123177 where: bonds (distance) C4'-P energy: -15.885 bonds (distance) P-C4' energy: -22.778 flat angles C4'-P-C4' energy: -21.428 flat angles P-C4'-P energy: -18.580 tors. eta vs tors. theta energy: -21.452 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -215.303422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.303422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.303422 (E_RNA) where: Base-Base interactions energy: -127.690 where: short stacking energy: -63.432 Base-Backbone interact. energy: -0.936 local terms energy: -86.677292 where: bonds (distance) C4'-P energy: -20.399 bonds (distance) P-C4' energy: -24.696 flat angles C4'-P-C4' energy: -15.841 flat angles P-C4'-P energy: -15.677 tors. eta vs tors. theta energy: -10.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -188.318895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.318895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.318895 (E_RNA) where: Base-Base interactions energy: -108.788 where: short stacking energy: -55.390 Base-Backbone interact. energy: -1.279 local terms energy: -78.251623 where: bonds (distance) C4'-P energy: -24.712 bonds (distance) P-C4' energy: -19.209 flat angles C4'-P-C4' energy: -13.817 flat angles P-C4'-P energy: -14.521 tors. eta vs tors. theta energy: -5.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -193.966994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.966994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.966994 (E_RNA) where: Base-Base interactions energy: -115.181 where: short stacking energy: -51.443 Base-Backbone interact. energy: 1.184 local terms energy: -79.970063 where: bonds (distance) C4'-P energy: -19.922 bonds (distance) P-C4' energy: -17.544 flat angles C4'-P-C4' energy: -25.425 flat angles P-C4'-P energy: -10.561 tors. eta vs tors. theta energy: -6.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -164.288164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.288164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.288164 (E_RNA) where: Base-Base interactions energy: -84.957 where: short stacking energy: -60.973 Base-Backbone interact. energy: -0.368 local terms energy: -78.963290 where: bonds (distance) C4'-P energy: -19.376 bonds (distance) P-C4' energy: -18.010 flat angles C4'-P-C4' energy: -21.427 flat angles P-C4'-P energy: -14.340 tors. eta vs tors. theta energy: -5.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -162.271633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.271633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.357320 (E_RNA) where: Base-Base interactions energy: -77.789 where: short stacking energy: -47.854 Base-Backbone interact. energy: -0.123 local terms energy: -84.444762 where: bonds (distance) C4'-P energy: -19.873 bonds (distance) P-C4' energy: -21.926 flat angles C4'-P-C4' energy: -20.256 flat angles P-C4'-P energy: -14.097 tors. eta vs tors. theta energy: -8.293 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -356.520176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.520176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.522984 (E_RNA) where: Base-Base interactions energy: -237.871 where: short stacking energy: -107.665 Base-Backbone interact. energy: -1.455 local terms energy: -117.196465 where: bonds (distance) C4'-P energy: -17.303 bonds (distance) P-C4' energy: -26.678 flat angles C4'-P-C4' energy: -23.970 flat angles P-C4'-P energy: -21.195 tors. eta vs tors. theta energy: -28.051 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -337.637135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.637135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.637135 (E_RNA) where: Base-Base interactions energy: -210.108 where: short stacking energy: -107.929 Base-Backbone interact. energy: -0.988 local terms energy: -126.541152 where: bonds (distance) C4'-P energy: -27.962 bonds (distance) P-C4' energy: -24.768 flat angles C4'-P-C4' energy: -27.272 flat angles P-C4'-P energy: -16.710 tors. eta vs tors. theta energy: -29.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -330.174222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.174222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.174222 (E_RNA) where: Base-Base interactions energy: -202.583 where: short stacking energy: -112.919 Base-Backbone interact. energy: -0.894 local terms energy: -126.696736 where: bonds (distance) C4'-P energy: -24.716 bonds (distance) P-C4' energy: -23.384 flat angles C4'-P-C4' energy: -27.253 flat angles P-C4'-P energy: -18.061 tors. eta vs tors. theta energy: -33.283 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -319.010191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.010191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.057551 (E_RNA) where: Base-Base interactions energy: -207.777 where: short stacking energy: -104.130 Base-Backbone interact. energy: -0.228 local terms energy: -111.052470 where: bonds (distance) C4'-P energy: -19.834 bonds (distance) P-C4' energy: -25.299 flat angles C4'-P-C4' energy: -21.199 flat angles P-C4'-P energy: -17.304 tors. eta vs tors. theta energy: -27.416 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -224.164985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.164985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.198486 (E_RNA) where: Base-Base interactions energy: -126.197 where: short stacking energy: -61.379 Base-Backbone interact. energy: 2.960 local terms energy: -100.961635 where: bonds (distance) C4'-P energy: -22.608 bonds (distance) P-C4' energy: -26.082 flat angles C4'-P-C4' energy: -20.562 flat angles P-C4'-P energy: -19.152 tors. eta vs tors. theta energy: -12.557 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -239.037279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.037279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.037279 (E_RNA) where: Base-Base interactions energy: -158.671 where: short stacking energy: -75.780 Base-Backbone interact. energy: 0.397 local terms energy: -80.763101 where: bonds (distance) C4'-P energy: -18.839 bonds (distance) P-C4' energy: -11.491 flat angles C4'-P-C4' energy: -24.447 flat angles P-C4'-P energy: -14.885 tors. eta vs tors. theta energy: -11.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -188.780463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.780463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.834301 (E_RNA) where: Base-Base interactions energy: -99.741 where: short stacking energy: -53.593 Base-Backbone interact. energy: -0.202 local terms energy: -88.891093 where: bonds (distance) C4'-P energy: -18.858 bonds (distance) P-C4' energy: -25.966 flat angles C4'-P-C4' energy: -18.482 flat angles P-C4'-P energy: -14.277 tors. eta vs tors. theta energy: -11.308 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -162.862308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.862308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.948756 (E_RNA) where: Base-Base interactions energy: -92.751 where: short stacking energy: -64.353 Base-Backbone interact. energy: -0.651 local terms energy: -69.546277 where: bonds (distance) C4'-P energy: -6.693 bonds (distance) P-C4' energy: -24.848 flat angles C4'-P-C4' energy: -20.821 flat angles P-C4'-P energy: -6.489 tors. eta vs tors. theta energy: -10.695 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -188.502810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.502810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.589165 (E_RNA) where: Base-Base interactions energy: -125.398 where: short stacking energy: -64.361 Base-Backbone interact. energy: -0.594 local terms energy: -62.597203 where: bonds (distance) C4'-P energy: -19.582 bonds (distance) P-C4' energy: -8.237 flat angles C4'-P-C4' energy: -18.278 flat angles P-C4'-P energy: -5.675 tors. eta vs tors. theta energy: -10.825 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -161.924970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.924970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.965619 (E_RNA) where: Base-Base interactions energy: -77.776 where: short stacking energy: -47.970 Base-Backbone interact. energy: 1.967 local terms energy: -86.156774 where: bonds (distance) C4'-P energy: -24.496 bonds (distance) P-C4' energy: -19.077 flat angles C4'-P-C4' energy: -17.208 flat angles P-C4'-P energy: -12.774 tors. eta vs tors. theta energy: -12.601 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -366.524994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.524994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.524994 (E_RNA) where: Base-Base interactions energy: -248.083 where: short stacking energy: -106.288 Base-Backbone interact. energy: -1.042 local terms energy: -117.400386 where: bonds (distance) C4'-P energy: -23.126 bonds (distance) P-C4' energy: -26.373 flat angles C4'-P-C4' energy: -22.725 flat angles P-C4'-P energy: -18.030 tors. eta vs tors. theta energy: -27.147 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -342.661070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.661070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.661070 (E_RNA) where: Base-Base interactions energy: -216.260 where: short stacking energy: -106.242 Base-Backbone interact. energy: -0.912 local terms energy: -125.489131 where: bonds (distance) C4'-P energy: -22.810 bonds (distance) P-C4' energy: -23.781 flat angles C4'-P-C4' energy: -24.715 flat angles P-C4'-P energy: -20.464 tors. eta vs tors. theta energy: -33.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -344.544001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.544001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.544001 (E_RNA) where: Base-Base interactions energy: -231.107 where: short stacking energy: -106.114 Base-Backbone interact. energy: -1.361 local terms energy: -112.076557 where: bonds (distance) C4'-P energy: -21.350 bonds (distance) P-C4' energy: -17.495 flat angles C4'-P-C4' energy: -23.089 flat angles P-C4'-P energy: -17.520 tors. eta vs tors. theta energy: -32.622 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -307.872804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.872804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.952033 (E_RNA) where: Base-Base interactions energy: -193.417 where: short stacking energy: -103.878 Base-Backbone interact. energy: -1.730 local terms energy: -112.805312 where: bonds (distance) C4'-P energy: -21.693 bonds (distance) P-C4' energy: -25.174 flat angles C4'-P-C4' energy: -23.634 flat angles P-C4'-P energy: -15.112 tors. eta vs tors. theta energy: -27.192 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -266.925478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.925478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.952100 (E_RNA) where: Base-Base interactions energy: -163.522 where: short stacking energy: -81.439 Base-Backbone interact. energy: -3.750 local terms energy: -99.679700 where: bonds (distance) C4'-P energy: -21.335 bonds (distance) P-C4' energy: -23.927 flat angles C4'-P-C4' energy: -24.791 flat angles P-C4'-P energy: -12.088 tors. eta vs tors. theta energy: -17.540 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -201.591062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.591062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.741803 (E_RNA) where: Base-Base interactions energy: -108.648 where: short stacking energy: -75.984 Base-Backbone interact. energy: -0.497 local terms energy: -92.596818 where: bonds (distance) C4'-P energy: -20.272 bonds (distance) P-C4' energy: -24.705 flat angles C4'-P-C4' energy: -24.013 flat angles P-C4'-P energy: -13.608 tors. eta vs tors. theta energy: -9.999 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -198.919276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.919276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.984154 (E_RNA) where: Base-Base interactions energy: -107.287 where: short stacking energy: -58.174 Base-Backbone interact. energy: -0.254 local terms energy: -91.442571 where: bonds (distance) C4'-P energy: -18.503 bonds (distance) P-C4' energy: -25.192 flat angles C4'-P-C4' energy: -26.424 flat angles P-C4'-P energy: -13.239 tors. eta vs tors. theta energy: -8.085 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -162.240047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.240047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.308593 (E_RNA) where: Base-Base interactions energy: -73.916 where: short stacking energy: -46.263 Base-Backbone interact. energy: -1.685 local terms energy: -86.706916 where: bonds (distance) C4'-P energy: -21.739 bonds (distance) P-C4' energy: -26.455 flat angles C4'-P-C4' energy: -21.875 flat angles P-C4'-P energy: -15.779 tors. eta vs tors. theta energy: -0.858 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -217.397760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.397760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.474334 (E_RNA) where: Base-Base interactions energy: -125.716 where: short stacking energy: -75.685 Base-Backbone interact. energy: 1.394 local terms energy: -93.152667 where: bonds (distance) C4'-P energy: -14.866 bonds (distance) P-C4' energy: -24.060 flat angles C4'-P-C4' energy: -17.784 flat angles P-C4'-P energy: -17.781 tors. eta vs tors. theta energy: -18.662 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -142.954595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.954595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.954595 (E_RNA) where: Base-Base interactions energy: -68.563 where: short stacking energy: -40.580 Base-Backbone interact. energy: -0.117 local terms energy: -74.274087 where: bonds (distance) C4'-P energy: -15.420 bonds (distance) P-C4' energy: -21.430 flat angles C4'-P-C4' energy: -18.239 flat angles P-C4'-P energy: -12.671 tors. eta vs tors. theta energy: -6.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -370.522902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.522902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.522902 (E_RNA) where: Base-Base interactions energy: -245.756 where: short stacking energy: -117.935 Base-Backbone interact. energy: -2.782 local terms energy: -121.985023 where: bonds (distance) C4'-P energy: -17.740 bonds (distance) P-C4' energy: -26.744 flat angles C4'-P-C4' energy: -27.956 flat angles P-C4'-P energy: -18.205 tors. eta vs tors. theta energy: -31.340 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -341.708526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.708526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.713164 (E_RNA) where: Base-Base interactions energy: -214.704 where: short stacking energy: -113.175 Base-Backbone interact. energy: -1.081 local terms energy: -125.927569 where: bonds (distance) C4'-P energy: -24.165 bonds (distance) P-C4' energy: -22.251 flat angles C4'-P-C4' energy: -24.172 flat angles P-C4'-P energy: -20.748 tors. eta vs tors. theta energy: -34.592 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -329.205136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.205136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.224265 (E_RNA) where: Base-Base interactions energy: -206.487 where: short stacking energy: -105.404 Base-Backbone interact. energy: -0.960 local terms energy: -121.777033 where: bonds (distance) C4'-P energy: -18.540 bonds (distance) P-C4' energy: -28.281 flat angles C4'-P-C4' energy: -26.849 flat angles P-C4'-P energy: -13.603 tors. eta vs tors. theta energy: -34.504 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -303.811760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.811760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.811760 (E_RNA) where: Base-Base interactions energy: -194.642 where: short stacking energy: -96.004 Base-Backbone interact. energy: -1.079 local terms energy: -108.090922 where: bonds (distance) C4'-P energy: -22.677 bonds (distance) P-C4' energy: -24.829 flat angles C4'-P-C4' energy: -23.856 flat angles P-C4'-P energy: -9.975 tors. eta vs tors. theta energy: -26.754 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -270.271480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.271480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.271480 (E_RNA) where: Base-Base interactions energy: -168.204 where: short stacking energy: -82.943 Base-Backbone interact. energy: -1.064 local terms energy: -101.002800 where: bonds (distance) C4'-P energy: -19.704 bonds (distance) P-C4' energy: -20.439 flat angles C4'-P-C4' energy: -24.801 flat angles P-C4'-P energy: -20.592 tors. eta vs tors. theta energy: -15.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -231.560814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.560814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.560814 (E_RNA) where: Base-Base interactions energy: -139.153 where: short stacking energy: -82.916 Base-Backbone interact. energy: 0.157 local terms energy: -92.564740 where: bonds (distance) C4'-P energy: -24.090 bonds (distance) P-C4' energy: -20.763 flat angles C4'-P-C4' energy: -25.105 flat angles P-C4'-P energy: -12.132 tors. eta vs tors. theta energy: -10.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -171.573389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.573389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.703412 (E_RNA) where: Base-Base interactions energy: -77.325 where: short stacking energy: -64.785 Base-Backbone interact. energy: -0.276 local terms energy: -95.102458 where: bonds (distance) C4'-P energy: -23.842 bonds (distance) P-C4' energy: -23.196 flat angles C4'-P-C4' energy: -18.756 flat angles P-C4'-P energy: -16.561 tors. eta vs tors. theta energy: -12.748 Dist. restrs. and SS energy: 1.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -249.126594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.126594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.158205 (E_RNA) where: Base-Base interactions energy: -164.382 where: short stacking energy: -74.289 Base-Backbone interact. energy: -1.542 local terms energy: -83.233943 where: bonds (distance) C4'-P energy: -18.830 bonds (distance) P-C4' energy: -19.510 flat angles C4'-P-C4' energy: -19.922 flat angles P-C4'-P energy: -10.827 tors. eta vs tors. theta energy: -14.145 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -169.693406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.693406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.693406 (E_RNA) where: Base-Base interactions energy: -97.453 where: short stacking energy: -67.933 Base-Backbone interact. energy: -0.585 local terms energy: -71.655159 where: bonds (distance) C4'-P energy: -18.524 bonds (distance) P-C4' energy: -18.597 flat angles C4'-P-C4' energy: -22.612 flat angles P-C4'-P energy: -5.370 tors. eta vs tors. theta energy: -6.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -141.248005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.248005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.351746 (E_RNA) where: Base-Base interactions energy: -70.316 where: short stacking energy: -36.643 Base-Backbone interact. energy: -0.571 local terms energy: -70.465560 where: bonds (distance) C4'-P energy: -21.630 bonds (distance) P-C4' energy: -22.723 flat angles C4'-P-C4' energy: -19.294 flat angles P-C4'-P energy: -9.100 tors. eta vs tors. theta energy: 2.280 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -370.871011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.871011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.875033 (E_RNA) where: Base-Base interactions energy: -247.609 where: short stacking energy: -107.362 Base-Backbone interact. energy: -2.944 local terms energy: -120.322623 where: bonds (distance) C4'-P energy: -21.958 bonds (distance) P-C4' energy: -22.526 flat angles C4'-P-C4' energy: -28.569 flat angles P-C4'-P energy: -19.597 tors. eta vs tors. theta energy: -27.671 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -342.309996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.309996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.426824 (E_RNA) where: Base-Base interactions energy: -212.632 where: short stacking energy: -116.596 Base-Backbone interact. energy: -0.143 local terms energy: -129.652049 where: bonds (distance) C4'-P energy: -26.197 bonds (distance) P-C4' energy: -25.787 flat angles C4'-P-C4' energy: -24.466 flat angles P-C4'-P energy: -19.465 tors. eta vs tors. theta energy: -33.737 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -335.807136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.807136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.807136 (E_RNA) where: Base-Base interactions energy: -215.398 where: short stacking energy: -113.934 Base-Backbone interact. energy: -0.155 local terms energy: -120.254490 where: bonds (distance) C4'-P energy: -21.025 bonds (distance) P-C4' energy: -27.570 flat angles C4'-P-C4' energy: -21.638 flat angles P-C4'-P energy: -17.553 tors. eta vs tors. theta energy: -32.468 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -336.001360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.001360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.001360 (E_RNA) where: Base-Base interactions energy: -217.684 where: short stacking energy: -93.769 Base-Backbone interact. energy: -0.750 local terms energy: -117.566915 where: bonds (distance) C4'-P energy: -25.522 bonds (distance) P-C4' energy: -20.668 flat angles C4'-P-C4' energy: -26.905 flat angles P-C4'-P energy: -15.985 tors. eta vs tors. theta energy: -28.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -282.265587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.265587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.447804 (E_RNA) where: Base-Base interactions energy: -175.016 where: short stacking energy: -96.450 Base-Backbone interact. energy: -1.062 local terms energy: -106.370208 where: bonds (distance) C4'-P energy: -20.940 bonds (distance) P-C4' energy: -24.076 flat angles C4'-P-C4' energy: -23.521 flat angles P-C4'-P energy: -17.302 tors. eta vs tors. theta energy: -20.531 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -231.282936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.282936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.282936 (E_RNA) where: Base-Base interactions energy: -138.209 where: short stacking energy: -69.114 Base-Backbone interact. energy: -0.340 local terms energy: -92.733244 where: bonds (distance) C4'-P energy: -23.632 bonds (distance) P-C4' energy: -18.867 flat angles C4'-P-C4' energy: -22.420 flat angles P-C4'-P energy: -12.997 tors. eta vs tors. theta energy: -14.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -260.088654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.088654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.088654 (E_RNA) where: Base-Base interactions energy: -174.626 where: short stacking energy: -80.185 Base-Backbone interact. energy: -0.447 local terms energy: -85.015532 where: bonds (distance) C4'-P energy: -21.910 bonds (distance) P-C4' energy: -18.169 flat angles C4'-P-C4' energy: -15.441 flat angles P-C4'-P energy: -8.397 tors. eta vs tors. theta energy: -21.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -163.544692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.544692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.619882 (E_RNA) where: Base-Base interactions energy: -78.809 where: short stacking energy: -41.523 Base-Backbone interact. energy: -0.270 local terms energy: -84.540582 where: bonds (distance) C4'-P energy: -25.635 bonds (distance) P-C4' energy: -22.853 flat angles C4'-P-C4' energy: -23.110 flat angles P-C4'-P energy: -12.516 tors. eta vs tors. theta energy: -0.426 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -162.002733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.002733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.002733 (E_RNA) where: Base-Base interactions energy: -77.272 where: short stacking energy: -43.106 Base-Backbone interact. energy: -0.351 local terms energy: -84.379525 where: bonds (distance) C4'-P energy: -23.532 bonds (distance) P-C4' energy: -21.591 flat angles C4'-P-C4' energy: -16.858 flat angles P-C4'-P energy: -13.679 tors. eta vs tors. theta energy: -8.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -157.091878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.091878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.214923 (E_RNA) where: Base-Base interactions energy: -84.319 where: short stacking energy: -49.373 Base-Backbone interact. energy: 1.146 local terms energy: -74.041871 where: bonds (distance) C4'-P energy: -16.744 bonds (distance) P-C4' energy: -23.567 flat angles C4'-P-C4' energy: -21.117 flat angles P-C4'-P energy: -12.874 tors. eta vs tors. theta energy: 0.260 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -380.248778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.248778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.248778 (E_RNA) where: Base-Base interactions energy: -265.496 where: short stacking energy: -119.532 Base-Backbone interact. energy: -1.533 local terms energy: -113.220495 where: bonds (distance) C4'-P energy: -22.571 bonds (distance) P-C4' energy: -20.735 flat angles C4'-P-C4' energy: -21.893 flat angles P-C4'-P energy: -16.382 tors. eta vs tors. theta energy: -31.639 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -349.930572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.930572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.930572 (E_RNA) where: Base-Base interactions energy: -235.006 where: short stacking energy: -118.552 Base-Backbone interact. energy: -1.083 local terms energy: -113.840861 where: bonds (distance) C4'-P energy: -17.393 bonds (distance) P-C4' energy: -22.238 flat angles C4'-P-C4' energy: -24.425 flat angles P-C4'-P energy: -17.237 tors. eta vs tors. theta energy: -32.548 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -338.179206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.179206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.179206 (E_RNA) where: Base-Base interactions energy: -219.165 where: short stacking energy: -108.011 Base-Backbone interact. energy: -0.130 local terms energy: -118.883765 where: bonds (distance) C4'-P energy: -22.362 bonds (distance) P-C4' energy: -20.329 flat angles C4'-P-C4' energy: -26.419 flat angles P-C4'-P energy: -15.164 tors. eta vs tors. theta energy: -34.610 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -340.464580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.464580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.464580 (E_RNA) where: Base-Base interactions energy: -227.714 where: short stacking energy: -105.396 Base-Backbone interact. energy: -1.536 local terms energy: -111.214480 where: bonds (distance) C4'-P energy: -25.142 bonds (distance) P-C4' energy: -22.447 flat angles C4'-P-C4' energy: -21.119 flat angles P-C4'-P energy: -15.977 tors. eta vs tors. theta energy: -26.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -279.437057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.437057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.686044 (E_RNA) where: Base-Base interactions energy: -175.950 where: short stacking energy: -88.648 Base-Backbone interact. energy: -0.769 local terms energy: -102.967467 where: bonds (distance) C4'-P energy: -23.367 bonds (distance) P-C4' energy: -20.127 flat angles C4'-P-C4' energy: -25.555 flat angles P-C4'-P energy: -13.214 tors. eta vs tors. theta energy: -20.705 Dist. restrs. and SS energy: 0.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -289.320641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.320641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.320641 (E_RNA) where: Base-Base interactions energy: -184.161 where: short stacking energy: -99.197 Base-Backbone interact. energy: -0.437 local terms energy: -104.722212 where: bonds (distance) C4'-P energy: -17.381 bonds (distance) P-C4' energy: -25.042 flat angles C4'-P-C4' energy: -18.685 flat angles P-C4'-P energy: -14.273 tors. eta vs tors. theta energy: -29.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -241.046681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.046681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.046681 (E_RNA) where: Base-Base interactions energy: -140.751 where: short stacking energy: -76.834 Base-Backbone interact. energy: -0.026 local terms energy: -100.268937 where: bonds (distance) C4'-P energy: -19.510 bonds (distance) P-C4' energy: -20.817 flat angles C4'-P-C4' energy: -20.344 flat angles P-C4'-P energy: -18.134 tors. eta vs tors. theta energy: -21.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -179.552942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.552942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.599238 (E_RNA) where: Base-Base interactions energy: -102.660 where: short stacking energy: -66.469 Base-Backbone interact. energy: -0.140 local terms energy: -76.799594 where: bonds (distance) C4'-P energy: -19.979 bonds (distance) P-C4' energy: -16.994 flat angles C4'-P-C4' energy: -22.611 flat angles P-C4'-P energy: -9.745 tors. eta vs tors. theta energy: -7.471 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -137.793247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.793247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.441249 (E_RNA) where: Base-Base interactions energy: -75.691 where: short stacking energy: -45.978 Base-Backbone interact. energy: -0.327 local terms energy: -62.424163 where: bonds (distance) C4'-P energy: -23.491 bonds (distance) P-C4' energy: -9.556 flat angles C4'-P-C4' energy: -19.882 flat angles P-C4'-P energy: -6.875 tors. eta vs tors. theta energy: -2.619 Dist. restrs. and SS energy: 0.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -171.205896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.205896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.345942 (E_RNA) where: Base-Base interactions energy: -99.560 where: short stacking energy: -64.807 Base-Backbone interact. energy: -0.898 local terms energy: -70.887723 where: bonds (distance) C4'-P energy: -14.689 bonds (distance) P-C4' energy: -18.371 flat angles C4'-P-C4' energy: -16.952 flat angles P-C4'-P energy: -11.157 tors. eta vs tors. theta energy: -9.719 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -376.074261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.074261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.122765 (E_RNA) where: Base-Base interactions energy: -260.987 where: short stacking energy: -116.948 Base-Backbone interact. energy: -0.927 local terms energy: -114.208570 where: bonds (distance) C4'-P energy: -22.833 bonds (distance) P-C4' energy: -21.232 flat angles C4'-P-C4' energy: -24.705 flat angles P-C4'-P energy: -18.532 tors. eta vs tors. theta energy: -26.906 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -343.344682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.344682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.349450 (E_RNA) where: Base-Base interactions energy: -220.331 where: short stacking energy: -109.514 Base-Backbone interact. energy: -0.871 local terms energy: -122.148119 where: bonds (distance) C4'-P energy: -21.364 bonds (distance) P-C4' energy: -21.751 flat angles C4'-P-C4' energy: -24.234 flat angles P-C4'-P energy: -19.786 tors. eta vs tors. theta energy: -35.013 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -351.862061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.862061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.862061 (E_RNA) where: Base-Base interactions energy: -230.791 where: short stacking energy: -110.438 Base-Backbone interact. energy: -1.293 local terms energy: -119.778487 where: bonds (distance) C4'-P energy: -24.363 bonds (distance) P-C4' energy: -22.050 flat angles C4'-P-C4' energy: -24.768 flat angles P-C4'-P energy: -17.792 tors. eta vs tors. theta energy: -30.805 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -335.207529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.207529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.207529 (E_RNA) where: Base-Base interactions energy: -218.302 where: short stacking energy: -109.792 Base-Backbone interact. energy: -0.475 local terms energy: -116.430887 where: bonds (distance) C4'-P energy: -19.129 bonds (distance) P-C4' energy: -27.974 flat angles C4'-P-C4' energy: -21.368 flat angles P-C4'-P energy: -15.592 tors. eta vs tors. theta energy: -32.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -311.498233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.498233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.499192 (E_RNA) where: Base-Base interactions energy: -203.265 where: short stacking energy: -107.348 Base-Backbone interact. energy: -0.380 local terms energy: -107.854863 where: bonds (distance) C4'-P energy: -16.592 bonds (distance) P-C4' energy: -23.520 flat angles C4'-P-C4' energy: -23.954 flat angles P-C4'-P energy: -10.856 tors. eta vs tors. theta energy: -32.932 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -244.894530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.894530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.919266 (E_RNA) where: Base-Base interactions energy: -148.745 where: short stacking energy: -71.706 Base-Backbone interact. energy: -0.400 local terms energy: -95.774569 where: bonds (distance) C4'-P energy: -25.168 bonds (distance) P-C4' energy: -22.388 flat angles C4'-P-C4' energy: -17.601 flat angles P-C4'-P energy: -16.653 tors. eta vs tors. theta energy: -13.964 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -229.142039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.142039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.142039 (E_RNA) where: Base-Base interactions energy: -125.462 where: short stacking energy: -77.272 Base-Backbone interact. energy: 0.196 local terms energy: -103.876023 where: bonds (distance) C4'-P energy: -22.372 bonds (distance) P-C4' energy: -26.456 flat angles C4'-P-C4' energy: -22.624 flat angles P-C4'-P energy: -16.526 tors. eta vs tors. theta energy: -15.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -182.259863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.259863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.340577 (E_RNA) where: Base-Base interactions energy: -104.141 where: short stacking energy: -49.902 Base-Backbone interact. energy: 1.615 local terms energy: -79.814252 where: bonds (distance) C4'-P energy: -22.478 bonds (distance) P-C4' energy: -19.750 flat angles C4'-P-C4' energy: -19.480 flat angles P-C4'-P energy: -10.158 tors. eta vs tors. theta energy: -7.948 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -201.847724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.847724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.862567 (E_RNA) where: Base-Base interactions energy: -127.995 where: short stacking energy: -67.403 Base-Backbone interact. energy: -1.012 local terms energy: -72.854967 where: bonds (distance) C4'-P energy: -19.745 bonds (distance) P-C4' energy: -15.871 flat angles C4'-P-C4' energy: -15.885 flat angles P-C4'-P energy: -9.661 tors. eta vs tors. theta energy: -11.693 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -123.972611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.972611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.961136 (E_RNA) where: Base-Base interactions energy: -50.108 where: short stacking energy: -41.226 Base-Backbone interact. energy: 0.115 local terms energy: -74.967260 where: bonds (distance) C4'-P energy: -19.609 bonds (distance) P-C4' energy: -21.390 flat angles C4'-P-C4' energy: -14.411 flat angles P-C4'-P energy: -16.752 tors. eta vs tors. theta energy: -2.807 Dist. restrs. and SS energy: 0.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -371.452835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.452835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.480412 (E_RNA) where: Base-Base interactions energy: -255.625 where: short stacking energy: -109.251 Base-Backbone interact. energy: -0.342 local terms energy: -115.513038 where: bonds (distance) C4'-P energy: -23.892 bonds (distance) P-C4' energy: -23.075 flat angles C4'-P-C4' energy: -23.817 flat angles P-C4'-P energy: -14.920 tors. eta vs tors. theta energy: -29.809 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -354.353859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.353859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.353859 (E_RNA) where: Base-Base interactions energy: -233.502 where: short stacking energy: -114.459 Base-Backbone interact. energy: -0.096 local terms energy: -120.755756 where: bonds (distance) C4'-P energy: -21.142 bonds (distance) P-C4' energy: -25.404 flat angles C4'-P-C4' energy: -25.396 flat angles P-C4'-P energy: -17.274 tors. eta vs tors. theta energy: -31.539 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -356.897995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.897995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.922482 (E_RNA) where: Base-Base interactions energy: -240.560 where: short stacking energy: -106.213 Base-Backbone interact. energy: 0.226 local terms energy: -116.588240 where: bonds (distance) C4'-P energy: -23.072 bonds (distance) P-C4' energy: -24.420 flat angles C4'-P-C4' energy: -24.188 flat angles P-C4'-P energy: -17.249 tors. eta vs tors. theta energy: -27.660 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -313.582323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.582323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.582323 (E_RNA) where: Base-Base interactions energy: -195.464 where: short stacking energy: -98.870 Base-Backbone interact. energy: -0.462 local terms energy: -117.656139 where: bonds (distance) C4'-P energy: -21.056 bonds (distance) P-C4' energy: -25.215 flat angles C4'-P-C4' energy: -25.241 flat angles P-C4'-P energy: -16.285 tors. eta vs tors. theta energy: -29.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -297.406138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.406138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.406138 (E_RNA) where: Base-Base interactions energy: -192.084 where: short stacking energy: -103.641 Base-Backbone interact. energy: 0.582 local terms energy: -105.903953 where: bonds (distance) C4'-P energy: -21.106 bonds (distance) P-C4' energy: -23.706 flat angles C4'-P-C4' energy: -15.500 flat angles P-C4'-P energy: -16.609 tors. eta vs tors. theta energy: -28.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -247.624635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.624635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.645556 (E_RNA) where: Base-Base interactions energy: -152.857 where: short stacking energy: -76.481 Base-Backbone interact. energy: -1.055 local terms energy: -93.733550 where: bonds (distance) C4'-P energy: -21.540 bonds (distance) P-C4' energy: -24.018 flat angles C4'-P-C4' energy: -19.967 flat angles P-C4'-P energy: -18.548 tors. eta vs tors. theta energy: -9.661 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -240.808024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.808024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.858923 (E_RNA) where: Base-Base interactions energy: -144.930 where: short stacking energy: -74.991 Base-Backbone interact. energy: -0.672 local terms energy: -95.257616 where: bonds (distance) C4'-P energy: -21.637 bonds (distance) P-C4' energy: -19.109 flat angles C4'-P-C4' energy: -23.331 flat angles P-C4'-P energy: -10.279 tors. eta vs tors. theta energy: -20.901 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -193.196030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.196030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.196030 (E_RNA) where: Base-Base interactions energy: -103.262 where: short stacking energy: -68.137 Base-Backbone interact. energy: -0.010 local terms energy: -89.924574 where: bonds (distance) C4'-P energy: -19.451 bonds (distance) P-C4' energy: -25.563 flat angles C4'-P-C4' energy: -14.822 flat angles P-C4'-P energy: -15.174 tors. eta vs tors. theta energy: -14.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -229.191808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.191808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.191808 (E_RNA) where: Base-Base interactions energy: -136.069 where: short stacking energy: -62.964 Base-Backbone interact. energy: -0.692 local terms energy: -92.430933 where: bonds (distance) C4'-P energy: -26.844 bonds (distance) P-C4' energy: -21.837 flat angles C4'-P-C4' energy: -13.081 flat angles P-C4'-P energy: -15.122 tors. eta vs tors. theta energy: -15.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -154.469539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.469539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.493029 (E_RNA) where: Base-Base interactions energy: -72.951 where: short stacking energy: -48.468 Base-Backbone interact. energy: -0.744 local terms energy: -80.798108 where: bonds (distance) C4'-P energy: -17.350 bonds (distance) P-C4' energy: -24.045 flat angles C4'-P-C4' energy: -23.179 flat angles P-C4'-P energy: -9.872 tors. eta vs tors. theta energy: -6.351 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -371.105336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.105336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.105336 (E_RNA) where: Base-Base interactions energy: -255.646 where: short stacking energy: -116.091 Base-Backbone interact. energy: -0.470 local terms energy: -114.988918 where: bonds (distance) C4'-P energy: -25.617 bonds (distance) P-C4' energy: -25.052 flat angles C4'-P-C4' energy: -18.800 flat angles P-C4'-P energy: -16.669 tors. eta vs tors. theta energy: -28.851 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -353.715829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.715829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.755891 (E_RNA) where: Base-Base interactions energy: -232.212 where: short stacking energy: -119.170 Base-Backbone interact. energy: -0.596 local terms energy: -120.947686 where: bonds (distance) C4'-P energy: -21.938 bonds (distance) P-C4' energy: -24.285 flat angles C4'-P-C4' energy: -28.075 flat angles P-C4'-P energy: -13.834 tors. eta vs tors. theta energy: -32.815 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -356.267993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.267993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.270143 (E_RNA) where: Base-Base interactions energy: -237.183 where: short stacking energy: -112.640 Base-Backbone interact. energy: -1.411 local terms energy: -117.676895 where: bonds (distance) C4'-P energy: -19.387 bonds (distance) P-C4' energy: -23.469 flat angles C4'-P-C4' energy: -27.367 flat angles P-C4'-P energy: -14.016 tors. eta vs tors. theta energy: -33.438 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -342.180212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.180212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.231892 (E_RNA) where: Base-Base interactions energy: -222.219 where: short stacking energy: -107.135 Base-Backbone interact. energy: -0.812 local terms energy: -119.200849 where: bonds (distance) C4'-P energy: -24.069 bonds (distance) P-C4' energy: -21.547 flat angles C4'-P-C4' energy: -25.124 flat angles P-C4'-P energy: -16.547 tors. eta vs tors. theta energy: -31.913 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -315.410518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.410518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.439992 (E_RNA) where: Base-Base interactions energy: -210.902 where: short stacking energy: -106.671 Base-Backbone interact. energy: -0.625 local terms energy: -103.912206 where: bonds (distance) C4'-P energy: -23.168 bonds (distance) P-C4' energy: -18.806 flat angles C4'-P-C4' energy: -18.529 flat angles P-C4'-P energy: -16.495 tors. eta vs tors. theta energy: -26.914 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -243.798696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.798696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.820466 (E_RNA) where: Base-Base interactions energy: -152.043 where: short stacking energy: -73.900 Base-Backbone interact. energy: -0.458 local terms energy: -91.320076 where: bonds (distance) C4'-P energy: -19.856 bonds (distance) P-C4' energy: -21.230 flat angles C4'-P-C4' energy: -20.779 flat angles P-C4'-P energy: -15.882 tors. eta vs tors. theta energy: -13.573 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -229.443099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.443099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.446071 (E_RNA) where: Base-Base interactions energy: -137.203 where: short stacking energy: -71.843 Base-Backbone interact. energy: 1.249 local terms energy: -93.492616 where: bonds (distance) C4'-P energy: -23.458 bonds (distance) P-C4' energy: -22.149 flat angles C4'-P-C4' energy: -15.992 flat angles P-C4'-P energy: -16.642 tors. eta vs tors. theta energy: -15.252 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -179.907047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.907047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.907047 (E_RNA) where: Base-Base interactions energy: -96.165 where: short stacking energy: -50.704 Base-Backbone interact. energy: -1.764 local terms energy: -81.978071 where: bonds (distance) C4'-P energy: -25.503 bonds (distance) P-C4' energy: -16.123 flat angles C4'-P-C4' energy: -24.029 flat angles P-C4'-P energy: -12.056 tors. eta vs tors. theta energy: -4.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -207.236999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.236999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.421144 (E_RNA) where: Base-Base interactions energy: -125.563 where: short stacking energy: -65.137 Base-Backbone interact. energy: -1.886 local terms energy: -79.971286 where: bonds (distance) C4'-P energy: -15.588 bonds (distance) P-C4' energy: -15.185 flat angles C4'-P-C4' energy: -18.633 flat angles P-C4'-P energy: -19.468 tors. eta vs tors. theta energy: -11.096 Dist. restrs. and SS energy: 0.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -127.737898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.737898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.855695 (E_RNA) where: Base-Base interactions energy: -65.567 where: short stacking energy: -40.587 Base-Backbone interact. energy: -1.130 local terms energy: -61.158093 where: bonds (distance) C4'-P energy: -17.757 bonds (distance) P-C4' energy: -17.655 flat angles C4'-P-C4' energy: -22.049 flat angles P-C4'-P energy: -5.561 tors. eta vs tors. theta energy: 1.864 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -370.042581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.042581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.074581 (E_RNA) where: Base-Base interactions energy: -240.636 where: short stacking energy: -115.914 Base-Backbone interact. energy: -4.037 local terms energy: -125.401586 where: bonds (distance) C4'-P energy: -24.072 bonds (distance) P-C4' energy: -26.370 flat angles C4'-P-C4' energy: -28.426 flat angles P-C4'-P energy: -14.256 tors. eta vs tors. theta energy: -32.279 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -363.079060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.079060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.079060 (E_RNA) where: Base-Base interactions energy: -232.720 where: short stacking energy: -126.171 Base-Backbone interact. energy: -0.583 local terms energy: -129.776178 where: bonds (distance) C4'-P energy: -23.589 bonds (distance) P-C4' energy: -26.364 flat angles C4'-P-C4' energy: -23.690 flat angles P-C4'-P energy: -19.300 tors. eta vs tors. theta energy: -36.834 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -367.044821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.044821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.269313 (E_RNA) where: Base-Base interactions energy: -244.270 where: short stacking energy: -117.718 Base-Backbone interact. energy: -0.579 local terms energy: -122.420864 where: bonds (distance) C4'-P energy: -23.194 bonds (distance) P-C4' energy: -22.196 flat angles C4'-P-C4' energy: -25.559 flat angles P-C4'-P energy: -18.671 tors. eta vs tors. theta energy: -32.801 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -333.567122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.567122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.567122 (E_RNA) where: Base-Base interactions energy: -217.109 where: short stacking energy: -102.053 Base-Backbone interact. energy: -0.263 local terms energy: -116.194362 where: bonds (distance) C4'-P energy: -22.219 bonds (distance) P-C4' energy: -21.933 flat angles C4'-P-C4' energy: -24.775 flat angles P-C4'-P energy: -19.053 tors. eta vs tors. theta energy: -28.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -295.864758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.864758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.864758 (E_RNA) where: Base-Base interactions energy: -182.529 where: short stacking energy: -94.055 Base-Backbone interact. energy: -1.486 local terms energy: -111.849338 where: bonds (distance) C4'-P energy: -21.878 bonds (distance) P-C4' energy: -21.619 flat angles C4'-P-C4' energy: -24.185 flat angles P-C4'-P energy: -19.055 tors. eta vs tors. theta energy: -25.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -231.983996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.983996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.996952 (E_RNA) where: Base-Base interactions energy: -143.695 where: short stacking energy: -72.343 Base-Backbone interact. energy: -0.833 local terms energy: -87.469640 where: bonds (distance) C4'-P energy: -14.124 bonds (distance) P-C4' energy: -24.208 flat angles C4'-P-C4' energy: -20.524 flat angles P-C4'-P energy: -16.574 tors. eta vs tors. theta energy: -12.040 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -214.321366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.321366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.321366 (E_RNA) where: Base-Base interactions energy: -120.048 where: short stacking energy: -76.882 Base-Backbone interact. energy: 2.992 local terms energy: -97.265887 where: bonds (distance) C4'-P energy: -17.581 bonds (distance) P-C4' energy: -27.959 flat angles C4'-P-C4' energy: -24.525 flat angles P-C4'-P energy: -15.957 tors. eta vs tors. theta energy: -11.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -185.684640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.684640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.748162 (E_RNA) where: Base-Base interactions energy: -96.943 where: short stacking energy: -60.020 Base-Backbone interact. energy: -0.733 local terms energy: -88.072481 where: bonds (distance) C4'-P energy: -19.147 bonds (distance) P-C4' energy: -27.100 flat angles C4'-P-C4' energy: -18.673 flat angles P-C4'-P energy: -9.845 tors. eta vs tors. theta energy: -13.307 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -163.104081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.104081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.105268 (E_RNA) where: Base-Base interactions energy: -87.480 where: short stacking energy: -52.781 Base-Backbone interact. energy: -0.616 local terms energy: -75.008660 where: bonds (distance) C4'-P energy: -19.165 bonds (distance) P-C4' energy: -21.692 flat angles C4'-P-C4' energy: -16.656 flat angles P-C4'-P energy: -12.489 tors. eta vs tors. theta energy: -5.006 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -151.654004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.654004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.654004 (E_RNA) where: Base-Base interactions energy: -75.309 where: short stacking energy: -52.494 Base-Backbone interact. energy: -0.467 local terms energy: -75.878271 where: bonds (distance) C4'-P energy: -11.934 bonds (distance) P-C4' energy: -22.698 flat angles C4'-P-C4' energy: -20.344 flat angles P-C4'-P energy: -17.939 tors. eta vs tors. theta energy: -2.964 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -368.037306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.037306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.037306 (E_RNA) where: Base-Base interactions energy: -239.552 where: short stacking energy: -123.803 Base-Backbone interact. energy: -0.289 local terms energy: -128.195681 where: bonds (distance) C4'-P energy: -22.574 bonds (distance) P-C4' energy: -27.457 flat angles C4'-P-C4' energy: -21.915 flat angles P-C4'-P energy: -18.567 tors. eta vs tors. theta energy: -37.682 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -363.475244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.475244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.599717 (E_RNA) where: Base-Base interactions energy: -239.372 where: short stacking energy: -107.097 Base-Backbone interact. energy: -0.237 local terms energy: -123.991227 where: bonds (distance) C4'-P energy: -27.162 bonds (distance) P-C4' energy: -20.846 flat angles C4'-P-C4' energy: -25.962 flat angles P-C4'-P energy: -18.406 tors. eta vs tors. theta energy: -31.614 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -362.503532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.503532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.568985 (E_RNA) where: Base-Base interactions energy: -239.014 where: short stacking energy: -109.914 Base-Backbone interact. energy: -0.232 local terms energy: -123.323027 where: bonds (distance) C4'-P energy: -23.425 bonds (distance) P-C4' energy: -24.897 flat angles C4'-P-C4' energy: -25.473 flat angles P-C4'-P energy: -18.793 tors. eta vs tors. theta energy: -30.735 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -341.891805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.891805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.940777 (E_RNA) where: Base-Base interactions energy: -226.586 where: short stacking energy: -110.883 Base-Backbone interact. energy: -0.196 local terms energy: -115.159437 where: bonds (distance) C4'-P energy: -24.023 bonds (distance) P-C4' energy: -23.566 flat angles C4'-P-C4' energy: -20.429 flat angles P-C4'-P energy: -16.073 tors. eta vs tors. theta energy: -31.069 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -287.554758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.554758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.554758 (E_RNA) where: Base-Base interactions energy: -179.964 where: short stacking energy: -90.031 Base-Backbone interact. energy: -0.709 local terms energy: -106.881340 where: bonds (distance) C4'-P energy: -21.259 bonds (distance) P-C4' energy: -19.794 flat angles C4'-P-C4' energy: -26.053 flat angles P-C4'-P energy: -18.593 tors. eta vs tors. theta energy: -21.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -243.110481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.110481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.118135 (E_RNA) where: Base-Base interactions energy: -146.390 where: short stacking energy: -82.670 Base-Backbone interact. energy: 0.468 local terms energy: -97.196335 where: bonds (distance) C4'-P energy: -24.218 bonds (distance) P-C4' energy: -23.372 flat angles C4'-P-C4' energy: -22.142 flat angles P-C4'-P energy: -11.365 tors. eta vs tors. theta energy: -16.100 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -210.857236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.857236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.857236 (E_RNA) where: Base-Base interactions energy: -118.422 where: short stacking energy: -77.052 Base-Backbone interact. energy: -1.347 local terms energy: -91.088202 where: bonds (distance) C4'-P energy: -24.496 bonds (distance) P-C4' energy: -17.662 flat angles C4'-P-C4' energy: -22.558 flat angles P-C4'-P energy: -15.022 tors. eta vs tors. theta energy: -11.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -186.001991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.001991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.001991 (E_RNA) where: Base-Base interactions energy: -90.340 where: short stacking energy: -55.522 Base-Backbone interact. energy: -0.840 local terms energy: -94.822095 where: bonds (distance) C4'-P energy: -18.431 bonds (distance) P-C4' energy: -19.325 flat angles C4'-P-C4' energy: -27.377 flat angles P-C4'-P energy: -16.687 tors. eta vs tors. theta energy: -13.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -151.654220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.654220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.823193 (E_RNA) where: Base-Base interactions energy: -66.437 where: short stacking energy: -48.896 Base-Backbone interact. energy: -0.084 local terms energy: -85.302422 where: bonds (distance) C4'-P energy: -20.433 bonds (distance) P-C4' energy: -20.884 flat angles C4'-P-C4' energy: -20.419 flat angles P-C4'-P energy: -10.821 tors. eta vs tors. theta energy: -12.746 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -163.484508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.484508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.484508 (E_RNA) where: Base-Base interactions energy: -89.382 where: short stacking energy: -61.670 Base-Backbone interact. energy: -0.435 local terms energy: -73.667319 where: bonds (distance) C4'-P energy: -18.768 bonds (distance) P-C4' energy: -16.212 flat angles C4'-P-C4' energy: -18.347 flat angles P-C4'-P energy: -10.832 tors. eta vs tors. theta energy: -9.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -378.932536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.932536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.932536 (E_RNA) where: Base-Base interactions energy: -244.147 where: short stacking energy: -123.692 Base-Backbone interact. energy: -0.105 local terms energy: -134.680936 where: bonds (distance) C4'-P energy: -24.244 bonds (distance) P-C4' energy: -24.052 flat angles C4'-P-C4' energy: -27.979 flat angles P-C4'-P energy: -17.726 tors. eta vs tors. theta energy: -40.680 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -366.479320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.479320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.528243 (E_RNA) where: Base-Base interactions energy: -240.757 where: short stacking energy: -123.599 Base-Backbone interact. energy: -0.162 local terms energy: -125.608937 where: bonds (distance) C4'-P energy: -23.747 bonds (distance) P-C4' energy: -20.189 flat angles C4'-P-C4' energy: -27.345 flat angles P-C4'-P energy: -19.073 tors. eta vs tors. theta energy: -35.254 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -351.098602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.098602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.098602 (E_RNA) where: Base-Base interactions energy: -235.718 where: short stacking energy: -103.033 Base-Backbone interact. energy: -0.090 local terms energy: -115.290934 where: bonds (distance) C4'-P energy: -23.957 bonds (distance) P-C4' energy: -23.379 flat angles C4'-P-C4' energy: -20.077 flat angles P-C4'-P energy: -20.054 tors. eta vs tors. theta energy: -27.823 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -340.935084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.935084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.935084 (E_RNA) where: Base-Base interactions energy: -223.552 where: short stacking energy: -108.900 Base-Backbone interact. energy: -0.109 local terms energy: -117.273898 where: bonds (distance) C4'-P energy: -24.901 bonds (distance) P-C4' energy: -21.819 flat angles C4'-P-C4' energy: -21.749 flat angles P-C4'-P energy: -15.464 tors. eta vs tors. theta energy: -33.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -302.393401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.393401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.533434 (E_RNA) where: Base-Base interactions energy: -195.270 where: short stacking energy: -82.403 Base-Backbone interact. energy: -0.834 local terms energy: -106.429873 where: bonds (distance) C4'-P energy: -25.785 bonds (distance) P-C4' energy: -17.371 flat angles C4'-P-C4' energy: -24.784 flat angles P-C4'-P energy: -19.236 tors. eta vs tors. theta energy: -19.254 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -249.943640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.943640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.051284 (E_RNA) where: Base-Base interactions energy: -147.066 where: short stacking energy: -86.670 Base-Backbone interact. energy: -0.705 local terms energy: -102.279662 where: bonds (distance) C4'-P energy: -17.930 bonds (distance) P-C4' energy: -21.325 flat angles C4'-P-C4' energy: -25.634 flat angles P-C4'-P energy: -17.737 tors. eta vs tors. theta energy: -19.653 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -196.325487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.325487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.373613 (E_RNA) where: Base-Base interactions energy: -110.132 where: short stacking energy: -59.318 Base-Backbone interact. energy: -0.078 local terms energy: -86.163940 where: bonds (distance) C4'-P energy: -26.649 bonds (distance) P-C4' energy: -24.291 flat angles C4'-P-C4' energy: -11.249 flat angles P-C4'-P energy: -14.897 tors. eta vs tors. theta energy: -9.077 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -190.751845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.751845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.113412 (E_RNA) where: Base-Base interactions energy: -107.818 where: short stacking energy: -73.257 Base-Backbone interact. energy: 0.061 local terms energy: -83.356929 where: bonds (distance) C4'-P energy: -22.379 bonds (distance) P-C4' energy: -22.163 flat angles C4'-P-C4' energy: -16.801 flat angles P-C4'-P energy: -10.594 tors. eta vs tors. theta energy: -11.420 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -187.017633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.017633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.017633 (E_RNA) where: Base-Base interactions energy: -93.664 where: short stacking energy: -62.433 Base-Backbone interact. energy: -0.329 local terms energy: -93.024657 where: bonds (distance) C4'-P energy: -21.637 bonds (distance) P-C4' energy: -19.638 flat angles C4'-P-C4' energy: -25.980 flat angles P-C4'-P energy: -12.976 tors. eta vs tors. theta energy: -12.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -161.841269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.841269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.855078 (E_RNA) where: Base-Base interactions energy: -84.139 where: short stacking energy: -51.613 Base-Backbone interact. energy: -0.345 local terms energy: -77.371092 where: bonds (distance) C4'-P energy: -14.854 bonds (distance) P-C4' energy: -24.583 flat angles C4'-P-C4' energy: -18.321 flat angles P-C4'-P energy: -17.005 tors. eta vs tors. theta energy: -2.607 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -375.272094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.272094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.272094 (E_RNA) where: Base-Base interactions energy: -243.760 where: short stacking energy: -121.803 Base-Backbone interact. energy: -0.020 local terms energy: -131.491915 where: bonds (distance) C4'-P energy: -23.358 bonds (distance) P-C4' energy: -25.664 flat angles C4'-P-C4' energy: -24.247 flat angles P-C4'-P energy: -19.017 tors. eta vs tors. theta energy: -39.205 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -368.623873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.623873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.625745 (E_RNA) where: Base-Base interactions energy: -242.554 where: short stacking energy: -123.929 Base-Backbone interact. energy: -0.358 local terms energy: -125.713667 where: bonds (distance) C4'-P energy: -24.505 bonds (distance) P-C4' energy: -22.792 flat angles C4'-P-C4' energy: -26.493 flat angles P-C4'-P energy: -14.201 tors. eta vs tors. theta energy: -37.723 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -332.708680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.708680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.761314 (E_RNA) where: Base-Base interactions energy: -215.486 where: short stacking energy: -103.804 Base-Backbone interact. energy: -0.614 local terms energy: -116.661282 where: bonds (distance) C4'-P energy: -22.145 bonds (distance) P-C4' energy: -21.503 flat angles C4'-P-C4' energy: -28.474 flat angles P-C4'-P energy: -11.029 tors. eta vs tors. theta energy: -33.511 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -352.546245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.546245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.546245 (E_RNA) where: Base-Base interactions energy: -240.989 where: short stacking energy: -111.086 Base-Backbone interact. energy: -0.857 local terms energy: -110.700341 where: bonds (distance) C4'-P energy: -19.057 bonds (distance) P-C4' energy: -22.305 flat angles C4'-P-C4' energy: -23.243 flat angles P-C4'-P energy: -18.353 tors. eta vs tors. theta energy: -27.743 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -320.671447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.671447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.671447 (E_RNA) where: Base-Base interactions energy: -211.584 where: short stacking energy: -100.989 Base-Backbone interact. energy: -1.064 local terms energy: -108.023291 where: bonds (distance) C4'-P energy: -21.691 bonds (distance) P-C4' energy: -25.395 flat angles C4'-P-C4' energy: -19.194 flat angles P-C4'-P energy: -13.351 tors. eta vs tors. theta energy: -28.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -276.334936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.334936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.389427 (E_RNA) where: Base-Base interactions energy: -170.131 where: short stacking energy: -84.405 Base-Backbone interact. energy: -0.757 local terms energy: -105.501303 where: bonds (distance) C4'-P energy: -26.116 bonds (distance) P-C4' energy: -21.607 flat angles C4'-P-C4' energy: -25.143 flat angles P-C4'-P energy: -16.122 tors. eta vs tors. theta energy: -16.512 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -189.132457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.132457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.198215 (E_RNA) where: Base-Base interactions energy: -94.914 where: short stacking energy: -59.193 Base-Backbone interact. energy: -0.598 local terms energy: -93.685691 where: bonds (distance) C4'-P energy: -25.145 bonds (distance) P-C4' energy: -26.968 flat angles C4'-P-C4' energy: -16.895 flat angles P-C4'-P energy: -14.369 tors. eta vs tors. theta energy: -10.308 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -206.001218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.001218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.184052 (E_RNA) where: Base-Base interactions energy: -119.095 where: short stacking energy: -67.710 Base-Backbone interact. energy: -0.377 local terms energy: -86.711865 where: bonds (distance) C4'-P energy: -21.195 bonds (distance) P-C4' energy: -24.442 flat angles C4'-P-C4' energy: -16.257 flat angles P-C4'-P energy: -4.230 tors. eta vs tors. theta energy: -20.588 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -164.574169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.574169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.585984 (E_RNA) where: Base-Base interactions energy: -92.708 where: short stacking energy: -55.536 Base-Backbone interact. energy: -0.570 local terms energy: -71.307003 where: bonds (distance) C4'-P energy: -19.296 bonds (distance) P-C4' energy: -22.399 flat angles C4'-P-C4' energy: -14.077 flat angles P-C4'-P energy: -11.844 tors. eta vs tors. theta energy: -3.690 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -160.788051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.788051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.788051 (E_RNA) where: Base-Base interactions energy: -96.114 where: short stacking energy: -59.015 Base-Backbone interact. energy: -0.233 local terms energy: -64.440868 where: bonds (distance) C4'-P energy: -19.613 bonds (distance) P-C4' energy: -15.927 flat angles C4'-P-C4' energy: -17.833 flat angles P-C4'-P energy: -9.683 tors. eta vs tors. theta energy: -1.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -380.434703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.434703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.434703 (E_RNA) where: Base-Base interactions energy: -251.541 where: short stacking energy: -124.263 Base-Backbone interact. energy: -0.205 local terms energy: -128.688944 where: bonds (distance) C4'-P energy: -22.626 bonds (distance) P-C4' energy: -25.666 flat angles C4'-P-C4' energy: -26.974 flat angles P-C4'-P energy: -19.082 tors. eta vs tors. theta energy: -34.341 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -364.215306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.215306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.215306 (E_RNA) where: Base-Base interactions energy: -234.930 where: short stacking energy: -130.756 Base-Backbone interact. energy: -0.853 local terms energy: -128.432389 where: bonds (distance) C4'-P energy: -18.863 bonds (distance) P-C4' energy: -23.410 flat angles C4'-P-C4' energy: -28.410 flat angles P-C4'-P energy: -18.657 tors. eta vs tors. theta energy: -39.092 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -329.517998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.517998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.561415 (E_RNA) where: Base-Base interactions energy: -224.371 where: short stacking energy: -104.822 Base-Backbone interact. energy: -0.456 local terms energy: -104.733973 where: bonds (distance) C4'-P energy: -14.430 bonds (distance) P-C4' energy: -19.247 flat angles C4'-P-C4' energy: -27.452 flat angles P-C4'-P energy: -14.547 tors. eta vs tors. theta energy: -29.058 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -334.458761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.458761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.458761 (E_RNA) where: Base-Base interactions energy: -228.103 where: short stacking energy: -101.013 Base-Backbone interact. energy: 0.104 local terms energy: -106.459314 where: bonds (distance) C4'-P energy: -25.072 bonds (distance) P-C4' energy: -18.082 flat angles C4'-P-C4' energy: -21.454 flat angles P-C4'-P energy: -20.084 tors. eta vs tors. theta energy: -21.767 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -320.613310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.613310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.613310 (E_RNA) where: Base-Base interactions energy: -213.921 where: short stacking energy: -101.042 Base-Backbone interact. energy: -0.912 local terms energy: -105.780734 where: bonds (distance) C4'-P energy: -18.369 bonds (distance) P-C4' energy: -24.039 flat angles C4'-P-C4' energy: -27.133 flat angles P-C4'-P energy: -12.707 tors. eta vs tors. theta energy: -23.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -208.177554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.177554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.177554 (E_RNA) where: Base-Base interactions energy: -126.320 where: short stacking energy: -68.579 Base-Backbone interact. energy: -0.391 local terms energy: -81.466253 where: bonds (distance) C4'-P energy: -19.940 bonds (distance) P-C4' energy: -22.536 flat angles C4'-P-C4' energy: -16.047 flat angles P-C4'-P energy: -10.501 tors. eta vs tors. theta energy: -12.443 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -253.769600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.769600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.812146 (E_RNA) where: Base-Base interactions energy: -149.786 where: short stacking energy: -81.991 Base-Backbone interact. energy: -0.530 local terms energy: -103.496118 where: bonds (distance) C4'-P energy: -23.885 bonds (distance) P-C4' energy: -20.482 flat angles C4'-P-C4' energy: -25.164 flat angles P-C4'-P energy: -14.513 tors. eta vs tors. theta energy: -19.452 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -209.399988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.399988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.399988 (E_RNA) where: Base-Base interactions energy: -122.617 where: short stacking energy: -63.353 Base-Backbone interact. energy: 0.019 local terms energy: -86.801746 where: bonds (distance) C4'-P energy: -19.981 bonds (distance) P-C4' energy: -16.824 flat angles C4'-P-C4' energy: -23.019 flat angles P-C4'-P energy: -14.478 tors. eta vs tors. theta energy: -12.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -150.304800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.304800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.304800 (E_RNA) where: Base-Base interactions energy: -84.096 where: short stacking energy: -44.973 Base-Backbone interact. energy: -1.277 local terms energy: -64.931894 where: bonds (distance) C4'-P energy: -16.150 bonds (distance) P-C4' energy: -23.800 flat angles C4'-P-C4' energy: -17.535 flat angles P-C4'-P energy: -2.900 tors. eta vs tors. theta energy: -4.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -150.965757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.965757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.007896 (E_RNA) where: Base-Base interactions energy: -81.193 where: short stacking energy: -40.050 Base-Backbone interact. energy: -0.644 local terms energy: -69.171659 where: bonds (distance) C4'-P energy: -16.734 bonds (distance) P-C4' energy: -24.079 flat angles C4'-P-C4' energy: -18.280 flat angles P-C4'-P energy: -7.955 tors. eta vs tors. theta energy: -2.124 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -379.231678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.231678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.239146 (E_RNA) where: Base-Base interactions energy: -236.129 where: short stacking energy: -118.540 Base-Backbone interact. energy: -0.517 local terms energy: -142.592643 where: bonds (distance) C4'-P energy: -25.929 bonds (distance) P-C4' energy: -27.109 flat angles C4'-P-C4' energy: -28.410 flat angles P-C4'-P energy: -21.449 tors. eta vs tors. theta energy: -39.695 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -369.284033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.284033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.284033 (E_RNA) where: Base-Base interactions energy: -244.428 where: short stacking energy: -122.542 Base-Backbone interact. energy: -0.753 local terms energy: -124.103043 where: bonds (distance) C4'-P energy: -27.770 bonds (distance) P-C4' energy: -23.018 flat angles C4'-P-C4' energy: -20.875 flat angles P-C4'-P energy: -16.201 tors. eta vs tors. theta energy: -36.239 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -351.840663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.840663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.840663 (E_RNA) where: Base-Base interactions energy: -229.932 where: short stacking energy: -97.779 Base-Backbone interact. energy: -1.913 local terms energy: -119.995440 where: bonds (distance) C4'-P energy: -26.570 bonds (distance) P-C4' energy: -24.517 flat angles C4'-P-C4' energy: -22.882 flat angles P-C4'-P energy: -17.238 tors. eta vs tors. theta energy: -28.789 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -341.627892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.627892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.627892 (E_RNA) where: Base-Base interactions energy: -226.756 where: short stacking energy: -114.424 Base-Backbone interact. energy: -2.301 local terms energy: -112.570646 where: bonds (distance) C4'-P energy: -22.090 bonds (distance) P-C4' energy: -19.460 flat angles C4'-P-C4' energy: -24.780 flat angles P-C4'-P energy: -13.408 tors. eta vs tors. theta energy: -32.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -330.765189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.765189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.765189 (E_RNA) where: Base-Base interactions energy: -212.273 where: short stacking energy: -116.467 Base-Backbone interact. energy: -0.009 local terms energy: -118.483664 where: bonds (distance) C4'-P energy: -18.662 bonds (distance) P-C4' energy: -18.170 flat angles C4'-P-C4' energy: -26.535 flat angles P-C4'-P energy: -17.257 tors. eta vs tors. theta energy: -37.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -209.724853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.724853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.740300 (E_RNA) where: Base-Base interactions energy: -119.909 where: short stacking energy: -65.940 Base-Backbone interact. energy: -0.616 local terms energy: -89.215438 where: bonds (distance) C4'-P energy: -15.932 bonds (distance) P-C4' energy: -22.450 flat angles C4'-P-C4' energy: -25.128 flat angles P-C4'-P energy: -14.792 tors. eta vs tors. theta energy: -10.914 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -226.269882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.269882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.269882 (E_RNA) where: Base-Base interactions energy: -127.184 where: short stacking energy: -71.582 Base-Backbone interact. energy: 1.722 local terms energy: -100.807666 where: bonds (distance) C4'-P energy: -23.972 bonds (distance) P-C4' energy: -23.251 flat angles C4'-P-C4' energy: -20.796 flat angles P-C4'-P energy: -17.460 tors. eta vs tors. theta energy: -15.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -140.831350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.831350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.572279 (E_RNA) where: Base-Base interactions energy: -73.932 where: short stacking energy: -52.538 Base-Backbone interact. energy: -0.379 local terms energy: -73.261838 where: bonds (distance) C4'-P energy: -18.708 bonds (distance) P-C4' energy: -27.784 flat angles C4'-P-C4' energy: -16.678 flat angles P-C4'-P energy: -11.949 tors. eta vs tors. theta energy: 1.857 Dist. restrs. and SS energy: 6.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -145.560364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.560364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.227283 (E_RNA) where: Base-Base interactions energy: -70.155 where: short stacking energy: -49.097 Base-Backbone interact. energy: -0.178 local terms energy: -75.894672 where: bonds (distance) C4'-P energy: -17.002 bonds (distance) P-C4' energy: -18.479 flat angles C4'-P-C4' energy: -15.880 flat angles P-C4'-P energy: -18.993 tors. eta vs tors. theta energy: -5.541 Dist. restrs. and SS energy: 0.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -172.055131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.055131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.055131 (E_RNA) where: Base-Base interactions energy: -101.662 where: short stacking energy: -51.408 Base-Backbone interact. energy: -0.099 local terms energy: -70.294860 where: bonds (distance) C4'-P energy: -23.185 bonds (distance) P-C4' energy: -21.971 flat angles C4'-P-C4' energy: -15.747 flat angles P-C4'-P energy: -6.345 tors. eta vs tors. theta energy: -3.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -371.753188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.753188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.759212 (E_RNA) where: Base-Base interactions energy: -238.676 where: short stacking energy: -120.602 Base-Backbone interact. energy: -0.837 local terms energy: -132.246703 where: bonds (distance) C4'-P energy: -22.439 bonds (distance) P-C4' energy: -24.247 flat angles C4'-P-C4' energy: -25.640 flat angles P-C4'-P energy: -20.268 tors. eta vs tors. theta energy: -39.652 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -367.413167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.413167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.677547 (E_RNA) where: Base-Base interactions energy: -238.561 where: short stacking energy: -120.670 Base-Backbone interact. energy: -0.173 local terms energy: -128.943021 where: bonds (distance) C4'-P energy: -21.490 bonds (distance) P-C4' energy: -25.386 flat angles C4'-P-C4' energy: -25.782 flat angles P-C4'-P energy: -21.422 tors. eta vs tors. theta energy: -34.863 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -348.161698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.161698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.178774 (E_RNA) where: Base-Base interactions energy: -231.156 where: short stacking energy: -104.304 Base-Backbone interact. energy: -1.051 local terms energy: -115.971363 where: bonds (distance) C4'-P energy: -23.975 bonds (distance) P-C4' energy: -23.834 flat angles C4'-P-C4' energy: -25.283 flat angles P-C4'-P energy: -13.183 tors. eta vs tors. theta energy: -29.696 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -339.167222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.167222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.167222 (E_RNA) where: Base-Base interactions energy: -216.625 where: short stacking energy: -104.664 Base-Backbone interact. energy: -0.871 local terms energy: -121.671101 where: bonds (distance) C4'-P energy: -26.554 bonds (distance) P-C4' energy: -27.902 flat angles C4'-P-C4' energy: -23.760 flat angles P-C4'-P energy: -10.975 tors. eta vs tors. theta energy: -32.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -324.785859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.785859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.938991 (E_RNA) where: Base-Base interactions energy: -209.376 where: short stacking energy: -105.553 Base-Backbone interact. energy: -0.391 local terms energy: -115.172357 where: bonds (distance) C4'-P energy: -24.447 bonds (distance) P-C4' energy: -19.065 flat angles C4'-P-C4' energy: -27.250 flat angles P-C4'-P energy: -15.829 tors. eta vs tors. theta energy: -28.581 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -261.738194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.738194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.842197 (E_RNA) where: Base-Base interactions energy: -168.381 where: short stacking energy: -96.204 Base-Backbone interact. energy: -0.286 local terms energy: -93.175425 where: bonds (distance) C4'-P energy: -22.513 bonds (distance) P-C4' energy: -14.397 flat angles C4'-P-C4' energy: -20.906 flat angles P-C4'-P energy: -15.826 tors. eta vs tors. theta energy: -19.532 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -226.548251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.548251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.548251 (E_RNA) where: Base-Base interactions energy: -158.085 where: short stacking energy: -80.890 Base-Backbone interact. energy: -0.831 local terms energy: -67.632113 where: bonds (distance) C4'-P energy: -22.243 bonds (distance) P-C4' energy: -17.333 flat angles C4'-P-C4' energy: -15.621 flat angles P-C4'-P energy: -6.045 tors. eta vs tors. theta energy: -6.391 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -186.301700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.301700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.301700 (E_RNA) where: Base-Base interactions energy: -106.757 where: short stacking energy: -63.995 Base-Backbone interact. energy: -0.506 local terms energy: -79.038006 where: bonds (distance) C4'-P energy: -25.282 bonds (distance) P-C4' energy: -19.306 flat angles C4'-P-C4' energy: -19.146 flat angles P-C4'-P energy: -14.358 tors. eta vs tors. theta energy: -0.946 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -150.126369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.126369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.136765 (E_RNA) where: Base-Base interactions energy: -75.389 where: short stacking energy: -37.699 Base-Backbone interact. energy: 2.750 local terms energy: -77.497733 where: bonds (distance) C4'-P energy: -19.155 bonds (distance) P-C4' energy: -18.407 flat angles C4'-P-C4' energy: -20.527 flat angles P-C4'-P energy: -14.385 tors. eta vs tors. theta energy: -5.024 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -165.137435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.137435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.199695 (E_RNA) where: Base-Base interactions energy: -96.833 where: short stacking energy: -56.630 Base-Backbone interact. energy: -1.606 local terms energy: -66.761074 where: bonds (distance) C4'-P energy: -8.295 bonds (distance) P-C4' energy: -17.988 flat angles C4'-P-C4' energy: -17.981 flat angles P-C4'-P energy: -20.529 tors. eta vs tors. theta energy: -1.967 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -364.642523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.642523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.660768 (E_RNA) where: Base-Base interactions energy: -239.555 where: short stacking energy: -122.026 Base-Backbone interact. energy: -0.676 local terms energy: -124.430298 where: bonds (distance) C4'-P energy: -24.787 bonds (distance) P-C4' energy: -25.984 flat angles C4'-P-C4' energy: -23.759 flat angles P-C4'-P energy: -18.028 tors. eta vs tors. theta energy: -31.872 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -364.316838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.316838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.316838 (E_RNA) where: Base-Base interactions energy: -236.994 where: short stacking energy: -118.202 Base-Backbone interact. energy: -0.329 local terms energy: -126.992948 where: bonds (distance) C4'-P energy: -23.541 bonds (distance) P-C4' energy: -27.548 flat angles C4'-P-C4' energy: -26.990 flat angles P-C4'-P energy: -15.103 tors. eta vs tors. theta energy: -33.811 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -346.712593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.712593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.712593 (E_RNA) where: Base-Base interactions energy: -233.295 where: short stacking energy: -113.048 Base-Backbone interact. energy: 0.482 local terms energy: -113.899615 where: bonds (distance) C4'-P energy: -24.038 bonds (distance) P-C4' energy: -25.795 flat angles C4'-P-C4' energy: -17.974 flat angles P-C4'-P energy: -17.454 tors. eta vs tors. theta energy: -28.639 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -336.944428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.944428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.944428 (E_RNA) where: Base-Base interactions energy: -219.044 where: short stacking energy: -105.983 Base-Backbone interact. energy: -0.621 local terms energy: -117.279466 where: bonds (distance) C4'-P energy: -19.445 bonds (distance) P-C4' energy: -23.129 flat angles C4'-P-C4' energy: -22.574 flat angles P-C4'-P energy: -17.971 tors. eta vs tors. theta energy: -34.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -330.905730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.905730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.905730 (E_RNA) where: Base-Base interactions energy: -214.146 where: short stacking energy: -103.229 Base-Backbone interact. energy: -0.172 local terms energy: -116.587847 where: bonds (distance) C4'-P energy: -21.913 bonds (distance) P-C4' energy: -21.538 flat angles C4'-P-C4' energy: -25.093 flat angles P-C4'-P energy: -18.905 tors. eta vs tors. theta energy: -29.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -273.283335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.283335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.344041 (E_RNA) where: Base-Base interactions energy: -175.733 where: short stacking energy: -78.511 Base-Backbone interact. energy: -1.025 local terms energy: -96.586304 where: bonds (distance) C4'-P energy: -23.534 bonds (distance) P-C4' energy: -26.380 flat angles C4'-P-C4' energy: -18.063 flat angles P-C4'-P energy: -10.443 tors. eta vs tors. theta energy: -18.167 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -255.389590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.389590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.396258 (E_RNA) where: Base-Base interactions energy: -167.795 where: short stacking energy: -78.999 Base-Backbone interact. energy: 0.827 local terms energy: -88.428883 where: bonds (distance) C4'-P energy: -19.579 bonds (distance) P-C4' energy: -18.728 flat angles C4'-P-C4' energy: -19.910 flat angles P-C4'-P energy: -13.423 tors. eta vs tors. theta energy: -16.789 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -183.475079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.475079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.475079 (E_RNA) where: Base-Base interactions energy: -106.494 where: short stacking energy: -70.736 Base-Backbone interact. energy: -0.488 local terms energy: -76.493259 where: bonds (distance) C4'-P energy: -22.257 bonds (distance) P-C4' energy: -11.727 flat angles C4'-P-C4' energy: -20.354 flat angles P-C4'-P energy: -13.116 tors. eta vs tors. theta energy: -9.040 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -185.529248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.529248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.563991 (E_RNA) where: Base-Base interactions energy: -102.468 where: short stacking energy: -50.390 Base-Backbone interact. energy: -0.025 local terms energy: -83.071003 where: bonds (distance) C4'-P energy: -24.369 bonds (distance) P-C4' energy: -22.584 flat angles C4'-P-C4' energy: -13.906 flat angles P-C4'-P energy: -18.168 tors. eta vs tors. theta energy: -4.044 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -151.814836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.814836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.862701 (E_RNA) where: Base-Base interactions energy: -72.046 where: short stacking energy: -51.801 Base-Backbone interact. energy: -0.213 local terms energy: -79.603755 where: bonds (distance) C4'-P energy: -15.625 bonds (distance) P-C4' energy: -18.605 flat angles C4'-P-C4' energy: -23.675 flat angles P-C4'-P energy: -15.048 tors. eta vs tors. theta energy: -6.652 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -378.399367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.399367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.414597 (E_RNA) where: Base-Base interactions energy: -246.808 where: short stacking energy: -123.422 Base-Backbone interact. energy: -0.634 local terms energy: -130.972933 where: bonds (distance) C4'-P energy: -22.617 bonds (distance) P-C4' energy: -27.661 flat angles C4'-P-C4' energy: -25.320 flat angles P-C4'-P energy: -18.956 tors. eta vs tors. theta energy: -36.418 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -360.770368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.770368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.807628 (E_RNA) where: Base-Base interactions energy: -239.244 where: short stacking energy: -107.808 Base-Backbone interact. energy: 0.206 local terms energy: -121.770206 where: bonds (distance) C4'-P energy: -27.377 bonds (distance) P-C4' energy: -27.061 flat angles C4'-P-C4' energy: -20.808 flat angles P-C4'-P energy: -17.787 tors. eta vs tors. theta energy: -28.737 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -357.440629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.440629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.517458 (E_RNA) where: Base-Base interactions energy: -236.948 where: short stacking energy: -122.934 Base-Backbone interact. energy: -0.287 local terms energy: -120.282713 where: bonds (distance) C4'-P energy: -19.898 bonds (distance) P-C4' energy: -24.416 flat angles C4'-P-C4' energy: -26.136 flat angles P-C4'-P energy: -14.042 tors. eta vs tors. theta energy: -35.792 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -346.216852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.216852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.242523 (E_RNA) where: Base-Base interactions energy: -228.854 where: short stacking energy: -123.725 Base-Backbone interact. energy: -0.211 local terms energy: -117.177721 where: bonds (distance) C4'-P energy: -25.125 bonds (distance) P-C4' energy: -17.649 flat angles C4'-P-C4' energy: -26.990 flat angles P-C4'-P energy: -15.950 tors. eta vs tors. theta energy: -31.464 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -323.135722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.135722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.171071 (E_RNA) where: Base-Base interactions energy: -208.864 where: short stacking energy: -97.494 Base-Backbone interact. energy: -1.201 local terms energy: -113.106142 where: bonds (distance) C4'-P energy: -21.610 bonds (distance) P-C4' energy: -20.990 flat angles C4'-P-C4' energy: -25.987 flat angles P-C4'-P energy: -16.758 tors. eta vs tors. theta energy: -27.761 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -281.863301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.863301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.960374 (E_RNA) where: Base-Base interactions energy: -168.553 where: short stacking energy: -81.386 Base-Backbone interact. energy: -0.320 local terms energy: -113.087338 where: bonds (distance) C4'-P energy: -17.658 bonds (distance) P-C4' energy: -28.622 flat angles C4'-P-C4' energy: -21.524 flat angles P-C4'-P energy: -19.828 tors. eta vs tors. theta energy: -25.455 Dist. restrs. and SS energy: 0.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -234.927155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.927155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.927155 (E_RNA) where: Base-Base interactions energy: -138.056 where: short stacking energy: -66.463 Base-Backbone interact. energy: -1.517 local terms energy: -95.354116 where: bonds (distance) C4'-P energy: -17.005 bonds (distance) P-C4' energy: -25.434 flat angles C4'-P-C4' energy: -24.477 flat angles P-C4'-P energy: -16.251 tors. eta vs tors. theta energy: -12.188 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -222.402698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.402698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.467596 (E_RNA) where: Base-Base interactions energy: -121.642 where: short stacking energy: -61.110 Base-Backbone interact. energy: -2.064 local terms energy: -98.761980 where: bonds (distance) C4'-P energy: -22.930 bonds (distance) P-C4' energy: -25.092 flat angles C4'-P-C4' energy: -22.431 flat angles P-C4'-P energy: -13.866 tors. eta vs tors. theta energy: -14.444 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -163.120068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.120068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.120068 (E_RNA) where: Base-Base interactions energy: -77.460 where: short stacking energy: -53.246 Base-Backbone interact. energy: -0.408 local terms energy: -85.252354 where: bonds (distance) C4'-P energy: -24.301 bonds (distance) P-C4' energy: -28.553 flat angles C4'-P-C4' energy: -17.660 flat angles P-C4'-P energy: -9.876 tors. eta vs tors. theta energy: -4.863 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -142.512749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.512749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.519926 (E_RNA) where: Base-Base interactions energy: -74.724 where: short stacking energy: -49.233 Base-Backbone interact. energy: -0.452 local terms energy: -67.343803 where: bonds (distance) C4'-P energy: -19.426 bonds (distance) P-C4' energy: -16.094 flat angles C4'-P-C4' energy: -19.186 flat angles P-C4'-P energy: -12.045 tors. eta vs tors. theta energy: -0.594 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -380.441359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.441359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.616107 (E_RNA) where: Base-Base interactions energy: -243.616 where: short stacking energy: -122.630 Base-Backbone interact. energy: -0.124 local terms energy: -136.876584 where: bonds (distance) C4'-P energy: -23.506 bonds (distance) P-C4' energy: -27.543 flat angles C4'-P-C4' energy: -27.665 flat angles P-C4'-P energy: -22.308 tors. eta vs tors. theta energy: -35.855 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -363.021351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.021351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.021351 (E_RNA) where: Base-Base interactions energy: -243.066 where: short stacking energy: -112.520 Base-Backbone interact. energy: -0.911 local terms energy: -119.044484 where: bonds (distance) C4'-P energy: -18.745 bonds (distance) P-C4' energy: -27.217 flat angles C4'-P-C4' energy: -25.171 flat angles P-C4'-P energy: -17.460 tors. eta vs tors. theta energy: -30.452 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -350.407753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.407753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.407753 (E_RNA) where: Base-Base interactions energy: -225.126 where: short stacking energy: -111.790 Base-Backbone interact. energy: -1.393 local terms energy: -123.888669 where: bonds (distance) C4'-P energy: -19.680 bonds (distance) P-C4' energy: -22.237 flat angles C4'-P-C4' energy: -26.453 flat angles P-C4'-P energy: -19.173 tors. eta vs tors. theta energy: -36.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -347.882396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.882396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.882396 (E_RNA) where: Base-Base interactions energy: -225.106 where: short stacking energy: -120.106 Base-Backbone interact. energy: -0.195 local terms energy: -122.581246 where: bonds (distance) C4'-P energy: -25.329 bonds (distance) P-C4' energy: -18.609 flat angles C4'-P-C4' energy: -23.698 flat angles P-C4'-P energy: -19.374 tors. eta vs tors. theta energy: -35.571 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -292.939082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.939082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.939082 (E_RNA) where: Base-Base interactions energy: -177.042 where: short stacking energy: -93.254 Base-Backbone interact. energy: -0.239 local terms energy: -115.658454 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -24.782 flat angles C4'-P-C4' energy: -22.858 flat angles P-C4'-P energy: -15.443 tors. eta vs tors. theta energy: -28.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -319.161845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.161845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.292599 (E_RNA) where: Base-Base interactions energy: -212.378 where: short stacking energy: -110.493 Base-Backbone interact. energy: -0.019 local terms energy: -106.894890 where: bonds (distance) C4'-P energy: -17.530 bonds (distance) P-C4' energy: -17.487 flat angles C4'-P-C4' energy: -24.455 flat angles P-C4'-P energy: -14.063 tors. eta vs tors. theta energy: -33.360 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -223.290109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.290109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.311486 (E_RNA) where: Base-Base interactions energy: -127.126 where: short stacking energy: -71.793 Base-Backbone interact. energy: -1.119 local terms energy: -95.066671 where: bonds (distance) C4'-P energy: -23.636 bonds (distance) P-C4' energy: -22.724 flat angles C4'-P-C4' energy: -23.181 flat angles P-C4'-P energy: -13.333 tors. eta vs tors. theta energy: -12.193 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -203.474220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.474220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.474220 (E_RNA) where: Base-Base interactions energy: -124.663 where: short stacking energy: -69.817 Base-Backbone interact. energy: 1.418 local terms energy: -80.229219 where: bonds (distance) C4'-P energy: -20.092 bonds (distance) P-C4' energy: -20.604 flat angles C4'-P-C4' energy: -16.906 flat angles P-C4'-P energy: -15.318 tors. eta vs tors. theta energy: -7.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -174.256197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.256197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.399575 (E_RNA) where: Base-Base interactions energy: -93.153 where: short stacking energy: -64.997 Base-Backbone interact. energy: 0.541 local terms energy: -81.787619 where: bonds (distance) C4'-P energy: -14.217 bonds (distance) P-C4' energy: -25.386 flat angles C4'-P-C4' energy: -24.535 flat angles P-C4'-P energy: -14.495 tors. eta vs tors. theta energy: -3.154 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -153.783270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.783270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.844181 (E_RNA) where: Base-Base interactions energy: -71.438 where: short stacking energy: -48.786 Base-Backbone interact. energy: -0.037 local terms energy: -82.368959 where: bonds (distance) C4'-P energy: -21.773 bonds (distance) P-C4' energy: -22.112 flat angles C4'-P-C4' energy: -18.906 flat angles P-C4'-P energy: -11.914 tors. eta vs tors. theta energy: -7.664 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -370.229887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.229887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.245234 (E_RNA) where: Base-Base interactions energy: -241.997 where: short stacking energy: -115.693 Base-Backbone interact. energy: -0.971 local terms energy: -127.277556 where: bonds (distance) C4'-P energy: -27.838 bonds (distance) P-C4' energy: -24.296 flat angles C4'-P-C4' energy: -25.587 flat angles P-C4'-P energy: -16.001 tors. eta vs tors. theta energy: -33.554 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -354.822757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.822757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.823160 (E_RNA) where: Base-Base interactions energy: -236.495 where: short stacking energy: -100.342 Base-Backbone interact. energy: -0.824 local terms energy: -117.504532 where: bonds (distance) C4'-P energy: -21.595 bonds (distance) P-C4' energy: -26.052 flat angles C4'-P-C4' energy: -25.602 flat angles P-C4'-P energy: -15.517 tors. eta vs tors. theta energy: -28.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -354.087551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.087551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.096153 (E_RNA) where: Base-Base interactions energy: -226.323 where: short stacking energy: -113.029 Base-Backbone interact. energy: -0.491 local terms energy: -127.282343 where: bonds (distance) C4'-P energy: -25.084 bonds (distance) P-C4' energy: -23.239 flat angles C4'-P-C4' energy: -26.433 flat angles P-C4'-P energy: -14.952 tors. eta vs tors. theta energy: -37.575 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -335.163582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.163582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.191269 (E_RNA) where: Base-Base interactions energy: -218.893 where: short stacking energy: -111.632 Base-Backbone interact. energy: -0.477 local terms energy: -115.821174 where: bonds (distance) C4'-P energy: -22.319 bonds (distance) P-C4' energy: -19.696 flat angles C4'-P-C4' energy: -22.816 flat angles P-C4'-P energy: -19.677 tors. eta vs tors. theta energy: -31.313 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -298.017089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.017089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.017089 (E_RNA) where: Base-Base interactions energy: -190.125 where: short stacking energy: -94.641 Base-Backbone interact. energy: -0.072 local terms energy: -107.820321 where: bonds (distance) C4'-P energy: -23.375 bonds (distance) P-C4' energy: -26.863 flat angles C4'-P-C4' energy: -18.800 flat angles P-C4'-P energy: -13.742 tors. eta vs tors. theta energy: -25.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -288.859133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.859133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.859133 (E_RNA) where: Base-Base interactions energy: -179.156 where: short stacking energy: -86.214 Base-Backbone interact. energy: -0.188 local terms energy: -109.515774 where: bonds (distance) C4'-P energy: -23.026 bonds (distance) P-C4' energy: -25.690 flat angles C4'-P-C4' energy: -17.121 flat angles P-C4'-P energy: -15.713 tors. eta vs tors. theta energy: -27.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -218.653017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.653017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.704203 (E_RNA) where: Base-Base interactions energy: -129.120 where: short stacking energy: -62.514 Base-Backbone interact. energy: -0.454 local terms energy: -89.130939 where: bonds (distance) C4'-P energy: -17.714 bonds (distance) P-C4' energy: -23.688 flat angles C4'-P-C4' energy: -26.902 flat angles P-C4'-P energy: -8.290 tors. eta vs tors. theta energy: -12.537 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -209.018752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.018752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.097887 (E_RNA) where: Base-Base interactions energy: -116.181 where: short stacking energy: -79.669 Base-Backbone interact. energy: -0.294 local terms energy: -92.622912 where: bonds (distance) C4'-P energy: -21.664 bonds (distance) P-C4' energy: -23.301 flat angles C4'-P-C4' energy: -22.650 flat angles P-C4'-P energy: -9.231 tors. eta vs tors. theta energy: -15.776 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -178.341864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.341864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.341864 (E_RNA) where: Base-Base interactions energy: -95.887 where: short stacking energy: -64.382 Base-Backbone interact. energy: -0.368 local terms energy: -82.086848 where: bonds (distance) C4'-P energy: -23.401 bonds (distance) P-C4' energy: -20.544 flat angles C4'-P-C4' energy: -17.641 flat angles P-C4'-P energy: -12.936 tors. eta vs tors. theta energy: -7.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -144.965691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.965691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.965691 (E_RNA) where: Base-Base interactions energy: -71.577 where: short stacking energy: -42.338 Base-Backbone interact. energy: -0.269 local terms energy: -73.119519 where: bonds (distance) C4'-P energy: -21.079 bonds (distance) P-C4' energy: -24.685 flat angles C4'-P-C4' energy: -17.694 flat angles P-C4'-P energy: -7.753 tors. eta vs tors. theta energy: -1.909 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -362.300544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.300544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.300544 (E_RNA) where: Base-Base interactions energy: -247.897 where: short stacking energy: -103.251 Base-Backbone interact. energy: -0.931 local terms energy: -113.472198 where: bonds (distance) C4'-P energy: -23.707 bonds (distance) P-C4' energy: -18.717 flat angles C4'-P-C4' energy: -22.887 flat angles P-C4'-P energy: -21.039 tors. eta vs tors. theta energy: -27.123 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -367.899201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.899201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.899201 (E_RNA) where: Base-Base interactions energy: -241.915 where: short stacking energy: -121.485 Base-Backbone interact. energy: -1.516 local terms energy: -124.468457 where: bonds (distance) C4'-P energy: -24.001 bonds (distance) P-C4' energy: -25.837 flat angles C4'-P-C4' energy: -23.766 flat angles P-C4'-P energy: -19.926 tors. eta vs tors. theta energy: -30.939 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -345.481652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.481652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.481652 (E_RNA) where: Base-Base interactions energy: -233.696 where: short stacking energy: -107.920 Base-Backbone interact. energy: -1.142 local terms energy: -110.643706 where: bonds (distance) C4'-P energy: -22.904 bonds (distance) P-C4' energy: -23.146 flat angles C4'-P-C4' energy: -18.998 flat angles P-C4'-P energy: -14.314 tors. eta vs tors. theta energy: -31.282 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -337.748092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.748092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.748092 (E_RNA) where: Base-Base interactions energy: -223.188 where: short stacking energy: -111.963 Base-Backbone interact. energy: 0.925 local terms energy: -115.485518 where: bonds (distance) C4'-P energy: -22.923 bonds (distance) P-C4' energy: -22.798 flat angles C4'-P-C4' energy: -21.781 flat angles P-C4'-P energy: -15.032 tors. eta vs tors. theta energy: -32.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -298.788430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.788430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.788430 (E_RNA) where: Base-Base interactions energy: -192.006 where: short stacking energy: -105.041 Base-Backbone interact. energy: -0.234 local terms energy: -106.548567 where: bonds (distance) C4'-P energy: -15.905 bonds (distance) P-C4' energy: -20.521 flat angles C4'-P-C4' energy: -23.875 flat angles P-C4'-P energy: -13.330 tors. eta vs tors. theta energy: -32.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -238.633406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.633406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.774800 (E_RNA) where: Base-Base interactions energy: -137.270 where: short stacking energy: -81.870 Base-Backbone interact. energy: -0.116 local terms energy: -101.389312 where: bonds (distance) C4'-P energy: -20.062 bonds (distance) P-C4' energy: -21.583 flat angles C4'-P-C4' energy: -22.159 flat angles P-C4'-P energy: -15.121 tors. eta vs tors. theta energy: -22.465 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -237.911862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.911862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.960793 (E_RNA) where: Base-Base interactions energy: -147.547 where: short stacking energy: -73.679 Base-Backbone interact. energy: -0.746 local terms energy: -89.667765 where: bonds (distance) C4'-P energy: -23.814 bonds (distance) P-C4' energy: -21.475 flat angles C4'-P-C4' energy: -20.792 flat angles P-C4'-P energy: -11.531 tors. eta vs tors. theta energy: -12.055 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -176.285143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.285143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.285143 (E_RNA) where: Base-Base interactions energy: -106.868 where: short stacking energy: -54.541 Base-Backbone interact. energy: 1.877 local terms energy: -71.294157 where: bonds (distance) C4'-P energy: -27.615 bonds (distance) P-C4' energy: -18.653 flat angles C4'-P-C4' energy: -16.069 flat angles P-C4'-P energy: -10.416 tors. eta vs tors. theta energy: 1.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -166.669227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.669227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.671042 (E_RNA) where: Base-Base interactions energy: -91.684 where: short stacking energy: -52.383 Base-Backbone interact. energy: -1.120 local terms energy: -73.866715 where: bonds (distance) C4'-P energy: -16.812 bonds (distance) P-C4' energy: -21.796 flat angles C4'-P-C4' energy: -20.773 flat angles P-C4'-P energy: -13.384 tors. eta vs tors. theta energy: -1.101 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -151.650218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.650218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.771471 (E_RNA) where: Base-Base interactions energy: -71.827 where: short stacking energy: -50.022 Base-Backbone interact. energy: -2.306 local terms energy: -77.638256 where: bonds (distance) C4'-P energy: -20.658 bonds (distance) P-C4' energy: -20.366 flat angles C4'-P-C4' energy: -20.917 flat angles P-C4'-P energy: -14.167 tors. eta vs tors. theta energy: -1.531 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -357.422868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.422868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.615645 (E_RNA) where: Base-Base interactions energy: -244.008 where: short stacking energy: -110.054 Base-Backbone interact. energy: -0.873 local terms energy: -112.734508 where: bonds (distance) C4'-P energy: -23.623 bonds (distance) P-C4' energy: -22.645 flat angles C4'-P-C4' energy: -24.366 flat angles P-C4'-P energy: -14.735 tors. eta vs tors. theta energy: -27.365 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -350.731272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.731272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.731272 (E_RNA) where: Base-Base interactions energy: -227.235 where: short stacking energy: -102.303 Base-Backbone interact. energy: -0.127 local terms energy: -123.369410 where: bonds (distance) C4'-P energy: -23.611 bonds (distance) P-C4' energy: -26.030 flat angles C4'-P-C4' energy: -23.755 flat angles P-C4'-P energy: -17.483 tors. eta vs tors. theta energy: -32.491 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -364.004120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.004120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.020857 (E_RNA) where: Base-Base interactions energy: -251.422 where: short stacking energy: -123.159 Base-Backbone interact. energy: -1.030 local terms energy: -111.568861 where: bonds (distance) C4'-P energy: -14.241 bonds (distance) P-C4' energy: -26.522 flat angles C4'-P-C4' energy: -24.473 flat angles P-C4'-P energy: -12.156 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -353.914266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.914266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.026854 (E_RNA) where: Base-Base interactions energy: -229.518 where: short stacking energy: -116.414 Base-Backbone interact. energy: -0.120 local terms energy: -124.388821 where: bonds (distance) C4'-P energy: -22.552 bonds (distance) P-C4' energy: -24.055 flat angles C4'-P-C4' energy: -23.873 flat angles P-C4'-P energy: -20.029 tors. eta vs tors. theta energy: -33.880 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -301.405678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.405678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.405678 (E_RNA) where: Base-Base interactions energy: -202.378 where: short stacking energy: -98.013 Base-Backbone interact. energy: -0.756 local terms energy: -98.272201 where: bonds (distance) C4'-P energy: -22.565 bonds (distance) P-C4' energy: -23.638 flat angles C4'-P-C4' energy: -20.036 flat angles P-C4'-P energy: -11.477 tors. eta vs tors. theta energy: -20.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -258.956228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.956228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.386175 (E_RNA) where: Base-Base interactions energy: -148.607 where: short stacking energy: -95.373 Base-Backbone interact. energy: -0.130 local terms energy: -110.648271 where: bonds (distance) C4'-P energy: -21.979 bonds (distance) P-C4' energy: -19.829 flat angles C4'-P-C4' energy: -22.824 flat angles P-C4'-P energy: -19.173 tors. eta vs tors. theta energy: -26.844 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -247.062814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.062814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.062814 (E_RNA) where: Base-Base interactions energy: -145.815 where: short stacking energy: -78.202 Base-Backbone interact. energy: -0.883 local terms energy: -100.365058 where: bonds (distance) C4'-P energy: -24.404 bonds (distance) P-C4' energy: -26.569 flat angles C4'-P-C4' energy: -16.180 flat angles P-C4'-P energy: -13.229 tors. eta vs tors. theta energy: -19.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -179.232696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.232696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.279071 (E_RNA) where: Base-Base interactions energy: -93.287 where: short stacking energy: -49.729 Base-Backbone interact. energy: -0.163 local terms energy: -85.829497 where: bonds (distance) C4'-P energy: -22.534 bonds (distance) P-C4' energy: -24.753 flat angles C4'-P-C4' energy: -21.203 flat angles P-C4'-P energy: -15.310 tors. eta vs tors. theta energy: -2.029 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -167.895001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.895001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.895001 (E_RNA) where: Base-Base interactions energy: -88.073 where: short stacking energy: -39.218 Base-Backbone interact. energy: 0.773 local terms energy: -80.595225 where: bonds (distance) C4'-P energy: -27.336 bonds (distance) P-C4' energy: -21.075 flat angles C4'-P-C4' energy: -17.390 flat angles P-C4'-P energy: -22.019 tors. eta vs tors. theta energy: 7.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -144.762809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.762809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.840778 (E_RNA) where: Base-Base interactions energy: -77.042 where: short stacking energy: -53.486 Base-Backbone interact. energy: -0.611 local terms energy: -67.187262 where: bonds (distance) C4'-P energy: -18.352 bonds (distance) P-C4' energy: -16.297 flat angles C4'-P-C4' energy: -14.226 flat angles P-C4'-P energy: -12.766 tors. eta vs tors. theta energy: -5.547 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -356.905723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.905723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.905723 (E_RNA) where: Base-Base interactions energy: -232.865 where: short stacking energy: -117.595 Base-Backbone interact. energy: -0.292 local terms energy: -123.748271 where: bonds (distance) C4'-P energy: -23.008 bonds (distance) P-C4' energy: -26.606 flat angles C4'-P-C4' energy: -25.187 flat angles P-C4'-P energy: -18.534 tors. eta vs tors. theta energy: -30.413 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -362.674676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.674676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.798663 (E_RNA) where: Base-Base interactions energy: -244.627 where: short stacking energy: -111.927 Base-Backbone interact. energy: -1.316 local terms energy: -116.854928 where: bonds (distance) C4'-P energy: -22.265 bonds (distance) P-C4' energy: -23.965 flat angles C4'-P-C4' energy: -21.838 flat angles P-C4'-P energy: -20.379 tors. eta vs tors. theta energy: -28.407 Dist. restrs. and SS energy: 0.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -351.667098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.667098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.691680 (E_RNA) where: Base-Base interactions energy: -233.899 where: short stacking energy: -114.122 Base-Backbone interact. energy: -0.381 local terms energy: -117.411640 where: bonds (distance) C4'-P energy: -22.385 bonds (distance) P-C4' energy: -16.970 flat angles C4'-P-C4' energy: -23.279 flat angles P-C4'-P energy: -19.556 tors. eta vs tors. theta energy: -35.221 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -328.448192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.448192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.461364 (E_RNA) where: Base-Base interactions energy: -218.709 where: short stacking energy: -112.883 Base-Backbone interact. energy: -0.017 local terms energy: -109.736025 where: bonds (distance) C4'-P energy: -19.827 bonds (distance) P-C4' energy: -24.141 flat angles C4'-P-C4' energy: -26.235 flat angles P-C4'-P energy: -10.690 tors. eta vs tors. theta energy: -28.844 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -308.609462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.609462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.614541 (E_RNA) where: Base-Base interactions energy: -191.566 where: short stacking energy: -101.130 Base-Backbone interact. energy: -0.295 local terms energy: -116.754189 where: bonds (distance) C4'-P energy: -22.175 bonds (distance) P-C4' energy: -24.064 flat angles C4'-P-C4' energy: -26.467 flat angles P-C4'-P energy: -16.451 tors. eta vs tors. theta energy: -27.597 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -255.117778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.117778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.160008 (E_RNA) where: Base-Base interactions energy: -162.024 where: short stacking energy: -86.619 Base-Backbone interact. energy: -1.370 local terms energy: -91.765660 where: bonds (distance) C4'-P energy: -23.527 bonds (distance) P-C4' energy: -20.586 flat angles C4'-P-C4' energy: -17.696 flat angles P-C4'-P energy: -17.205 tors. eta vs tors. theta energy: -12.752 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -256.357652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.357652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.397255 (E_RNA) where: Base-Base interactions energy: -161.049 where: short stacking energy: -80.018 Base-Backbone interact. energy: -0.486 local terms energy: -94.862414 where: bonds (distance) C4'-P energy: -16.782 bonds (distance) P-C4' energy: -19.325 flat angles C4'-P-C4' energy: -20.925 flat angles P-C4'-P energy: -17.601 tors. eta vs tors. theta energy: -20.230 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -180.435027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.435027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.435027 (E_RNA) where: Base-Base interactions energy: -90.442 where: short stacking energy: -54.900 Base-Backbone interact. energy: -0.582 local terms energy: -89.411385 where: bonds (distance) C4'-P energy: -18.862 bonds (distance) P-C4' energy: -24.333 flat angles C4'-P-C4' energy: -23.487 flat angles P-C4'-P energy: -12.311 tors. eta vs tors. theta energy: -10.418 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -208.009543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.009543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.009543 (E_RNA) where: Base-Base interactions energy: -125.714 where: short stacking energy: -68.805 Base-Backbone interact. energy: -0.381 local terms energy: -81.914355 where: bonds (distance) C4'-P energy: -17.577 bonds (distance) P-C4' energy: -20.436 flat angles C4'-P-C4' energy: -17.462 flat angles P-C4'-P energy: -15.935 tors. eta vs tors. theta energy: -10.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -165.482213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.482213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.691486 (E_RNA) where: Base-Base interactions energy: -85.734 where: short stacking energy: -49.843 Base-Backbone interact. energy: -0.091 local terms energy: -79.865849 where: bonds (distance) C4'-P energy: -23.040 bonds (distance) P-C4' energy: -23.244 flat angles C4'-P-C4' energy: -13.504 flat angles P-C4'-P energy: -10.614 tors. eta vs tors. theta energy: -9.464 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -362.499983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.499983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.499983 (E_RNA) where: Base-Base interactions energy: -227.696 where: short stacking energy: -114.185 Base-Backbone interact. energy: -0.031 local terms energy: -134.773275 where: bonds (distance) C4'-P energy: -25.398 bonds (distance) P-C4' energy: -26.465 flat angles C4'-P-C4' energy: -28.628 flat angles P-C4'-P energy: -23.102 tors. eta vs tors. theta energy: -31.180 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -362.391357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.391357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.399897 (E_RNA) where: Base-Base interactions energy: -244.298 where: short stacking energy: -113.461 Base-Backbone interact. energy: 1.510 local terms energy: -119.612759 where: bonds (distance) C4'-P energy: -21.761 bonds (distance) P-C4' energy: -23.046 flat angles C4'-P-C4' energy: -25.223 flat angles P-C4'-P energy: -21.608 tors. eta vs tors. theta energy: -27.976 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -360.149030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.149030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.203374 (E_RNA) where: Base-Base interactions energy: -237.228 where: short stacking energy: -119.828 Base-Backbone interact. energy: -0.456 local terms energy: -122.518949 where: bonds (distance) C4'-P energy: -23.775 bonds (distance) P-C4' energy: -24.778 flat angles C4'-P-C4' energy: -24.749 flat angles P-C4'-P energy: -17.283 tors. eta vs tors. theta energy: -31.934 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -341.184982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.184982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.184982 (E_RNA) where: Base-Base interactions energy: -217.879 where: short stacking energy: -106.948 Base-Backbone interact. energy: -0.150 local terms energy: -123.156324 where: bonds (distance) C4'-P energy: -22.354 bonds (distance) P-C4' energy: -27.199 flat angles C4'-P-C4' energy: -25.182 flat angles P-C4'-P energy: -15.559 tors. eta vs tors. theta energy: -32.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -318.192640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.192640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.248250 (E_RNA) where: Base-Base interactions energy: -210.422 where: short stacking energy: -95.883 Base-Backbone interact. energy: -0.959 local terms energy: -106.866827 where: bonds (distance) C4'-P energy: -20.835 bonds (distance) P-C4' energy: -22.994 flat angles C4'-P-C4' energy: -23.230 flat angles P-C4'-P energy: -15.562 tors. eta vs tors. theta energy: -24.246 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -280.808687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.808687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.808687 (E_RNA) where: Base-Base interactions energy: -190.642 where: short stacking energy: -81.450 Base-Backbone interact. energy: -0.867 local terms energy: -89.299623 where: bonds (distance) C4'-P energy: -19.145 bonds (distance) P-C4' energy: -19.035 flat angles C4'-P-C4' energy: -23.141 flat angles P-C4'-P energy: -10.336 tors. eta vs tors. theta energy: -17.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -226.837288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.837288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.843832 (E_RNA) where: Base-Base interactions energy: -126.413 where: short stacking energy: -64.712 Base-Backbone interact. energy: -0.252 local terms energy: -100.179341 where: bonds (distance) C4'-P energy: -21.135 bonds (distance) P-C4' energy: -25.585 flat angles C4'-P-C4' energy: -25.176 flat angles P-C4'-P energy: -13.717 tors. eta vs tors. theta energy: -14.567 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -203.263582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.263582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.271081 (E_RNA) where: Base-Base interactions energy: -112.882 where: short stacking energy: -71.728 Base-Backbone interact. energy: -1.347 local terms energy: -89.042410 where: bonds (distance) C4'-P energy: -20.927 bonds (distance) P-C4' energy: -21.163 flat angles C4'-P-C4' energy: -20.361 flat angles P-C4'-P energy: -14.295 tors. eta vs tors. theta energy: -12.296 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -152.580754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.580754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.753208 (E_RNA) where: Base-Base interactions energy: -65.770 where: short stacking energy: -44.045 Base-Backbone interact. energy: -1.046 local terms energy: -85.937362 where: bonds (distance) C4'-P energy: -22.057 bonds (distance) P-C4' energy: -26.092 flat angles C4'-P-C4' energy: -17.191 flat angles P-C4'-P energy: -17.311 tors. eta vs tors. theta energy: -3.287 Dist. restrs. and SS energy: 0.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -161.492017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.492017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.540687 (E_RNA) where: Base-Base interactions energy: -88.477 where: short stacking energy: -47.425 Base-Backbone interact. energy: -0.534 local terms energy: -72.529780 where: bonds (distance) C4'-P energy: -23.289 bonds (distance) P-C4' energy: -25.515 flat angles C4'-P-C4' energy: -6.919 flat angles P-C4'-P energy: -12.269 tors. eta vs tors. theta energy: -4.538 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -371.437504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.437504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.487438 (E_RNA) where: Base-Base interactions energy: -257.679 where: short stacking energy: -121.500 Base-Backbone interact. energy: -1.626 local terms energy: -112.182833 where: bonds (distance) C4'-P energy: -27.238 bonds (distance) P-C4' energy: -23.184 flat angles C4'-P-C4' energy: -21.723 flat angles P-C4'-P energy: -11.222 tors. eta vs tors. theta energy: -28.816 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -369.287850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.287850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.293808 (E_RNA) where: Base-Base interactions energy: -232.916 where: short stacking energy: -117.616 Base-Backbone interact. energy: 0.228 local terms energy: -136.605621 where: bonds (distance) C4'-P energy: -25.413 bonds (distance) P-C4' energy: -25.632 flat angles C4'-P-C4' energy: -28.894 flat angles P-C4'-P energy: -22.094 tors. eta vs tors. theta energy: -34.573 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -363.485943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.485943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.527398 (E_RNA) where: Base-Base interactions energy: -239.005 where: short stacking energy: -106.742 Base-Backbone interact. energy: -0.233 local terms energy: -124.288787 where: bonds (distance) C4'-P energy: -22.109 bonds (distance) P-C4' energy: -25.023 flat angles C4'-P-C4' energy: -27.391 flat angles P-C4'-P energy: -17.108 tors. eta vs tors. theta energy: -32.658 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -338.401944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.401944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.540481 (E_RNA) where: Base-Base interactions energy: -217.326 where: short stacking energy: -111.700 Base-Backbone interact. energy: -0.252 local terms energy: -120.962006 where: bonds (distance) C4'-P energy: -22.186 bonds (distance) P-C4' energy: -24.246 flat angles C4'-P-C4' energy: -23.317 flat angles P-C4'-P energy: -20.368 tors. eta vs tors. theta energy: -30.846 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -315.419783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.419783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.448516 (E_RNA) where: Base-Base interactions energy: -209.243 where: short stacking energy: -100.938 Base-Backbone interact. energy: 0.108 local terms energy: -106.313132 where: bonds (distance) C4'-P energy: -18.999 bonds (distance) P-C4' energy: -19.981 flat angles C4'-P-C4' energy: -23.430 flat angles P-C4'-P energy: -17.977 tors. eta vs tors. theta energy: -25.927 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -309.492452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.492452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.492452 (E_RNA) where: Base-Base interactions energy: -207.209 where: short stacking energy: -101.271 Base-Backbone interact. energy: -1.503 local terms energy: -100.780391 where: bonds (distance) C4'-P energy: -21.045 bonds (distance) P-C4' energy: -19.830 flat angles C4'-P-C4' energy: -24.684 flat angles P-C4'-P energy: -8.237 tors. eta vs tors. theta energy: -26.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -216.881390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.881390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.964594 (E_RNA) where: Base-Base interactions energy: -136.616 where: short stacking energy: -71.957 Base-Backbone interact. energy: -1.132 local terms energy: -79.216189 where: bonds (distance) C4'-P energy: -18.075 bonds (distance) P-C4' energy: -23.206 flat angles C4'-P-C4' energy: -18.020 flat angles P-C4'-P energy: -12.418 tors. eta vs tors. theta energy: -7.497 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -200.434947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.434947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.434947 (E_RNA) where: Base-Base interactions energy: -106.147 where: short stacking energy: -58.436 Base-Backbone interact. energy: -1.187 local terms energy: -93.101111 where: bonds (distance) C4'-P energy: -21.435 bonds (distance) P-C4' energy: -22.700 flat angles C4'-P-C4' energy: -21.523 flat angles P-C4'-P energy: -17.350 tors. eta vs tors. theta energy: -10.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -178.447119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.447119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.454693 (E_RNA) where: Base-Base interactions energy: -83.625 where: short stacking energy: -56.590 Base-Backbone interact. energy: 0.011 local terms energy: -94.841640 where: bonds (distance) C4'-P energy: -25.387 bonds (distance) P-C4' energy: -28.330 flat angles C4'-P-C4' energy: -27.038 flat angles P-C4'-P energy: -10.491 tors. eta vs tors. theta energy: -3.597 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -150.675731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.675731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.690401 (E_RNA) where: Base-Base interactions energy: -72.283 where: short stacking energy: -42.297 Base-Backbone interact. energy: -0.839 local terms energy: -77.568626 where: bonds (distance) C4'-P energy: -19.110 bonds (distance) P-C4' energy: -27.964 flat angles C4'-P-C4' energy: -14.985 flat angles P-C4'-P energy: -14.098 tors. eta vs tors. theta energy: -1.412 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -373.076770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.076770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.076770 (E_RNA) where: Base-Base interactions energy: -254.592 where: short stacking energy: -116.571 Base-Backbone interact. energy: -3.735 local terms energy: -114.749660 where: bonds (distance) C4'-P energy: -21.694 bonds (distance) P-C4' energy: -27.115 flat angles C4'-P-C4' energy: -23.768 flat angles P-C4'-P energy: -14.625 tors. eta vs tors. theta energy: -27.546 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -374.353399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.353399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.378235 (E_RNA) where: Base-Base interactions energy: -246.564 where: short stacking energy: -105.244 Base-Backbone interact. energy: -1.421 local terms energy: -126.392477 where: bonds (distance) C4'-P energy: -24.312 bonds (distance) P-C4' energy: -20.328 flat angles C4'-P-C4' energy: -26.808 flat angles P-C4'-P energy: -20.041 tors. eta vs tors. theta energy: -34.904 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -354.541998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.541998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.541998 (E_RNA) where: Base-Base interactions energy: -238.085 where: short stacking energy: -112.058 Base-Backbone interact. energy: -1.071 local terms energy: -115.386343 where: bonds (distance) C4'-P energy: -26.118 bonds (distance) P-C4' energy: -17.980 flat angles C4'-P-C4' energy: -24.822 flat angles P-C4'-P energy: -13.803 tors. eta vs tors. theta energy: -32.664 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -336.527776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.527776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.568591 (E_RNA) where: Base-Base interactions energy: -215.926 where: short stacking energy: -114.094 Base-Backbone interact. energy: -0.098 local terms energy: -120.544021 where: bonds (distance) C4'-P energy: -25.065 bonds (distance) P-C4' energy: -17.773 flat angles C4'-P-C4' energy: -27.321 flat angles P-C4'-P energy: -13.817 tors. eta vs tors. theta energy: -36.569 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -310.473735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.473735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.473735 (E_RNA) where: Base-Base interactions energy: -191.166 where: short stacking energy: -87.926 Base-Backbone interact. energy: -0.295 local terms energy: -119.012456 where: bonds (distance) C4'-P energy: -20.592 bonds (distance) P-C4' energy: -25.171 flat angles C4'-P-C4' energy: -26.990 flat angles P-C4'-P energy: -17.261 tors. eta vs tors. theta energy: -28.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -280.023501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.023501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.023501 (E_RNA) where: Base-Base interactions energy: -181.013 where: short stacking energy: -79.604 Base-Backbone interact. energy: -1.054 local terms energy: -97.956797 where: bonds (distance) C4'-P energy: -21.300 bonds (distance) P-C4' energy: -24.218 flat angles C4'-P-C4' energy: -20.917 flat angles P-C4'-P energy: -13.653 tors. eta vs tors. theta energy: -17.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -197.827955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.827955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.827955 (E_RNA) where: Base-Base interactions energy: -109.561 where: short stacking energy: -75.681 Base-Backbone interact. energy: -0.349 local terms energy: -87.917200 where: bonds (distance) C4'-P energy: -20.497 bonds (distance) P-C4' energy: -24.384 flat angles C4'-P-C4' energy: -23.516 flat angles P-C4'-P energy: -14.025 tors. eta vs tors. theta energy: -5.495 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -215.652704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.652704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.731620 (E_RNA) where: Base-Base interactions energy: -128.626 where: short stacking energy: -75.025 Base-Backbone interact. energy: -0.373 local terms energy: -86.732278 where: bonds (distance) C4'-P energy: -15.310 bonds (distance) P-C4' energy: -21.380 flat angles C4'-P-C4' energy: -17.436 flat angles P-C4'-P energy: -18.259 tors. eta vs tors. theta energy: -14.347 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -172.232008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.232008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.304143 (E_RNA) where: Base-Base interactions energy: -87.601 where: short stacking energy: -55.304 Base-Backbone interact. energy: -1.381 local terms energy: -83.322193 where: bonds (distance) C4'-P energy: -18.410 bonds (distance) P-C4' energy: -17.683 flat angles C4'-P-C4' energy: -27.262 flat angles P-C4'-P energy: -15.680 tors. eta vs tors. theta energy: -4.287 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -159.513416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.513416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.517652 (E_RNA) where: Base-Base interactions energy: -72.646 where: short stacking energy: -41.041 Base-Backbone interact. energy: -0.444 local terms energy: -86.427694 where: bonds (distance) C4'-P energy: -24.302 bonds (distance) P-C4' energy: -23.424 flat angles C4'-P-C4' energy: -24.985 flat angles P-C4'-P energy: -9.490 tors. eta vs tors. theta energy: -4.227 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -379.360154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.360154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.360154 (E_RNA) where: Base-Base interactions energy: -251.416 where: short stacking energy: -121.113 Base-Backbone interact. energy: -0.579 local terms energy: -127.364560 where: bonds (distance) C4'-P energy: -23.231 bonds (distance) P-C4' energy: -22.494 flat angles C4'-P-C4' energy: -26.145 flat angles P-C4'-P energy: -18.343 tors. eta vs tors. theta energy: -37.153 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -338.798629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.798629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.798629 (E_RNA) where: Base-Base interactions energy: -237.290 where: short stacking energy: -104.836 Base-Backbone interact. energy: 0.548 local terms energy: -102.056891 where: bonds (distance) C4'-P energy: -20.738 bonds (distance) P-C4' energy: -23.358 flat angles C4'-P-C4' energy: -21.789 flat angles P-C4'-P energy: -13.494 tors. eta vs tors. theta energy: -22.678 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -358.819559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.819559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.819559 (E_RNA) where: Base-Base interactions energy: -240.846 where: short stacking energy: -121.127 Base-Backbone interact. energy: -0.476 local terms energy: -117.497479 where: bonds (distance) C4'-P energy: -16.498 bonds (distance) P-C4' energy: -20.613 flat angles C4'-P-C4' energy: -27.362 flat angles P-C4'-P energy: -17.663 tors. eta vs tors. theta energy: -35.362 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -329.958974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.958974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.980278 (E_RNA) where: Base-Base interactions energy: -212.812 where: short stacking energy: -100.825 Base-Backbone interact. energy: -1.109 local terms energy: -116.059543 where: bonds (distance) C4'-P energy: -22.609 bonds (distance) P-C4' energy: -16.745 flat angles C4'-P-C4' energy: -26.976 flat angles P-C4'-P energy: -17.686 tors. eta vs tors. theta energy: -32.043 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -301.531985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.531985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.531985 (E_RNA) where: Base-Base interactions energy: -198.224 where: short stacking energy: -89.633 Base-Backbone interact. energy: -0.519 local terms energy: -102.789437 where: bonds (distance) C4'-P energy: -21.263 bonds (distance) P-C4' energy: -20.984 flat angles C4'-P-C4' energy: -23.100 flat angles P-C4'-P energy: -14.369 tors. eta vs tors. theta energy: -23.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -250.537204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.537204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.673630 (E_RNA) where: Base-Base interactions energy: -157.325 where: short stacking energy: -71.061 Base-Backbone interact. energy: -0.224 local terms energy: -93.124948 where: bonds (distance) C4'-P energy: -18.638 bonds (distance) P-C4' energy: -24.318 flat angles C4'-P-C4' energy: -21.630 flat angles P-C4'-P energy: -15.629 tors. eta vs tors. theta energy: -12.910 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -230.805691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.805691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.898102 (E_RNA) where: Base-Base interactions energy: -142.087 where: short stacking energy: -77.821 Base-Backbone interact. energy: -0.369 local terms energy: -88.442100 where: bonds (distance) C4'-P energy: -17.935 bonds (distance) P-C4' energy: -22.869 flat angles C4'-P-C4' energy: -21.502 flat angles P-C4'-P energy: -12.295 tors. eta vs tors. theta energy: -13.840 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -189.359148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.359148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.537639 (E_RNA) where: Base-Base interactions energy: -98.042 where: short stacking energy: -71.310 Base-Backbone interact. energy: -0.036 local terms energy: -91.459352 where: bonds (distance) C4'-P energy: -23.544 bonds (distance) P-C4' energy: -23.893 flat angles C4'-P-C4' energy: -19.951 flat angles P-C4'-P energy: -14.111 tors. eta vs tors. theta energy: -9.961 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -167.639932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.639932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.950394 (E_RNA) where: Base-Base interactions energy: -86.703 where: short stacking energy: -49.144 Base-Backbone interact. energy: -1.076 local terms energy: -80.171479 where: bonds (distance) C4'-P energy: -21.680 bonds (distance) P-C4' energy: -24.093 flat angles C4'-P-C4' energy: -14.635 flat angles P-C4'-P energy: -14.814 tors. eta vs tors. theta energy: -4.949 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -172.954461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.954461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.954461 (E_RNA) where: Base-Base interactions energy: -98.354 where: short stacking energy: -68.648 Base-Backbone interact. energy: -0.272 local terms energy: -74.327555 where: bonds (distance) C4'-P energy: -25.400 bonds (distance) P-C4' energy: -20.365 flat angles C4'-P-C4' energy: -14.730 flat angles P-C4'-P energy: -8.762 tors. eta vs tors. theta energy: -5.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -387.624598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.624598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.682237 (E_RNA) where: Base-Base interactions energy: -257.210 where: short stacking energy: -127.604 Base-Backbone interact. energy: -1.239 local terms energy: -129.233075 where: bonds (distance) C4'-P energy: -25.486 bonds (distance) P-C4' energy: -22.738 flat angles C4'-P-C4' energy: -23.760 flat angles P-C4'-P energy: -19.910 tors. eta vs tors. theta energy: -37.338 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -360.310291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.310291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.310291 (E_RNA) where: Base-Base interactions energy: -228.426 where: short stacking energy: -108.399 Base-Backbone interact. energy: -1.996 local terms energy: -129.888203 where: bonds (distance) C4'-P energy: -23.569 bonds (distance) P-C4' energy: -19.314 flat angles C4'-P-C4' energy: -31.143 flat angles P-C4'-P energy: -16.760 tors. eta vs tors. theta energy: -39.103 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -321.010187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.010187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.024369 (E_RNA) where: Base-Base interactions energy: -210.542 where: short stacking energy: -88.830 Base-Backbone interact. energy: -0.445 local terms energy: -110.037338 where: bonds (distance) C4'-P energy: -24.030 bonds (distance) P-C4' energy: -23.226 flat angles C4'-P-C4' energy: -21.407 flat angles P-C4'-P energy: -15.074 tors. eta vs tors. theta energy: -26.300 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -324.379555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.379555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.562064 (E_RNA) where: Base-Base interactions energy: -223.211 where: short stacking energy: -114.511 Base-Backbone interact. energy: -0.776 local terms energy: -100.574251 where: bonds (distance) C4'-P energy: -14.870 bonds (distance) P-C4' energy: -20.172 flat angles C4'-P-C4' energy: -21.889 flat angles P-C4'-P energy: -12.007 tors. eta vs tors. theta energy: -31.637 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -318.262038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.262038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.262038 (E_RNA) where: Base-Base interactions energy: -192.906 where: short stacking energy: -94.496 Base-Backbone interact. energy: -0.243 local terms energy: -125.113344 where: bonds (distance) C4'-P energy: -22.237 bonds (distance) P-C4' energy: -25.980 flat angles C4'-P-C4' energy: -27.867 flat angles P-C4'-P energy: -22.862 tors. eta vs tors. theta energy: -26.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -240.515434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.515434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.515434 (E_RNA) where: Base-Base interactions energy: -147.677 where: short stacking energy: -71.426 Base-Backbone interact. energy: -0.356 local terms energy: -92.482713 where: bonds (distance) C4'-P energy: -18.118 bonds (distance) P-C4' energy: -24.927 flat angles C4'-P-C4' energy: -22.395 flat angles P-C4'-P energy: -9.061 tors. eta vs tors. theta energy: -17.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -259.676756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.676756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.676756 (E_RNA) where: Base-Base interactions energy: -166.550 where: short stacking energy: -91.044 Base-Backbone interact. energy: -0.795 local terms energy: -92.331802 where: bonds (distance) C4'-P energy: -17.153 bonds (distance) P-C4' energy: -24.076 flat angles C4'-P-C4' energy: -23.142 flat angles P-C4'-P energy: -11.418 tors. eta vs tors. theta energy: -16.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -172.002169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.002169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.041482 (E_RNA) where: Base-Base interactions energy: -86.974 where: short stacking energy: -46.323 Base-Backbone interact. energy: -1.271 local terms energy: -83.796560 where: bonds (distance) C4'-P energy: -13.844 bonds (distance) P-C4' energy: -26.237 flat angles C4'-P-C4' energy: -24.767 flat angles P-C4'-P energy: -13.512 tors. eta vs tors. theta energy: -5.437 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -173.479173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.479173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.479173 (E_RNA) where: Base-Base interactions energy: -95.598 where: short stacking energy: -66.144 Base-Backbone interact. energy: -0.272 local terms energy: -77.608610 where: bonds (distance) C4'-P energy: -23.338 bonds (distance) P-C4' energy: -23.860 flat angles C4'-P-C4' energy: -18.616 flat angles P-C4'-P energy: -9.326 tors. eta vs tors. theta energy: -2.469 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -155.263372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.263372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.282480 (E_RNA) where: Base-Base interactions energy: -78.186 where: short stacking energy: -41.581 Base-Backbone interact. energy: 0.545 local terms energy: -77.641074 where: bonds (distance) C4'-P energy: -22.118 bonds (distance) P-C4' energy: -19.812 flat angles C4'-P-C4' energy: -18.739 flat angles P-C4'-P energy: -16.227 tors. eta vs tors. theta energy: -0.746 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -357.475895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.475895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.475895 (E_RNA) where: Base-Base interactions energy: -238.400 where: short stacking energy: -117.082 Base-Backbone interact. energy: -0.455 local terms energy: -118.620834 where: bonds (distance) C4'-P energy: -23.622 bonds (distance) P-C4' energy: -23.842 flat angles C4'-P-C4' energy: -19.688 flat angles P-C4'-P energy: -18.092 tors. eta vs tors. theta energy: -33.377 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -373.014146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.014146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.019765 (E_RNA) where: Base-Base interactions energy: -245.898 where: short stacking energy: -128.469 Base-Backbone interact. energy: -1.417 local terms energy: -125.704417 where: bonds (distance) C4'-P energy: -17.348 bonds (distance) P-C4' energy: -24.422 flat angles C4'-P-C4' energy: -28.042 flat angles P-C4'-P energy: -20.446 tors. eta vs tors. theta energy: -35.446 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -336.057562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.057562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.057562 (E_RNA) where: Base-Base interactions energy: -230.711 where: short stacking energy: -102.175 Base-Backbone interact. energy: -0.196 local terms energy: -105.150705 where: bonds (distance) C4'-P energy: -17.954 bonds (distance) P-C4' energy: -17.457 flat angles C4'-P-C4' energy: -23.303 flat angles P-C4'-P energy: -15.087 tors. eta vs tors. theta energy: -31.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -315.176876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.176876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.176876 (E_RNA) where: Base-Base interactions energy: -201.897 where: short stacking energy: -90.723 Base-Backbone interact. energy: -2.610 local terms energy: -110.669841 where: bonds (distance) C4'-P energy: -21.317 bonds (distance) P-C4' energy: -23.511 flat angles C4'-P-C4' energy: -27.741 flat angles P-C4'-P energy: -17.140 tors. eta vs tors. theta energy: -20.961 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -308.367423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.367423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.367423 (E_RNA) where: Base-Base interactions energy: -210.927 where: short stacking energy: -102.395 Base-Backbone interact. energy: -0.074 local terms energy: -97.366801 where: bonds (distance) C4'-P energy: -21.985 bonds (distance) P-C4' energy: -17.557 flat angles C4'-P-C4' energy: -24.229 flat angles P-C4'-P energy: -10.418 tors. eta vs tors. theta energy: -23.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -249.822652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.822652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.958648 (E_RNA) where: Base-Base interactions energy: -153.308 where: short stacking energy: -66.349 Base-Backbone interact. energy: -0.751 local terms energy: -95.900174 where: bonds (distance) C4'-P energy: -19.840 bonds (distance) P-C4' energy: -20.995 flat angles C4'-P-C4' energy: -29.872 flat angles P-C4'-P energy: -12.201 tors. eta vs tors. theta energy: -12.992 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -236.916514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.916514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.926796 (E_RNA) where: Base-Base interactions energy: -144.613 where: short stacking energy: -76.588 Base-Backbone interact. energy: 0.456 local terms energy: -92.769702 where: bonds (distance) C4'-P energy: -17.658 bonds (distance) P-C4' energy: -22.340 flat angles C4'-P-C4' energy: -20.965 flat angles P-C4'-P energy: -17.998 tors. eta vs tors. theta energy: -13.809 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -176.998582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.998582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.174097 (E_RNA) where: Base-Base interactions energy: -96.126 where: short stacking energy: -51.531 Base-Backbone interact. energy: 0.315 local terms energy: -81.363187 where: bonds (distance) C4'-P energy: -14.478 bonds (distance) P-C4' energy: -27.586 flat angles C4'-P-C4' energy: -19.823 flat angles P-C4'-P energy: -13.107 tors. eta vs tors. theta energy: -6.369 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -152.488645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.488645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.534669 (E_RNA) where: Base-Base interactions energy: -69.247 where: short stacking energy: -41.053 Base-Backbone interact. energy: -0.420 local terms energy: -82.867330 where: bonds (distance) C4'-P energy: -20.920 bonds (distance) P-C4' energy: -20.150 flat angles C4'-P-C4' energy: -22.814 flat angles P-C4'-P energy: -12.594 tors. eta vs tors. theta energy: -6.389 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -159.128161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.128161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.469571 (E_RNA) where: Base-Base interactions energy: -78.676 where: short stacking energy: -51.571 Base-Backbone interact. energy: -0.496 local terms energy: -80.297464 where: bonds (distance) C4'-P energy: -17.263 bonds (distance) P-C4' energy: -18.068 flat angles C4'-P-C4' energy: -18.324 flat angles P-C4'-P energy: -18.809 tors. eta vs tors. theta energy: -7.833 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -350.535142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.535142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.645321 (E_RNA) where: Base-Base interactions energy: -226.221 where: short stacking energy: -111.982 Base-Backbone interact. energy: -0.002 local terms energy: -124.422032 where: bonds (distance) C4'-P energy: -27.440 bonds (distance) P-C4' energy: -24.229 flat angles C4'-P-C4' energy: -27.007 flat angles P-C4'-P energy: -12.913 tors. eta vs tors. theta energy: -32.834 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -380.760233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.760233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.799681 (E_RNA) where: Base-Base interactions energy: -249.668 where: short stacking energy: -127.625 Base-Backbone interact. energy: -0.647 local terms energy: -130.483903 where: bonds (distance) C4'-P energy: -21.043 bonds (distance) P-C4' energy: -27.614 flat angles C4'-P-C4' energy: -25.590 flat angles P-C4'-P energy: -20.351 tors. eta vs tors. theta energy: -35.886 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -332.688763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.688763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.690842 (E_RNA) where: Base-Base interactions energy: -214.132 where: short stacking energy: -109.434 Base-Backbone interact. energy: -0.035 local terms energy: -118.523641 where: bonds (distance) C4'-P energy: -15.835 bonds (distance) P-C4' energy: -26.642 flat angles C4'-P-C4' energy: -25.733 flat angles P-C4'-P energy: -19.359 tors. eta vs tors. theta energy: -30.955 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -304.866178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.866178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.866178 (E_RNA) where: Base-Base interactions energy: -196.315 where: short stacking energy: -95.812 Base-Backbone interact. energy: 1.398 local terms energy: -109.949734 where: bonds (distance) C4'-P energy: -17.387 bonds (distance) P-C4' energy: -27.358 flat angles C4'-P-C4' energy: -22.241 flat angles P-C4'-P energy: -17.952 tors. eta vs tors. theta energy: -25.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -336.018456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.018456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.067654 (E_RNA) where: Base-Base interactions energy: -232.728 where: short stacking energy: -95.212 Base-Backbone interact. energy: -0.516 local terms energy: -102.824160 where: bonds (distance) C4'-P energy: -24.380 bonds (distance) P-C4' energy: -18.464 flat angles C4'-P-C4' energy: -19.518 flat angles P-C4'-P energy: -16.934 tors. eta vs tors. theta energy: -23.527 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -260.159872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.159872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.481940 (E_RNA) where: Base-Base interactions energy: -161.550 where: short stacking energy: -97.134 Base-Backbone interact. energy: -0.096 local terms energy: -98.836793 where: bonds (distance) C4'-P energy: -27.780 bonds (distance) P-C4' energy: -23.048 flat angles C4'-P-C4' energy: -22.008 flat angles P-C4'-P energy: -4.405 tors. eta vs tors. theta energy: -21.595 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -249.601349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.601349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.601349 (E_RNA) where: Base-Base interactions energy: -153.569 where: short stacking energy: -83.370 Base-Backbone interact. energy: -1.932 local terms energy: -94.100999 where: bonds (distance) C4'-P energy: -20.821 bonds (distance) P-C4' energy: -25.342 flat angles C4'-P-C4' energy: -21.284 flat angles P-C4'-P energy: -10.776 tors. eta vs tors. theta energy: -15.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -224.959470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.959470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.612070 (E_RNA) where: Base-Base interactions energy: -127.439 where: short stacking energy: -80.516 Base-Backbone interact. energy: 0.507 local terms energy: -98.679487 where: bonds (distance) C4'-P energy: -23.014 bonds (distance) P-C4' energy: -23.429 flat angles C4'-P-C4' energy: -24.017 flat angles P-C4'-P energy: -8.297 tors. eta vs tors. theta energy: -19.922 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -153.065306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.065306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.065306 (E_RNA) where: Base-Base interactions energy: -76.155 where: short stacking energy: -50.618 Base-Backbone interact. energy: -0.261 local terms energy: -76.649598 where: bonds (distance) C4'-P energy: -23.128 bonds (distance) P-C4' energy: -21.883 flat angles C4'-P-C4' energy: -18.137 flat angles P-C4'-P energy: -8.475 tors. eta vs tors. theta energy: -5.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -153.926209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.926209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.926209 (E_RNA) where: Base-Base interactions energy: -93.210 where: short stacking energy: -40.399 Base-Backbone interact. energy: -0.530 local terms energy: -60.186301 where: bonds (distance) C4'-P energy: -19.996 bonds (distance) P-C4' energy: -16.169 flat angles C4'-P-C4' energy: -8.600 flat angles P-C4'-P energy: -12.401 tors. eta vs tors. theta energy: -3.021 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -383.303809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.303809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.303809 (E_RNA) where: Base-Base interactions energy: -253.935 where: short stacking energy: -128.655 Base-Backbone interact. energy: -1.088 local terms energy: -128.280799 where: bonds (distance) C4'-P energy: -21.714 bonds (distance) P-C4' energy: -25.079 flat angles C4'-P-C4' energy: -26.517 flat angles P-C4'-P energy: -18.933 tors. eta vs tors. theta energy: -36.037 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -347.164969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.164969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.177935 (E_RNA) where: Base-Base interactions energy: -225.466 where: short stacking energy: -113.520 Base-Backbone interact. energy: -0.524 local terms energy: -121.187948 where: bonds (distance) C4'-P energy: -25.167 bonds (distance) P-C4' energy: -23.868 flat angles C4'-P-C4' energy: -26.609 flat angles P-C4'-P energy: -16.482 tors. eta vs tors. theta energy: -29.061 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -342.562051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.562051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.576068 (E_RNA) where: Base-Base interactions energy: -232.003 where: short stacking energy: -110.430 Base-Backbone interact. energy: -0.515 local terms energy: -110.058109 where: bonds (distance) C4'-P energy: -14.436 bonds (distance) P-C4' energy: -23.834 flat angles C4'-P-C4' energy: -25.484 flat angles P-C4'-P energy: -18.684 tors. eta vs tors. theta energy: -27.619 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -310.382523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.382523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.382523 (E_RNA) where: Base-Base interactions energy: -197.017 where: short stacking energy: -100.149 Base-Backbone interact. energy: -1.237 local terms energy: -112.128647 where: bonds (distance) C4'-P energy: -23.822 bonds (distance) P-C4' energy: -20.143 flat angles C4'-P-C4' energy: -26.208 flat angles P-C4'-P energy: -12.730 tors. eta vs tors. theta energy: -29.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -311.461726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.461726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.461726 (E_RNA) where: Base-Base interactions energy: -203.728 where: short stacking energy: -101.145 Base-Backbone interact. energy: -1.585 local terms energy: -106.148351 where: bonds (distance) C4'-P energy: -20.302 bonds (distance) P-C4' energy: -19.960 flat angles C4'-P-C4' energy: -21.505 flat angles P-C4'-P energy: -15.964 tors. eta vs tors. theta energy: -28.417 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -272.688660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.688660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.688660 (E_RNA) where: Base-Base interactions energy: -185.049 where: short stacking energy: -66.935 Base-Backbone interact. energy: -1.685 local terms energy: -85.954730 where: bonds (distance) C4'-P energy: -23.254 bonds (distance) P-C4' energy: -17.956 flat angles C4'-P-C4' energy: -18.913 flat angles P-C4'-P energy: -13.412 tors. eta vs tors. theta energy: -12.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -230.351514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.351514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.351514 (E_RNA) where: Base-Base interactions energy: -138.798 where: short stacking energy: -67.812 Base-Backbone interact. energy: -0.158 local terms energy: -91.395351 where: bonds (distance) C4'-P energy: -21.117 bonds (distance) P-C4' energy: -19.646 flat angles C4'-P-C4' energy: -22.725 flat angles P-C4'-P energy: -16.875 tors. eta vs tors. theta energy: -11.032 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -243.842247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.842247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.842247 (E_RNA) where: Base-Base interactions energy: -144.264 where: short stacking energy: -72.126 Base-Backbone interact. energy: -0.032 local terms energy: -99.546075 where: bonds (distance) C4'-P energy: -20.970 bonds (distance) P-C4' energy: -16.877 flat angles C4'-P-C4' energy: -24.437 flat angles P-C4'-P energy: -20.590 tors. eta vs tors. theta energy: -16.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -172.600607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.600607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.626842 (E_RNA) where: Base-Base interactions energy: -111.326 where: short stacking energy: -58.489 Base-Backbone interact. energy: -1.427 local terms energy: -59.874400 where: bonds (distance) C4'-P energy: -8.063 bonds (distance) P-C4' energy: -20.609 flat angles C4'-P-C4' energy: -17.474 flat angles P-C4'-P energy: -8.965 tors. eta vs tors. theta energy: -4.764 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -127.318953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.318953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.621636 (E_RNA) where: Base-Base interactions energy: -49.126 where: short stacking energy: -48.564 Base-Backbone interact. energy: -0.052 local terms energy: -83.443628 where: bonds (distance) C4'-P energy: -25.279 bonds (distance) P-C4' energy: -19.342 flat angles C4'-P-C4' energy: -18.931 flat angles P-C4'-P energy: -15.456 tors. eta vs tors. theta energy: -4.436 Dist. restrs. and SS energy: 5.303 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -379.602496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.602496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.607464 (E_RNA) where: Base-Base interactions energy: -251.036 where: short stacking energy: -125.241 Base-Backbone interact. energy: -0.901 local terms energy: -127.670298 where: bonds (distance) C4'-P energy: -21.950 bonds (distance) P-C4' energy: -22.730 flat angles C4'-P-C4' energy: -26.628 flat angles P-C4'-P energy: -20.507 tors. eta vs tors. theta energy: -35.854 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -367.834047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.834047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.922830 (E_RNA) where: Base-Base interactions energy: -238.832 where: short stacking energy: -125.457 Base-Backbone interact. energy: -0.636 local terms energy: -128.455308 where: bonds (distance) C4'-P energy: -25.051 bonds (distance) P-C4' energy: -23.720 flat angles C4'-P-C4' energy: -26.243 flat angles P-C4'-P energy: -15.797 tors. eta vs tors. theta energy: -37.645 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -353.224143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.224143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.231173 (E_RNA) where: Base-Base interactions energy: -227.135 where: short stacking energy: -120.707 Base-Backbone interact. energy: -1.309 local terms energy: -124.786385 where: bonds (distance) C4'-P energy: -22.779 bonds (distance) P-C4' energy: -24.163 flat angles C4'-P-C4' energy: -23.881 flat angles P-C4'-P energy: -18.058 tors. eta vs tors. theta energy: -35.906 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -295.851727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.851727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.038063 (E_RNA) where: Base-Base interactions energy: -195.029 where: short stacking energy: -98.720 Base-Backbone interact. energy: -0.791 local terms energy: -100.218188 where: bonds (distance) C4'-P energy: -20.726 bonds (distance) P-C4' energy: -25.214 flat angles C4'-P-C4' energy: -18.697 flat angles P-C4'-P energy: -14.151 tors. eta vs tors. theta energy: -21.430 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -274.494931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.494931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.534212 (E_RNA) where: Base-Base interactions energy: -170.760 where: short stacking energy: -86.194 Base-Backbone interact. energy: -0.972 local terms energy: -102.802265 where: bonds (distance) C4'-P energy: -19.521 bonds (distance) P-C4' energy: -24.364 flat angles C4'-P-C4' energy: -21.521 flat angles P-C4'-P energy: -17.838 tors. eta vs tors. theta energy: -19.558 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -255.628016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.628016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.628016 (E_RNA) where: Base-Base interactions energy: -160.144 where: short stacking energy: -81.622 Base-Backbone interact. energy: -0.991 local terms energy: -94.492642 where: bonds (distance) C4'-P energy: -19.734 bonds (distance) P-C4' energy: -20.954 flat angles C4'-P-C4' energy: -24.018 flat angles P-C4'-P energy: -10.456 tors. eta vs tors. theta energy: -19.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -244.846638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.846638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.846638 (E_RNA) where: Base-Base interactions energy: -156.029 where: short stacking energy: -80.949 Base-Backbone interact. energy: -0.044 local terms energy: -88.773438 where: bonds (distance) C4'-P energy: -12.929 bonds (distance) P-C4' energy: -24.146 flat angles C4'-P-C4' energy: -18.217 flat angles P-C4'-P energy: -11.860 tors. eta vs tors. theta energy: -21.621 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -241.751495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.751495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.776944 (E_RNA) where: Base-Base interactions energy: -158.109 where: short stacking energy: -84.236 Base-Backbone interact. energy: -0.488 local terms energy: -83.179665 where: bonds (distance) C4'-P energy: -15.687 bonds (distance) P-C4' energy: -19.487 flat angles C4'-P-C4' energy: -21.948 flat angles P-C4'-P energy: -9.969 tors. eta vs tors. theta energy: -16.088 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -180.494182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.494182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.501179 (E_RNA) where: Base-Base interactions energy: -100.867 where: short stacking energy: -49.725 Base-Backbone interact. energy: 0.801 local terms energy: -80.435779 where: bonds (distance) C4'-P energy: -20.333 bonds (distance) P-C4' energy: -23.369 flat angles C4'-P-C4' energy: -25.124 flat angles P-C4'-P energy: -10.740 tors. eta vs tors. theta energy: -0.870 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -123.099831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.099831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.286956 (E_RNA) where: Base-Base interactions energy: -64.303 where: short stacking energy: -47.718 Base-Backbone interact. energy: -1.594 local terms energy: -57.389833 where: bonds (distance) C4'-P energy: -17.177 bonds (distance) P-C4' energy: -19.362 flat angles C4'-P-C4' energy: -14.068 flat angles P-C4'-P energy: -6.846 tors. eta vs tors. theta energy: 0.063 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -353.091423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.091423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.091423 (E_RNA) where: Base-Base interactions energy: -225.843 where: short stacking energy: -109.129 Base-Backbone interact. energy: -0.849 local terms energy: -126.399641 where: bonds (distance) C4'-P energy: -21.139 bonds (distance) P-C4' energy: -25.902 flat angles C4'-P-C4' energy: -25.659 flat angles P-C4'-P energy: -18.216 tors. eta vs tors. theta energy: -35.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -366.846109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.846109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.891549 (E_RNA) where: Base-Base interactions energy: -245.014 where: short stacking energy: -120.406 Base-Backbone interact. energy: -0.110 local terms energy: -121.768158 where: bonds (distance) C4'-P energy: -22.782 bonds (distance) P-C4' energy: -23.414 flat angles C4'-P-C4' energy: -21.735 flat angles P-C4'-P energy: -20.404 tors. eta vs tors. theta energy: -33.433 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -349.396887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.396887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.403889 (E_RNA) where: Base-Base interactions energy: -223.022 where: short stacking energy: -106.830 Base-Backbone interact. energy: -1.025 local terms energy: -125.357618 where: bonds (distance) C4'-P energy: -25.846 bonds (distance) P-C4' energy: -19.349 flat angles C4'-P-C4' energy: -28.233 flat angles P-C4'-P energy: -21.011 tors. eta vs tors. theta energy: -30.918 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -326.688715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.688715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.725309 (E_RNA) where: Base-Base interactions energy: -211.722 where: short stacking energy: -110.679 Base-Backbone interact. energy: -0.084 local terms energy: -114.919370 where: bonds (distance) C4'-P energy: -20.646 bonds (distance) P-C4' energy: -21.970 flat angles C4'-P-C4' energy: -22.559 flat angles P-C4'-P energy: -14.519 tors. eta vs tors. theta energy: -35.225 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -278.009581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.009581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.071309 (E_RNA) where: Base-Base interactions energy: -167.511 where: short stacking energy: -94.017 Base-Backbone interact. energy: -0.907 local terms energy: -109.652905 where: bonds (distance) C4'-P energy: -20.505 bonds (distance) P-C4' energy: -22.937 flat angles C4'-P-C4' energy: -20.798 flat angles P-C4'-P energy: -19.422 tors. eta vs tors. theta energy: -25.991 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -239.945685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.945685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.319158 (E_RNA) where: Base-Base interactions energy: -139.323 where: short stacking energy: -70.302 Base-Backbone interact. energy: -0.537 local terms energy: -100.459392 where: bonds (distance) C4'-P energy: -25.269 bonds (distance) P-C4' energy: -22.472 flat angles C4'-P-C4' energy: -23.115 flat angles P-C4'-P energy: -9.484 tors. eta vs tors. theta energy: -20.119 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -275.029731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.029731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.029731 (E_RNA) where: Base-Base interactions energy: -167.434 where: short stacking energy: -81.894 Base-Backbone interact. energy: -0.419 local terms energy: -107.176507 where: bonds (distance) C4'-P energy: -26.707 bonds (distance) P-C4' energy: -25.085 flat angles C4'-P-C4' energy: -20.474 flat angles P-C4'-P energy: -12.694 tors. eta vs tors. theta energy: -22.216 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -235.554319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.554319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.563145 (E_RNA) where: Base-Base interactions energy: -141.392 where: short stacking energy: -77.186 Base-Backbone interact. energy: -0.686 local terms energy: -93.485652 where: bonds (distance) C4'-P energy: -18.953 bonds (distance) P-C4' energy: -24.750 flat angles C4'-P-C4' energy: -22.576 flat angles P-C4'-P energy: -9.667 tors. eta vs tors. theta energy: -17.539 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -130.027758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.027758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.296871 (E_RNA) where: Base-Base interactions energy: -58.357 where: short stacking energy: -51.584 Base-Backbone interact. energy: -0.577 local terms energy: -73.362466 where: bonds (distance) C4'-P energy: -24.042 bonds (distance) P-C4' energy: -23.084 flat angles C4'-P-C4' energy: -17.502 flat angles P-C4'-P energy: -3.955 tors. eta vs tors. theta energy: -4.779 Dist. restrs. and SS energy: 2.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -154.959406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.959406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.972372 (E_RNA) where: Base-Base interactions energy: -73.697 where: short stacking energy: -46.715 Base-Backbone interact. energy: -0.534 local terms energy: -80.740983 where: bonds (distance) C4'-P energy: -15.578 bonds (distance) P-C4' energy: -21.193 flat angles C4'-P-C4' energy: -17.212 flat angles P-C4'-P energy: -19.355 tors. eta vs tors. theta energy: -7.403 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -366.548830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.548830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.775315 (E_RNA) where: Base-Base interactions energy: -231.244 where: short stacking energy: -119.024 Base-Backbone interact. energy: -1.126 local terms energy: -134.405927 where: bonds (distance) C4'-P energy: -21.645 bonds (distance) P-C4' energy: -26.475 flat angles C4'-P-C4' energy: -30.384 flat angles P-C4'-P energy: -22.025 tors. eta vs tors. theta energy: -33.877 Dist. restrs. and SS energy: 0.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -378.366336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.366336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.539921 (E_RNA) where: Base-Base interactions energy: -251.024 where: short stacking energy: -126.419 Base-Backbone interact. energy: -0.308 local terms energy: -127.207719 where: bonds (distance) C4'-P energy: -21.030 bonds (distance) P-C4' energy: -25.218 flat angles C4'-P-C4' energy: -26.003 flat angles P-C4'-P energy: -18.393 tors. eta vs tors. theta energy: -36.563 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -350.288070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.288070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.288070 (E_RNA) where: Base-Base interactions energy: -221.735 where: short stacking energy: -105.074 Base-Backbone interact. energy: -1.405 local terms energy: -127.147945 where: bonds (distance) C4'-P energy: -22.354 bonds (distance) P-C4' energy: -27.008 flat angles C4'-P-C4' energy: -28.116 flat angles P-C4'-P energy: -18.652 tors. eta vs tors. theta energy: -31.018 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -330.388881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.388881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.388881 (E_RNA) where: Base-Base interactions energy: -223.307 where: short stacking energy: -105.521 Base-Backbone interact. energy: -2.482 local terms energy: -104.600121 where: bonds (distance) C4'-P energy: -16.694 bonds (distance) P-C4' energy: -22.597 flat angles C4'-P-C4' energy: -27.829 flat angles P-C4'-P energy: -6.001 tors. eta vs tors. theta energy: -31.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -246.869092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.869092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.869092 (E_RNA) where: Base-Base interactions energy: -140.888 where: short stacking energy: -90.431 Base-Backbone interact. energy: 0.499 local terms energy: -106.480007 where: bonds (distance) C4'-P energy: -16.388 bonds (distance) P-C4' energy: -24.753 flat angles C4'-P-C4' energy: -23.746 flat angles P-C4'-P energy: -18.401 tors. eta vs tors. theta energy: -23.192 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -281.948858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.948858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.976091 (E_RNA) where: Base-Base interactions energy: -182.828 where: short stacking energy: -87.304 Base-Backbone interact. energy: -0.509 local terms energy: -98.638861 where: bonds (distance) C4'-P energy: -18.560 bonds (distance) P-C4' energy: -22.748 flat angles C4'-P-C4' energy: -25.374 flat angles P-C4'-P energy: -8.492 tors. eta vs tors. theta energy: -23.464 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -271.632251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.632251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.632251 (E_RNA) where: Base-Base interactions energy: -180.194 where: short stacking energy: -92.078 Base-Backbone interact. energy: -0.181 local terms energy: -91.256876 where: bonds (distance) C4'-P energy: -13.539 bonds (distance) P-C4' energy: -20.297 flat angles C4'-P-C4' energy: -24.176 flat angles P-C4'-P energy: -11.556 tors. eta vs tors. theta energy: -21.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -220.848975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.848975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.887484 (E_RNA) where: Base-Base interactions energy: -127.143 where: short stacking energy: -67.415 Base-Backbone interact. energy: -0.453 local terms energy: -93.290961 where: bonds (distance) C4'-P energy: -21.678 bonds (distance) P-C4' energy: -21.623 flat angles C4'-P-C4' energy: -26.987 flat angles P-C4'-P energy: -13.988 tors. eta vs tors. theta energy: -9.015 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -126.396574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.396574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.931808 (E_RNA) where: Base-Base interactions energy: -53.405 where: short stacking energy: -41.191 Base-Backbone interact. energy: -0.443 local terms energy: -74.083987 where: bonds (distance) C4'-P energy: -23.517 bonds (distance) P-C4' energy: -23.942 flat angles C4'-P-C4' energy: -18.653 flat angles P-C4'-P energy: -8.713 tors. eta vs tors. theta energy: 0.742 Dist. restrs. and SS energy: 1.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -161.928304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.928304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.966489 (E_RNA) where: Base-Base interactions energy: -85.685 where: short stacking energy: -52.668 Base-Backbone interact. energy: 0.688 local terms energy: -76.969494 where: bonds (distance) C4'-P energy: -26.306 bonds (distance) P-C4' energy: -21.013 flat angles C4'-P-C4' energy: -13.298 flat angles P-C4'-P energy: -11.347 tors. eta vs tors. theta energy: -5.005 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -382.701058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.701058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.701058 (E_RNA) where: Base-Base interactions energy: -256.843 where: short stacking energy: -118.337 Base-Backbone interact. energy: -0.108 local terms energy: -125.749862 where: bonds (distance) C4'-P energy: -21.711 bonds (distance) P-C4' energy: -25.590 flat angles C4'-P-C4' energy: -29.796 flat angles P-C4'-P energy: -16.632 tors. eta vs tors. theta energy: -32.022 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -354.683802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.683802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.688467 (E_RNA) where: Base-Base interactions energy: -227.818 where: short stacking energy: -120.687 Base-Backbone interact. energy: -0.088 local terms energy: -126.781916 where: bonds (distance) C4'-P energy: -21.132 bonds (distance) P-C4' energy: -22.867 flat angles C4'-P-C4' energy: -23.268 flat angles P-C4'-P energy: -23.536 tors. eta vs tors. theta energy: -35.980 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -333.730911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.730911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.730911 (E_RNA) where: Base-Base interactions energy: -219.271 where: short stacking energy: -108.422 Base-Backbone interact. energy: -0.337 local terms energy: -114.122885 where: bonds (distance) C4'-P energy: -20.499 bonds (distance) P-C4' energy: -25.758 flat angles C4'-P-C4' energy: -25.499 flat angles P-C4'-P energy: -15.705 tors. eta vs tors. theta energy: -26.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -337.269823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.269823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.341229 (E_RNA) where: Base-Base interactions energy: -217.405 where: short stacking energy: -114.316 Base-Backbone interact. energy: -0.035 local terms energy: -119.901252 where: bonds (distance) C4'-P energy: -20.020 bonds (distance) P-C4' energy: -21.433 flat angles C4'-P-C4' energy: -24.390 flat angles P-C4'-P energy: -19.382 tors. eta vs tors. theta energy: -34.675 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -267.391572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.391572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.404885 (E_RNA) where: Base-Base interactions energy: -152.311 where: short stacking energy: -79.286 Base-Backbone interact. energy: -0.443 local terms energy: -114.650494 where: bonds (distance) C4'-P energy: -24.638 bonds (distance) P-C4' energy: -20.542 flat angles C4'-P-C4' energy: -23.877 flat angles P-C4'-P energy: -18.844 tors. eta vs tors. theta energy: -26.749 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -243.042154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.042154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.042154 (E_RNA) where: Base-Base interactions energy: -156.020 where: short stacking energy: -73.857 Base-Backbone interact. energy: -1.065 local terms energy: -85.957295 where: bonds (distance) C4'-P energy: -20.919 bonds (distance) P-C4' energy: -22.830 flat angles C4'-P-C4' energy: -23.162 flat angles P-C4'-P energy: -2.395 tors. eta vs tors. theta energy: -16.652 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -264.690198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.690198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.690198 (E_RNA) where: Base-Base interactions energy: -173.873 where: short stacking energy: -86.327 Base-Backbone interact. energy: -0.079 local terms energy: -90.738225 where: bonds (distance) C4'-P energy: -20.609 bonds (distance) P-C4' energy: -15.040 flat angles C4'-P-C4' energy: -23.067 flat angles P-C4'-P energy: -12.829 tors. eta vs tors. theta energy: -19.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -258.802761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.802761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.844823 (E_RNA) where: Base-Base interactions energy: -166.102 where: short stacking energy: -73.375 Base-Backbone interact. energy: -0.838 local terms energy: -91.904597 where: bonds (distance) C4'-P energy: -17.129 bonds (distance) P-C4' energy: -25.129 flat angles C4'-P-C4' energy: -23.796 flat angles P-C4'-P energy: -11.919 tors. eta vs tors. theta energy: -13.931 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -169.924967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.924967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.953678 (E_RNA) where: Base-Base interactions energy: -93.727 where: short stacking energy: -46.197 Base-Backbone interact. energy: -0.210 local terms energy: -76.017223 where: bonds (distance) C4'-P energy: -13.189 bonds (distance) P-C4' energy: -22.187 flat angles C4'-P-C4' energy: -21.386 flat angles P-C4'-P energy: -8.339 tors. eta vs tors. theta energy: -10.916 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -120.150937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.150937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.187132 (E_RNA) where: Base-Base interactions energy: -57.166 where: short stacking energy: -42.802 Base-Backbone interact. energy: 0.448 local terms energy: -69.469551 where: bonds (distance) C4'-P energy: -18.091 bonds (distance) P-C4' energy: -21.807 flat angles C4'-P-C4' energy: -20.968 flat angles P-C4'-P energy: -11.767 tors. eta vs tors. theta energy: 3.162 Dist. restrs. and SS energy: 6.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -374.954479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.954479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.016763 (E_RNA) where: Base-Base interactions energy: -249.755 where: short stacking energy: -125.487 Base-Backbone interact. energy: -0.050 local terms energy: -125.211728 where: bonds (distance) C4'-P energy: -24.298 bonds (distance) P-C4' energy: -21.523 flat angles C4'-P-C4' energy: -26.787 flat angles P-C4'-P energy: -17.931 tors. eta vs tors. theta energy: -34.673 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -348.142990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.142990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.213131 (E_RNA) where: Base-Base interactions energy: -228.269 where: short stacking energy: -114.006 Base-Backbone interact. energy: -0.211 local terms energy: -119.732370 where: bonds (distance) C4'-P energy: -18.510 bonds (distance) P-C4' energy: -22.333 flat angles C4'-P-C4' energy: -26.563 flat angles P-C4'-P energy: -19.617 tors. eta vs tors. theta energy: -32.710 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -363.019164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.019164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.019164 (E_RNA) where: Base-Base interactions energy: -238.937 where: short stacking energy: -110.162 Base-Backbone interact. energy: -1.697 local terms energy: -122.385762 where: bonds (distance) C4'-P energy: -14.792 bonds (distance) P-C4' energy: -26.199 flat angles C4'-P-C4' energy: -26.761 flat angles P-C4'-P energy: -18.999 tors. eta vs tors. theta energy: -35.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -350.068663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.068663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.068663 (E_RNA) where: Base-Base interactions energy: -233.696 where: short stacking energy: -124.936 Base-Backbone interact. energy: -0.453 local terms energy: -115.919442 where: bonds (distance) C4'-P energy: -18.499 bonds (distance) P-C4' energy: -23.332 flat angles C4'-P-C4' energy: -25.592 flat angles P-C4'-P energy: -16.611 tors. eta vs tors. theta energy: -31.885 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -293.595194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.595194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.617107 (E_RNA) where: Base-Base interactions energy: -181.033 where: short stacking energy: -92.960 Base-Backbone interact. energy: -0.035 local terms energy: -112.549005 where: bonds (distance) C4'-P energy: -18.576 bonds (distance) P-C4' energy: -24.736 flat angles C4'-P-C4' energy: -26.953 flat angles P-C4'-P energy: -17.784 tors. eta vs tors. theta energy: -24.500 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -236.435936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.435936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.435936 (E_RNA) where: Base-Base interactions energy: -134.189 where: short stacking energy: -78.109 Base-Backbone interact. energy: 2.658 local terms energy: -104.904968 where: bonds (distance) C4'-P energy: -22.945 bonds (distance) P-C4' energy: -24.313 flat angles C4'-P-C4' energy: -25.370 flat angles P-C4'-P energy: -14.967 tors. eta vs tors. theta energy: -17.310 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -279.659725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.659725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.702729 (E_RNA) where: Base-Base interactions energy: -181.623 where: short stacking energy: -92.109 Base-Backbone interact. energy: -0.898 local terms energy: -97.181588 where: bonds (distance) C4'-P energy: -13.431 bonds (distance) P-C4' energy: -23.188 flat angles C4'-P-C4' energy: -22.619 flat angles P-C4'-P energy: -12.680 tors. eta vs tors. theta energy: -25.264 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -267.668889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.668889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.711190 (E_RNA) where: Base-Base interactions energy: -167.570 where: short stacking energy: -95.910 Base-Backbone interact. energy: 1.023 local terms energy: -101.163319 where: bonds (distance) C4'-P energy: -22.407 bonds (distance) P-C4' energy: -19.227 flat angles C4'-P-C4' energy: -16.541 flat angles P-C4'-P energy: -16.992 tors. eta vs tors. theta energy: -25.996 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -176.392396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.392396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.392396 (E_RNA) where: Base-Base interactions energy: -88.168 where: short stacking energy: -59.091 Base-Backbone interact. energy: -0.282 local terms energy: -87.942824 where: bonds (distance) C4'-P energy: -22.910 bonds (distance) P-C4' energy: -18.106 flat angles C4'-P-C4' energy: -23.941 flat angles P-C4'-P energy: -12.172 tors. eta vs tors. theta energy: -10.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -149.642864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.642864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.677072 (E_RNA) where: Base-Base interactions energy: -72.908 where: short stacking energy: -39.606 Base-Backbone interact. energy: -2.516 local terms energy: -74.252723 where: bonds (distance) C4'-P energy: -21.922 bonds (distance) P-C4' energy: -21.567 flat angles C4'-P-C4' energy: -20.241 flat angles P-C4'-P energy: -12.083 tors. eta vs tors. theta energy: 1.560 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -377.208277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.208277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.208277 (E_RNA) where: Base-Base interactions energy: -254.776 where: short stacking energy: -119.661 Base-Backbone interact. energy: -0.983 local terms energy: -121.448750 where: bonds (distance) C4'-P energy: -25.213 bonds (distance) P-C4' energy: -21.151 flat angles C4'-P-C4' energy: -24.499 flat angles P-C4'-P energy: -15.035 tors. eta vs tors. theta energy: -35.551 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -346.231183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.231183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.303474 (E_RNA) where: Base-Base interactions energy: -227.483 where: short stacking energy: -108.243 Base-Backbone interact. energy: -0.150 local terms energy: -118.670308 where: bonds (distance) C4'-P energy: -23.817 bonds (distance) P-C4' energy: -24.247 flat angles C4'-P-C4' energy: -24.324 flat angles P-C4'-P energy: -14.306 tors. eta vs tors. theta energy: -31.976 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -357.773718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.773718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.773718 (E_RNA) where: Base-Base interactions energy: -225.688 where: short stacking energy: -113.545 Base-Backbone interact. energy: -0.033 local terms energy: -132.053158 where: bonds (distance) C4'-P energy: -24.452 bonds (distance) P-C4' energy: -27.473 flat angles C4'-P-C4' energy: -26.081 flat angles P-C4'-P energy: -20.358 tors. eta vs tors. theta energy: -33.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -345.319838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.319838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.387965 (E_RNA) where: Base-Base interactions energy: -217.479 where: short stacking energy: -120.714 Base-Backbone interact. energy: -1.170 local terms energy: -126.738834 where: bonds (distance) C4'-P energy: -20.308 bonds (distance) P-C4' energy: -25.943 flat angles C4'-P-C4' energy: -26.721 flat angles P-C4'-P energy: -20.715 tors. eta vs tors. theta energy: -33.052 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -303.870855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.870855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.870855 (E_RNA) where: Base-Base interactions energy: -199.259 where: short stacking energy: -105.860 Base-Backbone interact. energy: -1.896 local terms energy: -102.715332 where: bonds (distance) C4'-P energy: -20.767 bonds (distance) P-C4' energy: -15.499 flat angles C4'-P-C4' energy: -24.028 flat angles P-C4'-P energy: -16.028 tors. eta vs tors. theta energy: -26.394 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -208.441878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.441878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.441878 (E_RNA) where: Base-Base interactions energy: -117.333 where: short stacking energy: -68.341 Base-Backbone interact. energy: -0.124 local terms energy: -90.984899 where: bonds (distance) C4'-P energy: -23.011 bonds (distance) P-C4' energy: -17.577 flat angles C4'-P-C4' energy: -26.215 flat angles P-C4'-P energy: -15.564 tors. eta vs tors. theta energy: -8.618 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -261.088223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.088223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.088223 (E_RNA) where: Base-Base interactions energy: -158.041 where: short stacking energy: -73.155 Base-Backbone interact. energy: -1.165 local terms energy: -101.881832 where: bonds (distance) C4'-P energy: -24.346 bonds (distance) P-C4' energy: -23.570 flat angles C4'-P-C4' energy: -22.566 flat angles P-C4'-P energy: -18.456 tors. eta vs tors. theta energy: -12.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -217.799672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.799672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.846199 (E_RNA) where: Base-Base interactions energy: -133.004 where: short stacking energy: -66.444 Base-Backbone interact. energy: 0.557 local terms energy: -85.398900 where: bonds (distance) C4'-P energy: -20.328 bonds (distance) P-C4' energy: -21.204 flat angles C4'-P-C4' energy: -21.405 flat angles P-C4'-P energy: -10.540 tors. eta vs tors. theta energy: -11.921 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -174.102774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.102774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.240515 (E_RNA) where: Base-Base interactions energy: -93.254 where: short stacking energy: -65.342 Base-Backbone interact. energy: -0.667 local terms energy: -80.320319 where: bonds (distance) C4'-P energy: -14.936 bonds (distance) P-C4' energy: -23.684 flat angles C4'-P-C4' energy: -18.256 flat angles P-C4'-P energy: -16.610 tors. eta vs tors. theta energy: -6.835 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -157.447053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.447053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.448762 (E_RNA) where: Base-Base interactions energy: -83.873 where: short stacking energy: -57.058 Base-Backbone interact. energy: -0.030 local terms energy: -73.546011 where: bonds (distance) C4'-P energy: -24.341 bonds (distance) P-C4' energy: -15.595 flat angles C4'-P-C4' energy: -18.991 flat angles P-C4'-P energy: -11.043 tors. eta vs tors. theta energy: -3.576 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -383.032058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.032058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.040698 (E_RNA) where: Base-Base interactions energy: -258.459 where: short stacking energy: -116.628 Base-Backbone interact. energy: -0.324 local terms energy: -124.257834 where: bonds (distance) C4'-P energy: -22.397 bonds (distance) P-C4' energy: -24.293 flat angles C4'-P-C4' energy: -19.754 flat angles P-C4'-P energy: -21.266 tors. eta vs tors. theta energy: -36.548 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -367.828311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.828311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.846587 (E_RNA) where: Base-Base interactions energy: -236.485 where: short stacking energy: -125.624 Base-Backbone interact. energy: -0.418 local terms energy: -130.944271 where: bonds (distance) C4'-P energy: -21.996 bonds (distance) P-C4' energy: -27.038 flat angles C4'-P-C4' energy: -26.845 flat angles P-C4'-P energy: -16.099 tors. eta vs tors. theta energy: -38.966 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -342.175634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.175634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.175634 (E_RNA) where: Base-Base interactions energy: -218.749 where: short stacking energy: -115.908 Base-Backbone interact. energy: -1.244 local terms energy: -122.182393 where: bonds (distance) C4'-P energy: -19.942 bonds (distance) P-C4' energy: -21.622 flat angles C4'-P-C4' energy: -29.183 flat angles P-C4'-P energy: -17.650 tors. eta vs tors. theta energy: -33.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -322.248578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.248578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.248578 (E_RNA) where: Base-Base interactions energy: -208.132 where: short stacking energy: -98.495 Base-Backbone interact. energy: -0.929 local terms energy: -113.187390 where: bonds (distance) C4'-P energy: -18.743 bonds (distance) P-C4' energy: -24.948 flat angles C4'-P-C4' energy: -23.649 flat angles P-C4'-P energy: -15.834 tors. eta vs tors. theta energy: -30.013 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -315.140982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.140982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.151715 (E_RNA) where: Base-Base interactions energy: -197.475 where: short stacking energy: -94.727 Base-Backbone interact. energy: -0.233 local terms energy: -117.443424 where: bonds (distance) C4'-P energy: -24.616 bonds (distance) P-C4' energy: -27.042 flat angles C4'-P-C4' energy: -25.084 flat angles P-C4'-P energy: -16.146 tors. eta vs tors. theta energy: -24.554 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -279.301177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.301177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.314920 (E_RNA) where: Base-Base interactions energy: -182.709 where: short stacking energy: -86.016 Base-Backbone interact. energy: -0.633 local terms energy: -95.972795 where: bonds (distance) C4'-P energy: -19.290 bonds (distance) P-C4' energy: -23.126 flat angles C4'-P-C4' energy: -20.525 flat angles P-C4'-P energy: -16.213 tors. eta vs tors. theta energy: -16.819 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -232.489143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.489143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.489143 (E_RNA) where: Base-Base interactions energy: -141.409 where: short stacking energy: -73.988 Base-Backbone interact. energy: 0.353 local terms energy: -91.433194 where: bonds (distance) C4'-P energy: -23.874 bonds (distance) P-C4' energy: -13.671 flat angles C4'-P-C4' energy: -23.684 flat angles P-C4'-P energy: -14.652 tors. eta vs tors. theta energy: -15.552 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -197.488875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.488875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -197.520158 (E_RNA) where: Base-Base interactions energy: -102.798 where: short stacking energy: -55.909 Base-Backbone interact. energy: 0.411 local terms energy: -95.133931 where: bonds (distance) C4'-P energy: -26.586 bonds (distance) P-C4' energy: -26.800 flat angles C4'-P-C4' energy: -14.065 flat angles P-C4'-P energy: -16.332 tors. eta vs tors. theta energy: -11.350 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -210.675363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.675363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.089551 (E_RNA) where: Base-Base interactions energy: -122.240 where: short stacking energy: -68.661 Base-Backbone interact. energy: -0.068 local terms energy: -88.781867 where: bonds (distance) C4'-P energy: -20.507 bonds (distance) P-C4' energy: -21.323 flat angles C4'-P-C4' energy: -24.919 flat angles P-C4'-P energy: -10.745 tors. eta vs tors. theta energy: -11.288 Dist. restrs. and SS energy: 0.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -154.470980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.470980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.470980 (E_RNA) where: Base-Base interactions energy: -70.984 where: short stacking energy: -40.819 Base-Backbone interact. energy: -1.602 local terms energy: -81.884397 where: bonds (distance) C4'-P energy: -20.664 bonds (distance) P-C4' energy: -20.794 flat angles C4'-P-C4' energy: -16.093 flat angles P-C4'-P energy: -17.656 tors. eta vs tors. theta energy: -6.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -363.194838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.194838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.194838 (E_RNA) where: Base-Base interactions energy: -242.049 where: short stacking energy: -120.053 Base-Backbone interact. energy: -0.002 local terms energy: -121.143175 where: bonds (distance) C4'-P energy: -22.010 bonds (distance) P-C4' energy: -22.736 flat angles C4'-P-C4' energy: -25.817 flat angles P-C4'-P energy: -19.719 tors. eta vs tors. theta energy: -30.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -375.397754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.397754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.397754 (E_RNA) where: Base-Base interactions energy: -250.036 where: short stacking energy: -121.856 Base-Backbone interact. energy: -0.424 local terms energy: -124.937732 where: bonds (distance) C4'-P energy: -26.190 bonds (distance) P-C4' energy: -25.427 flat angles C4'-P-C4' energy: -23.183 flat angles P-C4'-P energy: -16.487 tors. eta vs tors. theta energy: -33.651 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -353.507209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.507209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.507209 (E_RNA) where: Base-Base interactions energy: -237.785 where: short stacking energy: -111.295 Base-Backbone interact. energy: -0.482 local terms energy: -115.240763 where: bonds (distance) C4'-P energy: -20.651 bonds (distance) P-C4' energy: -23.109 flat angles C4'-P-C4' energy: -20.280 flat angles P-C4'-P energy: -16.724 tors. eta vs tors. theta energy: -34.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -345.310624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.310624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.310624 (E_RNA) where: Base-Base interactions energy: -218.766 where: short stacking energy: -110.468 Base-Backbone interact. energy: -0.290 local terms energy: -126.254428 where: bonds (distance) C4'-P energy: -23.756 bonds (distance) P-C4' energy: -25.561 flat angles C4'-P-C4' energy: -27.498 flat angles P-C4'-P energy: -15.410 tors. eta vs tors. theta energy: -34.029 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -305.148458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.148458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.162785 (E_RNA) where: Base-Base interactions energy: -194.385 where: short stacking energy: -93.514 Base-Backbone interact. energy: -0.439 local terms energy: -110.339180 where: bonds (distance) C4'-P energy: -22.784 bonds (distance) P-C4' energy: -27.822 flat angles C4'-P-C4' energy: -24.213 flat angles P-C4'-P energy: -7.814 tors. eta vs tors. theta energy: -27.706 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -267.601484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.601484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.601484 (E_RNA) where: Base-Base interactions energy: -159.330 where: short stacking energy: -87.130 Base-Backbone interact. energy: -0.928 local terms energy: -107.343023 where: bonds (distance) C4'-P energy: -20.266 bonds (distance) P-C4' energy: -24.158 flat angles C4'-P-C4' energy: -21.825 flat angles P-C4'-P energy: -15.329 tors. eta vs tors. theta energy: -25.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -184.175891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.175891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.177148 (E_RNA) where: Base-Base interactions energy: -104.995 where: short stacking energy: -59.965 Base-Backbone interact. energy: 0.237 local terms energy: -79.419120 where: bonds (distance) C4'-P energy: -20.862 bonds (distance) P-C4' energy: -19.341 flat angles C4'-P-C4' energy: -15.311 flat angles P-C4'-P energy: -13.251 tors. eta vs tors. theta energy: -10.653 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -187.969610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.969610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.003040 (E_RNA) where: Base-Base interactions energy: -90.987 where: short stacking energy: -53.269 Base-Backbone interact. energy: -0.587 local terms energy: -96.429633 where: bonds (distance) C4'-P energy: -22.924 bonds (distance) P-C4' energy: -27.490 flat angles C4'-P-C4' energy: -19.490 flat angles P-C4'-P energy: -18.471 tors. eta vs tors. theta energy: -8.055 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -226.887574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.887574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.019058 (E_RNA) where: Base-Base interactions energy: -142.306 where: short stacking energy: -75.264 Base-Backbone interact. energy: 0.306 local terms energy: -85.019072 where: bonds (distance) C4'-P energy: -11.774 bonds (distance) P-C4' energy: -19.927 flat angles C4'-P-C4' energy: -19.476 flat angles P-C4'-P energy: -14.369 tors. eta vs tors. theta energy: -19.474 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -151.080447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.080447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.080863 (E_RNA) where: Base-Base interactions energy: -68.740 where: short stacking energy: -43.555 Base-Backbone interact. energy: -0.163 local terms energy: -82.177935 where: bonds (distance) C4'-P energy: -22.473 bonds (distance) P-C4' energy: -25.496 flat angles C4'-P-C4' energy: -18.923 flat angles P-C4'-P energy: -11.377 tors. eta vs tors. theta energy: -3.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -367.821131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.821131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.835800 (E_RNA) where: Base-Base interactions energy: -231.309 where: short stacking energy: -123.555 Base-Backbone interact. energy: -0.663 local terms energy: -135.863104 where: bonds (distance) C4'-P energy: -23.449 bonds (distance) P-C4' energy: -22.369 flat angles C4'-P-C4' energy: -29.294 flat angles P-C4'-P energy: -22.734 tors. eta vs tors. theta energy: -38.018 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -379.448513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.448513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.448513 (E_RNA) where: Base-Base interactions energy: -250.360 where: short stacking energy: -129.029 Base-Backbone interact. energy: -0.029 local terms energy: -129.060077 where: bonds (distance) C4'-P energy: -22.813 bonds (distance) P-C4' energy: -24.660 flat angles C4'-P-C4' energy: -27.292 flat angles P-C4'-P energy: -15.658 tors. eta vs tors. theta energy: -38.637 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -343.843653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.843653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.843653 (E_RNA) where: Base-Base interactions energy: -219.299 where: short stacking energy: -109.661 Base-Backbone interact. energy: -1.136 local terms energy: -123.408298 where: bonds (distance) C4'-P energy: -25.352 bonds (distance) P-C4' energy: -20.218 flat angles C4'-P-C4' energy: -25.459 flat angles P-C4'-P energy: -17.596 tors. eta vs tors. theta energy: -34.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -367.705945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.705945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.755514 (E_RNA) where: Base-Base interactions energy: -238.910 where: short stacking energy: -119.281 Base-Backbone interact. energy: -0.431 local terms energy: -128.413916 where: bonds (distance) C4'-P energy: -27.362 bonds (distance) P-C4' energy: -23.216 flat angles C4'-P-C4' energy: -28.900 flat angles P-C4'-P energy: -13.478 tors. eta vs tors. theta energy: -35.458 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -345.071027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.071027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.266234 (E_RNA) where: Base-Base interactions energy: -226.492 where: short stacking energy: -114.377 Base-Backbone interact. energy: -0.007 local terms energy: -118.767581 where: bonds (distance) C4'-P energy: -22.817 bonds (distance) P-C4' energy: -25.189 flat angles C4'-P-C4' energy: -19.158 flat angles P-C4'-P energy: -17.304 tors. eta vs tors. theta energy: -34.299 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -304.382492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.382492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.405636 (E_RNA) where: Base-Base interactions energy: -194.514 where: short stacking energy: -88.249 Base-Backbone interact. energy: -0.148 local terms energy: -109.744449 where: bonds (distance) C4'-P energy: -18.256 bonds (distance) P-C4' energy: -25.588 flat angles C4'-P-C4' energy: -24.055 flat angles P-C4'-P energy: -16.056 tors. eta vs tors. theta energy: -25.790 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -186.086066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.086066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.099712 (E_RNA) where: Base-Base interactions energy: -103.038 where: short stacking energy: -71.030 Base-Backbone interact. energy: -0.286 local terms energy: -82.775213 where: bonds (distance) C4'-P energy: -19.617 bonds (distance) P-C4' energy: -20.911 flat angles C4'-P-C4' energy: -22.425 flat angles P-C4'-P energy: -11.285 tors. eta vs tors. theta energy: -8.537 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -232.573933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.573933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.573933 (E_RNA) where: Base-Base interactions energy: -139.214 where: short stacking energy: -81.435 Base-Backbone interact. energy: -0.352 local terms energy: -93.007456 where: bonds (distance) C4'-P energy: -21.603 bonds (distance) P-C4' energy: -21.440 flat angles C4'-P-C4' energy: -18.552 flat angles P-C4'-P energy: -11.422 tors. eta vs tors. theta energy: -19.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -143.722856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.722856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.037402 (E_RNA) where: Base-Base interactions energy: -58.402 where: short stacking energy: -41.015 Base-Backbone interact. energy: -0.389 local terms energy: -85.247052 where: bonds (distance) C4'-P energy: -22.160 bonds (distance) P-C4' energy: -24.386 flat angles C4'-P-C4' energy: -25.622 flat angles P-C4'-P energy: -11.157 tors. eta vs tors. theta energy: -1.921 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -151.257477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.257477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.770788 (E_RNA) where: Base-Base interactions energy: -78.430 where: short stacking energy: -59.319 Base-Backbone interact. energy: -0.247 local terms energy: -73.093263 where: bonds (distance) C4'-P energy: -13.028 bonds (distance) P-C4' energy: -22.271 flat angles C4'-P-C4' energy: -21.639 flat angles P-C4'-P energy: -14.687 tors. eta vs tors. theta energy: -1.467 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -376.854643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.854643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.883449 (E_RNA) where: Base-Base interactions energy: -245.121 where: short stacking energy: -116.099 Base-Backbone interact. energy: -0.040 local terms energy: -131.723143 where: bonds (distance) C4'-P energy: -17.028 bonds (distance) P-C4' energy: -25.764 flat angles C4'-P-C4' energy: -30.880 flat angles P-C4'-P energy: -21.249 tors. eta vs tors. theta energy: -36.801 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -361.989743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.989743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.002975 (E_RNA) where: Base-Base interactions energy: -235.410 where: short stacking energy: -124.026 Base-Backbone interact. energy: -0.457 local terms energy: -126.135783 where: bonds (distance) C4'-P energy: -21.634 bonds (distance) P-C4' energy: -22.982 flat angles C4'-P-C4' energy: -24.800 flat angles P-C4'-P energy: -17.789 tors. eta vs tors. theta energy: -38.930 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -367.328285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.328285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.332598 (E_RNA) where: Base-Base interactions energy: -235.724 where: short stacking energy: -119.326 Base-Backbone interact. energy: -0.911 local terms energy: -130.697436 where: bonds (distance) C4'-P energy: -27.352 bonds (distance) P-C4' energy: -22.740 flat angles C4'-P-C4' energy: -27.181 flat angles P-C4'-P energy: -18.533 tors. eta vs tors. theta energy: -34.891 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -339.669230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.669230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.669230 (E_RNA) where: Base-Base interactions energy: -228.504 where: short stacking energy: -122.463 Base-Backbone interact. energy: -0.486 local terms energy: -110.679252 where: bonds (distance) C4'-P energy: -18.792 bonds (distance) P-C4' energy: -16.015 flat angles C4'-P-C4' energy: -25.858 flat angles P-C4'-P energy: -16.712 tors. eta vs tors. theta energy: -33.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -335.045581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.045581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.045581 (E_RNA) where: Base-Base interactions energy: -220.312 where: short stacking energy: -115.526 Base-Backbone interact. energy: -0.481 local terms energy: -114.252889 where: bonds (distance) C4'-P energy: -24.348 bonds (distance) P-C4' energy: -17.717 flat angles C4'-P-C4' energy: -25.586 flat angles P-C4'-P energy: -13.931 tors. eta vs tors. theta energy: -32.671 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -277.731711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.731711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.775403 (E_RNA) where: Base-Base interactions energy: -170.005 where: short stacking energy: -100.538 Base-Backbone interact. energy: -1.284 local terms energy: -106.486082 where: bonds (distance) C4'-P energy: -15.962 bonds (distance) P-C4' energy: -25.797 flat angles C4'-P-C4' energy: -22.342 flat angles P-C4'-P energy: -16.001 tors. eta vs tors. theta energy: -26.385 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -206.203695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.203695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.214570 (E_RNA) where: Base-Base interactions energy: -112.495 where: short stacking energy: -69.397 Base-Backbone interact. energy: -0.103 local terms energy: -93.616171 where: bonds (distance) C4'-P energy: -22.862 bonds (distance) P-C4' energy: -18.831 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -16.049 tors. eta vs tors. theta energy: -12.413 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -185.880423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.880423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.974167 (E_RNA) where: Base-Base interactions energy: -103.913 where: short stacking energy: -40.595 Base-Backbone interact. energy: -0.471 local terms energy: -81.589782 where: bonds (distance) C4'-P energy: -25.175 bonds (distance) P-C4' energy: -20.963 flat angles C4'-P-C4' energy: -21.151 flat angles P-C4'-P energy: -14.764 tors. eta vs tors. theta energy: 0.464 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -147.931402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.931402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.935664 (E_RNA) where: Base-Base interactions energy: -78.186 where: short stacking energy: -51.261 Base-Backbone interact. energy: -1.591 local terms energy: -68.158780 where: bonds (distance) C4'-P energy: -19.599 bonds (distance) P-C4' energy: -22.799 flat angles C4'-P-C4' energy: -16.700 flat angles P-C4'-P energy: -5.924 tors. eta vs tors. theta energy: -3.137 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -147.707561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.707561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.713943 (E_RNA) where: Base-Base interactions energy: -72.137 where: short stacking energy: -52.467 Base-Backbone interact. energy: -0.778 local terms energy: -74.798956 where: bonds (distance) C4'-P energy: -13.889 bonds (distance) P-C4' energy: -26.870 flat angles C4'-P-C4' energy: -18.078 flat angles P-C4'-P energy: -8.280 tors. eta vs tors. theta energy: -7.681 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -376.122351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.122351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.122351 (E_RNA) where: Base-Base interactions energy: -253.721 where: short stacking energy: -128.329 Base-Backbone interact. energy: -0.191 local terms energy: -122.210450 where: bonds (distance) C4'-P energy: -21.933 bonds (distance) P-C4' energy: -25.464 flat angles C4'-P-C4' energy: -26.160 flat angles P-C4'-P energy: -10.507 tors. eta vs tors. theta energy: -38.146 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -369.846122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.846122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.846122 (E_RNA) where: Base-Base interactions energy: -249.551 where: short stacking energy: -112.355 Base-Backbone interact. energy: -0.811 local terms energy: -119.483328 where: bonds (distance) C4'-P energy: -26.170 bonds (distance) P-C4' energy: -21.326 flat angles C4'-P-C4' energy: -22.103 flat angles P-C4'-P energy: -15.274 tors. eta vs tors. theta energy: -34.611 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -348.218482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.218482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.230551 (E_RNA) where: Base-Base interactions energy: -221.285 where: short stacking energy: -108.875 Base-Backbone interact. energy: -0.089 local terms energy: -126.856800 where: bonds (distance) C4'-P energy: -22.395 bonds (distance) P-C4' energy: -21.621 flat angles C4'-P-C4' energy: -25.677 flat angles P-C4'-P energy: -20.619 tors. eta vs tors. theta energy: -36.546 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -340.349199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.349199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.349199 (E_RNA) where: Base-Base interactions energy: -220.841 where: short stacking energy: -109.940 Base-Backbone interact. energy: -0.734 local terms energy: -118.773456 where: bonds (distance) C4'-P energy: -22.246 bonds (distance) P-C4' energy: -20.060 flat angles C4'-P-C4' energy: -21.871 flat angles P-C4'-P energy: -19.508 tors. eta vs tors. theta energy: -35.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -328.079929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.079929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.079929 (E_RNA) where: Base-Base interactions energy: -210.303 where: short stacking energy: -104.879 Base-Backbone interact. energy: -0.234 local terms energy: -117.542907 where: bonds (distance) C4'-P energy: -25.696 bonds (distance) P-C4' energy: -25.465 flat angles C4'-P-C4' energy: -20.885 flat angles P-C4'-P energy: -16.434 tors. eta vs tors. theta energy: -29.063 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -303.897688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.897688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.897688 (E_RNA) where: Base-Base interactions energy: -187.697 where: short stacking energy: -103.549 Base-Backbone interact. energy: -0.147 local terms energy: -116.054442 where: bonds (distance) C4'-P energy: -24.013 bonds (distance) P-C4' energy: -25.364 flat angles C4'-P-C4' energy: -22.547 flat angles P-C4'-P energy: -17.059 tors. eta vs tors. theta energy: -27.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -227.586903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.586903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.595021 (E_RNA) where: Base-Base interactions energy: -136.968 where: short stacking energy: -75.249 Base-Backbone interact. energy: -0.412 local terms energy: -90.214918 where: bonds (distance) C4'-P energy: -17.952 bonds (distance) P-C4' energy: -22.268 flat angles C4'-P-C4' energy: -20.641 flat angles P-C4'-P energy: -16.222 tors. eta vs tors. theta energy: -13.132 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -194.153226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.153226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.192256 (E_RNA) where: Base-Base interactions energy: -106.976 where: short stacking energy: -61.904 Base-Backbone interact. energy: -0.128 local terms energy: -87.088122 where: bonds (distance) C4'-P energy: -18.838 bonds (distance) P-C4' energy: -21.125 flat angles C4'-P-C4' energy: -20.358 flat angles P-C4'-P energy: -16.394 tors. eta vs tors. theta energy: -10.374 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -147.513124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.513124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.533156 (E_RNA) where: Base-Base interactions energy: -73.651 where: short stacking energy: -51.745 Base-Backbone interact. energy: -0.153 local terms energy: -73.728952 where: bonds (distance) C4'-P energy: -25.617 bonds (distance) P-C4' energy: -22.310 flat angles C4'-P-C4' energy: -14.723 flat angles P-C4'-P energy: -8.796 tors. eta vs tors. theta energy: -2.283 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -154.646684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.646684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.824656 (E_RNA) where: Base-Base interactions energy: -79.761 where: short stacking energy: -52.943 Base-Backbone interact. energy: 0.049 local terms energy: -75.112755 where: bonds (distance) C4'-P energy: -22.347 bonds (distance) P-C4' energy: -27.126 flat angles C4'-P-C4' energy: -12.361 flat angles P-C4'-P energy: -3.584 tors. eta vs tors. theta energy: -9.695 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -376.664539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.664539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.664539 (E_RNA) where: Base-Base interactions energy: -253.950 where: short stacking energy: -124.699 Base-Backbone interact. energy: -0.342 local terms energy: -122.373326 where: bonds (distance) C4'-P energy: -15.453 bonds (distance) P-C4' energy: -25.845 flat angles C4'-P-C4' energy: -28.853 flat angles P-C4'-P energy: -15.501 tors. eta vs tors. theta energy: -36.721 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -369.978494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.978494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.978494 (E_RNA) where: Base-Base interactions energy: -246.592 where: short stacking energy: -122.852 Base-Backbone interact. energy: -0.733 local terms energy: -122.653461 where: bonds (distance) C4'-P energy: -26.627 bonds (distance) P-C4' energy: -23.288 flat angles C4'-P-C4' energy: -25.746 flat angles P-C4'-P energy: -15.428 tors. eta vs tors. theta energy: -31.564 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -346.096568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.096568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.096568 (E_RNA) where: Base-Base interactions energy: -230.432 where: short stacking energy: -111.046 Base-Backbone interact. energy: -0.584 local terms energy: -115.080970 where: bonds (distance) C4'-P energy: -19.661 bonds (distance) P-C4' energy: -18.372 flat angles C4'-P-C4' energy: -26.599 flat angles P-C4'-P energy: -16.196 tors. eta vs tors. theta energy: -34.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -339.366135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.366135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.458660 (E_RNA) where: Base-Base interactions energy: -215.586 where: short stacking energy: -108.038 Base-Backbone interact. energy: -0.457 local terms energy: -123.415596 where: bonds (distance) C4'-P energy: -21.513 bonds (distance) P-C4' energy: -27.495 flat angles C4'-P-C4' energy: -26.889 flat angles P-C4'-P energy: -15.991 tors. eta vs tors. theta energy: -31.529 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -309.409478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.409478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.409478 (E_RNA) where: Base-Base interactions energy: -208.133 where: short stacking energy: -94.062 Base-Backbone interact. energy: 2.432 local terms energy: -103.708862 where: bonds (distance) C4'-P energy: -23.544 bonds (distance) P-C4' energy: -20.322 flat angles C4'-P-C4' energy: -21.305 flat angles P-C4'-P energy: -10.764 tors. eta vs tors. theta energy: -27.775 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -293.470272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.470272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.476708 (E_RNA) where: Base-Base interactions energy: -185.305 where: short stacking energy: -91.971 Base-Backbone interact. energy: -0.763 local terms energy: -107.408503 where: bonds (distance) C4'-P energy: -22.758 bonds (distance) P-C4' energy: -24.592 flat angles C4'-P-C4' energy: -24.935 flat angles P-C4'-P energy: -15.321 tors. eta vs tors. theta energy: -19.803 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -240.619219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.619219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.630541 (E_RNA) where: Base-Base interactions energy: -148.289 where: short stacking energy: -76.154 Base-Backbone interact. energy: -1.077 local terms energy: -91.263843 where: bonds (distance) C4'-P energy: -23.597 bonds (distance) P-C4' energy: -18.620 flat angles C4'-P-C4' energy: -22.985 flat angles P-C4'-P energy: -10.903 tors. eta vs tors. theta energy: -15.159 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -185.107985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.107985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.123218 (E_RNA) where: Base-Base interactions energy: -95.526 where: short stacking energy: -55.571 Base-Backbone interact. energy: -0.651 local terms energy: -88.946027 where: bonds (distance) C4'-P energy: -18.101 bonds (distance) P-C4' energy: -20.473 flat angles C4'-P-C4' energy: -25.141 flat angles P-C4'-P energy: -14.726 tors. eta vs tors. theta energy: -10.506 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -159.247692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.247692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.401691 (E_RNA) where: Base-Base interactions energy: -80.290 where: short stacking energy: -45.783 Base-Backbone interact. energy: -0.131 local terms energy: -78.981364 where: bonds (distance) C4'-P energy: -23.374 bonds (distance) P-C4' energy: -23.396 flat angles C4'-P-C4' energy: -20.121 flat angles P-C4'-P energy: -10.955 tors. eta vs tors. theta energy: -1.135 Dist. restrs. and SS energy: 0.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -158.387336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.387336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.404787 (E_RNA) where: Base-Base interactions energy: -79.516 where: short stacking energy: -43.747 Base-Backbone interact. energy: -0.301 local terms energy: -78.587841 where: bonds (distance) C4'-P energy: -19.743 bonds (distance) P-C4' energy: -25.683 flat angles C4'-P-C4' energy: -22.987 flat angles P-C4'-P energy: -7.951 tors. eta vs tors. theta energy: -2.224 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -381.423974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.423974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.423974 (E_RNA) where: Base-Base interactions energy: -247.217 where: short stacking energy: -125.660 Base-Backbone interact. energy: -0.028 local terms energy: -134.179639 where: bonds (distance) C4'-P energy: -26.766 bonds (distance) P-C4' energy: -23.168 flat angles C4'-P-C4' energy: -28.174 flat angles P-C4'-P energy: -21.502 tors. eta vs tors. theta energy: -34.570 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -370.590385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.590385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.600430 (E_RNA) where: Base-Base interactions energy: -238.173 where: short stacking energy: -122.972 Base-Backbone interact. energy: -1.164 local terms energy: -131.263652 where: bonds (distance) C4'-P energy: -22.077 bonds (distance) P-C4' energy: -22.997 flat angles C4'-P-C4' energy: -27.311 flat angles P-C4'-P energy: -22.598 tors. eta vs tors. theta energy: -36.280 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -362.194110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.194110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.194110 (E_RNA) where: Base-Base interactions energy: -234.744 where: short stacking energy: -127.380 Base-Backbone interact. energy: -0.125 local terms energy: -127.325163 where: bonds (distance) C4'-P energy: -19.991 bonds (distance) P-C4' energy: -23.064 flat angles C4'-P-C4' energy: -28.926 flat angles P-C4'-P energy: -16.449 tors. eta vs tors. theta energy: -38.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -325.202255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.202255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.202255 (E_RNA) where: Base-Base interactions energy: -204.946 where: short stacking energy: -102.972 Base-Backbone interact. energy: -0.786 local terms energy: -119.469528 where: bonds (distance) C4'-P energy: -24.974 bonds (distance) P-C4' energy: -25.357 flat angles C4'-P-C4' energy: -21.847 flat angles P-C4'-P energy: -18.094 tors. eta vs tors. theta energy: -29.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -294.799361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.799361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.799361 (E_RNA) where: Base-Base interactions energy: -181.497 where: short stacking energy: -90.720 Base-Backbone interact. energy: -0.161 local terms energy: -113.141187 where: bonds (distance) C4'-P energy: -22.084 bonds (distance) P-C4' energy: -26.893 flat angles C4'-P-C4' energy: -22.261 flat angles P-C4'-P energy: -14.222 tors. eta vs tors. theta energy: -27.682 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -280.243730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.243730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.396032 (E_RNA) where: Base-Base interactions energy: -180.713 where: short stacking energy: -92.825 Base-Backbone interact. energy: -0.199 local terms energy: -99.483692 where: bonds (distance) C4'-P energy: -19.993 bonds (distance) P-C4' energy: -17.803 flat angles C4'-P-C4' energy: -22.079 flat angles P-C4'-P energy: -16.129 tors. eta vs tors. theta energy: -23.480 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -236.010256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.010256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.229808 (E_RNA) where: Base-Base interactions energy: -141.829 where: short stacking energy: -84.641 Base-Backbone interact. energy: -0.322 local terms energy: -94.079476 where: bonds (distance) C4'-P energy: -17.035 bonds (distance) P-C4' energy: -21.903 flat angles C4'-P-C4' energy: -19.303 flat angles P-C4'-P energy: -20.421 tors. eta vs tors. theta energy: -15.417 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -174.475008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.475008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.475008 (E_RNA) where: Base-Base interactions energy: -100.356 where: short stacking energy: -60.507 Base-Backbone interact. energy: 0.427 local terms energy: -74.545981 where: bonds (distance) C4'-P energy: -20.311 bonds (distance) P-C4' energy: -13.938 flat angles C4'-P-C4' energy: -18.357 flat angles P-C4'-P energy: -10.799 tors. eta vs tors. theta energy: -11.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -174.217867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.217867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.363100 (E_RNA) where: Base-Base interactions energy: -92.651 where: short stacking energy: -66.445 Base-Backbone interact. energy: -0.560 local terms energy: -81.151455 where: bonds (distance) C4'-P energy: -20.829 bonds (distance) P-C4' energy: -18.427 flat angles C4'-P-C4' energy: -18.624 flat angles P-C4'-P energy: -14.125 tors. eta vs tors. theta energy: -9.145 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -169.503310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.503310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.560390 (E_RNA) where: Base-Base interactions energy: -79.025 where: short stacking energy: -49.218 Base-Backbone interact. energy: -0.517 local terms energy: -90.018401 where: bonds (distance) C4'-P energy: -22.393 bonds (distance) P-C4' energy: -26.026 flat angles C4'-P-C4' energy: -22.051 flat angles P-C4'-P energy: -13.495 tors. eta vs tors. theta energy: -6.054 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -367.364979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.364979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.364979 (E_RNA) where: Base-Base interactions energy: -238.389 where: short stacking energy: -119.400 Base-Backbone interact. energy: -0.642 local terms energy: -128.333369 where: bonds (distance) C4'-P energy: -25.068 bonds (distance) P-C4' energy: -25.788 flat angles C4'-P-C4' energy: -26.752 flat angles P-C4'-P energy: -15.756 tors. eta vs tors. theta energy: -34.970 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -381.009435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.009435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.009435 (E_RNA) where: Base-Base interactions energy: -251.229 where: short stacking energy: -124.622 Base-Backbone interact. energy: -0.043 local terms energy: -129.736957 where: bonds (distance) C4'-P energy: -27.953 bonds (distance) P-C4' energy: -17.992 flat angles C4'-P-C4' energy: -27.266 flat angles P-C4'-P energy: -19.518 tors. eta vs tors. theta energy: -37.009 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -339.865072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.865072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.865072 (E_RNA) where: Base-Base interactions energy: -206.126 where: short stacking energy: -99.541 Base-Backbone interact. energy: -0.991 local terms energy: -132.747766 where: bonds (distance) C4'-P energy: -24.621 bonds (distance) P-C4' energy: -30.681 flat angles C4'-P-C4' energy: -26.030 flat angles P-C4'-P energy: -18.729 tors. eta vs tors. theta energy: -32.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -346.785186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.785186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.785186 (E_RNA) where: Base-Base interactions energy: -229.327 where: short stacking energy: -111.659 Base-Backbone interact. energy: -0.632 local terms energy: -116.826143 where: bonds (distance) C4'-P energy: -23.652 bonds (distance) P-C4' energy: -20.363 flat angles C4'-P-C4' energy: -21.551 flat angles P-C4'-P energy: -13.931 tors. eta vs tors. theta energy: -37.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -278.506589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.506589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.533566 (E_RNA) where: Base-Base interactions energy: -166.137 where: short stacking energy: -99.958 Base-Backbone interact. energy: -0.038 local terms energy: -112.358357 where: bonds (distance) C4'-P energy: -21.880 bonds (distance) P-C4' energy: -25.260 flat angles C4'-P-C4' energy: -23.463 flat angles P-C4'-P energy: -16.593 tors. eta vs tors. theta energy: -25.163 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -311.865988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.865988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.921535 (E_RNA) where: Base-Base interactions energy: -199.532 where: short stacking energy: -99.636 Base-Backbone interact. energy: -0.274 local terms energy: -112.114982 where: bonds (distance) C4'-P energy: -20.391 bonds (distance) P-C4' energy: -23.156 flat angles C4'-P-C4' energy: -25.359 flat angles P-C4'-P energy: -15.452 tors. eta vs tors. theta energy: -27.757 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -202.680029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.680029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.713364 (E_RNA) where: Base-Base interactions energy: -104.131 where: short stacking energy: -70.661 Base-Backbone interact. energy: -0.146 local terms energy: -98.436549 where: bonds (distance) C4'-P energy: -24.537 bonds (distance) P-C4' energy: -23.375 flat angles C4'-P-C4' energy: -21.673 flat angles P-C4'-P energy: -9.826 tors. eta vs tors. theta energy: -19.026 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -211.591847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.591847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.591847 (E_RNA) where: Base-Base interactions energy: -140.507 where: short stacking energy: -77.176 Base-Backbone interact. energy: -0.202 local terms energy: -70.883147 where: bonds (distance) C4'-P energy: -12.283 bonds (distance) P-C4' energy: -9.411 flat angles C4'-P-C4' energy: -14.499 flat angles P-C4'-P energy: -12.599 tors. eta vs tors. theta energy: -22.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -160.433880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.433880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.510452 (E_RNA) where: Base-Base interactions energy: -86.619 where: short stacking energy: -53.131 Base-Backbone interact. energy: -0.181 local terms energy: -73.711032 where: bonds (distance) C4'-P energy: -21.644 bonds (distance) P-C4' energy: -23.305 flat angles C4'-P-C4' energy: -21.979 flat angles P-C4'-P energy: -3.393 tors. eta vs tors. theta energy: -3.390 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -142.086370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.086370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.110469 (E_RNA) where: Base-Base interactions energy: -71.846 where: short stacking energy: -43.066 Base-Backbone interact. energy: 0.167 local terms energy: -70.431467 where: bonds (distance) C4'-P energy: -23.036 bonds (distance) P-C4' energy: -20.192 flat angles C4'-P-C4' energy: -17.848 flat angles P-C4'-P energy: -8.098 tors. eta vs tors. theta energy: -1.258 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -372.581056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.581056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.589130 (E_RNA) where: Base-Base interactions energy: -252.448 where: short stacking energy: -120.021 Base-Backbone interact. energy: -2.110 local terms energy: -118.030489 where: bonds (distance) C4'-P energy: -20.724 bonds (distance) P-C4' energy: -22.007 flat angles C4'-P-C4' energy: -25.549 flat angles P-C4'-P energy: -19.588 tors. eta vs tors. theta energy: -30.161 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -359.807480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.807480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.836256 (E_RNA) where: Base-Base interactions energy: -235.049 where: short stacking energy: -121.100 Base-Backbone interact. energy: 0.434 local terms energy: -125.220980 where: bonds (distance) C4'-P energy: -19.446 bonds (distance) P-C4' energy: -21.849 flat angles C4'-P-C4' energy: -24.604 flat angles P-C4'-P energy: -24.226 tors. eta vs tors. theta energy: -35.096 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -363.463768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.463768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.463768 (E_RNA) where: Base-Base interactions energy: -236.083 where: short stacking energy: -113.612 Base-Backbone interact. energy: -0.771 local terms energy: -126.609994 where: bonds (distance) C4'-P energy: -22.295 bonds (distance) P-C4' energy: -25.208 flat angles C4'-P-C4' energy: -24.203 flat angles P-C4'-P energy: -19.382 tors. eta vs tors. theta energy: -35.522 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -341.519049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.519049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.644548 (E_RNA) where: Base-Base interactions energy: -219.830 where: short stacking energy: -116.321 Base-Backbone interact. energy: -0.811 local terms energy: -121.002994 where: bonds (distance) C4'-P energy: -21.324 bonds (distance) P-C4' energy: -27.077 flat angles C4'-P-C4' energy: -21.534 flat angles P-C4'-P energy: -16.601 tors. eta vs tors. theta energy: -34.466 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -276.855300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.855300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.855300 (E_RNA) where: Base-Base interactions energy: -176.732 where: short stacking energy: -95.570 Base-Backbone interact. energy: -0.042 local terms energy: -100.080420 where: bonds (distance) C4'-P energy: -15.765 bonds (distance) P-C4' energy: -22.620 flat angles C4'-P-C4' energy: -19.687 flat angles P-C4'-P energy: -12.020 tors. eta vs tors. theta energy: -29.989 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -312.012174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.012174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.012174 (E_RNA) where: Base-Base interactions energy: -199.789 where: short stacking energy: -97.235 Base-Backbone interact. energy: -0.468 local terms energy: -111.755460 where: bonds (distance) C4'-P energy: -18.581 bonds (distance) P-C4' energy: -22.763 flat angles C4'-P-C4' energy: -24.580 flat angles P-C4'-P energy: -17.527 tors. eta vs tors. theta energy: -28.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -216.970514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.970514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.977429 (E_RNA) where: Base-Base interactions energy: -125.057 where: short stacking energy: -64.986 Base-Backbone interact. energy: -0.244 local terms energy: -91.675658 where: bonds (distance) C4'-P energy: -17.728 bonds (distance) P-C4' energy: -19.261 flat angles C4'-P-C4' energy: -23.068 flat angles P-C4'-P energy: -16.084 tors. eta vs tors. theta energy: -15.534 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -220.101300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.101300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.208018 (E_RNA) where: Base-Base interactions energy: -126.767 where: short stacking energy: -75.579 Base-Backbone interact. energy: -0.787 local terms energy: -92.654674 where: bonds (distance) C4'-P energy: -21.586 bonds (distance) P-C4' energy: -20.093 flat angles C4'-P-C4' energy: -21.958 flat angles P-C4'-P energy: -12.617 tors. eta vs tors. theta energy: -16.400 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -189.049920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.049920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.130624 (E_RNA) where: Base-Base interactions energy: -100.349 where: short stacking energy: -70.189 Base-Backbone interact. energy: -0.133 local terms energy: -88.648618 where: bonds (distance) C4'-P energy: -12.784 bonds (distance) P-C4' energy: -23.548 flat angles C4'-P-C4' energy: -22.704 flat angles P-C4'-P energy: -13.457 tors. eta vs tors. theta energy: -16.156 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -158.108707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.108707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.297252 (E_RNA) where: Base-Base interactions energy: -79.943 where: short stacking energy: -45.036 Base-Backbone interact. energy: -0.438 local terms energy: -77.916379 where: bonds (distance) C4'-P energy: -12.273 bonds (distance) P-C4' energy: -27.679 flat angles C4'-P-C4' energy: -14.142 flat angles P-C4'-P energy: -13.795 tors. eta vs tors. theta energy: -10.027 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -370.026286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.026286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.026286 (E_RNA) where: Base-Base interactions energy: -249.584 where: short stacking energy: -122.999 Base-Backbone interact. energy: -0.381 local terms energy: -120.061495 where: bonds (distance) C4'-P energy: -19.906 bonds (distance) P-C4' energy: -23.704 flat angles C4'-P-C4' energy: -24.430 flat angles P-C4'-P energy: -19.277 tors. eta vs tors. theta energy: -32.746 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -354.120980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.120980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.143102 (E_RNA) where: Base-Base interactions energy: -230.973 where: short stacking energy: -108.835 Base-Backbone interact. energy: -0.876 local terms energy: -122.294040 where: bonds (distance) C4'-P energy: -22.431 bonds (distance) P-C4' energy: -23.504 flat angles C4'-P-C4' energy: -28.275 flat angles P-C4'-P energy: -16.981 tors. eta vs tors. theta energy: -31.103 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -362.270118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.270118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.270118 (E_RNA) where: Base-Base interactions energy: -239.795 where: short stacking energy: -116.239 Base-Backbone interact. energy: -0.042 local terms energy: -122.433364 where: bonds (distance) C4'-P energy: -18.593 bonds (distance) P-C4' energy: -27.771 flat angles C4'-P-C4' energy: -25.210 flat angles P-C4'-P energy: -14.159 tors. eta vs tors. theta energy: -36.700 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -344.130286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.130286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.130286 (E_RNA) where: Base-Base interactions energy: -223.902 where: short stacking energy: -117.566 Base-Backbone interact. energy: -0.688 local terms energy: -119.539421 where: bonds (distance) C4'-P energy: -26.156 bonds (distance) P-C4' energy: -21.966 flat angles C4'-P-C4' energy: -21.205 flat angles P-C4'-P energy: -14.179 tors. eta vs tors. theta energy: -36.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -325.263067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.263067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.401276 (E_RNA) where: Base-Base interactions energy: -219.812 where: short stacking energy: -107.458 Base-Backbone interact. energy: 1.427 local terms energy: -107.016603 where: bonds (distance) C4'-P energy: -21.323 bonds (distance) P-C4' energy: -19.409 flat angles C4'-P-C4' energy: -27.574 flat angles P-C4'-P energy: -8.759 tors. eta vs tors. theta energy: -29.951 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -284.245823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.245823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.541048 (E_RNA) where: Base-Base interactions energy: -178.509 where: short stacking energy: -88.013 Base-Backbone interact. energy: -0.277 local terms energy: -105.754839 where: bonds (distance) C4'-P energy: -25.332 bonds (distance) P-C4' energy: -21.815 flat angles C4'-P-C4' energy: -21.178 flat angles P-C4'-P energy: -15.374 tors. eta vs tors. theta energy: -22.055 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -235.749699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.749699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.749699 (E_RNA) where: Base-Base interactions energy: -154.823 where: short stacking energy: -72.373 Base-Backbone interact. energy: -1.876 local terms energy: -79.050344 where: bonds (distance) C4'-P energy: -11.963 bonds (distance) P-C4' energy: -22.244 flat angles C4'-P-C4' energy: -20.802 flat angles P-C4'-P energy: -12.543 tors. eta vs tors. theta energy: -11.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -228.035235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.035235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.049723 (E_RNA) where: Base-Base interactions energy: -132.041 where: short stacking energy: -70.609 Base-Backbone interact. energy: -1.249 local terms energy: -94.760426 where: bonds (distance) C4'-P energy: -18.656 bonds (distance) P-C4' energy: -21.249 flat angles C4'-P-C4' energy: -17.857 flat angles P-C4'-P energy: -16.676 tors. eta vs tors. theta energy: -20.321 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -186.271854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.271854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.271854 (E_RNA) where: Base-Base interactions energy: -98.812 where: short stacking energy: -52.713 Base-Backbone interact. energy: -1.519 local terms energy: -85.940610 where: bonds (distance) C4'-P energy: -23.036 bonds (distance) P-C4' energy: -23.669 flat angles C4'-P-C4' energy: -19.409 flat angles P-C4'-P energy: -12.322 tors. eta vs tors. theta energy: -7.504 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -161.310965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.310965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.331275 (E_RNA) where: Base-Base interactions energy: -89.272 where: short stacking energy: -44.565 Base-Backbone interact. energy: -0.263 local terms energy: -71.796748 where: bonds (distance) C4'-P energy: -19.678 bonds (distance) P-C4' energy: -16.628 flat angles C4'-P-C4' energy: -20.943 flat angles P-C4'-P energy: -14.178 tors. eta vs tors. theta energy: -0.370 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -376.145415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.145415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.145415 (E_RNA) where: Base-Base interactions energy: -243.163 where: short stacking energy: -111.794 Base-Backbone interact. energy: -0.591 local terms energy: -132.391621 where: bonds (distance) C4'-P energy: -26.099 bonds (distance) P-C4' energy: -26.905 flat angles C4'-P-C4' energy: -25.173 flat angles P-C4'-P energy: -16.868 tors. eta vs tors. theta energy: -37.346 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -367.807720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.807720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.927226 (E_RNA) where: Base-Base interactions energy: -244.490 where: short stacking energy: -111.559 Base-Backbone interact. energy: -0.632 local terms energy: -122.805674 where: bonds (distance) C4'-P energy: -23.761 bonds (distance) P-C4' energy: -25.150 flat angles C4'-P-C4' energy: -26.710 flat angles P-C4'-P energy: -17.895 tors. eta vs tors. theta energy: -29.290 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -360.819618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.819618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.819618 (E_RNA) where: Base-Base interactions energy: -232.088 where: short stacking energy: -121.271 Base-Backbone interact. energy: -1.198 local terms energy: -127.533711 where: bonds (distance) C4'-P energy: -23.729 bonds (distance) P-C4' energy: -24.810 flat angles C4'-P-C4' energy: -25.299 flat angles P-C4'-P energy: -16.708 tors. eta vs tors. theta energy: -36.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -324.652594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.652594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.818793 (E_RNA) where: Base-Base interactions energy: -205.685 where: short stacking energy: -101.375 Base-Backbone interact. energy: -1.366 local terms energy: -117.767658 where: bonds (distance) C4'-P energy: -21.587 bonds (distance) P-C4' energy: -24.187 flat angles C4'-P-C4' energy: -25.019 flat angles P-C4'-P energy: -19.275 tors. eta vs tors. theta energy: -27.699 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -307.091139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.091139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.095877 (E_RNA) where: Base-Base interactions energy: -201.214 where: short stacking energy: -94.280 Base-Backbone interact. energy: 1.162 local terms energy: -107.043240 where: bonds (distance) C4'-P energy: -14.478 bonds (distance) P-C4' energy: -22.676 flat angles C4'-P-C4' energy: -22.326 flat angles P-C4'-P energy: -19.320 tors. eta vs tors. theta energy: -28.244 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -292.653772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.653772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.741810 (E_RNA) where: Base-Base interactions energy: -185.486 where: short stacking energy: -93.618 Base-Backbone interact. energy: -0.719 local terms energy: -106.537251 where: bonds (distance) C4'-P energy: -22.608 bonds (distance) P-C4' energy: -21.738 flat angles C4'-P-C4' energy: -18.339 flat angles P-C4'-P energy: -19.150 tors. eta vs tors. theta energy: -24.702 Dist. restrs. and SS energy: 0.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -235.800079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.800079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.881651 (E_RNA) where: Base-Base interactions energy: -148.462 where: short stacking energy: -68.811 Base-Backbone interact. energy: -1.018 local terms energy: -86.401998 where: bonds (distance) C4'-P energy: -22.340 bonds (distance) P-C4' energy: -25.286 flat angles C4'-P-C4' energy: -23.741 flat angles P-C4'-P energy: -6.335 tors. eta vs tors. theta energy: -8.700 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -228.356479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.356479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.386017 (E_RNA) where: Base-Base interactions energy: -146.820 where: short stacking energy: -67.241 Base-Backbone interact. energy: -1.194 local terms energy: -80.372107 where: bonds (distance) C4'-P energy: -18.064 bonds (distance) P-C4' energy: -23.546 flat angles C4'-P-C4' energy: -13.101 flat angles P-C4'-P energy: -15.857 tors. eta vs tors. theta energy: -9.805 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -179.072728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.072728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.167171 (E_RNA) where: Base-Base interactions energy: -102.435 where: short stacking energy: -72.525 Base-Backbone interact. energy: -0.976 local terms energy: -75.756333 where: bonds (distance) C4'-P energy: -18.273 bonds (distance) P-C4' energy: -20.672 flat angles C4'-P-C4' energy: -18.792 flat angles P-C4'-P energy: -7.360 tors. eta vs tors. theta energy: -10.659 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -152.894840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.894840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.071683 (E_RNA) where: Base-Base interactions energy: -79.965 where: short stacking energy: -55.049 Base-Backbone interact. energy: -1.116 local terms energy: -71.990633 where: bonds (distance) C4'-P energy: -14.097 bonds (distance) P-C4' energy: -24.385 flat angles C4'-P-C4' energy: -20.612 flat angles P-C4'-P energy: -14.760 tors. eta vs tors. theta energy: 1.863 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -367.414063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.414063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.414063 (E_RNA) where: Base-Base interactions energy: -243.362 where: short stacking energy: -118.764 Base-Backbone interact. energy: 0.387 local terms energy: -124.439162 where: bonds (distance) C4'-P energy: -23.934 bonds (distance) P-C4' energy: -22.852 flat angles C4'-P-C4' energy: -26.616 flat angles P-C4'-P energy: -16.945 tors. eta vs tors. theta energy: -34.093 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -366.212381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.212381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.212381 (E_RNA) where: Base-Base interactions energy: -241.431 where: short stacking energy: -116.370 Base-Backbone interact. energy: -0.097 local terms energy: -124.683959 where: bonds (distance) C4'-P energy: -24.290 bonds (distance) P-C4' energy: -23.660 flat angles C4'-P-C4' energy: -26.519 flat angles P-C4'-P energy: -16.669 tors. eta vs tors. theta energy: -33.545 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -350.548269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.548269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.626379 (E_RNA) where: Base-Base interactions energy: -221.137 where: short stacking energy: -116.225 Base-Backbone interact. energy: -0.075 local terms energy: -129.413841 where: bonds (distance) C4'-P energy: -24.261 bonds (distance) P-C4' energy: -22.975 flat angles C4'-P-C4' energy: -26.376 flat angles P-C4'-P energy: -18.382 tors. eta vs tors. theta energy: -37.420 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -349.075021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.075021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.075021 (E_RNA) where: Base-Base interactions energy: -221.569 where: short stacking energy: -109.186 Base-Backbone interact. energy: -0.129 local terms energy: -127.377156 where: bonds (distance) C4'-P energy: -23.854 bonds (distance) P-C4' energy: -26.109 flat angles C4'-P-C4' energy: -20.837 flat angles P-C4'-P energy: -22.938 tors. eta vs tors. theta energy: -33.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -332.661856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.661856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.661856 (E_RNA) where: Base-Base interactions energy: -213.317 where: short stacking energy: -105.668 Base-Backbone interact. energy: -0.035 local terms energy: -119.309760 where: bonds (distance) C4'-P energy: -20.758 bonds (distance) P-C4' energy: -24.326 flat angles C4'-P-C4' energy: -26.555 flat angles P-C4'-P energy: -14.692 tors. eta vs tors. theta energy: -32.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -249.568402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.568402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.593668 (E_RNA) where: Base-Base interactions energy: -153.485 where: short stacking energy: -80.670 Base-Backbone interact. energy: -1.228 local terms energy: -94.880900 where: bonds (distance) C4'-P energy: -18.788 bonds (distance) P-C4' energy: -23.506 flat angles C4'-P-C4' energy: -28.923 flat angles P-C4'-P energy: -5.527 tors. eta vs tors. theta energy: -18.137 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -229.739502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.739502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.762936 (E_RNA) where: Base-Base interactions energy: -139.091 where: short stacking energy: -60.958 Base-Backbone interact. energy: -0.082 local terms energy: -90.590322 where: bonds (distance) C4'-P energy: -19.035 bonds (distance) P-C4' energy: -23.679 flat angles C4'-P-C4' energy: -19.191 flat angles P-C4'-P energy: -18.910 tors. eta vs tors. theta energy: -9.776 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -230.193488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.193488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.194152 (E_RNA) where: Base-Base interactions energy: -138.570 where: short stacking energy: -66.600 Base-Backbone interact. energy: -1.072 local terms energy: -90.552549 where: bonds (distance) C4'-P energy: -19.292 bonds (distance) P-C4' energy: -21.673 flat angles C4'-P-C4' energy: -23.397 flat angles P-C4'-P energy: -9.504 tors. eta vs tors. theta energy: -16.687 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -192.366988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.366988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.375210 (E_RNA) where: Base-Base interactions energy: -107.545 where: short stacking energy: -70.084 Base-Backbone interact. energy: -0.236 local terms energy: -84.594325 where: bonds (distance) C4'-P energy: -15.509 bonds (distance) P-C4' energy: -23.297 flat angles C4'-P-C4' energy: -22.719 flat angles P-C4'-P energy: -14.018 tors. eta vs tors. theta energy: -9.052 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -159.972305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.972305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.974095 (E_RNA) where: Base-Base interactions energy: -95.688 where: short stacking energy: -51.567 Base-Backbone interact. energy: -0.012 local terms energy: -64.273867 where: bonds (distance) C4'-P energy: -15.283 bonds (distance) P-C4' energy: -20.748 flat angles C4'-P-C4' energy: -16.200 flat angles P-C4'-P energy: -9.692 tors. eta vs tors. theta energy: -2.350 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -369.061165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.061165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.090575 (E_RNA) where: Base-Base interactions energy: -238.455 where: short stacking energy: -113.198 Base-Backbone interact. energy: -0.063 local terms energy: -130.572296 where: bonds (distance) C4'-P energy: -25.507 bonds (distance) P-C4' energy: -23.520 flat angles C4'-P-C4' energy: -28.779 flat angles P-C4'-P energy: -20.303 tors. eta vs tors. theta energy: -32.463 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -375.153797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.153797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.153797 (E_RNA) where: Base-Base interactions energy: -249.504 where: short stacking energy: -127.354 Base-Backbone interact. energy: 0.525 local terms energy: -126.174313 where: bonds (distance) C4'-P energy: -24.987 bonds (distance) P-C4' energy: -25.988 flat angles C4'-P-C4' energy: -22.341 flat angles P-C4'-P energy: -20.866 tors. eta vs tors. theta energy: -31.992 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -357.474801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.474801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.474801 (E_RNA) where: Base-Base interactions energy: -232.562 where: short stacking energy: -115.938 Base-Backbone interact. energy: -1.026 local terms energy: -123.886208 where: bonds (distance) C4'-P energy: -24.648 bonds (distance) P-C4' energy: -25.850 flat angles C4'-P-C4' energy: -25.358 flat angles P-C4'-P energy: -16.152 tors. eta vs tors. theta energy: -31.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -345.261576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.261576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.261576 (E_RNA) where: Base-Base interactions energy: -223.186 where: short stacking energy: -109.284 Base-Backbone interact. energy: -1.130 local terms energy: -120.945320 where: bonds (distance) C4'-P energy: -24.070 bonds (distance) P-C4' energy: -21.962 flat angles C4'-P-C4' energy: -24.798 flat angles P-C4'-P energy: -14.108 tors. eta vs tors. theta energy: -36.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -329.680513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.680513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.680513 (E_RNA) where: Base-Base interactions energy: -214.970 where: short stacking energy: -105.802 Base-Backbone interact. energy: -0.872 local terms energy: -113.837942 where: bonds (distance) C4'-P energy: -21.256 bonds (distance) P-C4' energy: -23.038 flat angles C4'-P-C4' energy: -22.924 flat angles P-C4'-P energy: -15.535 tors. eta vs tors. theta energy: -31.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -243.878777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.878777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.889184 (E_RNA) where: Base-Base interactions energy: -148.342 where: short stacking energy: -96.237 Base-Backbone interact. energy: -0.147 local terms energy: -95.399980 where: bonds (distance) C4'-P energy: -21.447 bonds (distance) P-C4' energy: -19.736 flat angles C4'-P-C4' energy: -19.025 flat angles P-C4'-P energy: -12.475 tors. eta vs tors. theta energy: -22.718 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -232.541765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.541765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.551150 (E_RNA) where: Base-Base interactions energy: -135.054 where: short stacking energy: -79.259 Base-Backbone interact. energy: 0.046 local terms energy: -97.543403 where: bonds (distance) C4'-P energy: -18.859 bonds (distance) P-C4' energy: -22.048 flat angles C4'-P-C4' energy: -20.426 flat angles P-C4'-P energy: -19.837 tors. eta vs tors. theta energy: -16.373 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -225.822350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.822350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.844832 (E_RNA) where: Base-Base interactions energy: -132.237 where: short stacking energy: -64.482 Base-Backbone interact. energy: -0.451 local terms energy: -93.156983 where: bonds (distance) C4'-P energy: -22.555 bonds (distance) P-C4' energy: -23.347 flat angles C4'-P-C4' energy: -24.662 flat angles P-C4'-P energy: -10.367 tors. eta vs tors. theta energy: -12.226 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -212.348835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.348835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.460464 (E_RNA) where: Base-Base interactions energy: -129.335 where: short stacking energy: -71.086 Base-Backbone interact. energy: -0.956 local terms energy: -82.170045 where: bonds (distance) C4'-P energy: -12.884 bonds (distance) P-C4' energy: -16.998 flat angles C4'-P-C4' energy: -17.100 flat angles P-C4'-P energy: -18.407 tors. eta vs tors. theta energy: -16.781 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -169.146826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.146826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.325734 (E_RNA) where: Base-Base interactions energy: -86.325 where: short stacking energy: -53.875 Base-Backbone interact. energy: 0.705 local terms energy: -83.705818 where: bonds (distance) C4'-P energy: -14.986 bonds (distance) P-C4' energy: -22.200 flat angles C4'-P-C4' energy: -20.452 flat angles P-C4'-P energy: -15.749 tors. eta vs tors. theta energy: -10.318 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -381.261863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.261863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.299867 (E_RNA) where: Base-Base interactions energy: -251.660 where: short stacking energy: -115.936 Base-Backbone interact. energy: -0.805 local terms energy: -128.835155 where: bonds (distance) C4'-P energy: -22.691 bonds (distance) P-C4' energy: -25.724 flat angles C4'-P-C4' energy: -29.174 flat angles P-C4'-P energy: -14.149 tors. eta vs tors. theta energy: -37.098 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -359.459270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.459270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.459270 (E_RNA) where: Base-Base interactions energy: -239.175 where: short stacking energy: -115.037 Base-Backbone interact. energy: -0.384 local terms energy: -119.900139 where: bonds (distance) C4'-P energy: -24.739 bonds (distance) P-C4' energy: -16.690 flat angles C4'-P-C4' energy: -25.607 flat angles P-C4'-P energy: -17.967 tors. eta vs tors. theta energy: -34.897 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -349.530105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.530105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.530105 (E_RNA) where: Base-Base interactions energy: -226.105 where: short stacking energy: -111.492 Base-Backbone interact. energy: -0.967 local terms energy: -122.458118 where: bonds (distance) C4'-P energy: -24.815 bonds (distance) P-C4' energy: -21.544 flat angles C4'-P-C4' energy: -22.787 flat angles P-C4'-P energy: -17.758 tors. eta vs tors. theta energy: -35.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -331.730031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.730031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.968979 (E_RNA) where: Base-Base interactions energy: -212.778 where: short stacking energy: -103.833 Base-Backbone interact. energy: -0.057 local terms energy: -119.133656 where: bonds (distance) C4'-P energy: -22.923 bonds (distance) P-C4' energy: -28.545 flat angles C4'-P-C4' energy: -20.698 flat angles P-C4'-P energy: -20.292 tors. eta vs tors. theta energy: -26.675 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -322.191856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.191856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.499489 (E_RNA) where: Base-Base interactions energy: -209.668 where: short stacking energy: -102.261 Base-Backbone interact. energy: -0.403 local terms energy: -112.427769 where: bonds (distance) C4'-P energy: -18.091 bonds (distance) P-C4' energy: -26.032 flat angles C4'-P-C4' energy: -24.676 flat angles P-C4'-P energy: -12.536 tors. eta vs tors. theta energy: -31.094 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -263.529962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.529962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.529962 (E_RNA) where: Base-Base interactions energy: -158.477 where: short stacking energy: -94.755 Base-Backbone interact. energy: -0.099 local terms energy: -104.954125 where: bonds (distance) C4'-P energy: -16.858 bonds (distance) P-C4' energy: -22.045 flat angles C4'-P-C4' energy: -26.043 flat angles P-C4'-P energy: -13.331 tors. eta vs tors. theta energy: -26.677 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -235.967072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.967072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.076242 (E_RNA) where: Base-Base interactions energy: -146.029 where: short stacking energy: -79.953 Base-Backbone interact. energy: -1.035 local terms energy: -89.012222 where: bonds (distance) C4'-P energy: -20.166 bonds (distance) P-C4' energy: -19.308 flat angles C4'-P-C4' energy: -24.428 flat angles P-C4'-P energy: -11.696 tors. eta vs tors. theta energy: -13.414 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -228.564635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.564635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.577434 (E_RNA) where: Base-Base interactions energy: -136.125 where: short stacking energy: -77.591 Base-Backbone interact. energy: -1.270 local terms energy: -91.182444 where: bonds (distance) C4'-P energy: -17.777 bonds (distance) P-C4' energy: -18.019 flat angles C4'-P-C4' energy: -19.585 flat angles P-C4'-P energy: -15.934 tors. eta vs tors. theta energy: -19.867 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -239.338401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.338401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.410260 (E_RNA) where: Base-Base interactions energy: -146.331 where: short stacking energy: -64.058 Base-Backbone interact. energy: -0.602 local terms energy: -92.477346 where: bonds (distance) C4'-P energy: -20.259 bonds (distance) P-C4' energy: -16.713 flat angles C4'-P-C4' energy: -21.786 flat angles P-C4'-P energy: -16.616 tors. eta vs tors. theta energy: -17.103 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -152.073604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.073604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.095151 (E_RNA) where: Base-Base interactions energy: -85.898 where: short stacking energy: -53.772 Base-Backbone interact. energy: -0.796 local terms energy: -65.401429 where: bonds (distance) C4'-P energy: -22.318 bonds (distance) P-C4' energy: -12.978 flat angles C4'-P-C4' energy: -21.182 flat angles P-C4'-P energy: -9.231 tors. eta vs tors. theta energy: 0.307 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -384.421425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.421425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.421425 (E_RNA) where: Base-Base interactions energy: -252.907 where: short stacking energy: -130.058 Base-Backbone interact. energy: -0.008 local terms energy: -131.506981 where: bonds (distance) C4'-P energy: -26.020 bonds (distance) P-C4' energy: -23.499 flat angles C4'-P-C4' energy: -27.844 flat angles P-C4'-P energy: -15.127 tors. eta vs tors. theta energy: -39.017 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -370.609663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.609663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.627044 (E_RNA) where: Base-Base interactions energy: -249.799 where: short stacking energy: -117.757 Base-Backbone interact. energy: -0.588 local terms energy: -120.240892 where: bonds (distance) C4'-P energy: -23.694 bonds (distance) P-C4' energy: -24.099 flat angles C4'-P-C4' energy: -22.545 flat angles P-C4'-P energy: -15.237 tors. eta vs tors. theta energy: -34.667 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -362.554528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.554528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.635893 (E_RNA) where: Base-Base interactions energy: -238.068 where: short stacking energy: -119.169 Base-Backbone interact. energy: -0.239 local terms energy: -124.329865 where: bonds (distance) C4'-P energy: -22.749 bonds (distance) P-C4' energy: -25.985 flat angles C4'-P-C4' energy: -25.286 flat angles P-C4'-P energy: -13.968 tors. eta vs tors. theta energy: -36.343 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -337.849214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.849214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.849214 (E_RNA) where: Base-Base interactions energy: -214.058 where: short stacking energy: -111.842 Base-Backbone interact. energy: -0.409 local terms energy: -123.381927 where: bonds (distance) C4'-P energy: -21.979 bonds (distance) P-C4' energy: -22.113 flat angles C4'-P-C4' energy: -29.855 flat angles P-C4'-P energy: -19.847 tors. eta vs tors. theta energy: -29.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -324.103168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.103168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.242665 (E_RNA) where: Base-Base interactions energy: -210.645 where: short stacking energy: -109.131 Base-Backbone interact. energy: -0.420 local terms energy: -113.177640 where: bonds (distance) C4'-P energy: -15.272 bonds (distance) P-C4' energy: -23.168 flat angles C4'-P-C4' energy: -23.836 flat angles P-C4'-P energy: -19.413 tors. eta vs tors. theta energy: -31.488 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -226.553237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.553237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.553237 (E_RNA) where: Base-Base interactions energy: -130.738 where: short stacking energy: -69.965 Base-Backbone interact. energy: -1.492 local terms energy: -94.323585 where: bonds (distance) C4'-P energy: -23.756 bonds (distance) P-C4' energy: -18.783 flat angles C4'-P-C4' energy: -25.565 flat angles P-C4'-P energy: -11.600 tors. eta vs tors. theta energy: -14.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -239.493027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.493027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.499657 (E_RNA) where: Base-Base interactions energy: -146.967 where: short stacking energy: -87.847 Base-Backbone interact. energy: -1.028 local terms energy: -91.504293 where: bonds (distance) C4'-P energy: -20.265 bonds (distance) P-C4' energy: -17.021 flat angles C4'-P-C4' energy: -21.605 flat angles P-C4'-P energy: -14.031 tors. eta vs tors. theta energy: -18.582 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -245.689639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.689639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.805805 (E_RNA) where: Base-Base interactions energy: -146.143 where: short stacking energy: -78.417 Base-Backbone interact. energy: -2.065 local terms energy: -97.597327 where: bonds (distance) C4'-P energy: -18.200 bonds (distance) P-C4' energy: -25.961 flat angles C4'-P-C4' energy: -22.067 flat angles P-C4'-P energy: -12.860 tors. eta vs tors. theta energy: -18.510 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -217.942605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.942605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.978322 (E_RNA) where: Base-Base interactions energy: -148.213 where: short stacking energy: -69.091 Base-Backbone interact. energy: -0.993 local terms energy: -68.772645 where: bonds (distance) C4'-P energy: -16.172 bonds (distance) P-C4' energy: -20.752 flat angles C4'-P-C4' energy: -19.388 flat angles P-C4'-P energy: -2.390 tors. eta vs tors. theta energy: -10.071 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -143.111454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.111454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.158591 (E_RNA) where: Base-Base interactions energy: -76.612 where: short stacking energy: -49.087 Base-Backbone interact. energy: -0.562 local terms energy: -65.984240 where: bonds (distance) C4'-P energy: -17.789 bonds (distance) P-C4' energy: -17.503 flat angles C4'-P-C4' energy: -18.409 flat angles P-C4'-P energy: -12.905 tors. eta vs tors. theta energy: 0.623 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -379.970177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.970177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.970177 (E_RNA) where: Base-Base interactions energy: -256.893 where: short stacking energy: -128.042 Base-Backbone interact. energy: -0.633 local terms energy: -122.444716 where: bonds (distance) C4'-P energy: -21.942 bonds (distance) P-C4' energy: -21.505 flat angles C4'-P-C4' energy: -23.781 flat angles P-C4'-P energy: -20.082 tors. eta vs tors. theta energy: -35.136 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -373.025021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.025021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.070446 (E_RNA) where: Base-Base interactions energy: -242.262 where: short stacking energy: -121.099 Base-Backbone interact. energy: -0.031 local terms energy: -130.776903 where: bonds (distance) C4'-P energy: -23.344 bonds (distance) P-C4' energy: -24.209 flat angles C4'-P-C4' energy: -25.346 flat angles P-C4'-P energy: -21.706 tors. eta vs tors. theta energy: -36.172 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -352.794406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.794406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.833105 (E_RNA) where: Base-Base interactions energy: -230.705 where: short stacking energy: -122.284 Base-Backbone interact. energy: -0.261 local terms energy: -121.867064 where: bonds (distance) C4'-P energy: -23.007 bonds (distance) P-C4' energy: -14.982 flat angles C4'-P-C4' energy: -25.604 flat angles P-C4'-P energy: -20.737 tors. eta vs tors. theta energy: -37.537 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -334.616177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.616177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.616177 (E_RNA) where: Base-Base interactions energy: -219.440 where: short stacking energy: -114.548 Base-Backbone interact. energy: -0.356 local terms energy: -114.820769 where: bonds (distance) C4'-P energy: -17.860 bonds (distance) P-C4' energy: -24.030 flat angles C4'-P-C4' energy: -24.600 flat angles P-C4'-P energy: -15.028 tors. eta vs tors. theta energy: -33.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -340.213159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.213159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.237254 (E_RNA) where: Base-Base interactions energy: -215.068 where: short stacking energy: -110.645 Base-Backbone interact. energy: -0.609 local terms energy: -124.560570 where: bonds (distance) C4'-P energy: -28.149 bonds (distance) P-C4' energy: -22.206 flat angles C4'-P-C4' energy: -27.112 flat angles P-C4'-P energy: -13.412 tors. eta vs tors. theta energy: -33.682 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -242.619362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.619362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.619362 (E_RNA) where: Base-Base interactions energy: -149.964 where: short stacking energy: -84.483 Base-Backbone interact. energy: -0.117 local terms energy: -92.538009 where: bonds (distance) C4'-P energy: -14.552 bonds (distance) P-C4' energy: -22.676 flat angles C4'-P-C4' energy: -19.471 flat angles P-C4'-P energy: -12.039 tors. eta vs tors. theta energy: -23.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -272.341772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.341772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.488011 (E_RNA) where: Base-Base interactions energy: -173.478 where: short stacking energy: -74.686 Base-Backbone interact. energy: -0.160 local terms energy: -98.850670 where: bonds (distance) C4'-P energy: -16.687 bonds (distance) P-C4' energy: -23.453 flat angles C4'-P-C4' energy: -24.025 flat angles P-C4'-P energy: -16.756 tors. eta vs tors. theta energy: -17.930 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -254.192031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.192031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.192031 (E_RNA) where: Base-Base interactions energy: -151.861 where: short stacking energy: -75.489 Base-Backbone interact. energy: -0.407 local terms energy: -101.923179 where: bonds (distance) C4'-P energy: -20.319 bonds (distance) P-C4' energy: -23.652 flat angles C4'-P-C4' energy: -20.588 flat angles P-C4'-P energy: -17.710 tors. eta vs tors. theta energy: -19.654 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -162.596860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.596860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.015469 (E_RNA) where: Base-Base interactions energy: -82.882 where: short stacking energy: -56.599 Base-Backbone interact. energy: -0.861 local terms energy: -79.272317 where: bonds (distance) C4'-P energy: -23.180 bonds (distance) P-C4' energy: -21.898 flat angles C4'-P-C4' energy: -22.701 flat angles P-C4'-P energy: -6.854 tors. eta vs tors. theta energy: -4.639 Dist. restrs. and SS energy: 0.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -120.908024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.908024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.200678 (E_RNA) where: Base-Base interactions energy: -47.420 where: short stacking energy: -47.420 Base-Backbone interact. energy: -0.999 local terms energy: -80.781867 where: bonds (distance) C4'-P energy: -19.303 bonds (distance) P-C4' energy: -18.097 flat angles C4'-P-C4' energy: -18.769 flat angles P-C4'-P energy: -17.341 tors. eta vs tors. theta energy: -7.272 Dist. restrs. and SS energy: 8.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -380.239625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.239625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.282942 (E_RNA) where: Base-Base interactions energy: -248.535 where: short stacking energy: -124.047 Base-Backbone interact. energy: -0.222 local terms energy: -131.526673 where: bonds (distance) C4'-P energy: -23.090 bonds (distance) P-C4' energy: -24.243 flat angles C4'-P-C4' energy: -29.046 flat angles P-C4'-P energy: -19.511 tors. eta vs tors. theta energy: -35.637 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -367.146628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.146628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.229852 (E_RNA) where: Base-Base interactions energy: -232.728 where: short stacking energy: -118.997 Base-Backbone interact. energy: -0.344 local terms energy: -134.157740 where: bonds (distance) C4'-P energy: -24.633 bonds (distance) P-C4' energy: -21.961 flat angles C4'-P-C4' energy: -28.187 flat angles P-C4'-P energy: -20.708 tors. eta vs tors. theta energy: -38.669 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -358.796624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.796624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.836700 (E_RNA) where: Base-Base interactions energy: -239.608 where: short stacking energy: -116.587 Base-Backbone interact. energy: 0.827 local terms energy: -120.055388 where: bonds (distance) C4'-P energy: -25.321 bonds (distance) P-C4' energy: -18.821 flat angles C4'-P-C4' energy: -28.075 flat angles P-C4'-P energy: -15.735 tors. eta vs tors. theta energy: -32.104 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -337.915877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.915877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.915877 (E_RNA) where: Base-Base interactions energy: -218.692 where: short stacking energy: -112.572 Base-Backbone interact. energy: -0.058 local terms energy: -119.166307 where: bonds (distance) C4'-P energy: -21.119 bonds (distance) P-C4' energy: -18.281 flat angles C4'-P-C4' energy: -26.350 flat angles P-C4'-P energy: -21.463 tors. eta vs tors. theta energy: -31.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -329.522962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.522962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.566779 (E_RNA) where: Base-Base interactions energy: -211.930 where: short stacking energy: -121.077 Base-Backbone interact. energy: 0.594 local terms energy: -118.230048 where: bonds (distance) C4'-P energy: -18.875 bonds (distance) P-C4' energy: -23.898 flat angles C4'-P-C4' energy: -27.166 flat angles P-C4'-P energy: -15.673 tors. eta vs tors. theta energy: -32.618 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -267.851236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.851236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.149773 (E_RNA) where: Base-Base interactions energy: -168.390 where: short stacking energy: -87.870 Base-Backbone interact. energy: 6.241 local terms energy: -106.001122 where: bonds (distance) C4'-P energy: -19.525 bonds (distance) P-C4' energy: -25.578 flat angles C4'-P-C4' energy: -24.003 flat angles P-C4'-P energy: -17.660 tors. eta vs tors. theta energy: -19.235 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -247.847042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.847042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.904762 (E_RNA) where: Base-Base interactions energy: -146.735 where: short stacking energy: -78.683 Base-Backbone interact. energy: -0.164 local terms energy: -101.005668 where: bonds (distance) C4'-P energy: -20.776 bonds (distance) P-C4' energy: -22.035 flat angles C4'-P-C4' energy: -22.432 flat angles P-C4'-P energy: -15.427 tors. eta vs tors. theta energy: -20.337 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -200.525100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.525100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.704130 (E_RNA) where: Base-Base interactions energy: -109.409 where: short stacking energy: -53.414 Base-Backbone interact. energy: -0.382 local terms energy: -90.913450 where: bonds (distance) C4'-P energy: -23.582 bonds (distance) P-C4' energy: -26.037 flat angles C4'-P-C4' energy: -17.584 flat angles P-C4'-P energy: -16.205 tors. eta vs tors. theta energy: -7.506 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -167.473929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.473929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.720114 (E_RNA) where: Base-Base interactions energy: -88.706 where: short stacking energy: -60.195 Base-Backbone interact. energy: 1.731 local terms energy: -80.745247 where: bonds (distance) C4'-P energy: -8.973 bonds (distance) P-C4' energy: -19.245 flat angles C4'-P-C4' energy: -23.376 flat angles P-C4'-P energy: -14.470 tors. eta vs tors. theta energy: -14.681 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -124.400082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.400082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.501322 (E_RNA) where: Base-Base interactions energy: -48.429 where: short stacking energy: -30.508 Base-Backbone interact. energy: -0.282 local terms energy: -75.789563 where: bonds (distance) C4'-P energy: -18.341 bonds (distance) P-C4' energy: -23.639 flat angles C4'-P-C4' energy: -19.769 flat angles P-C4'-P energy: -12.225 tors. eta vs tors. theta energy: -1.815 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -367.183965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.183965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.201808 (E_RNA) where: Base-Base interactions energy: -241.464 where: short stacking energy: -131.917 Base-Backbone interact. energy: -0.027 local terms energy: -125.710980 where: bonds (distance) C4'-P energy: -26.174 bonds (distance) P-C4' energy: -16.866 flat angles C4'-P-C4' energy: -27.002 flat angles P-C4'-P energy: -16.801 tors. eta vs tors. theta energy: -38.867 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -373.813017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.813017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.991782 (E_RNA) where: Base-Base interactions energy: -254.784 where: short stacking energy: -123.245 Base-Backbone interact. energy: -0.099 local terms energy: -119.108972 where: bonds (distance) C4'-P energy: -17.012 bonds (distance) P-C4' energy: -25.723 flat angles C4'-P-C4' energy: -21.569 flat angles P-C4'-P energy: -21.446 tors. eta vs tors. theta energy: -33.359 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -366.876814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.876814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.236924 (E_RNA) where: Base-Base interactions energy: -240.615 where: short stacking energy: -124.325 Base-Backbone interact. energy: -0.409 local terms energy: -126.213101 where: bonds (distance) C4'-P energy: -22.203 bonds (distance) P-C4' energy: -24.542 flat angles C4'-P-C4' energy: -28.438 flat angles P-C4'-P energy: -16.983 tors. eta vs tors. theta energy: -34.048 Dist. restrs. and SS energy: 0.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -338.071772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.071772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.110826 (E_RNA) where: Base-Base interactions energy: -224.198 where: short stacking energy: -118.956 Base-Backbone interact. energy: -0.693 local terms energy: -113.219140 where: bonds (distance) C4'-P energy: -14.775 bonds (distance) P-C4' energy: -26.446 flat angles C4'-P-C4' energy: -20.726 flat angles P-C4'-P energy: -19.974 tors. eta vs tors. theta energy: -31.298 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -308.946026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.946026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.951858 (E_RNA) where: Base-Base interactions energy: -203.026 where: short stacking energy: -115.086 Base-Backbone interact. energy: -0.008 local terms energy: -105.917459 where: bonds (distance) C4'-P energy: -20.418 bonds (distance) P-C4' energy: -15.837 flat angles C4'-P-C4' energy: -25.330 flat angles P-C4'-P energy: -15.033 tors. eta vs tors. theta energy: -29.299 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -265.469391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.469391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.706345 (E_RNA) where: Base-Base interactions energy: -157.973 where: short stacking energy: -88.424 Base-Backbone interact. energy: -0.092 local terms energy: -107.640849 where: bonds (distance) C4'-P energy: -20.375 bonds (distance) P-C4' energy: -18.852 flat angles C4'-P-C4' energy: -22.679 flat angles P-C4'-P energy: -19.331 tors. eta vs tors. theta energy: -26.404 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -249.265979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.265979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.265979 (E_RNA) where: Base-Base interactions energy: -152.058 where: short stacking energy: -99.595 Base-Backbone interact. energy: -0.234 local terms energy: -96.974755 where: bonds (distance) C4'-P energy: -17.637 bonds (distance) P-C4' energy: -15.240 flat angles C4'-P-C4' energy: -26.337 flat angles P-C4'-P energy: -16.679 tors. eta vs tors. theta energy: -21.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -206.104356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.104356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.504719 (E_RNA) where: Base-Base interactions energy: -117.806 where: short stacking energy: -58.758 Base-Backbone interact. energy: -0.330 local terms energy: -88.368764 where: bonds (distance) C4'-P energy: -24.970 bonds (distance) P-C4' energy: -19.142 flat angles C4'-P-C4' energy: -17.358 flat angles P-C4'-P energy: -16.524 tors. eta vs tors. theta energy: -10.375 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -264.933866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.933866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.389937 (E_RNA) where: Base-Base interactions energy: -169.840 where: short stacking energy: -93.252 Base-Backbone interact. energy: -1.303 local terms energy: -94.247410 where: bonds (distance) C4'-P energy: -8.794 bonds (distance) P-C4' energy: -24.512 flat angles C4'-P-C4' energy: -25.243 flat angles P-C4'-P energy: -16.885 tors. eta vs tors. theta energy: -18.813 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -128.344293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.344293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.023696 (E_RNA) where: Base-Base interactions energy: -57.300 where: short stacking energy: -39.804 Base-Backbone interact. energy: -0.518 local terms energy: -76.206313 where: bonds (distance) C4'-P energy: -14.009 bonds (distance) P-C4' energy: -23.234 flat angles C4'-P-C4' energy: -21.962 flat angles P-C4'-P energy: -11.332 tors. eta vs tors. theta energy: -5.669 Dist. restrs. and SS energy: 5.679 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -360.168218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.168218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.406870 (E_RNA) where: Base-Base interactions energy: -234.238 where: short stacking energy: -116.009 Base-Backbone interact. energy: -0.704 local terms energy: -125.465597 where: bonds (distance) C4'-P energy: -27.067 bonds (distance) P-C4' energy: -23.283 flat angles C4'-P-C4' energy: -26.634 flat angles P-C4'-P energy: -17.176 tors. eta vs tors. theta energy: -31.305 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -365.701270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.701270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.701270 (E_RNA) where: Base-Base interactions energy: -248.689 where: short stacking energy: -125.681 Base-Backbone interact. energy: -0.039 local terms energy: -116.973428 where: bonds (distance) C4'-P energy: -20.433 bonds (distance) P-C4' energy: -17.132 flat angles C4'-P-C4' energy: -26.464 flat angles P-C4'-P energy: -18.039 tors. eta vs tors. theta energy: -34.905 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -365.948066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.948066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.004634 (E_RNA) where: Base-Base interactions energy: -254.146 where: short stacking energy: -120.703 Base-Backbone interact. energy: -0.014 local terms energy: -111.844958 where: bonds (distance) C4'-P energy: -15.552 bonds (distance) P-C4' energy: -21.533 flat angles C4'-P-C4' energy: -25.658 flat angles P-C4'-P energy: -16.293 tors. eta vs tors. theta energy: -32.809 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -342.969922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.969922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.969922 (E_RNA) where: Base-Base interactions energy: -234.112 where: short stacking energy: -109.963 Base-Backbone interact. energy: -1.291 local terms energy: -107.567401 where: bonds (distance) C4'-P energy: -17.926 bonds (distance) P-C4' energy: -19.857 flat angles C4'-P-C4' energy: -23.586 flat angles P-C4'-P energy: -17.459 tors. eta vs tors. theta energy: -28.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -336.003978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.003978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.020526 (E_RNA) where: Base-Base interactions energy: -217.588 where: short stacking energy: -110.954 Base-Backbone interact. energy: -0.155 local terms energy: -118.277164 where: bonds (distance) C4'-P energy: -18.198 bonds (distance) P-C4' energy: -26.359 flat angles C4'-P-C4' energy: -25.740 flat angles P-C4'-P energy: -18.875 tors. eta vs tors. theta energy: -29.105 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -284.175722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.175722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.180685 (E_RNA) where: Base-Base interactions energy: -184.677 where: short stacking energy: -88.029 Base-Backbone interact. energy: -0.791 local terms energy: -98.712858 where: bonds (distance) C4'-P energy: -21.778 bonds (distance) P-C4' energy: -23.858 flat angles C4'-P-C4' energy: -21.305 flat angles P-C4'-P energy: -9.762 tors. eta vs tors. theta energy: -22.010 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -233.689535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.689535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.689535 (E_RNA) where: Base-Base interactions energy: -151.441 where: short stacking energy: -89.558 Base-Backbone interact. energy: -0.727 local terms energy: -81.522001 where: bonds (distance) C4'-P energy: -18.976 bonds (distance) P-C4' energy: -21.214 flat angles C4'-P-C4' energy: -14.410 flat angles P-C4'-P energy: -7.697 tors. eta vs tors. theta energy: -19.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -270.230258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.230258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.237502 (E_RNA) where: Base-Base interactions energy: -171.469 where: short stacking energy: -84.999 Base-Backbone interact. energy: -1.073 local terms energy: -97.695726 where: bonds (distance) C4'-P energy: -18.749 bonds (distance) P-C4' energy: -21.584 flat angles C4'-P-C4' energy: -23.125 flat angles P-C4'-P energy: -14.805 tors. eta vs tors. theta energy: -19.432 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -186.253919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.253919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.253919 (E_RNA) where: Base-Base interactions energy: -103.720 where: short stacking energy: -46.477 Base-Backbone interact. energy: -0.937 local terms energy: -81.596466 where: bonds (distance) C4'-P energy: -22.278 bonds (distance) P-C4' energy: -19.197 flat angles C4'-P-C4' energy: -21.118 flat angles P-C4'-P energy: -10.790 tors. eta vs tors. theta energy: -8.214 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -144.902200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.902200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.233563 (E_RNA) where: Base-Base interactions energy: -75.104 where: short stacking energy: -44.969 Base-Backbone interact. energy: 0.809 local terms energy: -70.938639 where: bonds (distance) C4'-P energy: -22.463 bonds (distance) P-C4' energy: -25.815 flat angles C4'-P-C4' energy: -11.630 flat angles P-C4'-P energy: -9.445 tors. eta vs tors. theta energy: -1.585 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -365.358422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.358422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.388655 (E_RNA) where: Base-Base interactions energy: -254.377 where: short stacking energy: -117.862 Base-Backbone interact. energy: -1.611 local terms energy: -109.400211 where: bonds (distance) C4'-P energy: -19.334 bonds (distance) P-C4' energy: -20.047 flat angles C4'-P-C4' energy: -25.498 flat angles P-C4'-P energy: -9.701 tors. eta vs tors. theta energy: -34.820 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -361.827903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.827903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.921325 (E_RNA) where: Base-Base interactions energy: -239.491 where: short stacking energy: -109.560 Base-Backbone interact. energy: -0.177 local terms energy: -122.253424 where: bonds (distance) C4'-P energy: -24.918 bonds (distance) P-C4' energy: -20.855 flat angles C4'-P-C4' energy: -27.580 flat angles P-C4'-P energy: -20.796 tors. eta vs tors. theta energy: -28.105 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -361.551318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.551318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.652981 (E_RNA) where: Base-Base interactions energy: -245.391 where: short stacking energy: -122.819 Base-Backbone interact. energy: 0.299 local terms energy: -116.561812 where: bonds (distance) C4'-P energy: -22.779 bonds (distance) P-C4' energy: -23.566 flat angles C4'-P-C4' energy: -23.839 flat angles P-C4'-P energy: -13.156 tors. eta vs tors. theta energy: -33.221 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -345.043018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.043018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.059380 (E_RNA) where: Base-Base interactions energy: -231.068 where: short stacking energy: -105.838 Base-Backbone interact. energy: -0.310 local terms energy: -113.681368 where: bonds (distance) C4'-P energy: -14.147 bonds (distance) P-C4' energy: -26.816 flat angles C4'-P-C4' energy: -23.864 flat angles P-C4'-P energy: -17.205 tors. eta vs tors. theta energy: -31.650 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -347.151800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.151800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.155340 (E_RNA) where: Base-Base interactions energy: -226.072 where: short stacking energy: -108.530 Base-Backbone interact. energy: -0.595 local terms energy: -120.488352 where: bonds (distance) C4'-P energy: -16.678 bonds (distance) P-C4' energy: -24.174 flat angles C4'-P-C4' energy: -27.171 flat angles P-C4'-P energy: -18.137 tors. eta vs tors. theta energy: -34.329 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -266.349709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.349709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.395537 (E_RNA) where: Base-Base interactions energy: -164.085 where: short stacking energy: -85.133 Base-Backbone interact. energy: -0.365 local terms energy: -101.945165 where: bonds (distance) C4'-P energy: -24.516 bonds (distance) P-C4' energy: -23.500 flat angles C4'-P-C4' energy: -21.235 flat angles P-C4'-P energy: -17.379 tors. eta vs tors. theta energy: -15.314 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -271.966453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.966453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.980673 (E_RNA) where: Base-Base interactions energy: -169.509 where: short stacking energy: -93.025 Base-Backbone interact. energy: -0.686 local terms energy: -101.785943 where: bonds (distance) C4'-P energy: -23.601 bonds (distance) P-C4' energy: -20.506 flat angles C4'-P-C4' energy: -21.658 flat angles P-C4'-P energy: -11.095 tors. eta vs tors. theta energy: -24.927 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -217.680526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.680526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.688382 (E_RNA) where: Base-Base interactions energy: -129.484 where: short stacking energy: -71.654 Base-Backbone interact. energy: -0.842 local terms energy: -87.361817 where: bonds (distance) C4'-P energy: -18.229 bonds (distance) P-C4' energy: -17.439 flat angles C4'-P-C4' energy: -21.131 flat angles P-C4'-P energy: -12.198 tors. eta vs tors. theta energy: -18.365 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -151.163663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.163663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.009068 (E_RNA) where: Base-Base interactions energy: -73.711 where: short stacking energy: -50.026 Base-Backbone interact. energy: 4.483 local terms energy: -83.780417 where: bonds (distance) C4'-P energy: -23.458 bonds (distance) P-C4' energy: -19.810 flat angles C4'-P-C4' energy: -17.913 flat angles P-C4'-P energy: -16.629 tors. eta vs tors. theta energy: -5.971 Dist. restrs. and SS energy: 1.845 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -167.870795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.870795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.900217 (E_RNA) where: Base-Base interactions energy: -87.822 where: short stacking energy: -49.206 Base-Backbone interact. energy: -0.535 local terms energy: -79.543160 where: bonds (distance) C4'-P energy: -24.928 bonds (distance) P-C4' energy: -25.202 flat angles C4'-P-C4' energy: -19.942 flat angles P-C4'-P energy: -2.610 tors. eta vs tors. theta energy: -6.862 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -373.820082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.820082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.820082 (E_RNA) where: Base-Base interactions energy: -251.681 where: short stacking energy: -119.382 Base-Backbone interact. energy: -0.990 local terms energy: -121.149395 where: bonds (distance) C4'-P energy: -20.038 bonds (distance) P-C4' energy: -24.196 flat angles C4'-P-C4' energy: -23.334 flat angles P-C4'-P energy: -18.116 tors. eta vs tors. theta energy: -35.465 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -386.917173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.917173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.919195 (E_RNA) where: Base-Base interactions energy: -249.058 where: short stacking energy: -123.734 Base-Backbone interact. energy: -0.011 local terms energy: -137.850475 where: bonds (distance) C4'-P energy: -24.767 bonds (distance) P-C4' energy: -27.661 flat angles C4'-P-C4' energy: -29.189 flat angles P-C4'-P energy: -19.289 tors. eta vs tors. theta energy: -36.946 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -349.092616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.092616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.092616 (E_RNA) where: Base-Base interactions energy: -236.305 where: short stacking energy: -118.669 Base-Backbone interact. energy: -0.674 local terms energy: -112.113224 where: bonds (distance) C4'-P energy: -19.145 bonds (distance) P-C4' energy: -25.938 flat angles C4'-P-C4' energy: -21.206 flat angles P-C4'-P energy: -18.950 tors. eta vs tors. theta energy: -26.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -337.576080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.576080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.578028 (E_RNA) where: Base-Base interactions energy: -227.873 where: short stacking energy: -115.286 Base-Backbone interact. energy: -0.753 local terms energy: -108.952111 where: bonds (distance) C4'-P energy: -14.321 bonds (distance) P-C4' energy: -20.849 flat angles C4'-P-C4' energy: -22.502 flat angles P-C4'-P energy: -16.311 tors. eta vs tors. theta energy: -34.969 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -325.036142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.036142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.036142 (E_RNA) where: Base-Base interactions energy: -217.256 where: short stacking energy: -105.007 Base-Backbone interact. energy: -1.582 local terms energy: -106.197806 where: bonds (distance) C4'-P energy: -15.898 bonds (distance) P-C4' energy: -20.922 flat angles C4'-P-C4' energy: -22.565 flat angles P-C4'-P energy: -13.913 tors. eta vs tors. theta energy: -32.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -262.930778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.930778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.940281 (E_RNA) where: Base-Base interactions energy: -155.241 where: short stacking energy: -91.887 Base-Backbone interact. energy: -0.239 local terms energy: -107.460671 where: bonds (distance) C4'-P energy: -19.679 bonds (distance) P-C4' energy: -23.557 flat angles C4'-P-C4' energy: -25.985 flat angles P-C4'-P energy: -12.398 tors. eta vs tors. theta energy: -25.842 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -262.098696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.098696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.138086 (E_RNA) where: Base-Base interactions energy: -162.656 where: short stacking energy: -95.360 Base-Backbone interact. energy: -1.176 local terms energy: -98.306311 where: bonds (distance) C4'-P energy: -19.974 bonds (distance) P-C4' energy: -23.644 flat angles C4'-P-C4' energy: -21.027 flat angles P-C4'-P energy: -8.395 tors. eta vs tors. theta energy: -25.267 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -242.897727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.897727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.052663 (E_RNA) where: Base-Base interactions energy: -143.405 where: short stacking energy: -74.652 Base-Backbone interact. energy: -0.349 local terms energy: -99.298159 where: bonds (distance) C4'-P energy: -22.726 bonds (distance) P-C4' energy: -21.656 flat angles C4'-P-C4' energy: -26.055 flat angles P-C4'-P energy: -9.194 tors. eta vs tors. theta energy: -19.667 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -147.886893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.886893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.888774 (E_RNA) where: Base-Base interactions energy: -72.902 where: short stacking energy: -39.919 Base-Backbone interact. energy: 0.883 local terms energy: -75.870292 where: bonds (distance) C4'-P energy: -24.238 bonds (distance) P-C4' energy: -17.948 flat angles C4'-P-C4' energy: -21.565 flat angles P-C4'-P energy: -9.497 tors. eta vs tors. theta energy: -2.622 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -163.526366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.526366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.810324 (E_RNA) where: Base-Base interactions energy: -84.370 where: short stacking energy: -55.536 Base-Backbone interact. energy: -0.120 local terms energy: -79.320023 where: bonds (distance) C4'-P energy: -23.929 bonds (distance) P-C4' energy: -19.835 flat angles C4'-P-C4' energy: -18.554 flat angles P-C4'-P energy: -7.048 tors. eta vs tors. theta energy: -9.954 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -377.661194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.661194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.661194 (E_RNA) where: Base-Base interactions energy: -247.789 where: short stacking energy: -128.106 Base-Backbone interact. energy: -0.673 local terms energy: -129.199431 where: bonds (distance) C4'-P energy: -25.769 bonds (distance) P-C4' energy: -25.854 flat angles C4'-P-C4' energy: -22.635 flat angles P-C4'-P energy: -18.910 tors. eta vs tors. theta energy: -36.032 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -363.130030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.130030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.280946 (E_RNA) where: Base-Base interactions energy: -232.389 where: short stacking energy: -113.604 Base-Backbone interact. energy: -1.491 local terms energy: -129.401121 where: bonds (distance) C4'-P energy: -28.657 bonds (distance) P-C4' energy: -24.502 flat angles C4'-P-C4' energy: -23.147 flat angles P-C4'-P energy: -19.081 tors. eta vs tors. theta energy: -34.014 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -344.877314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.877314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.877314 (E_RNA) where: Base-Base interactions energy: -230.222 where: short stacking energy: -111.801 Base-Backbone interact. energy: -1.692 local terms energy: -112.963943 where: bonds (distance) C4'-P energy: -21.152 bonds (distance) P-C4' energy: -18.035 flat angles C4'-P-C4' energy: -24.960 flat angles P-C4'-P energy: -20.427 tors. eta vs tors. theta energy: -28.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -318.383467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.383467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.383467 (E_RNA) where: Base-Base interactions energy: -213.556 where: short stacking energy: -106.834 Base-Backbone interact. energy: -0.311 local terms energy: -104.516696 where: bonds (distance) C4'-P energy: -21.221 bonds (distance) P-C4' energy: -21.886 flat angles C4'-P-C4' energy: -20.207 flat angles P-C4'-P energy: -17.743 tors. eta vs tors. theta energy: -23.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -319.311045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.311045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.312468 (E_RNA) where: Base-Base interactions energy: -196.267 where: short stacking energy: -114.980 Base-Backbone interact. energy: 0.946 local terms energy: -123.991438 where: bonds (distance) C4'-P energy: -20.449 bonds (distance) P-C4' energy: -26.458 flat angles C4'-P-C4' energy: -24.467 flat angles P-C4'-P energy: -14.706 tors. eta vs tors. theta energy: -37.912 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -299.678342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.678342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.726579 (E_RNA) where: Base-Base interactions energy: -191.207 where: short stacking energy: -96.892 Base-Backbone interact. energy: 1.442 local terms energy: -109.960830 where: bonds (distance) C4'-P energy: -17.341 bonds (distance) P-C4' energy: -24.922 flat angles C4'-P-C4' energy: -21.097 flat angles P-C4'-P energy: -18.735 tors. eta vs tors. theta energy: -27.866 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -225.873994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.873994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.873994 (E_RNA) where: Base-Base interactions energy: -138.220 where: short stacking energy: -63.318 Base-Backbone interact. energy: 0.700 local terms energy: -88.353839 where: bonds (distance) C4'-P energy: -19.668 bonds (distance) P-C4' energy: -16.891 flat angles C4'-P-C4' energy: -21.844 flat angles P-C4'-P energy: -15.024 tors. eta vs tors. theta energy: -14.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -256.821150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.821150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.821150 (E_RNA) where: Base-Base interactions energy: -164.764 where: short stacking energy: -70.186 Base-Backbone interact. energy: -0.341 local terms energy: -91.715765 where: bonds (distance) C4'-P energy: -14.388 bonds (distance) P-C4' energy: -26.386 flat angles C4'-P-C4' energy: -26.553 flat angles P-C4'-P energy: -10.146 tors. eta vs tors. theta energy: -14.243 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -167.317128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.317128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.334589 (E_RNA) where: Base-Base interactions energy: -86.363 where: short stacking energy: -60.029 Base-Backbone interact. energy: -0.296 local terms energy: -80.674832 where: bonds (distance) C4'-P energy: -19.405 bonds (distance) P-C4' energy: -24.797 flat angles C4'-P-C4' energy: -16.598 flat angles P-C4'-P energy: -10.289 tors. eta vs tors. theta energy: -9.586 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -217.852228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.852228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.901910 (E_RNA) where: Base-Base interactions energy: -132.422 where: short stacking energy: -77.914 Base-Backbone interact. energy: -0.094 local terms energy: -85.386286 where: bonds (distance) C4'-P energy: -13.984 bonds (distance) P-C4' energy: -21.503 flat angles C4'-P-C4' energy: -16.261 flat angles P-C4'-P energy: -14.172 tors. eta vs tors. theta energy: -19.465 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -371.246268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.246268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.246268 (E_RNA) where: Base-Base interactions energy: -245.401 where: short stacking energy: -116.086 Base-Backbone interact. energy: -1.362 local terms energy: -124.483783 where: bonds (distance) C4'-P energy: -24.314 bonds (distance) P-C4' energy: -26.864 flat angles C4'-P-C4' energy: -20.303 flat angles P-C4'-P energy: -15.851 tors. eta vs tors. theta energy: -37.150 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -355.257716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.257716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.335787 (E_RNA) where: Base-Base interactions energy: -235.936 where: short stacking energy: -123.209 Base-Backbone interact. energy: -0.113 local terms energy: -119.287289 where: bonds (distance) C4'-P energy: -22.149 bonds (distance) P-C4' energy: -25.006 flat angles C4'-P-C4' energy: -23.937 flat angles P-C4'-P energy: -15.663 tors. eta vs tors. theta energy: -32.531 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -373.000174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.000174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.000174 (E_RNA) where: Base-Base interactions energy: -240.278 where: short stacking energy: -118.445 Base-Backbone interact. energy: -0.058 local terms energy: -132.664488 where: bonds (distance) C4'-P energy: -23.275 bonds (distance) P-C4' energy: -24.637 flat angles C4'-P-C4' energy: -26.742 flat angles P-C4'-P energy: -20.272 tors. eta vs tors. theta energy: -37.737 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -331.530724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.530724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.581628 (E_RNA) where: Base-Base interactions energy: -205.536 where: short stacking energy: -104.256 Base-Backbone interact. energy: -1.130 local terms energy: -124.914852 where: bonds (distance) C4'-P energy: -20.598 bonds (distance) P-C4' energy: -27.173 flat angles C4'-P-C4' energy: -24.810 flat angles P-C4'-P energy: -20.502 tors. eta vs tors. theta energy: -31.831 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -347.702201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.702201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.809481 (E_RNA) where: Base-Base interactions energy: -226.992 where: short stacking energy: -116.822 Base-Backbone interact. energy: -0.549 local terms energy: -120.268307 where: bonds (distance) C4'-P energy: -16.395 bonds (distance) P-C4' energy: -25.355 flat angles C4'-P-C4' energy: -26.782 flat angles P-C4'-P energy: -17.543 tors. eta vs tors. theta energy: -34.193 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -308.507977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.507977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.507977 (E_RNA) where: Base-Base interactions energy: -189.546 where: short stacking energy: -91.653 Base-Backbone interact. energy: -1.046 local terms energy: -117.915361 where: bonds (distance) C4'-P energy: -20.456 bonds (distance) P-C4' energy: -23.225 flat angles C4'-P-C4' energy: -26.006 flat angles P-C4'-P energy: -20.729 tors. eta vs tors. theta energy: -27.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -265.512544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.512544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.570625 (E_RNA) where: Base-Base interactions energy: -158.428 where: short stacking energy: -77.318 Base-Backbone interact. energy: -0.170 local terms energy: -106.971816 where: bonds (distance) C4'-P energy: -19.231 bonds (distance) P-C4' energy: -22.468 flat angles C4'-P-C4' energy: -26.071 flat angles P-C4'-P energy: -13.447 tors. eta vs tors. theta energy: -25.754 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -248.221504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.221504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.571877 (E_RNA) where: Base-Base interactions energy: -151.306 where: short stacking energy: -65.643 Base-Backbone interact. energy: -0.660 local terms energy: -96.606345 where: bonds (distance) C4'-P energy: -22.407 bonds (distance) P-C4' energy: -27.371 flat angles C4'-P-C4' energy: -12.789 flat angles P-C4'-P energy: -15.042 tors. eta vs tors. theta energy: -18.997 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -175.745358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.745358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.795557 (E_RNA) where: Base-Base interactions energy: -102.732 where: short stacking energy: -68.173 Base-Backbone interact. energy: 0.062 local terms energy: -73.125249 where: bonds (distance) C4'-P energy: -8.696 bonds (distance) P-C4' energy: -20.850 flat angles C4'-P-C4' energy: -22.698 flat angles P-C4'-P energy: -10.397 tors. eta vs tors. theta energy: -10.486 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -198.683930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.683930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.828712 (E_RNA) where: Base-Base interactions energy: -115.202 where: short stacking energy: -63.245 Base-Backbone interact. energy: 1.914 local terms energy: -85.541177 where: bonds (distance) C4'-P energy: -22.246 bonds (distance) P-C4' energy: -25.840 flat angles C4'-P-C4' energy: -12.337 flat angles P-C4'-P energy: -14.145 tors. eta vs tors. theta energy: -10.974 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -376.323742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.323742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.323742 (E_RNA) where: Base-Base interactions energy: -251.785 where: short stacking energy: -111.437 Base-Backbone interact. energy: 0.475 local terms energy: -125.013473 where: bonds (distance) C4'-P energy: -24.210 bonds (distance) P-C4' energy: -17.644 flat angles C4'-P-C4' energy: -29.398 flat angles P-C4'-P energy: -18.663 tors. eta vs tors. theta energy: -35.100 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -357.769516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.769516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.769516 (E_RNA) where: Base-Base interactions energy: -227.958 where: short stacking energy: -104.166 Base-Backbone interact. energy: -0.548 local terms energy: -129.262834 where: bonds (distance) C4'-P energy: -27.146 bonds (distance) P-C4' energy: -27.759 flat angles C4'-P-C4' energy: -25.299 flat angles P-C4'-P energy: -14.281 tors. eta vs tors. theta energy: -34.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -367.220383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.220383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.381972 (E_RNA) where: Base-Base interactions energy: -236.612 where: short stacking energy: -113.069 Base-Backbone interact. energy: -0.301 local terms energy: -130.468102 where: bonds (distance) C4'-P energy: -20.527 bonds (distance) P-C4' energy: -23.132 flat angles C4'-P-C4' energy: -25.817 flat angles P-C4'-P energy: -20.547 tors. eta vs tors. theta energy: -40.445 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -307.890626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.890626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.890626 (E_RNA) where: Base-Base interactions energy: -190.915 where: short stacking energy: -102.583 Base-Backbone interact. energy: -0.075 local terms energy: -116.900532 where: bonds (distance) C4'-P energy: -23.312 bonds (distance) P-C4' energy: -24.245 flat angles C4'-P-C4' energy: -25.868 flat angles P-C4'-P energy: -17.744 tors. eta vs tors. theta energy: -25.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -328.307286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.307286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.421167 (E_RNA) where: Base-Base interactions energy: -223.179 where: short stacking energy: -103.365 Base-Backbone interact. energy: -0.128 local terms energy: -105.114669 where: bonds (distance) C4'-P energy: -16.638 bonds (distance) P-C4' energy: -23.647 flat angles C4'-P-C4' energy: -22.525 flat angles P-C4'-P energy: -16.532 tors. eta vs tors. theta energy: -25.773 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -291.855105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.855105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.871117 (E_RNA) where: Base-Base interactions energy: -188.238 where: short stacking energy: -97.403 Base-Backbone interact. energy: -0.129 local terms energy: -103.503944 where: bonds (distance) C4'-P energy: -19.030 bonds (distance) P-C4' energy: -24.525 flat angles C4'-P-C4' energy: -25.167 flat angles P-C4'-P energy: -14.847 tors. eta vs tors. theta energy: -19.935 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -265.419993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.419993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.552801 (E_RNA) where: Base-Base interactions energy: -169.931 where: short stacking energy: -90.081 Base-Backbone interact. energy: -0.104 local terms energy: -95.517783 where: bonds (distance) C4'-P energy: -16.477 bonds (distance) P-C4' energy: -24.237 flat angles C4'-P-C4' energy: -21.200 flat angles P-C4'-P energy: -13.051 tors. eta vs tors. theta energy: -20.552 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -255.596989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.596989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.596989 (E_RNA) where: Base-Base interactions energy: -154.050 where: short stacking energy: -81.810 Base-Backbone interact. energy: 0.405 local terms energy: -101.951813 where: bonds (distance) C4'-P energy: -21.681 bonds (distance) P-C4' energy: -26.850 flat angles C4'-P-C4' energy: -20.414 flat angles P-C4'-P energy: -13.463 tors. eta vs tors. theta energy: -19.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -225.050150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.050150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.084872 (E_RNA) where: Base-Base interactions energy: -137.055 where: short stacking energy: -74.153 Base-Backbone interact. energy: -0.479 local terms energy: -87.550086 where: bonds (distance) C4'-P energy: -18.365 bonds (distance) P-C4' energy: -17.209 flat angles C4'-P-C4' energy: -20.883 flat angles P-C4'-P energy: -15.985 tors. eta vs tors. theta energy: -15.108 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -137.611856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.611856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.611856 (E_RNA) where: Base-Base interactions energy: -77.032 where: short stacking energy: -45.952 Base-Backbone interact. energy: -0.830 local terms energy: -59.750029 where: bonds (distance) C4'-P energy: -14.027 bonds (distance) P-C4' energy: -23.129 flat angles C4'-P-C4' energy: -16.868 flat angles P-C4'-P energy: -11.746 tors. eta vs tors. theta energy: 6.020 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -391.278912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.278912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.321163 (E_RNA) where: Base-Base interactions energy: -251.849 where: short stacking energy: -116.734 Base-Backbone interact. energy: -0.532 local terms energy: -138.940183 where: bonds (distance) C4'-P energy: -25.196 bonds (distance) P-C4' energy: -26.152 flat angles C4'-P-C4' energy: -30.761 flat angles P-C4'-P energy: -21.583 tors. eta vs tors. theta energy: -35.248 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -367.314086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.314086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.325712 (E_RNA) where: Base-Base interactions energy: -238.804 where: short stacking energy: -117.491 Base-Backbone interact. energy: -0.083 local terms energy: -128.438936 where: bonds (distance) C4'-P energy: -23.768 bonds (distance) P-C4' energy: -24.716 flat angles C4'-P-C4' energy: -26.965 flat angles P-C4'-P energy: -16.048 tors. eta vs tors. theta energy: -36.942 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -354.012392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.012392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.022183 (E_RNA) where: Base-Base interactions energy: -229.849 where: short stacking energy: -119.751 Base-Backbone interact. energy: 0.652 local terms energy: -124.824891 where: bonds (distance) C4'-P energy: -20.125 bonds (distance) P-C4' energy: -24.225 flat angles C4'-P-C4' energy: -24.006 flat angles P-C4'-P energy: -19.548 tors. eta vs tors. theta energy: -36.920 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -317.645671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.645671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.645671 (E_RNA) where: Base-Base interactions energy: -205.881 where: short stacking energy: -90.928 Base-Backbone interact. energy: -1.273 local terms energy: -110.491516 where: bonds (distance) C4'-P energy: -22.640 bonds (distance) P-C4' energy: -17.347 flat angles C4'-P-C4' energy: -27.755 flat angles P-C4'-P energy: -16.737 tors. eta vs tors. theta energy: -26.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -282.119565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.119565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.137612 (E_RNA) where: Base-Base interactions energy: -174.475 where: short stacking energy: -90.702 Base-Backbone interact. energy: 0.141 local terms energy: -107.804314 where: bonds (distance) C4'-P energy: -20.213 bonds (distance) P-C4' energy: -26.847 flat angles C4'-P-C4' energy: -24.525 flat angles P-C4'-P energy: -14.388 tors. eta vs tors. theta energy: -21.831 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -308.142319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.142319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.169330 (E_RNA) where: Base-Base interactions energy: -209.496 where: short stacking energy: -100.816 Base-Backbone interact. energy: -0.172 local terms energy: -98.501277 where: bonds (distance) C4'-P energy: -17.459 bonds (distance) P-C4' energy: -20.795 flat angles C4'-P-C4' energy: -17.656 flat angles P-C4'-P energy: -17.405 tors. eta vs tors. theta energy: -25.188 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -281.242694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.242694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.265868 (E_RNA) where: Base-Base interactions energy: -174.149 where: short stacking energy: -91.768 Base-Backbone interact. energy: -0.435 local terms energy: -106.681518 where: bonds (distance) C4'-P energy: -23.206 bonds (distance) P-C4' energy: -15.206 flat angles C4'-P-C4' energy: -23.620 flat angles P-C4'-P energy: -20.936 tors. eta vs tors. theta energy: -23.714 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -250.560952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.560952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.564615 (E_RNA) where: Base-Base interactions energy: -161.554 where: short stacking energy: -78.019 Base-Backbone interact. energy: 0.673 local terms energy: -89.683646 where: bonds (distance) C4'-P energy: -26.695 bonds (distance) P-C4' energy: -23.083 flat angles C4'-P-C4' energy: -15.928 flat angles P-C4'-P energy: -5.801 tors. eta vs tors. theta energy: -18.177 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -215.062775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.062775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.155582 (E_RNA) where: Base-Base interactions energy: -131.191 where: short stacking energy: -71.981 Base-Backbone interact. energy: -0.425 local terms energy: -83.539565 where: bonds (distance) C4'-P energy: -22.029 bonds (distance) P-C4' energy: -16.928 flat angles C4'-P-C4' energy: -19.177 flat angles P-C4'-P energy: -6.957 tors. eta vs tors. theta energy: -18.449 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -151.155191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.155191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.253196 (E_RNA) where: Base-Base interactions energy: -79.982 where: short stacking energy: -56.244 Base-Backbone interact. energy: -0.526 local terms energy: -70.746010 where: bonds (distance) C4'-P energy: -21.408 bonds (distance) P-C4' energy: -18.462 flat angles C4'-P-C4' energy: -20.232 flat angles P-C4'-P energy: -3.219 tors. eta vs tors. theta energy: -7.424 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -378.404501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.404501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.404501 (E_RNA) where: Base-Base interactions energy: -250.813 where: short stacking energy: -121.217 Base-Backbone interact. energy: -0.105 local terms energy: -127.486177 where: bonds (distance) C4'-P energy: -23.341 bonds (distance) P-C4' energy: -28.648 flat angles C4'-P-C4' energy: -22.010 flat angles P-C4'-P energy: -20.221 tors. eta vs tors. theta energy: -33.266 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -368.053499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.053499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.062105 (E_RNA) where: Base-Base interactions energy: -241.285 where: short stacking energy: -114.366 Base-Backbone interact. energy: -0.425 local terms energy: -126.352376 where: bonds (distance) C4'-P energy: -24.634 bonds (distance) P-C4' energy: -24.222 flat angles C4'-P-C4' energy: -25.821 flat angles P-C4'-P energy: -19.068 tors. eta vs tors. theta energy: -32.607 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -345.961440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.961440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.961440 (E_RNA) where: Base-Base interactions energy: -229.835 where: short stacking energy: -114.461 Base-Backbone interact. energy: -0.095 local terms energy: -116.031171 where: bonds (distance) C4'-P energy: -21.625 bonds (distance) P-C4' energy: -24.800 flat angles C4'-P-C4' energy: -23.875 flat angles P-C4'-P energy: -16.770 tors. eta vs tors. theta energy: -28.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -343.965722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.965722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.965722 (E_RNA) where: Base-Base interactions energy: -225.699 where: short stacking energy: -111.424 Base-Backbone interact. energy: -0.870 local terms energy: -117.396037 where: bonds (distance) C4'-P energy: -24.037 bonds (distance) P-C4' energy: -18.009 flat angles C4'-P-C4' energy: -28.031 flat angles P-C4'-P energy: -16.417 tors. eta vs tors. theta energy: -30.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -295.697560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.697560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.871682 (E_RNA) where: Base-Base interactions energy: -177.521 where: short stacking energy: -101.867 Base-Backbone interact. energy: -0.661 local terms energy: -117.689357 where: bonds (distance) C4'-P energy: -23.726 bonds (distance) P-C4' energy: -25.641 flat angles C4'-P-C4' energy: -23.376 flat angles P-C4'-P energy: -15.392 tors. eta vs tors. theta energy: -29.554 Dist. restrs. and SS energy: 0.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -277.758677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.758677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.758677 (E_RNA) where: Base-Base interactions energy: -180.688 where: short stacking energy: -86.987 Base-Backbone interact. energy: -0.459 local terms energy: -96.611924 where: bonds (distance) C4'-P energy: -18.084 bonds (distance) P-C4' energy: -18.140 flat angles C4'-P-C4' energy: -18.349 flat angles P-C4'-P energy: -19.204 tors. eta vs tors. theta energy: -22.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -280.181815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.181815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.181815 (E_RNA) where: Base-Base interactions energy: -178.248 where: short stacking energy: -99.248 Base-Backbone interact. energy: -0.180 local terms energy: -101.753751 where: bonds (distance) C4'-P energy: -19.594 bonds (distance) P-C4' energy: -24.501 flat angles C4'-P-C4' energy: -18.993 flat angles P-C4'-P energy: -16.442 tors. eta vs tors. theta energy: -22.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -321.769227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.769227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.769227 (E_RNA) where: Base-Base interactions energy: -211.006 where: short stacking energy: -112.829 Base-Backbone interact. energy: -0.685 local terms energy: -110.078629 where: bonds (distance) C4'-P energy: -20.527 bonds (distance) P-C4' energy: -24.180 flat angles C4'-P-C4' energy: -22.747 flat angles P-C4'-P energy: -13.705 tors. eta vs tors. theta energy: -28.918 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -188.896364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.896364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.923563 (E_RNA) where: Base-Base interactions energy: -106.365 where: short stacking energy: -62.406 Base-Backbone interact. energy: -0.708 local terms energy: -81.850395 where: bonds (distance) C4'-P energy: -19.411 bonds (distance) P-C4' energy: -24.165 flat angles C4'-P-C4' energy: -16.959 flat angles P-C4'-P energy: -11.146 tors. eta vs tors. theta energy: -10.170 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -220.595410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.595410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.595410 (E_RNA) where: Base-Base interactions energy: -124.029 where: short stacking energy: -74.644 Base-Backbone interact. energy: 0.137 local terms energy: -96.703723 where: bonds (distance) C4'-P energy: -17.491 bonds (distance) P-C4' energy: -21.087 flat angles C4'-P-C4' energy: -25.945 flat angles P-C4'-P energy: -16.534 tors. eta vs tors. theta energy: -15.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -371.661567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.661567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.661567 (E_RNA) where: Base-Base interactions energy: -243.148 where: short stacking energy: -118.853 Base-Backbone interact. energy: -0.220 local terms energy: -128.293590 where: bonds (distance) C4'-P energy: -22.759 bonds (distance) P-C4' energy: -26.973 flat angles C4'-P-C4' energy: -26.007 flat angles P-C4'-P energy: -17.047 tors. eta vs tors. theta energy: -35.508 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -367.377886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.377886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.377886 (E_RNA) where: Base-Base interactions energy: -244.023 where: short stacking energy: -106.541 Base-Backbone interact. energy: -0.192 local terms energy: -123.162790 where: bonds (distance) C4'-P energy: -20.000 bonds (distance) P-C4' energy: -22.853 flat angles C4'-P-C4' energy: -26.239 flat angles P-C4'-P energy: -20.142 tors. eta vs tors. theta energy: -33.929 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -344.370726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.370726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.506992 (E_RNA) where: Base-Base interactions energy: -231.710 where: short stacking energy: -114.253 Base-Backbone interact. energy: -0.398 local terms energy: -112.398602 where: bonds (distance) C4'-P energy: -16.921 bonds (distance) P-C4' energy: -20.001 flat angles C4'-P-C4' energy: -22.233 flat angles P-C4'-P energy: -18.057 tors. eta vs tors. theta energy: -35.186 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -313.626761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.626761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.627327 (E_RNA) where: Base-Base interactions energy: -193.584 where: short stacking energy: -89.208 Base-Backbone interact. energy: -0.145 local terms energy: -119.898719 where: bonds (distance) C4'-P energy: -26.931 bonds (distance) P-C4' energy: -25.927 flat angles C4'-P-C4' energy: -23.390 flat angles P-C4'-P energy: -17.693 tors. eta vs tors. theta energy: -25.958 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -337.182819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.182819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.182819 (E_RNA) where: Base-Base interactions energy: -219.209 where: short stacking energy: -101.938 Base-Backbone interact. energy: -0.329 local terms energy: -117.644826 where: bonds (distance) C4'-P energy: -18.759 bonds (distance) P-C4' energy: -21.655 flat angles C4'-P-C4' energy: -22.654 flat angles P-C4'-P energy: -16.118 tors. eta vs tors. theta energy: -38.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -276.784752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.784752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.784752 (E_RNA) where: Base-Base interactions energy: -173.367 where: short stacking energy: -85.422 Base-Backbone interact. energy: -0.112 local terms energy: -103.306149 where: bonds (distance) C4'-P energy: -17.592 bonds (distance) P-C4' energy: -23.023 flat angles C4'-P-C4' energy: -24.875 flat angles P-C4'-P energy: -14.178 tors. eta vs tors. theta energy: -23.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -251.075963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.075963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.075963 (E_RNA) where: Base-Base interactions energy: -149.043 where: short stacking energy: -83.980 Base-Backbone interact. energy: -1.354 local terms energy: -100.678222 where: bonds (distance) C4'-P energy: -21.739 bonds (distance) P-C4' energy: -19.222 flat angles C4'-P-C4' energy: -23.854 flat angles P-C4'-P energy: -14.205 tors. eta vs tors. theta energy: -21.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -267.505498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.505498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.564260 (E_RNA) where: Base-Base interactions energy: -166.804 where: short stacking energy: -83.583 Base-Backbone interact. energy: -0.197 local terms energy: -100.562672 where: bonds (distance) C4'-P energy: -21.744 bonds (distance) P-C4' energy: -18.823 flat angles C4'-P-C4' energy: -22.816 flat angles P-C4'-P energy: -18.376 tors. eta vs tors. theta energy: -18.803 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -161.465480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.465480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.490006 (E_RNA) where: Base-Base interactions energy: -79.800 where: short stacking energy: -49.183 Base-Backbone interact. energy: 0.181 local terms energy: -81.870762 where: bonds (distance) C4'-P energy: -18.849 bonds (distance) P-C4' energy: -19.678 flat angles C4'-P-C4' energy: -20.064 flat angles P-C4'-P energy: -17.584 tors. eta vs tors. theta energy: -5.696 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -217.220076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.220076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.292791 (E_RNA) where: Base-Base interactions energy: -129.350 where: short stacking energy: -70.329 Base-Backbone interact. energy: -0.199 local terms energy: -87.743337 where: bonds (distance) C4'-P energy: -11.229 bonds (distance) P-C4' energy: -25.074 flat angles C4'-P-C4' energy: -24.434 flat angles P-C4'-P energy: -15.173 tors. eta vs tors. theta energy: -11.833 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -378.605579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.605579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.605579 (E_RNA) where: Base-Base interactions energy: -242.100 where: short stacking energy: -116.216 Base-Backbone interact. energy: -2.370 local terms energy: -134.135058 where: bonds (distance) C4'-P energy: -26.115 bonds (distance) P-C4' energy: -24.254 flat angles C4'-P-C4' energy: -27.833 flat angles P-C4'-P energy: -18.152 tors. eta vs tors. theta energy: -37.781 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -379.005524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.005524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.005524 (E_RNA) where: Base-Base interactions energy: -246.178 where: short stacking energy: -120.497 Base-Backbone interact. energy: -1.213 local terms energy: -131.614362 where: bonds (distance) C4'-P energy: -23.738 bonds (distance) P-C4' energy: -24.317 flat angles C4'-P-C4' energy: -25.153 flat angles P-C4'-P energy: -23.198 tors. eta vs tors. theta energy: -35.210 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -358.314270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.314270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.314270 (E_RNA) where: Base-Base interactions energy: -240.090 where: short stacking energy: -116.989 Base-Backbone interact. energy: -0.710 local terms energy: -117.513814 where: bonds (distance) C4'-P energy: -25.094 bonds (distance) P-C4' energy: -19.388 flat angles C4'-P-C4' energy: -22.955 flat angles P-C4'-P energy: -17.192 tors. eta vs tors. theta energy: -32.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -330.935308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.935308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.998887 (E_RNA) where: Base-Base interactions energy: -202.632 where: short stacking energy: -101.130 Base-Backbone interact. energy: -0.079 local terms energy: -128.287779 where: bonds (distance) C4'-P energy: -24.797 bonds (distance) P-C4' energy: -28.044 flat angles C4'-P-C4' energy: -26.405 flat angles P-C4'-P energy: -19.507 tors. eta vs tors. theta energy: -29.535 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -299.216437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.216437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.222556 (E_RNA) where: Base-Base interactions energy: -183.770 where: short stacking energy: -95.103 Base-Backbone interact. energy: -0.558 local terms energy: -114.895273 where: bonds (distance) C4'-P energy: -22.616 bonds (distance) P-C4' energy: -24.150 flat angles C4'-P-C4' energy: -23.228 flat angles P-C4'-P energy: -18.822 tors. eta vs tors. theta energy: -26.079 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -318.095729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.095729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.095729 (E_RNA) where: Base-Base interactions energy: -205.502 where: short stacking energy: -105.912 Base-Backbone interact. energy: -0.104 local terms energy: -112.489567 where: bonds (distance) C4'-P energy: -20.248 bonds (distance) P-C4' energy: -21.343 flat angles C4'-P-C4' energy: -24.899 flat angles P-C4'-P energy: -15.564 tors. eta vs tors. theta energy: -30.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -246.899705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.899705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.174343 (E_RNA) where: Base-Base interactions energy: -141.053 where: short stacking energy: -75.828 Base-Backbone interact. energy: -0.225 local terms energy: -105.895580 where: bonds (distance) C4'-P energy: -22.522 bonds (distance) P-C4' energy: -27.677 flat angles C4'-P-C4' energy: -22.938 flat angles P-C4'-P energy: -13.766 tors. eta vs tors. theta energy: -18.993 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -261.349269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.349269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.492498 (E_RNA) where: Base-Base interactions energy: -157.277 where: short stacking energy: -83.743 Base-Backbone interact. energy: -0.357 local terms energy: -103.859156 where: bonds (distance) C4'-P energy: -17.631 bonds (distance) P-C4' energy: -23.746 flat angles C4'-P-C4' energy: -23.988 flat angles P-C4'-P energy: -19.880 tors. eta vs tors. theta energy: -18.614 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -229.343061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.343061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.343061 (E_RNA) where: Base-Base interactions energy: -129.882 where: short stacking energy: -68.102 Base-Backbone interact. energy: -0.038 local terms energy: -99.422910 where: bonds (distance) C4'-P energy: -22.402 bonds (distance) P-C4' energy: -22.864 flat angles C4'-P-C4' energy: -20.715 flat angles P-C4'-P energy: -16.759 tors. eta vs tors. theta energy: -16.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -174.452883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.452883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.476952 (E_RNA) where: Base-Base interactions energy: -102.785 where: short stacking energy: -58.805 Base-Backbone interact. energy: -0.437 local terms energy: -71.254488 where: bonds (distance) C4'-P energy: -15.844 bonds (distance) P-C4' energy: -18.260 flat angles C4'-P-C4' energy: -15.760 flat angles P-C4'-P energy: -8.675 tors. eta vs tors. theta energy: -12.716 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -380.821576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.821576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.855874 (E_RNA) where: Base-Base interactions energy: -245.695 where: short stacking energy: -122.269 Base-Backbone interact. energy: -0.602 local terms energy: -134.559206 where: bonds (distance) C4'-P energy: -24.021 bonds (distance) P-C4' energy: -28.072 flat angles C4'-P-C4' energy: -21.920 flat angles P-C4'-P energy: -22.625 tors. eta vs tors. theta energy: -37.921 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -378.297603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.297603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.518926 (E_RNA) where: Base-Base interactions energy: -242.767 where: short stacking energy: -120.423 Base-Backbone interact. energy: 0.378 local terms energy: -136.129314 where: bonds (distance) C4'-P energy: -26.098 bonds (distance) P-C4' energy: -24.243 flat angles C4'-P-C4' energy: -28.478 flat angles P-C4'-P energy: -20.832 tors. eta vs tors. theta energy: -36.480 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -360.734125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.734125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.825827 (E_RNA) where: Base-Base interactions energy: -236.603 where: short stacking energy: -119.714 Base-Backbone interact. energy: -0.400 local terms energy: -123.822707 where: bonds (distance) C4'-P energy: -20.440 bonds (distance) P-C4' energy: -23.774 flat angles C4'-P-C4' energy: -25.702 flat angles P-C4'-P energy: -19.026 tors. eta vs tors. theta energy: -34.881 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -317.848023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.848023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.851691 (E_RNA) where: Base-Base interactions energy: -191.364 where: short stacking energy: -110.748 Base-Backbone interact. energy: -0.730 local terms energy: -125.757847 where: bonds (distance) C4'-P energy: -25.622 bonds (distance) P-C4' energy: -21.511 flat angles C4'-P-C4' energy: -25.363 flat angles P-C4'-P energy: -17.516 tors. eta vs tors. theta energy: -35.746 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -330.261394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.261394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.276488 (E_RNA) where: Base-Base interactions energy: -219.259 where: short stacking energy: -100.128 Base-Backbone interact. energy: -0.002 local terms energy: -111.015200 where: bonds (distance) C4'-P energy: -17.819 bonds (distance) P-C4' energy: -17.837 flat angles C4'-P-C4' energy: -20.924 flat angles P-C4'-P energy: -19.542 tors. eta vs tors. theta energy: -34.892 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -320.773601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.773601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.773601 (E_RNA) where: Base-Base interactions energy: -215.060 where: short stacking energy: -103.340 Base-Backbone interact. energy: -0.099 local terms energy: -105.614890 where: bonds (distance) C4'-P energy: -16.380 bonds (distance) P-C4' energy: -19.861 flat angles C4'-P-C4' energy: -21.318 flat angles P-C4'-P energy: -16.366 tors. eta vs tors. theta energy: -31.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -238.515212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.515212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.515212 (E_RNA) where: Base-Base interactions energy: -138.535 where: short stacking energy: -80.796 Base-Backbone interact. energy: -0.244 local terms energy: -99.736855 where: bonds (distance) C4'-P energy: -20.679 bonds (distance) P-C4' energy: -20.910 flat angles C4'-P-C4' energy: -18.911 flat angles P-C4'-P energy: -18.912 tors. eta vs tors. theta energy: -20.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -252.806540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.806540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.863723 (E_RNA) where: Base-Base interactions energy: -178.693 where: short stacking energy: -89.992 Base-Backbone interact. energy: -0.018 local terms energy: -74.152889 where: bonds (distance) C4'-P energy: -16.573 bonds (distance) P-C4' energy: -9.555 flat angles C4'-P-C4' energy: -23.450 flat angles P-C4'-P energy: -9.412 tors. eta vs tors. theta energy: -15.163 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -236.504597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.504597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.523264 (E_RNA) where: Base-Base interactions energy: -140.827 where: short stacking energy: -72.547 Base-Backbone interact. energy: -0.163 local terms energy: -95.532618 where: bonds (distance) C4'-P energy: -18.213 bonds (distance) P-C4' energy: -27.711 flat angles C4'-P-C4' energy: -19.975 flat angles P-C4'-P energy: -14.515 tors. eta vs tors. theta energy: -15.119 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -174.879155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.879155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.996321 (E_RNA) where: Base-Base interactions energy: -83.913 where: short stacking energy: -52.145 Base-Backbone interact. energy: 0.381 local terms energy: -91.464330 where: bonds (distance) C4'-P energy: -26.240 bonds (distance) P-C4' energy: -21.477 flat angles C4'-P-C4' energy: -22.519 flat angles P-C4'-P energy: -16.592 tors. eta vs tors. theta energy: -4.637 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -392.320690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.320690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.358357 (E_RNA) where: Base-Base interactions energy: -256.765 where: short stacking energy: -130.492 Base-Backbone interact. energy: -0.338 local terms energy: -135.255032 where: bonds (distance) C4'-P energy: -26.927 bonds (distance) P-C4' energy: -25.766 flat angles C4'-P-C4' energy: -28.526 flat angles P-C4'-P energy: -17.202 tors. eta vs tors. theta energy: -36.834 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -366.190886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.190886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.239808 (E_RNA) where: Base-Base interactions energy: -239.481 where: short stacking energy: -123.227 Base-Backbone interact. energy: -0.002 local terms energy: -126.756697 where: bonds (distance) C4'-P energy: -23.880 bonds (distance) P-C4' energy: -26.659 flat angles C4'-P-C4' energy: -22.571 flat angles P-C4'-P energy: -18.475 tors. eta vs tors. theta energy: -35.172 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -345.958552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.958552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.987766 (E_RNA) where: Base-Base interactions energy: -227.196 where: short stacking energy: -107.850 Base-Backbone interact. energy: -0.334 local terms energy: -118.457645 where: bonds (distance) C4'-P energy: -25.175 bonds (distance) P-C4' energy: -27.452 flat angles C4'-P-C4' energy: -17.485 flat angles P-C4'-P energy: -18.960 tors. eta vs tors. theta energy: -29.386 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -321.939106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.939106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.977571 (E_RNA) where: Base-Base interactions energy: -204.918 where: short stacking energy: -103.105 Base-Backbone interact. energy: -0.548 local terms energy: -116.511050 where: bonds (distance) C4'-P energy: -18.800 bonds (distance) P-C4' energy: -26.973 flat angles C4'-P-C4' energy: -22.719 flat angles P-C4'-P energy: -14.193 tors. eta vs tors. theta energy: -33.826 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -321.539459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.539459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.539459 (E_RNA) where: Base-Base interactions energy: -211.206 where: short stacking energy: -92.212 Base-Backbone interact. energy: -0.043 local terms energy: -110.290111 where: bonds (distance) C4'-P energy: -26.385 bonds (distance) P-C4' energy: -18.024 flat angles C4'-P-C4' energy: -22.085 flat angles P-C4'-P energy: -16.036 tors. eta vs tors. theta energy: -27.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -322.510376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.510376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.586950 (E_RNA) where: Base-Base interactions energy: -204.092 where: short stacking energy: -116.085 Base-Backbone interact. energy: -0.001 local terms energy: -118.493362 where: bonds (distance) C4'-P energy: -17.268 bonds (distance) P-C4' energy: -22.837 flat angles C4'-P-C4' energy: -24.109 flat angles P-C4'-P energy: -16.298 tors. eta vs tors. theta energy: -37.982 Dist. restrs. and SS energy: 0.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -268.099782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.099782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.099782 (E_RNA) where: Base-Base interactions energy: -168.744 where: short stacking energy: -85.642 Base-Backbone interact. energy: -1.357 local terms energy: -97.998408 where: bonds (distance) C4'-P energy: -19.078 bonds (distance) P-C4' energy: -24.629 flat angles C4'-P-C4' energy: -16.812 flat angles P-C4'-P energy: -18.048 tors. eta vs tors. theta energy: -19.431 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -218.391963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.391963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.445002 (E_RNA) where: Base-Base interactions energy: -138.005 where: short stacking energy: -70.147 Base-Backbone interact. energy: -0.153 local terms energy: -80.286870 where: bonds (distance) C4'-P energy: -13.687 bonds (distance) P-C4' energy: -27.201 flat angles C4'-P-C4' energy: -17.808 flat angles P-C4'-P energy: -9.613 tors. eta vs tors. theta energy: -11.978 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -163.389942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.389942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.441039 (E_RNA) where: Base-Base interactions energy: -85.382 where: short stacking energy: -53.052 Base-Backbone interact. energy: 1.917 local terms energy: -79.976190 where: bonds (distance) C4'-P energy: -17.890 bonds (distance) P-C4' energy: -24.298 flat angles C4'-P-C4' energy: -18.808 flat angles P-C4'-P energy: -12.345 tors. eta vs tors. theta energy: -6.635 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -162.934204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.934204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.934204 (E_RNA) where: Base-Base interactions energy: -98.850 where: short stacking energy: -42.875 Base-Backbone interact. energy: -1.003 local terms energy: -63.080539 where: bonds (distance) C4'-P energy: -18.378 bonds (distance) P-C4' energy: -14.828 flat angles C4'-P-C4' energy: -14.177 flat angles P-C4'-P energy: -16.410 tors. eta vs tors. theta energy: 0.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -375.209817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.209817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.228350 (E_RNA) where: Base-Base interactions energy: -245.632 where: short stacking energy: -128.929 Base-Backbone interact. energy: -0.594 local terms energy: -129.001661 where: bonds (distance) C4'-P energy: -21.492 bonds (distance) P-C4' energy: -27.182 flat angles C4'-P-C4' energy: -23.681 flat angles P-C4'-P energy: -21.698 tors. eta vs tors. theta energy: -34.949 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -351.902206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.902206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.948217 (E_RNA) where: Base-Base interactions energy: -228.323 where: short stacking energy: -106.168 Base-Backbone interact. energy: -0.327 local terms energy: -123.297762 where: bonds (distance) C4'-P energy: -21.763 bonds (distance) P-C4' energy: -25.384 flat angles C4'-P-C4' energy: -23.919 flat angles P-C4'-P energy: -16.334 tors. eta vs tors. theta energy: -35.898 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -362.217415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.217415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.217415 (E_RNA) where: Base-Base interactions energy: -238.597 where: short stacking energy: -121.181 Base-Backbone interact. energy: -0.312 local terms energy: -123.308677 where: bonds (distance) C4'-P energy: -20.859 bonds (distance) P-C4' energy: -18.260 flat angles C4'-P-C4' energy: -26.980 flat angles P-C4'-P energy: -19.085 tors. eta vs tors. theta energy: -38.124 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -318.222984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.222984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.222984 (E_RNA) where: Base-Base interactions energy: -207.272 where: short stacking energy: -98.121 Base-Backbone interact. energy: -1.974 local terms energy: -108.977495 where: bonds (distance) C4'-P energy: -15.947 bonds (distance) P-C4' energy: -24.006 flat angles C4'-P-C4' energy: -23.143 flat angles P-C4'-P energy: -18.309 tors. eta vs tors. theta energy: -27.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -291.137812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.137812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.137812 (E_RNA) where: Base-Base interactions energy: -180.128 where: short stacking energy: -93.003 Base-Backbone interact. energy: -1.557 local terms energy: -109.453452 where: bonds (distance) C4'-P energy: -22.153 bonds (distance) P-C4' energy: -21.506 flat angles C4'-P-C4' energy: -20.730 flat angles P-C4'-P energy: -17.975 tors. eta vs tors. theta energy: -27.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -273.900011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.900011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.967343 (E_RNA) where: Base-Base interactions energy: -170.979 where: short stacking energy: -88.468 Base-Backbone interact. energy: -0.728 local terms energy: -102.260467 where: bonds (distance) C4'-P energy: -22.411 bonds (distance) P-C4' energy: -21.543 flat angles C4'-P-C4' energy: -18.658 flat angles P-C4'-P energy: -16.528 tors. eta vs tors. theta energy: -23.121 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -314.039139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.039139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.039139 (E_RNA) where: Base-Base interactions energy: -201.638 where: short stacking energy: -102.800 Base-Backbone interact. energy: -1.203 local terms energy: -111.198606 where: bonds (distance) C4'-P energy: -22.333 bonds (distance) P-C4' energy: -23.270 flat angles C4'-P-C4' energy: -24.312 flat angles P-C4'-P energy: -16.281 tors. eta vs tors. theta energy: -25.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -195.086627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.086627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.101037 (E_RNA) where: Base-Base interactions energy: -114.586 where: short stacking energy: -54.301 Base-Backbone interact. energy: -0.106 local terms energy: -80.409003 where: bonds (distance) C4'-P energy: -14.515 bonds (distance) P-C4' energy: -18.980 flat angles C4'-P-C4' energy: -22.253 flat angles P-C4'-P energy: -16.409 tors. eta vs tors. theta energy: -8.252 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -162.514393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.514393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.532039 (E_RNA) where: Base-Base interactions energy: -78.303 where: short stacking energy: -43.856 Base-Backbone interact. energy: -0.181 local terms energy: -84.047802 where: bonds (distance) C4'-P energy: -23.052 bonds (distance) P-C4' energy: -20.116 flat angles C4'-P-C4' energy: -21.424 flat angles P-C4'-P energy: -16.291 tors. eta vs tors. theta energy: -3.165 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -138.013240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.013240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.013240 (E_RNA) where: Base-Base interactions energy: -67.449 where: short stacking energy: -38.486 Base-Backbone interact. energy: -0.769 local terms energy: -69.795627 where: bonds (distance) C4'-P energy: -17.553 bonds (distance) P-C4' energy: -19.164 flat angles C4'-P-C4' energy: -21.743 flat angles P-C4'-P energy: -13.200 tors. eta vs tors. theta energy: 1.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -379.773021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.773021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.773021 (E_RNA) where: Base-Base interactions energy: -249.144 where: short stacking energy: -129.427 Base-Backbone interact. energy: -0.322 local terms energy: -130.307052 where: bonds (distance) C4'-P energy: -26.074 bonds (distance) P-C4' energy: -22.665 flat angles C4'-P-C4' energy: -26.422 flat angles P-C4'-P energy: -18.335 tors. eta vs tors. theta energy: -36.811 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -363.902583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.902583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.926661 (E_RNA) where: Base-Base interactions energy: -241.895 where: short stacking energy: -129.667 Base-Backbone interact. energy: -0.884 local terms energy: -121.148428 where: bonds (distance) C4'-P energy: -26.251 bonds (distance) P-C4' energy: -23.367 flat angles C4'-P-C4' energy: -22.093 flat angles P-C4'-P energy: -18.007 tors. eta vs tors. theta energy: -31.431 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -362.007584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.007584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.029601 (E_RNA) where: Base-Base interactions energy: -237.485 where: short stacking energy: -116.350 Base-Backbone interact. energy: -0.354 local terms energy: -124.190899 where: bonds (distance) C4'-P energy: -21.295 bonds (distance) P-C4' energy: -25.702 flat angles C4'-P-C4' energy: -21.411 flat angles P-C4'-P energy: -21.831 tors. eta vs tors. theta energy: -33.951 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -348.349682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.349682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.349682 (E_RNA) where: Base-Base interactions energy: -222.172 where: short stacking energy: -122.084 Base-Backbone interact. energy: -0.899 local terms energy: -125.279114 where: bonds (distance) C4'-P energy: -24.056 bonds (distance) P-C4' energy: -23.367 flat angles C4'-P-C4' energy: -21.675 flat angles P-C4'-P energy: -20.079 tors. eta vs tors. theta energy: -36.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -287.511182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.511182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.511182 (E_RNA) where: Base-Base interactions energy: -184.691 where: short stacking energy: -92.609 Base-Backbone interact. energy: -0.230 local terms energy: -102.590508 where: bonds (distance) C4'-P energy: -20.046 bonds (distance) P-C4' energy: -26.834 flat angles C4'-P-C4' energy: -21.512 flat angles P-C4'-P energy: -13.315 tors. eta vs tors. theta energy: -20.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -267.174605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.174605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.192002 (E_RNA) where: Base-Base interactions energy: -168.949 where: short stacking energy: -82.159 Base-Backbone interact. energy: -0.169 local terms energy: -98.073847 where: bonds (distance) C4'-P energy: -17.880 bonds (distance) P-C4' energy: -25.521 flat angles C4'-P-C4' energy: -23.281 flat angles P-C4'-P energy: -12.609 tors. eta vs tors. theta energy: -18.783 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -288.959359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.959359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.024579 (E_RNA) where: Base-Base interactions energy: -187.653 where: short stacking energy: -86.697 Base-Backbone interact. energy: -1.736 local terms energy: -99.635546 where: bonds (distance) C4'-P energy: -18.211 bonds (distance) P-C4' energy: -21.067 flat angles C4'-P-C4' energy: -17.701 flat angles P-C4'-P energy: -16.566 tors. eta vs tors. theta energy: -26.091 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -179.494995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.494995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.504486 (E_RNA) where: Base-Base interactions energy: -95.408 where: short stacking energy: -60.643 Base-Backbone interact. energy: -1.192 local terms energy: -82.904936 where: bonds (distance) C4'-P energy: -19.984 bonds (distance) P-C4' energy: -24.589 flat angles C4'-P-C4' energy: -17.705 flat angles P-C4'-P energy: -14.143 tors. eta vs tors. theta energy: -6.484 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -176.176725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.176725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.176725 (E_RNA) where: Base-Base interactions energy: -98.527 where: short stacking energy: -58.724 Base-Backbone interact. energy: -0.736 local terms energy: -76.913889 where: bonds (distance) C4'-P energy: -18.746 bonds (distance) P-C4' energy: -15.485 flat angles C4'-P-C4' energy: -20.354 flat angles P-C4'-P energy: -14.619 tors. eta vs tors. theta energy: -7.711 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -170.567160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.567160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.665121 (E_RNA) where: Base-Base interactions energy: -98.147 where: short stacking energy: -45.379 Base-Backbone interact. energy: -1.285 local terms energy: -71.233424 where: bonds (distance) C4'-P energy: -25.349 bonds (distance) P-C4' energy: -21.971 flat angles C4'-P-C4' energy: -15.564 flat angles P-C4'-P energy: -7.193 tors. eta vs tors. theta energy: -1.156 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -371.063371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.063371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.063371 (E_RNA) where: Base-Base interactions energy: -242.632 where: short stacking energy: -123.513 Base-Backbone interact. energy: -0.475 local terms energy: -127.955906 where: bonds (distance) C4'-P energy: -23.908 bonds (distance) P-C4' energy: -23.679 flat angles C4'-P-C4' energy: -26.847 flat angles P-C4'-P energy: -21.168 tors. eta vs tors. theta energy: -32.354 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -372.773095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.773095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.871142 (E_RNA) where: Base-Base interactions energy: -241.541 where: short stacking energy: -131.033 Base-Backbone interact. energy: -0.167 local terms energy: -131.163297 where: bonds (distance) C4'-P energy: -23.159 bonds (distance) P-C4' energy: -23.462 flat angles C4'-P-C4' energy: -26.058 flat angles P-C4'-P energy: -19.555 tors. eta vs tors. theta energy: -38.929 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -351.968155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.968155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.968155 (E_RNA) where: Base-Base interactions energy: -227.826 where: short stacking energy: -123.669 Base-Backbone interact. energy: -1.466 local terms energy: -122.676773 where: bonds (distance) C4'-P energy: -25.200 bonds (distance) P-C4' energy: -19.870 flat angles C4'-P-C4' energy: -25.311 flat angles P-C4'-P energy: -16.736 tors. eta vs tors. theta energy: -35.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -342.999851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.999851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.012550 (E_RNA) where: Base-Base interactions energy: -217.808 where: short stacking energy: -115.563 Base-Backbone interact. energy: -0.650 local terms energy: -124.553962 where: bonds (distance) C4'-P energy: -25.053 bonds (distance) P-C4' energy: -24.830 flat angles C4'-P-C4' energy: -25.889 flat angles P-C4'-P energy: -13.485 tors. eta vs tors. theta energy: -35.296 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -284.569978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.569978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.592906 (E_RNA) where: Base-Base interactions energy: -169.791 where: short stacking energy: -91.498 Base-Backbone interact. energy: -0.413 local terms energy: -114.388399 where: bonds (distance) C4'-P energy: -24.394 bonds (distance) P-C4' energy: -25.693 flat angles C4'-P-C4' energy: -20.480 flat angles P-C4'-P energy: -15.936 tors. eta vs tors. theta energy: -27.885 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -297.157562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.157562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.432246 (E_RNA) where: Base-Base interactions energy: -187.423 where: short stacking energy: -96.945 Base-Backbone interact. energy: -0.671 local terms energy: -109.338181 where: bonds (distance) C4'-P energy: -19.931 bonds (distance) P-C4' energy: -21.263 flat angles C4'-P-C4' energy: -27.709 flat angles P-C4'-P energy: -17.035 tors. eta vs tors. theta energy: -23.400 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -266.826027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.826027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.826027 (E_RNA) where: Base-Base interactions energy: -162.571 where: short stacking energy: -86.261 Base-Backbone interact. energy: 0.100 local terms energy: -104.354373 where: bonds (distance) C4'-P energy: -27.179 bonds (distance) P-C4' energy: -22.011 flat angles C4'-P-C4' energy: -23.140 flat angles P-C4'-P energy: -17.982 tors. eta vs tors. theta energy: -14.042 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -201.597856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.597856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.597856 (E_RNA) where: Base-Base interactions energy: -107.158 where: short stacking energy: -62.901 Base-Backbone interact. energy: 0.305 local terms energy: -94.744940 where: bonds (distance) C4'-P energy: -24.694 bonds (distance) P-C4' energy: -20.769 flat angles C4'-P-C4' energy: -19.952 flat angles P-C4'-P energy: -20.485 tors. eta vs tors. theta energy: -8.844 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -170.036908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.036908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.036908 (E_RNA) where: Base-Base interactions energy: -100.939 where: short stacking energy: -60.809 Base-Backbone interact. energy: 0.054 local terms energy: -69.151604 where: bonds (distance) C4'-P energy: -12.960 bonds (distance) P-C4' energy: -23.307 flat angles C4'-P-C4' energy: -15.014 flat angles P-C4'-P energy: -10.738 tors. eta vs tors. theta energy: -7.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -178.113163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.113163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.153956 (E_RNA) where: Base-Base interactions energy: -98.334 where: short stacking energy: -50.727 Base-Backbone interact. energy: -0.622 local terms energy: -79.198070 where: bonds (distance) C4'-P energy: -20.577 bonds (distance) P-C4' energy: -24.012 flat angles C4'-P-C4' energy: -20.558 flat angles P-C4'-P energy: -6.696 tors. eta vs tors. theta energy: -7.355 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -378.402542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.402542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.402542 (E_RNA) where: Base-Base interactions energy: -246.060 where: short stacking energy: -123.633 Base-Backbone interact. energy: -0.006 local terms energy: -132.335964 where: bonds (distance) C4'-P energy: -27.390 bonds (distance) P-C4' energy: -22.748 flat angles C4'-P-C4' energy: -25.339 flat angles P-C4'-P energy: -18.040 tors. eta vs tors. theta energy: -38.819 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -366.762804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.762804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.804937 (E_RNA) where: Base-Base interactions energy: -237.275 where: short stacking energy: -115.599 Base-Backbone interact. energy: -0.454 local terms energy: -129.075698 where: bonds (distance) C4'-P energy: -22.600 bonds (distance) P-C4' energy: -26.043 flat angles C4'-P-C4' energy: -25.870 flat angles P-C4'-P energy: -19.104 tors. eta vs tors. theta energy: -35.459 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -344.238858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.238858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.238858 (E_RNA) where: Base-Base interactions energy: -227.264 where: short stacking energy: -109.550 Base-Backbone interact. energy: -0.589 local terms energy: -116.385493 where: bonds (distance) C4'-P energy: -23.345 bonds (distance) P-C4' energy: -17.813 flat angles C4'-P-C4' energy: -22.789 flat angles P-C4'-P energy: -20.312 tors. eta vs tors. theta energy: -32.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -339.603632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.603632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.603632 (E_RNA) where: Base-Base interactions energy: -224.231 where: short stacking energy: -106.098 Base-Backbone interact. energy: -0.557 local terms energy: -114.815454 where: bonds (distance) C4'-P energy: -17.223 bonds (distance) P-C4' energy: -23.407 flat angles C4'-P-C4' energy: -25.396 flat angles P-C4'-P energy: -17.623 tors. eta vs tors. theta energy: -31.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -281.584569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.584569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.665007 (E_RNA) where: Base-Base interactions energy: -176.794 where: short stacking energy: -98.280 Base-Backbone interact. energy: -1.624 local terms energy: -103.247877 where: bonds (distance) C4'-P energy: -19.350 bonds (distance) P-C4' energy: -23.100 flat angles C4'-P-C4' energy: -19.404 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -28.717 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -289.096684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.096684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.096684 (E_RNA) where: Base-Base interactions energy: -172.131 where: short stacking energy: -98.232 Base-Backbone interact. energy: -1.161 local terms energy: -115.804570 where: bonds (distance) C4'-P energy: -19.548 bonds (distance) P-C4' energy: -26.035 flat angles C4'-P-C4' energy: -20.129 flat angles P-C4'-P energy: -15.429 tors. eta vs tors. theta energy: -34.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -273.025215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.025215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.025215 (E_RNA) where: Base-Base interactions energy: -160.792 where: short stacking energy: -86.877 Base-Backbone interact. energy: -0.358 local terms energy: -111.874712 where: bonds (distance) C4'-P energy: -15.987 bonds (distance) P-C4' energy: -23.600 flat angles C4'-P-C4' energy: -25.809 flat angles P-C4'-P energy: -17.492 tors. eta vs tors. theta energy: -28.986 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -191.595559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.595559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.621573 (E_RNA) where: Base-Base interactions energy: -115.374 where: short stacking energy: -66.151 Base-Backbone interact. energy: -0.162 local terms energy: -76.085290 where: bonds (distance) C4'-P energy: -16.730 bonds (distance) P-C4' energy: -23.780 flat angles C4'-P-C4' energy: -14.552 flat angles P-C4'-P energy: -14.732 tors. eta vs tors. theta energy: -6.290 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -149.035205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.035205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.035205 (E_RNA) where: Base-Base interactions energy: -70.996 where: short stacking energy: -37.159 Base-Backbone interact. energy: -0.502 local terms energy: -77.536666 where: bonds (distance) C4'-P energy: -22.574 bonds (distance) P-C4' energy: -20.727 flat angles C4'-P-C4' energy: -19.775 flat angles P-C4'-P energy: -17.219 tors. eta vs tors. theta energy: 2.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -157.636235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.636235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.226930 (E_RNA) where: Base-Base interactions energy: -82.857 where: short stacking energy: -52.485 Base-Backbone interact. energy: -0.470 local terms energy: -75.899107 where: bonds (distance) C4'-P energy: -10.391 bonds (distance) P-C4' energy: -20.806 flat angles C4'-P-C4' energy: -24.679 flat angles P-C4'-P energy: -11.862 tors. eta vs tors. theta energy: -8.162 Dist. restrs. and SS energy: 1.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -388.577814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.577814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.577814 (E_RNA) where: Base-Base interactions energy: -256.580 where: short stacking energy: -131.926 Base-Backbone interact. energy: -0.417 local terms energy: -131.581086 where: bonds (distance) C4'-P energy: -22.444 bonds (distance) P-C4' energy: -18.423 flat angles C4'-P-C4' energy: -29.151 flat angles P-C4'-P energy: -23.675 tors. eta vs tors. theta energy: -37.889 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -355.331454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.331454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.405095 (E_RNA) where: Base-Base interactions energy: -231.671 where: short stacking energy: -125.569 Base-Backbone interact. energy: -0.092 local terms energy: -123.642050 where: bonds (distance) C4'-P energy: -24.920 bonds (distance) P-C4' energy: -21.193 flat angles C4'-P-C4' energy: -24.517 flat angles P-C4'-P energy: -15.364 tors. eta vs tors. theta energy: -37.648 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -368.126957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.126957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.142112 (E_RNA) where: Base-Base interactions energy: -237.621 where: short stacking energy: -114.647 Base-Backbone interact. energy: -0.481 local terms energy: -130.040387 where: bonds (distance) C4'-P energy: -24.533 bonds (distance) P-C4' energy: -22.599 flat angles C4'-P-C4' energy: -26.890 flat angles P-C4'-P energy: -19.517 tors. eta vs tors. theta energy: -36.501 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -271.140766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.140766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.141061 (E_RNA) where: Base-Base interactions energy: -163.687 where: short stacking energy: -93.476 Base-Backbone interact. energy: -0.035 local terms energy: -107.418870 where: bonds (distance) C4'-P energy: -21.627 bonds (distance) P-C4' energy: -21.720 flat angles C4'-P-C4' energy: -23.611 flat angles P-C4'-P energy: -15.290 tors. eta vs tors. theta energy: -25.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -324.654991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.654991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.818362 (E_RNA) where: Base-Base interactions energy: -201.816 where: short stacking energy: -103.440 Base-Backbone interact. energy: -0.240 local terms energy: -122.762314 where: bonds (distance) C4'-P energy: -22.091 bonds (distance) P-C4' energy: -26.008 flat angles C4'-P-C4' energy: -25.017 flat angles P-C4'-P energy: -17.734 tors. eta vs tors. theta energy: -31.913 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -258.803251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.803251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.803251 (E_RNA) where: Base-Base interactions energy: -157.660 where: short stacking energy: -76.182 Base-Backbone interact. energy: 0.904 local terms energy: -102.047745 where: bonds (distance) C4'-P energy: -19.992 bonds (distance) P-C4' energy: -23.156 flat angles C4'-P-C4' energy: -22.552 flat angles P-C4'-P energy: -17.469 tors. eta vs tors. theta energy: -18.878 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -272.814175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.814175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.814175 (E_RNA) where: Base-Base interactions energy: -159.877 where: short stacking energy: -91.241 Base-Backbone interact. energy: -0.865 local terms energy: -112.072168 where: bonds (distance) C4'-P energy: -19.934 bonds (distance) P-C4' energy: -24.427 flat angles C4'-P-C4' energy: -26.920 flat angles P-C4'-P energy: -16.475 tors. eta vs tors. theta energy: -24.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -169.815597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.815597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.855551 (E_RNA) where: Base-Base interactions energy: -68.315 where: short stacking energy: -45.821 Base-Backbone interact. energy: -0.513 local terms energy: -101.027235 where: bonds (distance) C4'-P energy: -25.879 bonds (distance) P-C4' energy: -28.598 flat angles C4'-P-C4' energy: -24.390 flat angles P-C4'-P energy: -13.686 tors. eta vs tors. theta energy: -8.474 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -221.030386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.030386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.088151 (E_RNA) where: Base-Base interactions energy: -133.105 where: short stacking energy: -85.040 Base-Backbone interact. energy: -0.100 local terms energy: -87.883130 where: bonds (distance) C4'-P energy: -19.702 bonds (distance) P-C4' energy: -21.021 flat angles C4'-P-C4' energy: -19.012 flat angles P-C4'-P energy: -10.730 tors. eta vs tors. theta energy: -17.419 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -162.766437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.766437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.766437 (E_RNA) where: Base-Base interactions energy: -86.458 where: short stacking energy: -58.437 Base-Backbone interact. energy: 0.270 local terms energy: -76.578760 where: bonds (distance) C4'-P energy: -22.831 bonds (distance) P-C4' energy: -19.447 flat angles C4'-P-C4' energy: -20.106 flat angles P-C4'-P energy: -5.955 tors. eta vs tors. theta energy: -8.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -359.379671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.379671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.379671 (E_RNA) where: Base-Base interactions energy: -224.676 where: short stacking energy: -118.018 Base-Backbone interact. energy: -0.396 local terms energy: -134.307888 where: bonds (distance) C4'-P energy: -27.304 bonds (distance) P-C4' energy: -25.072 flat angles C4'-P-C4' energy: -25.126 flat angles P-C4'-P energy: -19.317 tors. eta vs tors. theta energy: -37.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -372.745316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.745316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.745316 (E_RNA) where: Base-Base interactions energy: -250.598 where: short stacking energy: -119.462 Base-Backbone interact. energy: 1.219 local terms energy: -123.365629 where: bonds (distance) C4'-P energy: -16.698 bonds (distance) P-C4' energy: -25.952 flat angles C4'-P-C4' energy: -24.107 flat angles P-C4'-P energy: -21.885 tors. eta vs tors. theta energy: -34.724 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -364.022285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.022285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.053271 (E_RNA) where: Base-Base interactions energy: -241.760 where: short stacking energy: -105.768 Base-Backbone interact. energy: -0.350 local terms energy: -121.943191 where: bonds (distance) C4'-P energy: -24.732 bonds (distance) P-C4' energy: -25.481 flat angles C4'-P-C4' energy: -22.571 flat angles P-C4'-P energy: -16.427 tors. eta vs tors. theta energy: -32.732 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -257.819851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.819851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.044110 (E_RNA) where: Base-Base interactions energy: -160.373 where: short stacking energy: -91.944 Base-Backbone interact. energy: -0.580 local terms energy: -97.091138 where: bonds (distance) C4'-P energy: -19.068 bonds (distance) P-C4' energy: -19.751 flat angles C4'-P-C4' energy: -15.093 flat angles P-C4'-P energy: -18.264 tors. eta vs tors. theta energy: -24.914 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -327.766724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.766724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.766724 (E_RNA) where: Base-Base interactions energy: -211.688 where: short stacking energy: -105.732 Base-Backbone interact. energy: -0.025 local terms energy: -116.053808 where: bonds (distance) C4'-P energy: -23.598 bonds (distance) P-C4' energy: -20.426 flat angles C4'-P-C4' energy: -24.663 flat angles P-C4'-P energy: -15.799 tors. eta vs tors. theta energy: -31.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -299.249673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.249673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.336724 (E_RNA) where: Base-Base interactions energy: -189.582 where: short stacking energy: -81.912 Base-Backbone interact. energy: -0.628 local terms energy: -109.126391 where: bonds (distance) C4'-P energy: -26.058 bonds (distance) P-C4' energy: -23.107 flat angles C4'-P-C4' energy: -23.378 flat angles P-C4'-P energy: -16.574 tors. eta vs tors. theta energy: -20.009 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -179.609905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.609905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.633958 (E_RNA) where: Base-Base interactions energy: -84.017 where: short stacking energy: -58.447 Base-Backbone interact. energy: -0.277 local terms energy: -95.340367 where: bonds (distance) C4'-P energy: -23.373 bonds (distance) P-C4' energy: -25.659 flat angles C4'-P-C4' energy: -21.722 flat angles P-C4'-P energy: -16.962 tors. eta vs tors. theta energy: -7.625 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -278.107755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.107755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.158460 (E_RNA) where: Base-Base interactions energy: -161.933 where: short stacking energy: -91.102 Base-Backbone interact. energy: -0.100 local terms energy: -116.124986 where: bonds (distance) C4'-P energy: -22.060 bonds (distance) P-C4' energy: -24.569 flat angles C4'-P-C4' energy: -25.181 flat angles P-C4'-P energy: -14.795 tors. eta vs tors. theta energy: -29.520 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -165.854501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.854501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.030657 (E_RNA) where: Base-Base interactions energy: -91.947 where: short stacking energy: -50.584 Base-Backbone interact. energy: -0.385 local terms energy: -73.699144 where: bonds (distance) C4'-P energy: -16.027 bonds (distance) P-C4' energy: -26.424 flat angles C4'-P-C4' energy: -12.619 flat angles P-C4'-P energy: -13.329 tors. eta vs tors. theta energy: -5.300 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -167.233635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.233635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.507820 (E_RNA) where: Base-Base interactions energy: -92.497 where: short stacking energy: -59.121 Base-Backbone interact. energy: -1.140 local terms energy: -73.870477 where: bonds (distance) C4'-P energy: -15.720 bonds (distance) P-C4' energy: -22.903 flat angles C4'-P-C4' energy: -18.869 flat angles P-C4'-P energy: -8.607 tors. eta vs tors. theta energy: -7.772 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -371.929817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.929817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.982023 (E_RNA) where: Base-Base interactions energy: -238.774 where: short stacking energy: -138.617 Base-Backbone interact. energy: -0.333 local terms energy: -132.875978 where: bonds (distance) C4'-P energy: -23.897 bonds (distance) P-C4' energy: -28.351 flat angles C4'-P-C4' energy: -26.735 flat angles P-C4'-P energy: -15.161 tors. eta vs tors. theta energy: -38.732 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -372.831702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.831702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.836515 (E_RNA) where: Base-Base interactions energy: -239.230 where: short stacking energy: -113.277 Base-Backbone interact. energy: -0.452 local terms energy: -133.154995 where: bonds (distance) C4'-P energy: -23.196 bonds (distance) P-C4' energy: -26.913 flat angles C4'-P-C4' energy: -27.854 flat angles P-C4'-P energy: -18.068 tors. eta vs tors. theta energy: -37.125 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -359.396989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.396989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.416776 (E_RNA) where: Base-Base interactions energy: -236.059 where: short stacking energy: -120.615 Base-Backbone interact. energy: -0.460 local terms energy: -122.898236 where: bonds (distance) C4'-P energy: -24.641 bonds (distance) P-C4' energy: -22.739 flat angles C4'-P-C4' energy: -25.359 flat angles P-C4'-P energy: -15.647 tors. eta vs tors. theta energy: -34.512 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -315.009384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.009384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.010237 (E_RNA) where: Base-Base interactions energy: -206.501 where: short stacking energy: -96.159 Base-Backbone interact. energy: -1.074 local terms energy: -107.434899 where: bonds (distance) C4'-P energy: -13.121 bonds (distance) P-C4' energy: -21.348 flat angles C4'-P-C4' energy: -24.278 flat angles P-C4'-P energy: -20.853 tors. eta vs tors. theta energy: -27.836 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -263.305703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.305703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.306488 (E_RNA) where: Base-Base interactions energy: -159.827 where: short stacking energy: -95.837 Base-Backbone interact. energy: 0.885 local terms energy: -104.363584 where: bonds (distance) C4'-P energy: -20.316 bonds (distance) P-C4' energy: -24.975 flat angles C4'-P-C4' energy: -17.823 flat angles P-C4'-P energy: -19.443 tors. eta vs tors. theta energy: -21.806 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -311.078556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.078556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.078556 (E_RNA) where: Base-Base interactions energy: -197.188 where: short stacking energy: -89.958 Base-Backbone interact. energy: -1.695 local terms energy: -112.195893 where: bonds (distance) C4'-P energy: -26.210 bonds (distance) P-C4' energy: -20.305 flat angles C4'-P-C4' energy: -20.571 flat angles P-C4'-P energy: -15.304 tors. eta vs tors. theta energy: -29.806 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -183.704680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.704680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.704680 (E_RNA) where: Base-Base interactions energy: -96.789 where: short stacking energy: -65.474 Base-Backbone interact. energy: -0.110 local terms energy: -86.805480 where: bonds (distance) C4'-P energy: -23.506 bonds (distance) P-C4' energy: -18.003 flat angles C4'-P-C4' energy: -20.575 flat angles P-C4'-P energy: -12.114 tors. eta vs tors. theta energy: -12.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -226.194049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.194049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.194049 (E_RNA) where: Base-Base interactions energy: -139.968 where: short stacking energy: -76.120 Base-Backbone interact. energy: -0.566 local terms energy: -85.660273 where: bonds (distance) C4'-P energy: -17.681 bonds (distance) P-C4' energy: -23.224 flat angles C4'-P-C4' energy: -25.650 flat angles P-C4'-P energy: -8.950 tors. eta vs tors. theta energy: -10.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -163.035394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.035394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.035394 (E_RNA) where: Base-Base interactions energy: -88.339 where: short stacking energy: -57.201 Base-Backbone interact. energy: -0.638 local terms energy: -74.058234 where: bonds (distance) C4'-P energy: -12.259 bonds (distance) P-C4' energy: -24.925 flat angles C4'-P-C4' energy: -19.866 flat angles P-C4'-P energy: -12.569 tors. eta vs tors. theta energy: -4.439 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -177.223354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.223354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.223354 (E_RNA) where: Base-Base interactions energy: -100.544 where: short stacking energy: -49.918 Base-Backbone interact. energy: -0.112 local terms energy: -76.567175 where: bonds (distance) C4'-P energy: -18.138 bonds (distance) P-C4' energy: -17.380 flat angles C4'-P-C4' energy: -16.785 flat angles P-C4'-P energy: -15.676 tors. eta vs tors. theta energy: -8.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -369.405589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.405589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.405589 (E_RNA) where: Base-Base interactions energy: -239.779 where: short stacking energy: -130.288 Base-Backbone interact. energy: -1.116 local terms energy: -128.510672 where: bonds (distance) C4'-P energy: -19.616 bonds (distance) P-C4' energy: -22.030 flat angles C4'-P-C4' energy: -26.810 flat angles P-C4'-P energy: -23.361 tors. eta vs tors. theta energy: -36.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -372.795515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.795515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.795515 (E_RNA) where: Base-Base interactions energy: -249.487 where: short stacking energy: -124.629 Base-Backbone interact. energy: -1.372 local terms energy: -121.936188 where: bonds (distance) C4'-P energy: -21.785 bonds (distance) P-C4' energy: -25.818 flat angles C4'-P-C4' energy: -22.651 flat angles P-C4'-P energy: -19.395 tors. eta vs tors. theta energy: -32.287 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -364.594704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.594704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.594704 (E_RNA) where: Base-Base interactions energy: -233.357 where: short stacking energy: -125.329 Base-Backbone interact. energy: -0.346 local terms energy: -130.891034 where: bonds (distance) C4'-P energy: -24.906 bonds (distance) P-C4' energy: -28.355 flat angles C4'-P-C4' energy: -25.995 flat angles P-C4'-P energy: -16.589 tors. eta vs tors. theta energy: -35.046 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -324.932955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.932955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.932955 (E_RNA) where: Base-Base interactions energy: -216.119 where: short stacking energy: -97.948 Base-Backbone interact. energy: 0.185 local terms energy: -108.999566 where: bonds (distance) C4'-P energy: -12.159 bonds (distance) P-C4' energy: -26.068 flat angles C4'-P-C4' energy: -26.714 flat angles P-C4'-P energy: -18.627 tors. eta vs tors. theta energy: -25.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -348.313214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.313214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.313214 (E_RNA) where: Base-Base interactions energy: -229.057 where: short stacking energy: -110.755 Base-Backbone interact. energy: -0.002 local terms energy: -119.253978 where: bonds (distance) C4'-P energy: -21.772 bonds (distance) P-C4' energy: -24.337 flat angles C4'-P-C4' energy: -26.801 flat angles P-C4'-P energy: -14.570 tors. eta vs tors. theta energy: -31.774 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -240.549045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.549045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.556625 (E_RNA) where: Base-Base interactions energy: -146.300 where: short stacking energy: -80.110 Base-Backbone interact. energy: -0.118 local terms energy: -94.138952 where: bonds (distance) C4'-P energy: -11.860 bonds (distance) P-C4' energy: -19.707 flat angles C4'-P-C4' energy: -27.210 flat angles P-C4'-P energy: -19.933 tors. eta vs tors. theta energy: -15.429 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -242.313025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.313025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.353098 (E_RNA) where: Base-Base interactions energy: -150.824 where: short stacking energy: -73.157 Base-Backbone interact. energy: -0.716 local terms energy: -90.813516 where: bonds (distance) C4'-P energy: -24.501 bonds (distance) P-C4' energy: -17.348 flat angles C4'-P-C4' energy: -17.644 flat angles P-C4'-P energy: -19.292 tors. eta vs tors. theta energy: -12.028 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -162.436484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.436484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.436484 (E_RNA) where: Base-Base interactions energy: -84.724 where: short stacking energy: -46.997 Base-Backbone interact. energy: -0.577 local terms energy: -77.135762 where: bonds (distance) C4'-P energy: -23.717 bonds (distance) P-C4' energy: -21.221 flat angles C4'-P-C4' energy: -20.312 flat angles P-C4'-P energy: -9.623 tors. eta vs tors. theta energy: -2.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -179.188002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.188002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.295089 (E_RNA) where: Base-Base interactions energy: -105.935 where: short stacking energy: -60.215 Base-Backbone interact. energy: -0.351 local terms energy: -73.008931 where: bonds (distance) C4'-P energy: -18.527 bonds (distance) P-C4' energy: -14.133 flat angles C4'-P-C4' energy: -21.299 flat angles P-C4'-P energy: -10.834 tors. eta vs tors. theta energy: -8.215 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -150.259252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.259252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.259252 (E_RNA) where: Base-Base interactions energy: -76.582 where: short stacking energy: -52.741 Base-Backbone interact. energy: -1.015 local terms energy: -72.662082 where: bonds (distance) C4'-P energy: -16.684 bonds (distance) P-C4' energy: -23.588 flat angles C4'-P-C4' energy: -17.473 flat angles P-C4'-P energy: -11.849 tors. eta vs tors. theta energy: -3.068 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -375.875386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.875386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.876499 (E_RNA) where: Base-Base interactions energy: -236.659 where: short stacking energy: -123.538 Base-Backbone interact. energy: -0.383 local terms energy: -138.834228 where: bonds (distance) C4'-P energy: -24.716 bonds (distance) P-C4' energy: -27.585 flat angles C4'-P-C4' energy: -27.453 flat angles P-C4'-P energy: -20.475 tors. eta vs tors. theta energy: -38.605 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -361.370040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.370040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.442451 (E_RNA) where: Base-Base interactions energy: -239.643 where: short stacking energy: -110.031 Base-Backbone interact. energy: 0.010 local terms energy: -121.809493 where: bonds (distance) C4'-P energy: -21.869 bonds (distance) P-C4' energy: -21.224 flat angles C4'-P-C4' energy: -24.106 flat angles P-C4'-P energy: -20.089 tors. eta vs tors. theta energy: -34.522 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -357.097673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.097673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.097673 (E_RNA) where: Base-Base interactions energy: -231.215 where: short stacking energy: -122.118 Base-Backbone interact. energy: -0.030 local terms energy: -125.852562 where: bonds (distance) C4'-P energy: -19.326 bonds (distance) P-C4' energy: -27.404 flat angles C4'-P-C4' energy: -22.803 flat angles P-C4'-P energy: -20.435 tors. eta vs tors. theta energy: -35.885 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -338.814513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.814513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.847775 (E_RNA) where: Base-Base interactions energy: -220.719 where: short stacking energy: -100.874 Base-Backbone interact. energy: -0.193 local terms energy: -117.936168 where: bonds (distance) C4'-P energy: -17.910 bonds (distance) P-C4' energy: -24.892 flat angles C4'-P-C4' energy: -25.167 flat angles P-C4'-P energy: -18.905 tors. eta vs tors. theta energy: -31.062 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -356.246944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.246944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.246944 (E_RNA) where: Base-Base interactions energy: -227.798 where: short stacking energy: -98.739 Base-Backbone interact. energy: 0.799 local terms energy: -129.247914 where: bonds (distance) C4'-P energy: -27.196 bonds (distance) P-C4' energy: -26.928 flat angles C4'-P-C4' energy: -27.085 flat angles P-C4'-P energy: -13.133 tors. eta vs tors. theta energy: -34.906 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -265.447312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.447312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.455484 (E_RNA) where: Base-Base interactions energy: -155.351 where: short stacking energy: -80.096 Base-Backbone interact. energy: 0.174 local terms energy: -110.278917 where: bonds (distance) C4'-P energy: -25.569 bonds (distance) P-C4' energy: -22.561 flat angles C4'-P-C4' energy: -24.134 flat angles P-C4'-P energy: -15.471 tors. eta vs tors. theta energy: -22.544 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -215.720761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.720761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.720761 (E_RNA) where: Base-Base interactions energy: -123.447 where: short stacking energy: -58.064 Base-Backbone interact. energy: -0.981 local terms energy: -91.292815 where: bonds (distance) C4'-P energy: -27.229 bonds (distance) P-C4' energy: -15.336 flat angles C4'-P-C4' energy: -22.058 flat angles P-C4'-P energy: -17.913 tors. eta vs tors. theta energy: -8.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -213.013954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.013954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.013954 (E_RNA) where: Base-Base interactions energy: -118.073 where: short stacking energy: -66.488 Base-Backbone interact. energy: -0.376 local terms energy: -94.565166 where: bonds (distance) C4'-P energy: -20.133 bonds (distance) P-C4' energy: -22.893 flat angles C4'-P-C4' energy: -23.722 flat angles P-C4'-P energy: -12.325 tors. eta vs tors. theta energy: -15.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -161.150464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.150464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.226026 (E_RNA) where: Base-Base interactions energy: -92.857 where: short stacking energy: -48.751 Base-Backbone interact. energy: -0.848 local terms energy: -67.520078 where: bonds (distance) C4'-P energy: -13.732 bonds (distance) P-C4' energy: -21.183 flat angles C4'-P-C4' energy: -19.977 flat angles P-C4'-P energy: -7.604 tors. eta vs tors. theta energy: -5.023 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -158.540423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.540423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.540423 (E_RNA) where: Base-Base interactions energy: -70.611 where: short stacking energy: -38.733 Base-Backbone interact. energy: -0.950 local terms energy: -86.978916 where: bonds (distance) C4'-P energy: -19.168 bonds (distance) P-C4' energy: -20.849 flat angles C4'-P-C4' energy: -20.917 flat angles P-C4'-P energy: -15.971 tors. eta vs tors. theta energy: -10.073 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -375.212522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.212522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.212522 (E_RNA) where: Base-Base interactions energy: -247.573 where: short stacking energy: -120.774 Base-Backbone interact. energy: -0.555 local terms energy: -127.084673 where: bonds (distance) C4'-P energy: -28.227 bonds (distance) P-C4' energy: -26.076 flat angles C4'-P-C4' energy: -25.569 flat angles P-C4'-P energy: -15.219 tors. eta vs tors. theta energy: -31.994 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -359.554130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.554130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.637130 (E_RNA) where: Base-Base interactions energy: -234.759 where: short stacking energy: -125.463 Base-Backbone interact. energy: -0.724 local terms energy: -124.154244 where: bonds (distance) C4'-P energy: -22.369 bonds (distance) P-C4' energy: -25.334 flat angles C4'-P-C4' energy: -26.230 flat angles P-C4'-P energy: -13.216 tors. eta vs tors. theta energy: -37.006 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -372.062779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.062779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.062779 (E_RNA) where: Base-Base interactions energy: -245.091 where: short stacking energy: -122.323 Base-Backbone interact. energy: -0.135 local terms energy: -126.837095 where: bonds (distance) C4'-P energy: -23.382 bonds (distance) P-C4' energy: -26.041 flat angles C4'-P-C4' energy: -23.839 flat angles P-C4'-P energy: -15.661 tors. eta vs tors. theta energy: -37.913 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -313.183909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.183909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.183909 (E_RNA) where: Base-Base interactions energy: -197.730 where: short stacking energy: -105.664 Base-Backbone interact. energy: -0.035 local terms energy: -115.418809 where: bonds (distance) C4'-P energy: -24.070 bonds (distance) P-C4' energy: -21.859 flat angles C4'-P-C4' energy: -23.899 flat angles P-C4'-P energy: -17.406 tors. eta vs tors. theta energy: -28.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -351.088739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.088739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.121145 (E_RNA) where: Base-Base interactions energy: -232.484 where: short stacking energy: -109.061 Base-Backbone interact. energy: -0.579 local terms energy: -118.058315 where: bonds (distance) C4'-P energy: -24.001 bonds (distance) P-C4' energy: -17.510 flat angles C4'-P-C4' energy: -23.206 flat angles P-C4'-P energy: -17.720 tors. eta vs tors. theta energy: -35.622 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -281.766444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.766444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.766444 (E_RNA) where: Base-Base interactions energy: -172.840 where: short stacking energy: -79.163 Base-Backbone interact. energy: -1.097 local terms energy: -107.830187 where: bonds (distance) C4'-P energy: -26.757 bonds (distance) P-C4' energy: -22.952 flat angles C4'-P-C4' energy: -25.687 flat angles P-C4'-P energy: -16.023 tors. eta vs tors. theta energy: -16.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -234.799405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.799405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.799405 (E_RNA) where: Base-Base interactions energy: -129.649 where: short stacking energy: -73.026 Base-Backbone interact. energy: -0.475 local terms energy: -104.675662 where: bonds (distance) C4'-P energy: -20.742 bonds (distance) P-C4' energy: -22.428 flat angles C4'-P-C4' energy: -25.692 flat angles P-C4'-P energy: -19.622 tors. eta vs tors. theta energy: -16.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -225.491737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.491737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.520279 (E_RNA) where: Base-Base interactions energy: -132.763 where: short stacking energy: -72.134 Base-Backbone interact. energy: -0.343 local terms energy: -92.414051 where: bonds (distance) C4'-P energy: -20.782 bonds (distance) P-C4' energy: -22.816 flat angles C4'-P-C4' energy: -22.092 flat angles P-C4'-P energy: -10.878 tors. eta vs tors. theta energy: -15.846 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -165.987931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.987931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.197069 (E_RNA) where: Base-Base interactions energy: -80.541 where: short stacking energy: -48.292 Base-Backbone interact. energy: -0.097 local terms energy: -85.558747 where: bonds (distance) C4'-P energy: -18.227 bonds (distance) P-C4' energy: -23.110 flat angles C4'-P-C4' energy: -17.101 flat angles P-C4'-P energy: -11.730 tors. eta vs tors. theta energy: -15.391 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -141.386746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.386746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.497821 (E_RNA) where: Base-Base interactions energy: -68.148 where: short stacking energy: -46.434 Base-Backbone interact. energy: -0.423 local terms energy: -72.926405 where: bonds (distance) C4'-P energy: -17.950 bonds (distance) P-C4' energy: -22.242 flat angles C4'-P-C4' energy: -19.167 flat angles P-C4'-P energy: -14.128 tors. eta vs tors. theta energy: 0.561 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -383.290524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.290524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.290524 (E_RNA) where: Base-Base interactions energy: -253.951 where: short stacking energy: -116.536 Base-Backbone interact. energy: -0.106 local terms energy: -129.233572 where: bonds (distance) C4'-P energy: -29.419 bonds (distance) P-C4' energy: -20.095 flat angles C4'-P-C4' energy: -28.692 flat angles P-C4'-P energy: -19.245 tors. eta vs tors. theta energy: -31.782 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -368.659126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.659126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.711930 (E_RNA) where: Base-Base interactions energy: -241.927 where: short stacking energy: -128.585 Base-Backbone interact. energy: -0.753 local terms energy: -126.032860 where: bonds (distance) C4'-P energy: -19.024 bonds (distance) P-C4' energy: -23.380 flat angles C4'-P-C4' energy: -26.677 flat angles P-C4'-P energy: -20.118 tors. eta vs tors. theta energy: -36.834 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -355.331273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.331273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.366263 (E_RNA) where: Base-Base interactions energy: -227.057 where: short stacking energy: -120.266 Base-Backbone interact. energy: -1.356 local terms energy: -126.953626 where: bonds (distance) C4'-P energy: -20.464 bonds (distance) P-C4' energy: -22.655 flat angles C4'-P-C4' energy: -28.286 flat angles P-C4'-P energy: -20.446 tors. eta vs tors. theta energy: -35.102 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -368.122505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.122505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.152498 (E_RNA) where: Base-Base interactions energy: -238.013 where: short stacking energy: -124.975 Base-Backbone interact. energy: -0.092 local terms energy: -130.047540 where: bonds (distance) C4'-P energy: -24.777 bonds (distance) P-C4' energy: -26.312 flat angles C4'-P-C4' energy: -23.620 flat angles P-C4'-P energy: -18.577 tors. eta vs tors. theta energy: -36.761 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -301.842519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.842519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.842519 (E_RNA) where: Base-Base interactions energy: -186.096 where: short stacking energy: -97.205 Base-Backbone interact. energy: -0.011 local terms energy: -115.735286 where: bonds (distance) C4'-P energy: -23.637 bonds (distance) P-C4' energy: -22.066 flat angles C4'-P-C4' energy: -22.547 flat angles P-C4'-P energy: -19.455 tors. eta vs tors. theta energy: -28.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -279.993073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.993073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.995320 (E_RNA) where: Base-Base interactions energy: -178.580 where: short stacking energy: -89.852 Base-Backbone interact. energy: -0.114 local terms energy: -101.301721 where: bonds (distance) C4'-P energy: -19.278 bonds (distance) P-C4' energy: -22.523 flat angles C4'-P-C4' energy: -16.855 flat angles P-C4'-P energy: -16.435 tors. eta vs tors. theta energy: -26.211 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -261.101514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.101514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.101514 (E_RNA) where: Base-Base interactions energy: -158.093 where: short stacking energy: -77.982 Base-Backbone interact. energy: -1.179 local terms energy: -101.828949 where: bonds (distance) C4'-P energy: -20.187 bonds (distance) P-C4' energy: -21.588 flat angles C4'-P-C4' energy: -21.423 flat angles P-C4'-P energy: -21.929 tors. eta vs tors. theta energy: -16.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -311.228243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.228243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.277869 (E_RNA) where: Base-Base interactions energy: -204.454 where: short stacking energy: -112.450 Base-Backbone interact. energy: -1.212 local terms energy: -105.612108 where: bonds (distance) C4'-P energy: -16.403 bonds (distance) P-C4' energy: -22.916 flat angles C4'-P-C4' energy: -21.668 flat angles P-C4'-P energy: -11.319 tors. eta vs tors. theta energy: -33.305 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -163.359114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.359114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.393714 (E_RNA) where: Base-Base interactions energy: -91.830 where: short stacking energy: -55.877 Base-Backbone interact. energy: -0.318 local terms energy: -71.245234 where: bonds (distance) C4'-P energy: -10.017 bonds (distance) P-C4' energy: -19.555 flat angles C4'-P-C4' energy: -21.169 flat angles P-C4'-P energy: -12.477 tors. eta vs tors. theta energy: -8.027 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -161.893817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.893817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.893817 (E_RNA) where: Base-Base interactions energy: -87.810 where: short stacking energy: -55.505 Base-Backbone interact. energy: -0.042 local terms energy: -74.041128 where: bonds (distance) C4'-P energy: -23.293 bonds (distance) P-C4' energy: -14.994 flat angles C4'-P-C4' energy: -20.261 flat angles P-C4'-P energy: -8.955 tors. eta vs tors. theta energy: -6.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -375.342611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.342611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.528935 (E_RNA) where: Base-Base interactions energy: -250.159 where: short stacking energy: -129.324 Base-Backbone interact. energy: -0.633 local terms energy: -124.737562 where: bonds (distance) C4'-P energy: -19.026 bonds (distance) P-C4' energy: -26.519 flat angles C4'-P-C4' energy: -26.660 flat angles P-C4'-P energy: -17.952 tors. eta vs tors. theta energy: -34.581 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -359.133597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.133597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.151142 (E_RNA) where: Base-Base interactions energy: -230.095 where: short stacking energy: -103.965 Base-Backbone interact. energy: -0.646 local terms energy: -128.410161 where: bonds (distance) C4'-P energy: -25.435 bonds (distance) P-C4' energy: -26.070 flat angles C4'-P-C4' energy: -26.008 flat angles P-C4'-P energy: -21.681 tors. eta vs tors. theta energy: -29.216 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -376.102086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.102086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.102086 (E_RNA) where: Base-Base interactions energy: -247.269 where: short stacking energy: -126.696 Base-Backbone interact. energy: -0.040 local terms energy: -128.793701 where: bonds (distance) C4'-P energy: -21.487 bonds (distance) P-C4' energy: -22.575 flat angles C4'-P-C4' energy: -26.720 flat angles P-C4'-P energy: -18.995 tors. eta vs tors. theta energy: -39.017 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -352.798625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.798625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.798625 (E_RNA) where: Base-Base interactions energy: -223.367 where: short stacking energy: -105.593 Base-Backbone interact. energy: -1.343 local terms energy: -128.089152 where: bonds (distance) C4'-P energy: -22.655 bonds (distance) P-C4' energy: -19.811 flat angles C4'-P-C4' energy: -29.379 flat angles P-C4'-P energy: -19.576 tors. eta vs tors. theta energy: -36.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -316.173815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.173815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.243726 (E_RNA) where: Base-Base interactions energy: -207.486 where: short stacking energy: -112.376 Base-Backbone interact. energy: -0.313 local terms energy: -108.445143 where: bonds (distance) C4'-P energy: -27.875 bonds (distance) P-C4' energy: -18.605 flat angles C4'-P-C4' energy: -22.387 flat angles P-C4'-P energy: -8.224 tors. eta vs tors. theta energy: -31.355 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -298.698061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.698061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.698061 (E_RNA) where: Base-Base interactions energy: -186.097 where: short stacking energy: -93.319 Base-Backbone interact. energy: 0.175 local terms energy: -112.775581 where: bonds (distance) C4'-P energy: -22.214 bonds (distance) P-C4' energy: -23.655 flat angles C4'-P-C4' energy: -26.114 flat angles P-C4'-P energy: -19.788 tors. eta vs tors. theta energy: -21.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -322.238287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.238287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.238287 (E_RNA) where: Base-Base interactions energy: -219.444 where: short stacking energy: -111.308 Base-Backbone interact. energy: -1.159 local terms energy: -101.634661 where: bonds (distance) C4'-P energy: -14.873 bonds (distance) P-C4' energy: -21.578 flat angles C4'-P-C4' energy: -18.353 flat angles P-C4'-P energy: -15.357 tors. eta vs tors. theta energy: -31.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -244.233559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.233559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.326865 (E_RNA) where: Base-Base interactions energy: -140.106 where: short stacking energy: -68.461 Base-Backbone interact. energy: -0.433 local terms energy: -103.787407 where: bonds (distance) C4'-P energy: -25.139 bonds (distance) P-C4' energy: -23.679 flat angles C4'-P-C4' energy: -22.639 flat angles P-C4'-P energy: -14.471 tors. eta vs tors. theta energy: -17.861 Dist. restrs. and SS energy: 0.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -155.143118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.143118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.420856 (E_RNA) where: Base-Base interactions energy: -79.548 where: short stacking energy: -38.559 Base-Backbone interact. energy: -0.442 local terms energy: -75.430817 where: bonds (distance) C4'-P energy: -20.435 bonds (distance) P-C4' energy: -20.632 flat angles C4'-P-C4' energy: -22.870 flat angles P-C4'-P energy: -9.343 tors. eta vs tors. theta energy: -2.151 Dist. restrs. and SS energy: 0.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -177.147051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.147051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.327209 (E_RNA) where: Base-Base interactions energy: -95.665 where: short stacking energy: -53.223 Base-Backbone interact. energy: -0.043 local terms energy: -81.618763 where: bonds (distance) C4'-P energy: -18.229 bonds (distance) P-C4' energy: -16.315 flat angles C4'-P-C4' energy: -24.055 flat angles P-C4'-P energy: -11.325 tors. eta vs tors. theta energy: -11.694 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -373.123643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.123643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.123643 (E_RNA) where: Base-Base interactions energy: -247.477 where: short stacking energy: -120.480 Base-Backbone interact. energy: -0.352 local terms energy: -125.293984 where: bonds (distance) C4'-P energy: -25.395 bonds (distance) P-C4' energy: -21.020 flat angles C4'-P-C4' energy: -27.395 flat angles P-C4'-P energy: -18.164 tors. eta vs tors. theta energy: -33.321 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -364.362135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.362135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.376878 (E_RNA) where: Base-Base interactions energy: -245.726 where: short stacking energy: -125.931 Base-Backbone interact. energy: -0.387 local terms energy: -118.264481 where: bonds (distance) C4'-P energy: -20.803 bonds (distance) P-C4' energy: -23.397 flat angles C4'-P-C4' energy: -25.450 flat angles P-C4'-P energy: -17.980 tors. eta vs tors. theta energy: -30.635 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -352.546071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.546071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.564422 (E_RNA) where: Base-Base interactions energy: -232.284 where: short stacking energy: -113.785 Base-Backbone interact. energy: -0.237 local terms energy: -120.042458 where: bonds (distance) C4'-P energy: -19.284 bonds (distance) P-C4' energy: -27.323 flat angles C4'-P-C4' energy: -21.742 flat angles P-C4'-P energy: -16.148 tors. eta vs tors. theta energy: -35.546 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -339.443593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.443593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.443593 (E_RNA) where: Base-Base interactions energy: -219.021 where: short stacking energy: -106.779 Base-Backbone interact. energy: -0.600 local terms energy: -119.822844 where: bonds (distance) C4'-P energy: -23.433 bonds (distance) P-C4' energy: -23.080 flat angles C4'-P-C4' energy: -26.031 flat angles P-C4'-P energy: -14.269 tors. eta vs tors. theta energy: -33.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -309.606471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.606471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.670414 (E_RNA) where: Base-Base interactions energy: -190.587 where: short stacking energy: -111.123 Base-Backbone interact. energy: -0.516 local terms energy: -118.567020 where: bonds (distance) C4'-P energy: -23.571 bonds (distance) P-C4' energy: -23.584 flat angles C4'-P-C4' energy: -24.177 flat angles P-C4'-P energy: -13.697 tors. eta vs tors. theta energy: -33.538 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -311.201983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.201983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.227169 (E_RNA) where: Base-Base interactions energy: -206.943 where: short stacking energy: -94.102 Base-Backbone interact. energy: -0.134 local terms energy: -104.150258 where: bonds (distance) C4'-P energy: -19.261 bonds (distance) P-C4' energy: -23.053 flat angles C4'-P-C4' energy: -23.422 flat angles P-C4'-P energy: -15.630 tors. eta vs tors. theta energy: -22.785 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -262.308162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.308162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.308162 (E_RNA) where: Base-Base interactions energy: -167.544 where: short stacking energy: -81.147 Base-Backbone interact. energy: 3.170 local terms energy: -97.934656 where: bonds (distance) C4'-P energy: -17.757 bonds (distance) P-C4' energy: -22.624 flat angles C4'-P-C4' energy: -23.126 flat angles P-C4'-P energy: -14.796 tors. eta vs tors. theta energy: -19.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -198.878357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.878357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.878357 (E_RNA) where: Base-Base interactions energy: -109.837 where: short stacking energy: -56.832 Base-Backbone interact. energy: 0.717 local terms energy: -89.759211 where: bonds (distance) C4'-P energy: -21.246 bonds (distance) P-C4' energy: -25.148 flat angles C4'-P-C4' energy: -22.118 flat angles P-C4'-P energy: -15.383 tors. eta vs tors. theta energy: -5.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -234.681176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.681176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.695498 (E_RNA) where: Base-Base interactions energy: -155.343 where: short stacking energy: -79.067 Base-Backbone interact. energy: -1.691 local terms energy: -77.661782 where: bonds (distance) C4'-P energy: -13.830 bonds (distance) P-C4' energy: -21.264 flat angles C4'-P-C4' energy: -21.535 flat angles P-C4'-P energy: -7.723 tors. eta vs tors. theta energy: -13.310 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -182.761011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.761011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.841301 (E_RNA) where: Base-Base interactions energy: -110.589 where: short stacking energy: -51.397 Base-Backbone interact. energy: -0.401 local terms energy: -71.851500 where: bonds (distance) C4'-P energy: -19.941 bonds (distance) P-C4' energy: -22.323 flat angles C4'-P-C4' energy: -17.364 flat angles P-C4'-P energy: -7.803 tors. eta vs tors. theta energy: -4.420 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -378.755715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.755715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.786350 (E_RNA) where: Base-Base interactions energy: -251.099 where: short stacking energy: -112.523 Base-Backbone interact. energy: -0.195 local terms energy: -127.492805 where: bonds (distance) C4'-P energy: -25.520 bonds (distance) P-C4' energy: -25.406 flat angles C4'-P-C4' energy: -27.436 flat angles P-C4'-P energy: -15.296 tors. eta vs tors. theta energy: -33.835 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -376.185223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.185223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.227312 (E_RNA) where: Base-Base interactions energy: -245.279 where: short stacking energy: -117.148 Base-Backbone interact. energy: -0.240 local terms energy: -130.708780 where: bonds (distance) C4'-P energy: -25.930 bonds (distance) P-C4' energy: -24.675 flat angles C4'-P-C4' energy: -26.436 flat angles P-C4'-P energy: -20.202 tors. eta vs tors. theta energy: -33.465 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -343.387617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.387617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.387617 (E_RNA) where: Base-Base interactions energy: -219.698 where: short stacking energy: -115.699 Base-Backbone interact. energy: -0.806 local terms energy: -122.883066 where: bonds (distance) C4'-P energy: -24.087 bonds (distance) P-C4' energy: -26.503 flat angles C4'-P-C4' energy: -26.498 flat angles P-C4'-P energy: -16.765 tors. eta vs tors. theta energy: -29.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -342.423344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.423344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.423344 (E_RNA) where: Base-Base interactions energy: -225.128 where: short stacking energy: -113.814 Base-Backbone interact. energy: -0.062 local terms energy: -117.233263 where: bonds (distance) C4'-P energy: -19.365 bonds (distance) P-C4' energy: -24.175 flat angles C4'-P-C4' energy: -22.147 flat angles P-C4'-P energy: -19.257 tors. eta vs tors. theta energy: -32.289 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -332.772954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.772954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.775099 (E_RNA) where: Base-Base interactions energy: -216.226 where: short stacking energy: -108.211 Base-Backbone interact. energy: -0.073 local terms energy: -116.475938 where: bonds (distance) C4'-P energy: -22.651 bonds (distance) P-C4' energy: -23.705 flat angles C4'-P-C4' energy: -20.815 flat angles P-C4'-P energy: -19.630 tors. eta vs tors. theta energy: -29.676 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -269.942941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.942941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.976285 (E_RNA) where: Base-Base interactions energy: -169.306 where: short stacking energy: -99.666 Base-Backbone interact. energy: -0.139 local terms energy: -100.531093 where: bonds (distance) C4'-P energy: -15.541 bonds (distance) P-C4' energy: -26.265 flat angles C4'-P-C4' energy: -23.197 flat angles P-C4'-P energy: -14.181 tors. eta vs tors. theta energy: -21.347 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -242.738438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.738438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.738438 (E_RNA) where: Base-Base interactions energy: -137.989 where: short stacking energy: -83.409 Base-Backbone interact. energy: -1.045 local terms energy: -103.704278 where: bonds (distance) C4'-P energy: -17.437 bonds (distance) P-C4' energy: -24.830 flat angles C4'-P-C4' energy: -21.568 flat angles P-C4'-P energy: -19.065 tors. eta vs tors. theta energy: -20.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -165.167222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.167222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.208578 (E_RNA) where: Base-Base interactions energy: -78.496 where: short stacking energy: -43.528 Base-Backbone interact. energy: 0.316 local terms energy: -87.028092 where: bonds (distance) C4'-P energy: -27.646 bonds (distance) P-C4' energy: -19.395 flat angles C4'-P-C4' energy: -18.850 flat angles P-C4'-P energy: -15.100 tors. eta vs tors. theta energy: -6.038 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -225.022339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.022339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.074008 (E_RNA) where: Base-Base interactions energy: -148.051 where: short stacking energy: -80.327 Base-Backbone interact. energy: -0.533 local terms energy: -76.490505 where: bonds (distance) C4'-P energy: -16.067 bonds (distance) P-C4' energy: -14.849 flat angles C4'-P-C4' energy: -13.850 flat angles P-C4'-P energy: -16.393 tors. eta vs tors. theta energy: -15.333 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -154.758837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.758837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.758837 (E_RNA) where: Base-Base interactions energy: -93.487 where: short stacking energy: -58.323 Base-Backbone interact. energy: -0.110 local terms energy: -61.161739 where: bonds (distance) C4'-P energy: -16.636 bonds (distance) P-C4' energy: -17.996 flat angles C4'-P-C4' energy: -15.541 flat angles P-C4'-P energy: -8.361 tors. eta vs tors. theta energy: -2.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -379.400949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.400949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.400949 (E_RNA) where: Base-Base interactions energy: -247.391 where: short stacking energy: -120.531 Base-Backbone interact. energy: -0.909 local terms energy: -131.100722 where: bonds (distance) C4'-P energy: -22.988 bonds (distance) P-C4' energy: -26.241 flat angles C4'-P-C4' energy: -24.467 flat angles P-C4'-P energy: -19.180 tors. eta vs tors. theta energy: -38.224 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -376.777025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.777025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.823727 (E_RNA) where: Base-Base interactions energy: -243.753 where: short stacking energy: -124.535 Base-Backbone interact. energy: -0.457 local terms energy: -132.614428 where: bonds (distance) C4'-P energy: -23.065 bonds (distance) P-C4' energy: -28.254 flat angles C4'-P-C4' energy: -26.581 flat angles P-C4'-P energy: -19.111 tors. eta vs tors. theta energy: -35.602 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -334.392729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.392729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.392729 (E_RNA) where: Base-Base interactions energy: -214.137 where: short stacking energy: -106.564 Base-Backbone interact. energy: -0.775 local terms energy: -119.480897 where: bonds (distance) C4'-P energy: -16.802 bonds (distance) P-C4' energy: -24.272 flat angles C4'-P-C4' energy: -26.876 flat angles P-C4'-P energy: -21.313 tors. eta vs tors. theta energy: -30.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -346.522833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.522833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.543117 (E_RNA) where: Base-Base interactions energy: -236.054 where: short stacking energy: -113.782 Base-Backbone interact. energy: -0.588 local terms energy: -109.900539 where: bonds (distance) C4'-P energy: -17.875 bonds (distance) P-C4' energy: -19.334 flat angles C4'-P-C4' energy: -24.691 flat angles P-C4'-P energy: -16.786 tors. eta vs tors. theta energy: -31.214 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -341.559737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.559737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.615104 (E_RNA) where: Base-Base interactions energy: -216.267 where: short stacking energy: -112.212 Base-Backbone interact. energy: -1.900 local terms energy: -123.448063 where: bonds (distance) C4'-P energy: -26.960 bonds (distance) P-C4' energy: -25.131 flat angles C4'-P-C4' energy: -24.919 flat angles P-C4'-P energy: -16.666 tors. eta vs tors. theta energy: -29.772 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -254.184689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.184689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.265056 (E_RNA) where: Base-Base interactions energy: -144.736 where: short stacking energy: -82.407 Base-Backbone interact. energy: -0.166 local terms energy: -109.362943 where: bonds (distance) C4'-P energy: -27.312 bonds (distance) P-C4' energy: -20.261 flat angles C4'-P-C4' energy: -26.728 flat angles P-C4'-P energy: -14.187 tors. eta vs tors. theta energy: -20.875 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -231.727293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.727293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.136648 (E_RNA) where: Base-Base interactions energy: -142.497 where: short stacking energy: -83.550 Base-Backbone interact. energy: -0.405 local terms energy: -89.234997 where: bonds (distance) C4'-P energy: -13.065 bonds (distance) P-C4' energy: -27.934 flat angles C4'-P-C4' energy: -20.380 flat angles P-C4'-P energy: -13.026 tors. eta vs tors. theta energy: -14.829 Dist. restrs. and SS energy: 0.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -233.733593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.733593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.763079 (E_RNA) where: Base-Base interactions energy: -132.150 where: short stacking energy: -63.852 Base-Backbone interact. energy: 0.003 local terms energy: -101.616421 where: bonds (distance) C4'-P energy: -21.227 bonds (distance) P-C4' energy: -23.045 flat angles C4'-P-C4' energy: -24.921 flat angles P-C4'-P energy: -18.531 tors. eta vs tors. theta energy: -13.892 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -162.028544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.028544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.028544 (E_RNA) where: Base-Base interactions energy: -83.452 where: short stacking energy: -45.697 Base-Backbone interact. energy: -0.173 local terms energy: -78.403410 where: bonds (distance) C4'-P energy: -21.446 bonds (distance) P-C4' energy: -25.915 flat angles C4'-P-C4' energy: -10.754 flat angles P-C4'-P energy: -13.601 tors. eta vs tors. theta energy: -6.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -168.896013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.896013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.917098 (E_RNA) where: Base-Base interactions energy: -106.836 where: short stacking energy: -58.022 Base-Backbone interact. energy: -0.637 local terms energy: -61.444288 where: bonds (distance) C4'-P energy: -15.292 bonds (distance) P-C4' energy: -15.279 flat angles C4'-P-C4' energy: -18.050 flat angles P-C4'-P energy: -11.149 tors. eta vs tors. theta energy: -1.675 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -389.630480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.630480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.630480 (E_RNA) where: Base-Base interactions energy: -257.655 where: short stacking energy: -134.712 Base-Backbone interact. energy: -1.192 local terms energy: -130.783661 where: bonds (distance) C4'-P energy: -21.003 bonds (distance) P-C4' energy: -26.878 flat angles C4'-P-C4' energy: -28.749 flat angles P-C4'-P energy: -19.057 tors. eta vs tors. theta energy: -35.096 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -368.274671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.274671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.341295 (E_RNA) where: Base-Base interactions energy: -242.250 where: short stacking energy: -119.787 Base-Backbone interact. energy: -0.511 local terms energy: -125.580439 where: bonds (distance) C4'-P energy: -23.549 bonds (distance) P-C4' energy: -21.002 flat angles C4'-P-C4' energy: -24.092 flat angles P-C4'-P energy: -16.996 tors. eta vs tors. theta energy: -39.942 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -357.511252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.511252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.511252 (E_RNA) where: Base-Base interactions energy: -234.373 where: short stacking energy: -124.462 Base-Backbone interact. energy: -1.092 local terms energy: -122.045716 where: bonds (distance) C4'-P energy: -21.644 bonds (distance) P-C4' energy: -22.707 flat angles C4'-P-C4' energy: -24.165 flat angles P-C4'-P energy: -16.822 tors. eta vs tors. theta energy: -36.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -356.533910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.533910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.533910 (E_RNA) where: Base-Base interactions energy: -237.711 where: short stacking energy: -119.839 Base-Backbone interact. energy: -0.775 local terms energy: -118.048192 where: bonds (distance) C4'-P energy: -23.966 bonds (distance) P-C4' energy: -22.074 flat angles C4'-P-C4' energy: -22.484 flat angles P-C4'-P energy: -21.329 tors. eta vs tors. theta energy: -28.196 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -323.802694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.802694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.802694 (E_RNA) where: Base-Base interactions energy: -221.460 where: short stacking energy: -110.962 Base-Backbone interact. energy: -0.022 local terms energy: -102.321510 where: bonds (distance) C4'-P energy: -16.648 bonds (distance) P-C4' energy: -19.746 flat angles C4'-P-C4' energy: -23.488 flat angles P-C4'-P energy: -13.531 tors. eta vs tors. theta energy: -28.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -252.643784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.643784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.664159 (E_RNA) where: Base-Base interactions energy: -148.068 where: short stacking energy: -78.891 Base-Backbone interact. energy: -0.804 local terms energy: -103.791746 where: bonds (distance) C4'-P energy: -24.347 bonds (distance) P-C4' energy: -19.907 flat angles C4'-P-C4' energy: -23.333 flat angles P-C4'-P energy: -16.195 tors. eta vs tors. theta energy: -20.009 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -233.980220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.980220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.049332 (E_RNA) where: Base-Base interactions energy: -138.139 where: short stacking energy: -67.595 Base-Backbone interact. energy: -0.787 local terms energy: -95.123639 where: bonds (distance) C4'-P energy: -20.882 bonds (distance) P-C4' energy: -22.960 flat angles C4'-P-C4' energy: -22.688 flat angles P-C4'-P energy: -17.749 tors. eta vs tors. theta energy: -10.845 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -239.981200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.981200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.047805 (E_RNA) where: Base-Base interactions energy: -147.523 where: short stacking energy: -80.928 Base-Backbone interact. energy: 0.189 local terms energy: -92.714194 where: bonds (distance) C4'-P energy: -16.287 bonds (distance) P-C4' energy: -26.139 flat angles C4'-P-C4' energy: -18.868 flat angles P-C4'-P energy: -12.511 tors. eta vs tors. theta energy: -18.910 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -177.341586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.341586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.341586 (E_RNA) where: Base-Base interactions energy: -100.757 where: short stacking energy: -62.149 Base-Backbone interact. energy: -0.346 local terms energy: -76.238633 where: bonds (distance) C4'-P energy: -20.673 bonds (distance) P-C4' energy: -24.540 flat angles C4'-P-C4' energy: -8.554 flat angles P-C4'-P energy: -14.452 tors. eta vs tors. theta energy: -8.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -150.729032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.729032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.774173 (E_RNA) where: Base-Base interactions energy: -65.905 where: short stacking energy: -42.449 Base-Backbone interact. energy: -1.219 local terms energy: -83.650806 where: bonds (distance) C4'-P energy: -21.110 bonds (distance) P-C4' energy: -25.039 flat angles C4'-P-C4' energy: -18.949 flat angles P-C4'-P energy: -13.019 tors. eta vs tors. theta energy: -5.533 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -377.235940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.235940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.498792 (E_RNA) where: Base-Base interactions energy: -247.802 where: short stacking energy: -127.173 Base-Backbone interact. energy: -0.411 local terms energy: -129.286229 where: bonds (distance) C4'-P energy: -24.597 bonds (distance) P-C4' energy: -22.497 flat angles C4'-P-C4' energy: -27.217 flat angles P-C4'-P energy: -19.056 tors. eta vs tors. theta energy: -35.918 Dist. restrs. and SS energy: 0.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -372.946896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.946896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.972843 (E_RNA) where: Base-Base interactions energy: -243.797 where: short stacking energy: -123.913 Base-Backbone interact. energy: -0.027 local terms energy: -129.148619 where: bonds (distance) C4'-P energy: -26.603 bonds (distance) P-C4' energy: -22.911 flat angles C4'-P-C4' energy: -24.779 flat angles P-C4'-P energy: -18.906 tors. eta vs tors. theta energy: -35.950 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -355.278108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.278108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.293008 (E_RNA) where: Base-Base interactions energy: -222.771 where: short stacking energy: -116.527 Base-Backbone interact. energy: -0.358 local terms energy: -132.163516 where: bonds (distance) C4'-P energy: -26.206 bonds (distance) P-C4' energy: -23.359 flat angles C4'-P-C4' energy: -26.499 flat angles P-C4'-P energy: -21.368 tors. eta vs tors. theta energy: -34.732 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -310.773890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.773890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.773890 (E_RNA) where: Base-Base interactions energy: -193.175 where: short stacking energy: -99.814 Base-Backbone interact. energy: -0.598 local terms energy: -117.001053 where: bonds (distance) C4'-P energy: -25.415 bonds (distance) P-C4' energy: -27.147 flat angles C4'-P-C4' energy: -18.171 flat angles P-C4'-P energy: -18.017 tors. eta vs tors. theta energy: -28.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -337.470296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.470296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.470296 (E_RNA) where: Base-Base interactions energy: -229.359 where: short stacking energy: -110.615 Base-Backbone interact. energy: -0.120 local terms energy: -107.991439 where: bonds (distance) C4'-P energy: -17.612 bonds (distance) P-C4' energy: -21.822 flat angles C4'-P-C4' energy: -26.752 flat angles P-C4'-P energy: -15.720 tors. eta vs tors. theta energy: -26.085 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -244.602578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.602578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.608697 (E_RNA) where: Base-Base interactions energy: -145.808 where: short stacking energy: -82.094 Base-Backbone interact. energy: -1.001 local terms energy: -97.799730 where: bonds (distance) C4'-P energy: -24.753 bonds (distance) P-C4' energy: -24.906 flat angles C4'-P-C4' energy: -20.310 flat angles P-C4'-P energy: -11.965 tors. eta vs tors. theta energy: -15.866 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -237.568345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.568345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.570262 (E_RNA) where: Base-Base interactions energy: -147.760 where: short stacking energy: -76.428 Base-Backbone interact. energy: -0.313 local terms energy: -89.497059 where: bonds (distance) C4'-P energy: -15.737 bonds (distance) P-C4' energy: -19.215 flat angles C4'-P-C4' energy: -22.754 flat angles P-C4'-P energy: -16.649 tors. eta vs tors. theta energy: -15.142 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -246.117019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.117019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.117019 (E_RNA) where: Base-Base interactions energy: -147.331 where: short stacking energy: -82.961 Base-Backbone interact. energy: 1.212 local terms energy: -99.997687 where: bonds (distance) C4'-P energy: -23.081 bonds (distance) P-C4' energy: -24.078 flat angles C4'-P-C4' energy: -13.908 flat angles P-C4'-P energy: -18.631 tors. eta vs tors. theta energy: -20.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -193.565947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.565947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.565947 (E_RNA) where: Base-Base interactions energy: -96.095 where: short stacking energy: -65.664 Base-Backbone interact. energy: -1.420 local terms energy: -96.051890 where: bonds (distance) C4'-P energy: -22.745 bonds (distance) P-C4' energy: -22.763 flat angles C4'-P-C4' energy: -19.987 flat angles P-C4'-P energy: -15.528 tors. eta vs tors. theta energy: -15.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -143.193343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.193343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.196896 (E_RNA) where: Base-Base interactions energy: -77.930 where: short stacking energy: -46.067 Base-Backbone interact. energy: -0.710 local terms energy: -64.557202 where: bonds (distance) C4'-P energy: -24.286 bonds (distance) P-C4' energy: -15.934 flat angles C4'-P-C4' energy: -16.145 flat angles P-C4'-P energy: -13.227 tors. eta vs tors. theta energy: 5.035 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -373.791366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.791366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.837834 (E_RNA) where: Base-Base interactions energy: -241.601 where: short stacking energy: -125.822 Base-Backbone interact. energy: -0.740 local terms energy: -131.496911 where: bonds (distance) C4'-P energy: -24.495 bonds (distance) P-C4' energy: -25.016 flat angles C4'-P-C4' energy: -28.740 flat angles P-C4'-P energy: -18.779 tors. eta vs tors. theta energy: -34.467 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -371.139066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.139066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.181450 (E_RNA) where: Base-Base interactions energy: -249.080 where: short stacking energy: -126.001 Base-Backbone interact. energy: -0.887 local terms energy: -121.214349 where: bonds (distance) C4'-P energy: -17.364 bonds (distance) P-C4' energy: -26.704 flat angles C4'-P-C4' energy: -20.844 flat angles P-C4'-P energy: -18.272 tors. eta vs tors. theta energy: -38.030 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -355.993704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.993704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.067789 (E_RNA) where: Base-Base interactions energy: -236.469 where: short stacking energy: -130.764 Base-Backbone interact. energy: -0.517 local terms energy: -119.082013 where: bonds (distance) C4'-P energy: -22.133 bonds (distance) P-C4' energy: -18.775 flat angles C4'-P-C4' energy: -25.641 flat angles P-C4'-P energy: -17.743 tors. eta vs tors. theta energy: -34.790 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -323.411765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.411765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.411765 (E_RNA) where: Base-Base interactions energy: -206.405 where: short stacking energy: -104.728 Base-Backbone interact. energy: -0.028 local terms energy: -116.978190 where: bonds (distance) C4'-P energy: -18.344 bonds (distance) P-C4' energy: -25.738 flat angles C4'-P-C4' energy: -26.088 flat angles P-C4'-P energy: -17.301 tors. eta vs tors. theta energy: -29.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -341.004726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.004726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.004726 (E_RNA) where: Base-Base interactions energy: -228.073 where: short stacking energy: -104.728 Base-Backbone interact. energy: -0.025 local terms energy: -112.907237 where: bonds (distance) C4'-P energy: -18.681 bonds (distance) P-C4' energy: -25.897 flat angles C4'-P-C4' energy: -25.304 flat angles P-C4'-P energy: -15.467 tors. eta vs tors. theta energy: -27.559 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -258.639641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.639641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.707815 (E_RNA) where: Base-Base interactions energy: -164.825 where: short stacking energy: -88.345 Base-Backbone interact. energy: -0.208 local terms energy: -93.674532 where: bonds (distance) C4'-P energy: -20.448 bonds (distance) P-C4' energy: -19.732 flat angles C4'-P-C4' energy: -22.949 flat angles P-C4'-P energy: -8.401 tors. eta vs tors. theta energy: -22.145 Dist. restrs. and SS energy: 0.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -256.712630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.712630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.785549 (E_RNA) where: Base-Base interactions energy: -166.530 where: short stacking energy: -88.994 Base-Backbone interact. energy: -0.005 local terms energy: -90.250689 where: bonds (distance) C4'-P energy: -12.626 bonds (distance) P-C4' energy: -21.797 flat angles C4'-P-C4' energy: -19.687 flat angles P-C4'-P energy: -14.598 tors. eta vs tors. theta energy: -21.542 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -231.208543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.208543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.208543 (E_RNA) where: Base-Base interactions energy: -134.411 where: short stacking energy: -78.291 Base-Backbone interact. energy: -0.075 local terms energy: -96.722388 where: bonds (distance) C4'-P energy: -20.013 bonds (distance) P-C4' energy: -16.810 flat angles C4'-P-C4' energy: -21.967 flat angles P-C4'-P energy: -19.358 tors. eta vs tors. theta energy: -18.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -181.662955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.662955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.688895 (E_RNA) where: Base-Base interactions energy: -99.443 where: short stacking energy: -59.635 Base-Backbone interact. energy: 0.803 local terms energy: -83.049722 where: bonds (distance) C4'-P energy: -16.920 bonds (distance) P-C4' energy: -21.126 flat angles C4'-P-C4' energy: -22.307 flat angles P-C4'-P energy: -10.672 tors. eta vs tors. theta energy: -12.025 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -155.353650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.353650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.429181 (E_RNA) where: Base-Base interactions energy: -80.442 where: short stacking energy: -53.936 Base-Backbone interact. energy: -0.255 local terms energy: -74.732017 where: bonds (distance) C4'-P energy: -13.190 bonds (distance) P-C4' energy: -22.827 flat angles C4'-P-C4' energy: -19.890 flat angles P-C4'-P energy: -12.164 tors. eta vs tors. theta energy: -6.660 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -380.466893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.466893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.466893 (E_RNA) where: Base-Base interactions energy: -252.078 where: short stacking energy: -121.204 Base-Backbone interact. energy: -0.560 local terms energy: -127.829528 where: bonds (distance) C4'-P energy: -21.110 bonds (distance) P-C4' energy: -29.203 flat angles C4'-P-C4' energy: -26.316 flat angles P-C4'-P energy: -13.668 tors. eta vs tors. theta energy: -37.532 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -351.352217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.352217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.352217 (E_RNA) where: Base-Base interactions energy: -231.833 where: short stacking energy: -123.509 Base-Backbone interact. energy: -0.396 local terms energy: -119.124065 where: bonds (distance) C4'-P energy: -23.900 bonds (distance) P-C4' energy: -20.459 flat angles C4'-P-C4' energy: -27.116 flat angles P-C4'-P energy: -10.482 tors. eta vs tors. theta energy: -37.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -364.911617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.911617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.964401 (E_RNA) where: Base-Base interactions energy: -241.463 where: short stacking energy: -118.988 Base-Backbone interact. energy: -0.620 local terms energy: -122.881417 where: bonds (distance) C4'-P energy: -23.991 bonds (distance) P-C4' energy: -22.174 flat angles C4'-P-C4' energy: -25.577 flat angles P-C4'-P energy: -15.385 tors. eta vs tors. theta energy: -35.753 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -352.283962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.283962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.283962 (E_RNA) where: Base-Base interactions energy: -237.784 where: short stacking energy: -103.130 Base-Backbone interact. energy: 0.406 local terms energy: -114.905636 where: bonds (distance) C4'-P energy: -23.259 bonds (distance) P-C4' energy: -22.859 flat angles C4'-P-C4' energy: -24.631 flat angles P-C4'-P energy: -19.353 tors. eta vs tors. theta energy: -24.804 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -292.561493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.561493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.561493 (E_RNA) where: Base-Base interactions energy: -178.595 where: short stacking energy: -87.849 Base-Backbone interact. energy: -0.774 local terms energy: -113.192472 where: bonds (distance) C4'-P energy: -24.837 bonds (distance) P-C4' energy: -28.019 flat angles C4'-P-C4' energy: -21.525 flat angles P-C4'-P energy: -15.145 tors. eta vs tors. theta energy: -23.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -251.424224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.424224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.424224 (E_RNA) where: Base-Base interactions energy: -160.424 where: short stacking energy: -79.028 Base-Backbone interact. energy: 0.504 local terms energy: -91.503710 where: bonds (distance) C4'-P energy: -14.569 bonds (distance) P-C4' energy: -16.034 flat angles C4'-P-C4' energy: -23.701 flat angles P-C4'-P energy: -20.531 tors. eta vs tors. theta energy: -16.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -270.181443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.181443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.445703 (E_RNA) where: Base-Base interactions energy: -166.707 where: short stacking energy: -85.238 Base-Backbone interact. energy: -0.133 local terms energy: -103.605667 where: bonds (distance) C4'-P energy: -20.670 bonds (distance) P-C4' energy: -23.048 flat angles C4'-P-C4' energy: -18.047 flat angles P-C4'-P energy: -16.558 tors. eta vs tors. theta energy: -25.283 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -200.380167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.380167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.380167 (E_RNA) where: Base-Base interactions energy: -122.309 where: short stacking energy: -69.366 Base-Backbone interact. energy: 0.077 local terms energy: -78.148496 where: bonds (distance) C4'-P energy: -21.619 bonds (distance) P-C4' energy: -19.849 flat angles C4'-P-C4' energy: -11.804 flat angles P-C4'-P energy: -18.480 tors. eta vs tors. theta energy: -6.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -173.473159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.473159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.553131 (E_RNA) where: Base-Base interactions energy: -88.391 where: short stacking energy: -46.243 Base-Backbone interact. energy: -0.038 local terms energy: -85.123926 where: bonds (distance) C4'-P energy: -22.916 bonds (distance) P-C4' energy: -20.840 flat angles C4'-P-C4' energy: -14.840 flat angles P-C4'-P energy: -17.427 tors. eta vs tors. theta energy: -9.101 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -179.727111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.727111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.738491 (E_RNA) where: Base-Base interactions energy: -93.162 where: short stacking energy: -57.669 Base-Backbone interact. energy: -0.275 local terms energy: -86.301627 where: bonds (distance) C4'-P energy: -18.114 bonds (distance) P-C4' energy: -19.791 flat angles C4'-P-C4' energy: -22.365 flat angles P-C4'-P energy: -16.941 tors. eta vs tors. theta energy: -9.090 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -379.145964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.145964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.145964 (E_RNA) where: Base-Base interactions energy: -248.569 where: short stacking energy: -126.613 Base-Backbone interact. energy: -0.717 local terms energy: -129.860692 where: bonds (distance) C4'-P energy: -24.473 bonds (distance) P-C4' energy: -21.502 flat angles C4'-P-C4' energy: -26.572 flat angles P-C4'-P energy: -19.357 tors. eta vs tors. theta energy: -37.958 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -365.448738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.448738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.448738 (E_RNA) where: Base-Base interactions energy: -245.933 where: short stacking energy: -123.307 Base-Backbone interact. energy: -0.782 local terms energy: -118.733510 where: bonds (distance) C4'-P energy: -17.979 bonds (distance) P-C4' energy: -19.477 flat angles C4'-P-C4' energy: -23.324 flat angles P-C4'-P energy: -18.287 tors. eta vs tors. theta energy: -39.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -368.559936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.559936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.559936 (E_RNA) where: Base-Base interactions energy: -250.025 where: short stacking energy: -122.125 Base-Backbone interact. energy: -0.051 local terms energy: -118.484006 where: bonds (distance) C4'-P energy: -24.762 bonds (distance) P-C4' energy: -22.923 flat angles C4'-P-C4' energy: -24.277 flat angles P-C4'-P energy: -15.233 tors. eta vs tors. theta energy: -31.289 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -356.391201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.391201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.436569 (E_RNA) where: Base-Base interactions energy: -240.921 where: short stacking energy: -116.030 Base-Backbone interact. energy: -0.268 local terms energy: -115.247212 where: bonds (distance) C4'-P energy: -18.288 bonds (distance) P-C4' energy: -25.231 flat angles C4'-P-C4' energy: -23.954 flat angles P-C4'-P energy: -18.088 tors. eta vs tors. theta energy: -29.686 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -301.588012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.588012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.595487 (E_RNA) where: Base-Base interactions energy: -188.233 where: short stacking energy: -112.442 Base-Backbone interact. energy: -0.049 local terms energy: -113.312858 where: bonds (distance) C4'-P energy: -22.590 bonds (distance) P-C4' energy: -17.953 flat angles C4'-P-C4' energy: -21.601 flat angles P-C4'-P energy: -16.662 tors. eta vs tors. theta energy: -34.506 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -273.018511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.018511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.083053 (E_RNA) where: Base-Base interactions energy: -167.765 where: short stacking energy: -82.154 Base-Backbone interact. energy: -1.069 local terms energy: -104.249179 where: bonds (distance) C4'-P energy: -24.529 bonds (distance) P-C4' energy: -17.856 flat angles C4'-P-C4' energy: -22.175 flat angles P-C4'-P energy: -16.143 tors. eta vs tors. theta energy: -23.546 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -263.447281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.447281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.480607 (E_RNA) where: Base-Base interactions energy: -177.879 where: short stacking energy: -83.700 Base-Backbone interact. energy: 0.996 local terms energy: -86.598158 where: bonds (distance) C4'-P energy: -11.736 bonds (distance) P-C4' energy: -21.357 flat angles C4'-P-C4' energy: -23.118 flat angles P-C4'-P energy: -15.023 tors. eta vs tors. theta energy: -15.364 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -222.273601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.273601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.273601 (E_RNA) where: Base-Base interactions energy: -134.774 where: short stacking energy: -87.101 Base-Backbone interact. energy: -0.246 local terms energy: -87.253380 where: bonds (distance) C4'-P energy: -18.171 bonds (distance) P-C4' energy: -18.285 flat angles C4'-P-C4' energy: -18.780 flat angles P-C4'-P energy: -9.669 tors. eta vs tors. theta energy: -22.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -159.224191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.224191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.224191 (E_RNA) where: Base-Base interactions energy: -83.696 where: short stacking energy: -53.201 Base-Backbone interact. energy: -0.546 local terms energy: -74.982145 where: bonds (distance) C4'-P energy: -14.961 bonds (distance) P-C4' energy: -23.005 flat angles C4'-P-C4' energy: -23.398 flat angles P-C4'-P energy: -12.411 tors. eta vs tors. theta energy: -1.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -174.516259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.516259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.520670 (E_RNA) where: Base-Base interactions energy: -98.854 where: short stacking energy: -68.422 Base-Backbone interact. energy: -1.134 local terms energy: -74.532908 where: bonds (distance) C4'-P energy: -18.763 bonds (distance) P-C4' energy: -17.880 flat angles C4'-P-C4' energy: -20.427 flat angles P-C4'-P energy: -15.682 tors. eta vs tors. theta energy: -1.781 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -378.931862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.931862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.931862 (E_RNA) where: Base-Base interactions energy: -253.748 where: short stacking energy: -123.638 Base-Backbone interact. energy: -0.052 local terms energy: -125.132428 where: bonds (distance) C4'-P energy: -19.670 bonds (distance) P-C4' energy: -23.414 flat angles C4'-P-C4' energy: -24.654 flat angles P-C4'-P energy: -18.975 tors. eta vs tors. theta energy: -38.419 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -372.038739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.038739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.038739 (E_RNA) where: Base-Base interactions energy: -252.321 where: short stacking energy: -132.972 Base-Backbone interact. energy: -0.743 local terms energy: -118.975334 where: bonds (distance) C4'-P energy: -17.764 bonds (distance) P-C4' energy: -25.781 flat angles C4'-P-C4' energy: -22.052 flat angles P-C4'-P energy: -17.557 tors. eta vs tors. theta energy: -35.822 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -351.429948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.429948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.429948 (E_RNA) where: Base-Base interactions energy: -226.974 where: short stacking energy: -112.642 Base-Backbone interact. energy: -0.721 local terms energy: -123.735821 where: bonds (distance) C4'-P energy: -23.628 bonds (distance) P-C4' energy: -24.511 flat angles C4'-P-C4' energy: -27.104 flat angles P-C4'-P energy: -15.286 tors. eta vs tors. theta energy: -33.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -341.163845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.163845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.257465 (E_RNA) where: Base-Base interactions energy: -225.769 where: short stacking energy: -112.274 Base-Backbone interact. energy: 1.179 local terms energy: -116.666915 where: bonds (distance) C4'-P energy: -22.008 bonds (distance) P-C4' energy: -24.971 flat angles C4'-P-C4' energy: -26.350 flat angles P-C4'-P energy: -16.200 tors. eta vs tors. theta energy: -27.138 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -302.335790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.335790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.335790 (E_RNA) where: Base-Base interactions energy: -193.145 where: short stacking energy: -103.971 Base-Backbone interact. energy: -0.249 local terms energy: -108.941122 where: bonds (distance) C4'-P energy: -19.346 bonds (distance) P-C4' energy: -20.133 flat angles C4'-P-C4' energy: -26.499 flat angles P-C4'-P energy: -16.083 tors. eta vs tors. theta energy: -26.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -268.502052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.502052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.587915 (E_RNA) where: Base-Base interactions energy: -167.147 where: short stacking energy: -94.051 Base-Backbone interact. energy: -0.332 local terms energy: -101.109306 where: bonds (distance) C4'-P energy: -19.810 bonds (distance) P-C4' energy: -20.720 flat angles C4'-P-C4' energy: -25.409 flat angles P-C4'-P energy: -11.845 tors. eta vs tors. theta energy: -23.324 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -237.242115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.242115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.307081 (E_RNA) where: Base-Base interactions energy: -142.861 where: short stacking energy: -71.547 Base-Backbone interact. energy: -0.885 local terms energy: -93.560613 where: bonds (distance) C4'-P energy: -18.849 bonds (distance) P-C4' energy: -17.248 flat angles C4'-P-C4' energy: -25.231 flat angles P-C4'-P energy: -18.617 tors. eta vs tors. theta energy: -13.615 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -165.565843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.565843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.616125 (E_RNA) where: Base-Base interactions energy: -78.776 where: short stacking energy: -55.324 Base-Backbone interact. energy: -0.071 local terms energy: -86.769683 where: bonds (distance) C4'-P energy: -21.587 bonds (distance) P-C4' energy: -25.865 flat angles C4'-P-C4' energy: -23.683 flat angles P-C4'-P energy: -15.656 tors. eta vs tors. theta energy: 0.021 Dist. restrs. and SS energy: 0.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -219.968871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.968871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.032879 (E_RNA) where: Base-Base interactions energy: -138.247 where: short stacking energy: -67.167 Base-Backbone interact. energy: 1.940 local terms energy: -83.726049 where: bonds (distance) C4'-P energy: -14.845 bonds (distance) P-C4' energy: -22.680 flat angles C4'-P-C4' energy: -26.155 flat angles P-C4'-P energy: -12.502 tors. eta vs tors. theta energy: -7.544 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -146.825632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.825632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.603932 (E_RNA) where: Base-Base interactions energy: -66.248 where: short stacking energy: -47.397 Base-Backbone interact. energy: -0.319 local terms energy: -82.037033 where: bonds (distance) C4'-P energy: -22.855 bonds (distance) P-C4' energy: -22.607 flat angles C4'-P-C4' energy: -20.419 flat angles P-C4'-P energy: -11.894 tors. eta vs tors. theta energy: -4.261 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -374.877725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.877725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.877725 (E_RNA) where: Base-Base interactions energy: -242.123 where: short stacking energy: -118.322 Base-Backbone interact. energy: -0.200 local terms energy: -132.554199 where: bonds (distance) C4'-P energy: -21.731 bonds (distance) P-C4' energy: -26.930 flat angles C4'-P-C4' energy: -26.587 flat angles P-C4'-P energy: -21.435 tors. eta vs tors. theta energy: -35.872 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -378.154975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.154975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.154975 (E_RNA) where: Base-Base interactions energy: -254.286 where: short stacking energy: -131.556 Base-Backbone interact. energy: -0.818 local terms energy: -123.051611 where: bonds (distance) C4'-P energy: -20.823 bonds (distance) P-C4' energy: -20.998 flat angles C4'-P-C4' energy: -27.488 flat angles P-C4'-P energy: -16.895 tors. eta vs tors. theta energy: -36.847 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -343.168858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.168858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.189677 (E_RNA) where: Base-Base interactions energy: -222.181 where: short stacking energy: -109.606 Base-Backbone interact. energy: -0.682 local terms energy: -120.326846 where: bonds (distance) C4'-P energy: -19.999 bonds (distance) P-C4' energy: -26.585 flat angles C4'-P-C4' energy: -24.257 flat angles P-C4'-P energy: -18.275 tors. eta vs tors. theta energy: -31.210 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -336.983016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.983016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.048462 (E_RNA) where: Base-Base interactions energy: -220.378 where: short stacking energy: -99.561 Base-Backbone interact. energy: -0.424 local terms energy: -116.246477 where: bonds (distance) C4'-P energy: -26.103 bonds (distance) P-C4' energy: -22.739 flat angles C4'-P-C4' energy: -24.731 flat angles P-C4'-P energy: -18.154 tors. eta vs tors. theta energy: -24.520 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -281.914686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.914686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.914686 (E_RNA) where: Base-Base interactions energy: -176.725 where: short stacking energy: -91.978 Base-Backbone interact. energy: -0.942 local terms energy: -104.246957 where: bonds (distance) C4'-P energy: -17.975 bonds (distance) P-C4' energy: -25.719 flat angles C4'-P-C4' energy: -24.533 flat angles P-C4'-P energy: -14.648 tors. eta vs tors. theta energy: -21.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -311.852992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.852992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.852992 (E_RNA) where: Base-Base interactions energy: -192.091 where: short stacking energy: -100.704 Base-Backbone interact. energy: -0.043 local terms energy: -119.719064 where: bonds (distance) C4'-P energy: -24.572 bonds (distance) P-C4' energy: -22.056 flat angles C4'-P-C4' energy: -26.948 flat angles P-C4'-P energy: -13.526 tors. eta vs tors. theta energy: -32.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -235.674098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.674098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.674098 (E_RNA) where: Base-Base interactions energy: -149.790 where: short stacking energy: -66.932 Base-Backbone interact. energy: -0.629 local terms energy: -85.255117 where: bonds (distance) C4'-P energy: -19.881 bonds (distance) P-C4' energy: -23.653 flat angles C4'-P-C4' energy: -22.023 flat angles P-C4'-P energy: -5.499 tors. eta vs tors. theta energy: -14.198 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -179.332097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.332097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.468411 (E_RNA) where: Base-Base interactions energy: -107.334 where: short stacking energy: -63.430 Base-Backbone interact. energy: 1.929 local terms energy: -74.063289 where: bonds (distance) C4'-P energy: -17.325 bonds (distance) P-C4' energy: -23.314 flat angles C4'-P-C4' energy: -22.774 flat angles P-C4'-P energy: -2.788 tors. eta vs tors. theta energy: -7.862 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -183.241212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.241212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.247767 (E_RNA) where: Base-Base interactions energy: -100.557 where: short stacking energy: -57.772 Base-Backbone interact. energy: -0.567 local terms energy: -82.124028 where: bonds (distance) C4'-P energy: -19.743 bonds (distance) P-C4' energy: -21.816 flat angles C4'-P-C4' energy: -17.841 flat angles P-C4'-P energy: -14.052 tors. eta vs tors. theta energy: -8.671 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -152.233224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.233224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.284605 (E_RNA) where: Base-Base interactions energy: -70.543 where: short stacking energy: -40.745 Base-Backbone interact. energy: -0.179 local terms energy: -81.561809 where: bonds (distance) C4'-P energy: -20.994 bonds (distance) P-C4' energy: -20.076 flat angles C4'-P-C4' energy: -20.205 flat angles P-C4'-P energy: -15.126 tors. eta vs tors. theta energy: -5.161 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -369.948885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.948885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.980115 (E_RNA) where: Base-Base interactions energy: -236.373 where: short stacking energy: -114.495 Base-Backbone interact. energy: -0.574 local terms energy: -133.033061 where: bonds (distance) C4'-P energy: -25.301 bonds (distance) P-C4' energy: -25.146 flat angles C4'-P-C4' energy: -27.392 flat angles P-C4'-P energy: -17.601 tors. eta vs tors. theta energy: -37.593 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -370.415526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.415526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.415526 (E_RNA) where: Base-Base interactions energy: -240.320 where: short stacking energy: -123.770 Base-Backbone interact. energy: -0.085 local terms energy: -130.010624 where: bonds (distance) C4'-P energy: -27.039 bonds (distance) P-C4' energy: -27.229 flat angles C4'-P-C4' energy: -27.087 flat angles P-C4'-P energy: -12.704 tors. eta vs tors. theta energy: -35.952 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -341.051846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.051846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.126540 (E_RNA) where: Base-Base interactions energy: -226.016 where: short stacking energy: -116.796 Base-Backbone interact. energy: -0.356 local terms energy: -114.754834 where: bonds (distance) C4'-P energy: -20.756 bonds (distance) P-C4' energy: -24.062 flat angles C4'-P-C4' energy: -22.499 flat angles P-C4'-P energy: -16.858 tors. eta vs tors. theta energy: -30.579 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -361.490764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.490764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.490764 (E_RNA) where: Base-Base interactions energy: -244.202 where: short stacking energy: -119.803 Base-Backbone interact. energy: 0.351 local terms energy: -117.639579 where: bonds (distance) C4'-P energy: -22.189 bonds (distance) P-C4' energy: -20.784 flat angles C4'-P-C4' energy: -24.648 flat angles P-C4'-P energy: -20.619 tors. eta vs tors. theta energy: -29.400 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -269.437863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.437863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.635423 (E_RNA) where: Base-Base interactions energy: -162.888 where: short stacking energy: -89.583 Base-Backbone interact. energy: -0.254 local terms energy: -106.493730 where: bonds (distance) C4'-P energy: -20.534 bonds (distance) P-C4' energy: -23.373 flat angles C4'-P-C4' energy: -26.052 flat angles P-C4'-P energy: -16.368 tors. eta vs tors. theta energy: -20.167 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -282.681486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.681486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.750210 (E_RNA) where: Base-Base interactions energy: -189.403 where: short stacking energy: -91.253 Base-Backbone interact. energy: -0.406 local terms energy: -92.941791 where: bonds (distance) C4'-P energy: -22.873 bonds (distance) P-C4' energy: -21.979 flat angles C4'-P-C4' energy: -15.802 flat angles P-C4'-P energy: -5.503 tors. eta vs tors. theta energy: -26.785 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -267.976667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.976667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.976667 (E_RNA) where: Base-Base interactions energy: -176.056 where: short stacking energy: -84.433 Base-Backbone interact. energy: -0.493 local terms energy: -91.427146 where: bonds (distance) C4'-P energy: -20.241 bonds (distance) P-C4' energy: -18.417 flat angles C4'-P-C4' energy: -21.568 flat angles P-C4'-P energy: -13.938 tors. eta vs tors. theta energy: -17.262 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -238.679341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.679341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.713053 (E_RNA) where: Base-Base interactions energy: -154.442 where: short stacking energy: -64.676 Base-Backbone interact. energy: 2.659 local terms energy: -86.930203 where: bonds (distance) C4'-P energy: -26.199 bonds (distance) P-C4' energy: -23.199 flat angles C4'-P-C4' energy: -15.113 flat angles P-C4'-P energy: -11.368 tors. eta vs tors. theta energy: -11.052 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -175.312122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.312122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.312122 (E_RNA) where: Base-Base interactions energy: -95.475 where: short stacking energy: -48.005 Base-Backbone interact. energy: 0.443 local terms energy: -80.280628 where: bonds (distance) C4'-P energy: -22.931 bonds (distance) P-C4' energy: -23.444 flat angles C4'-P-C4' energy: -20.149 flat angles P-C4'-P energy: -10.266 tors. eta vs tors. theta energy: -3.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -164.092155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.092155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.224886 (E_RNA) where: Base-Base interactions energy: -82.949 where: short stacking energy: -45.671 Base-Backbone interact. energy: -1.003 local terms energy: -80.272949 where: bonds (distance) C4'-P energy: -20.182 bonds (distance) P-C4' energy: -22.229 flat angles C4'-P-C4' energy: -19.350 flat angles P-C4'-P energy: -12.247 tors. eta vs tors. theta energy: -6.264 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -378.099159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.099159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.115012 (E_RNA) where: Base-Base interactions energy: -240.019 where: short stacking energy: -125.594 Base-Backbone interact. energy: -0.205 local terms energy: -137.891340 where: bonds (distance) C4'-P energy: -25.416 bonds (distance) P-C4' energy: -23.601 flat angles C4'-P-C4' energy: -27.930 flat angles P-C4'-P energy: -21.893 tors. eta vs tors. theta energy: -39.051 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -365.389298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.389298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.389298 (E_RNA) where: Base-Base interactions energy: -242.308 where: short stacking energy: -116.024 Base-Backbone interact. energy: -0.290 local terms energy: -122.791559 where: bonds (distance) C4'-P energy: -21.526 bonds (distance) P-C4' energy: -27.370 flat angles C4'-P-C4' energy: -23.427 flat angles P-C4'-P energy: -15.002 tors. eta vs tors. theta energy: -35.466 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -354.659936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.659936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.659936 (E_RNA) where: Base-Base interactions energy: -238.114 where: short stacking energy: -117.117 Base-Backbone interact. energy: -0.177 local terms energy: -116.369403 where: bonds (distance) C4'-P energy: -20.103 bonds (distance) P-C4' energy: -22.308 flat angles C4'-P-C4' energy: -24.101 flat angles P-C4'-P energy: -19.761 tors. eta vs tors. theta energy: -30.096 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -351.495157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.495157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.495157 (E_RNA) where: Base-Base interactions energy: -229.723 where: short stacking energy: -113.595 Base-Backbone interact. energy: -0.327 local terms energy: -121.445903 where: bonds (distance) C4'-P energy: -19.785 bonds (distance) P-C4' energy: -20.605 flat angles C4'-P-C4' energy: -25.909 flat angles P-C4'-P energy: -20.431 tors. eta vs tors. theta energy: -34.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -309.801176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.801176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.801176 (E_RNA) where: Base-Base interactions energy: -209.067 where: short stacking energy: -98.915 Base-Backbone interact. energy: -0.344 local terms energy: -100.389640 where: bonds (distance) C4'-P energy: -19.141 bonds (distance) P-C4' energy: -22.491 flat angles C4'-P-C4' energy: -23.236 flat angles P-C4'-P energy: -11.479 tors. eta vs tors. theta energy: -24.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -268.618023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.618023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.618023 (E_RNA) where: Base-Base interactions energy: -164.164 where: short stacking energy: -88.477 Base-Backbone interact. energy: -1.615 local terms energy: -102.838188 where: bonds (distance) C4'-P energy: -24.604 bonds (distance) P-C4' energy: -18.073 flat angles C4'-P-C4' energy: -21.509 flat angles P-C4'-P energy: -15.058 tors. eta vs tors. theta energy: -23.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -223.872921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.872921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.884732 (E_RNA) where: Base-Base interactions energy: -131.259 where: short stacking energy: -49.647 Base-Backbone interact. energy: -0.503 local terms energy: -92.123166 where: bonds (distance) C4'-P energy: -23.740 bonds (distance) P-C4' energy: -20.612 flat angles C4'-P-C4' energy: -24.296 flat angles P-C4'-P energy: -19.067 tors. eta vs tors. theta energy: -4.409 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -261.694788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.694788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.730010 (E_RNA) where: Base-Base interactions energy: -159.741 where: short stacking energy: -84.806 Base-Backbone interact. energy: -0.080 local terms energy: -101.909198 where: bonds (distance) C4'-P energy: -23.512 bonds (distance) P-C4' energy: -20.231 flat angles C4'-P-C4' energy: -22.604 flat angles P-C4'-P energy: -18.048 tors. eta vs tors. theta energy: -17.514 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -183.652734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.652734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.652734 (E_RNA) where: Base-Base interactions energy: -106.043 where: short stacking energy: -62.372 Base-Backbone interact. energy: -2.630 local terms energy: -74.980163 where: bonds (distance) C4'-P energy: -26.593 bonds (distance) P-C4' energy: -12.002 flat angles C4'-P-C4' energy: -17.653 flat angles P-C4'-P energy: -5.272 tors. eta vs tors. theta energy: -13.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -187.367127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.367127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.374184 (E_RNA) where: Base-Base interactions energy: -106.110 where: short stacking energy: -61.310 Base-Backbone interact. energy: -0.566 local terms energy: -80.697627 where: bonds (distance) C4'-P energy: -18.932 bonds (distance) P-C4' energy: -24.104 flat angles C4'-P-C4' energy: -14.821 flat angles P-C4'-P energy: -15.990 tors. eta vs tors. theta energy: -6.850 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -375.480571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.480571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.480571 (E_RNA) where: Base-Base interactions energy: -243.321 where: short stacking energy: -111.314 Base-Backbone interact. energy: -1.469 local terms energy: -130.689930 where: bonds (distance) C4'-P energy: -25.764 bonds (distance) P-C4' energy: -26.991 flat angles C4'-P-C4' energy: -23.526 flat angles P-C4'-P energy: -21.439 tors. eta vs tors. theta energy: -32.971 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -369.501617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.501617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.522114 (E_RNA) where: Base-Base interactions energy: -242.588 where: short stacking energy: -111.329 Base-Backbone interact. energy: -0.308 local terms energy: -126.625603 where: bonds (distance) C4'-P energy: -22.534 bonds (distance) P-C4' energy: -22.220 flat angles C4'-P-C4' energy: -27.652 flat angles P-C4'-P energy: -21.678 tors. eta vs tors. theta energy: -32.542 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -339.996436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.996436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.009214 (E_RNA) where: Base-Base interactions energy: -224.637 where: short stacking energy: -107.078 Base-Backbone interact. energy: -0.396 local terms energy: -114.976290 where: bonds (distance) C4'-P energy: -23.373 bonds (distance) P-C4' energy: -24.707 flat angles C4'-P-C4' energy: -20.208 flat angles P-C4'-P energy: -16.253 tors. eta vs tors. theta energy: -30.436 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -333.823152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.823152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.835648 (E_RNA) where: Base-Base interactions energy: -222.469 where: short stacking energy: -111.904 Base-Backbone interact. energy: -0.019 local terms energy: -111.347378 where: bonds (distance) C4'-P energy: -21.563 bonds (distance) P-C4' energy: -19.659 flat angles C4'-P-C4' energy: -25.291 flat angles P-C4'-P energy: -10.649 tors. eta vs tors. theta energy: -34.186 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -329.650130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.650130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.650130 (E_RNA) where: Base-Base interactions energy: -225.161 where: short stacking energy: -98.570 Base-Backbone interact. energy: 0.019 local terms energy: -104.507245 where: bonds (distance) C4'-P energy: -18.300 bonds (distance) P-C4' energy: -21.766 flat angles C4'-P-C4' energy: -21.033 flat angles P-C4'-P energy: -16.447 tors. eta vs tors. theta energy: -26.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -285.542087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.542087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.605981 (E_RNA) where: Base-Base interactions energy: -174.900 where: short stacking energy: -94.432 Base-Backbone interact. energy: -0.420 local terms energy: -110.285986 where: bonds (distance) C4'-P energy: -21.817 bonds (distance) P-C4' energy: -25.299 flat angles C4'-P-C4' energy: -25.728 flat angles P-C4'-P energy: -10.915 tors. eta vs tors. theta energy: -26.527 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -198.540646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.540646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.540646 (E_RNA) where: Base-Base interactions energy: -113.491 where: short stacking energy: -54.140 Base-Backbone interact. energy: -0.417 local terms energy: -84.632548 where: bonds (distance) C4'-P energy: -16.738 bonds (distance) P-C4' energy: -26.417 flat angles C4'-P-C4' energy: -18.359 flat angles P-C4'-P energy: -16.415 tors. eta vs tors. theta energy: -6.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -228.478321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.478321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.478321 (E_RNA) where: Base-Base interactions energy: -131.381 where: short stacking energy: -62.340 Base-Backbone interact. energy: 0.193 local terms energy: -97.289885 where: bonds (distance) C4'-P energy: -24.923 bonds (distance) P-C4' energy: -24.076 flat angles C4'-P-C4' energy: -24.556 flat angles P-C4'-P energy: -12.366 tors. eta vs tors. theta energy: -11.369 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -169.291639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.291639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.489359 (E_RNA) where: Base-Base interactions energy: -99.219 where: short stacking energy: -58.422 Base-Backbone interact. energy: -0.643 local terms energy: -69.626665 where: bonds (distance) C4'-P energy: -7.816 bonds (distance) P-C4' energy: -18.667 flat angles C4'-P-C4' energy: -19.356 flat angles P-C4'-P energy: -9.972 tors. eta vs tors. theta energy: -13.815 Dist. restrs. and SS energy: 0.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -186.142512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.142512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.142512 (E_RNA) where: Base-Base interactions energy: -108.180 where: short stacking energy: -55.487 Base-Backbone interact. energy: -1.870 local terms energy: -76.092156 where: bonds (distance) C4'-P energy: -16.696 bonds (distance) P-C4' energy: -25.188 flat angles C4'-P-C4' energy: -18.205 flat angles P-C4'-P energy: -13.491 tors. eta vs tors. theta energy: -2.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -379.574391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.574391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.574391 (E_RNA) where: Base-Base interactions energy: -249.714 where: short stacking energy: -121.407 Base-Backbone interact. energy: -0.352 local terms energy: -129.507611 where: bonds (distance) C4'-P energy: -26.472 bonds (distance) P-C4' energy: -24.608 flat angles C4'-P-C4' energy: -26.039 flat angles P-C4'-P energy: -15.987 tors. eta vs tors. theta energy: -36.402 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -376.142884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.142884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.222436 (E_RNA) where: Base-Base interactions energy: -255.956 where: short stacking energy: -106.390 Base-Backbone interact. energy: -1.151 local terms energy: -119.115566 where: bonds (distance) C4'-P energy: -25.237 bonds (distance) P-C4' energy: -17.378 flat angles C4'-P-C4' energy: -26.534 flat angles P-C4'-P energy: -17.974 tors. eta vs tors. theta energy: -31.993 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -336.809776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.809776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.809776 (E_RNA) where: Base-Base interactions energy: -225.078 where: short stacking energy: -109.875 Base-Backbone interact. energy: -0.938 local terms energy: -110.793967 where: bonds (distance) C4'-P energy: -22.344 bonds (distance) P-C4' energy: -21.658 flat angles C4'-P-C4' energy: -23.815 flat angles P-C4'-P energy: -16.853 tors. eta vs tors. theta energy: -26.124 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -342.105290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.105290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.121408 (E_RNA) where: Base-Base interactions energy: -216.994 where: short stacking energy: -111.291 Base-Backbone interact. energy: -0.632 local terms energy: -124.495222 where: bonds (distance) C4'-P energy: -20.817 bonds (distance) P-C4' energy: -25.582 flat angles C4'-P-C4' energy: -24.215 flat angles P-C4'-P energy: -19.157 tors. eta vs tors. theta energy: -34.725 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -282.732870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.732870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.828008 (E_RNA) where: Base-Base interactions energy: -167.060 where: short stacking energy: -82.696 Base-Backbone interact. energy: -1.471 local terms energy: -114.296901 where: bonds (distance) C4'-P energy: -25.404 bonds (distance) P-C4' energy: -23.790 flat angles C4'-P-C4' energy: -24.185 flat angles P-C4'-P energy: -11.404 tors. eta vs tors. theta energy: -29.514 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -336.743694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.743694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.743694 (E_RNA) where: Base-Base interactions energy: -222.612 where: short stacking energy: -110.978 Base-Backbone interact. energy: -0.473 local terms energy: -113.659150 where: bonds (distance) C4'-P energy: -20.500 bonds (distance) P-C4' energy: -21.993 flat angles C4'-P-C4' energy: -17.765 flat angles P-C4'-P energy: -16.739 tors. eta vs tors. theta energy: -36.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -239.582890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.582890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.593504 (E_RNA) where: Base-Base interactions energy: -144.123 where: short stacking energy: -73.792 Base-Backbone interact. energy: 0.369 local terms energy: -95.840103 where: bonds (distance) C4'-P energy: -17.849 bonds (distance) P-C4' energy: -24.589 flat angles C4'-P-C4' energy: -19.341 flat angles P-C4'-P energy: -15.954 tors. eta vs tors. theta energy: -18.108 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -230.342854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.342854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.342854 (E_RNA) where: Base-Base interactions energy: -147.157 where: short stacking energy: -75.995 Base-Backbone interact. energy: -0.202 local terms energy: -82.983390 where: bonds (distance) C4'-P energy: -15.703 bonds (distance) P-C4' energy: -19.367 flat angles C4'-P-C4' energy: -23.633 flat angles P-C4'-P energy: -10.029 tors. eta vs tors. theta energy: -14.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -156.878307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.878307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.257921 (E_RNA) where: Base-Base interactions energy: -85.234 where: short stacking energy: -56.969 Base-Backbone interact. energy: -1.506 local terms energy: -70.517630 where: bonds (distance) C4'-P energy: -22.480 bonds (distance) P-C4' energy: -18.637 flat angles C4'-P-C4' energy: -13.588 flat angles P-C4'-P energy: -13.381 tors. eta vs tors. theta energy: -2.432 Dist. restrs. and SS energy: 0.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -160.283346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.283346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.300827 (E_RNA) where: Base-Base interactions energy: -83.415 where: short stacking energy: -55.139 Base-Backbone interact. energy: -1.119 local terms energy: -75.766548 where: bonds (distance) C4'-P energy: -17.156 bonds (distance) P-C4' energy: -21.991 flat angles C4'-P-C4' energy: -18.710 flat angles P-C4'-P energy: -11.391 tors. eta vs tors. theta energy: -6.518 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -374.918343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.918343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.918343 (E_RNA) where: Base-Base interactions energy: -246.591 where: short stacking energy: -115.152 Base-Backbone interact. energy: -1.146 local terms energy: -127.180373 where: bonds (distance) C4'-P energy: -20.691 bonds (distance) P-C4' energy: -23.697 flat angles C4'-P-C4' energy: -24.677 flat angles P-C4'-P energy: -20.125 tors. eta vs tors. theta energy: -37.990 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -367.360858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.360858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.360858 (E_RNA) where: Base-Base interactions energy: -240.083 where: short stacking energy: -111.004 Base-Backbone interact. energy: 0.035 local terms energy: -127.313444 where: bonds (distance) C4'-P energy: -23.718 bonds (distance) P-C4' energy: -27.855 flat angles C4'-P-C4' energy: -23.410 flat angles P-C4'-P energy: -17.382 tors. eta vs tors. theta energy: -34.949 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -336.018102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.018102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.073080 (E_RNA) where: Base-Base interactions energy: -219.254 where: short stacking energy: -99.663 Base-Backbone interact. energy: -0.547 local terms energy: -116.272744 where: bonds (distance) C4'-P energy: -26.011 bonds (distance) P-C4' energy: -24.911 flat angles C4'-P-C4' energy: -22.276 flat angles P-C4'-P energy: -17.345 tors. eta vs tors. theta energy: -25.729 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -286.288926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.288926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.288926 (E_RNA) where: Base-Base interactions energy: -179.009 where: short stacking energy: -99.655 Base-Backbone interact. energy: -0.309 local terms energy: -106.971010 where: bonds (distance) C4'-P energy: -19.685 bonds (distance) P-C4' energy: -25.303 flat angles C4'-P-C4' energy: -16.733 flat angles P-C4'-P energy: -17.294 tors. eta vs tors. theta energy: -27.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -333.801551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.801551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.801551 (E_RNA) where: Base-Base interactions energy: -222.791 where: short stacking energy: -111.630 Base-Backbone interact. energy: -1.093 local terms energy: -109.918156 where: bonds (distance) C4'-P energy: -16.941 bonds (distance) P-C4' energy: -20.857 flat angles C4'-P-C4' energy: -27.129 flat angles P-C4'-P energy: -14.937 tors. eta vs tors. theta energy: -30.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -321.675566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.675566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.675566 (E_RNA) where: Base-Base interactions energy: -206.219 where: short stacking energy: -102.240 Base-Backbone interact. energy: -0.299 local terms energy: -115.157608 where: bonds (distance) C4'-P energy: -21.690 bonds (distance) P-C4' energy: -26.896 flat angles C4'-P-C4' energy: -24.969 flat angles P-C4'-P energy: -11.597 tors. eta vs tors. theta energy: -30.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -254.856846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.856846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.026862 (E_RNA) where: Base-Base interactions energy: -156.734 where: short stacking energy: -93.612 Base-Backbone interact. energy: -1.866 local terms energy: -96.426620 where: bonds (distance) C4'-P energy: -10.797 bonds (distance) P-C4' energy: -24.237 flat angles C4'-P-C4' energy: -22.420 flat angles P-C4'-P energy: -15.075 tors. eta vs tors. theta energy: -23.897 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -220.741465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.741465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.767550 (E_RNA) where: Base-Base interactions energy: -127.045 where: short stacking energy: -71.518 Base-Backbone interact. energy: -1.460 local terms energy: -92.262260 where: bonds (distance) C4'-P energy: -25.108 bonds (distance) P-C4' energy: -19.062 flat angles C4'-P-C4' energy: -19.452 flat angles P-C4'-P energy: -13.984 tors. eta vs tors. theta energy: -14.656 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -223.585437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.585437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.585437 (E_RNA) where: Base-Base interactions energy: -134.103 where: short stacking energy: -62.974 Base-Backbone interact. energy: -1.358 local terms energy: -88.124729 where: bonds (distance) C4'-P energy: -22.138 bonds (distance) P-C4' energy: -22.571 flat angles C4'-P-C4' energy: -18.150 flat angles P-C4'-P energy: -12.621 tors. eta vs tors. theta energy: -12.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -166.415500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.415500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.415500 (E_RNA) where: Base-Base interactions energy: -103.612 where: short stacking energy: -48.632 Base-Backbone interact. energy: -0.699 local terms energy: -62.103777 where: bonds (distance) C4'-P energy: -15.741 bonds (distance) P-C4' energy: -17.976 flat angles C4'-P-C4' energy: -17.666 flat angles P-C4'-P energy: -13.188 tors. eta vs tors. theta energy: 2.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -381.983404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.983404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.994083 (E_RNA) where: Base-Base interactions energy: -253.250 where: short stacking energy: -127.991 Base-Backbone interact. energy: -0.725 local terms energy: -128.018478 where: bonds (distance) C4'-P energy: -21.284 bonds (distance) P-C4' energy: -25.380 flat angles C4'-P-C4' energy: -26.215 flat angles P-C4'-P energy: -21.291 tors. eta vs tors. theta energy: -33.849 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -367.066775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.066775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.084202 (E_RNA) where: Base-Base interactions energy: -240.662 where: short stacking energy: -127.175 Base-Backbone interact. energy: -0.166 local terms energy: -126.256371 where: bonds (distance) C4'-P energy: -17.725 bonds (distance) P-C4' energy: -24.533 flat angles C4'-P-C4' energy: -27.176 flat angles P-C4'-P energy: -22.211 tors. eta vs tors. theta energy: -34.612 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -309.318561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.318561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.343390 (E_RNA) where: Base-Base interactions energy: -194.243 where: short stacking energy: -103.646 Base-Backbone interact. energy: -0.920 local terms energy: -114.180791 where: bonds (distance) C4'-P energy: -23.272 bonds (distance) P-C4' energy: -22.241 flat angles C4'-P-C4' energy: -23.933 flat angles P-C4'-P energy: -17.842 tors. eta vs tors. theta energy: -26.892 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -339.307889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.307889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.338690 (E_RNA) where: Base-Base interactions energy: -229.090 where: short stacking energy: -114.329 Base-Backbone interact. energy: -0.847 local terms energy: -109.401707 where: bonds (distance) C4'-P energy: -24.660 bonds (distance) P-C4' energy: -18.179 flat angles C4'-P-C4' energy: -26.546 flat angles P-C4'-P energy: -11.164 tors. eta vs tors. theta energy: -28.853 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -327.673986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.673986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.673986 (E_RNA) where: Base-Base interactions energy: -211.930 where: short stacking energy: -95.251 Base-Backbone interact. energy: -0.058 local terms energy: -115.686080 where: bonds (distance) C4'-P energy: -21.982 bonds (distance) P-C4' energy: -24.145 flat angles C4'-P-C4' energy: -22.623 flat angles P-C4'-P energy: -16.857 tors. eta vs tors. theta energy: -30.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -293.248059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.248059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.330006 (E_RNA) where: Base-Base interactions energy: -183.863 where: short stacking energy: -107.705 Base-Backbone interact. energy: -0.519 local terms energy: -108.948011 where: bonds (distance) C4'-P energy: -22.512 bonds (distance) P-C4' energy: -14.303 flat angles C4'-P-C4' energy: -27.554 flat angles P-C4'-P energy: -12.623 tors. eta vs tors. theta energy: -31.955 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -263.820458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.820458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.846070 (E_RNA) where: Base-Base interactions energy: -167.459 where: short stacking energy: -86.743 Base-Backbone interact. energy: -0.422 local terms energy: -95.964367 where: bonds (distance) C4'-P energy: -22.402 bonds (distance) P-C4' energy: -16.311 flat angles C4'-P-C4' energy: -21.080 flat angles P-C4'-P energy: -13.914 tors. eta vs tors. theta energy: -22.258 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -229.165775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.165775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.165775 (E_RNA) where: Base-Base interactions energy: -133.995 where: short stacking energy: -66.822 Base-Backbone interact. energy: 1.188 local terms energy: -96.359137 where: bonds (distance) C4'-P energy: -19.143 bonds (distance) P-C4' energy: -27.262 flat angles C4'-P-C4' energy: -26.323 flat angles P-C4'-P energy: -9.892 tors. eta vs tors. theta energy: -13.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -230.230588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.230588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.230588 (E_RNA) where: Base-Base interactions energy: -140.546 where: short stacking energy: -69.049 Base-Backbone interact. energy: -0.491 local terms energy: -89.193823 where: bonds (distance) C4'-P energy: -23.485 bonds (distance) P-C4' energy: -14.652 flat angles C4'-P-C4' energy: -17.514 flat angles P-C4'-P energy: -14.278 tors. eta vs tors. theta energy: -19.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -162.772881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.772881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.772881 (E_RNA) where: Base-Base interactions energy: -82.374 where: short stacking energy: -45.256 Base-Backbone interact. energy: -0.636 local terms energy: -79.762381 where: bonds (distance) C4'-P energy: -18.602 bonds (distance) P-C4' energy: -25.152 flat angles C4'-P-C4' energy: -16.613 flat angles P-C4'-P energy: -11.044 tors. eta vs tors. theta energy: -8.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -368.176952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.176952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.265609 (E_RNA) where: Base-Base interactions energy: -249.343 where: short stacking energy: -122.476 Base-Backbone interact. energy: -1.204 local terms energy: -117.718661 where: bonds (distance) C4'-P energy: -19.409 bonds (distance) P-C4' energy: -23.280 flat angles C4'-P-C4' energy: -27.968 flat angles P-C4'-P energy: -13.360 tors. eta vs tors. theta energy: -33.702 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -356.667153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.667153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.667153 (E_RNA) where: Base-Base interactions energy: -237.220 where: short stacking energy: -119.592 Base-Backbone interact. energy: 0.628 local terms energy: -120.074368 where: bonds (distance) C4'-P energy: -19.513 bonds (distance) P-C4' energy: -19.335 flat angles C4'-P-C4' energy: -27.623 flat angles P-C4'-P energy: -20.413 tors. eta vs tors. theta energy: -33.191 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -303.985579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.985579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.985579 (E_RNA) where: Base-Base interactions energy: -189.718 where: short stacking energy: -104.609 Base-Backbone interact. energy: -0.467 local terms energy: -113.800478 where: bonds (distance) C4'-P energy: -19.571 bonds (distance) P-C4' energy: -26.016 flat angles C4'-P-C4' energy: -26.262 flat angles P-C4'-P energy: -17.641 tors. eta vs tors. theta energy: -24.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -342.373527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.373527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.373527 (E_RNA) where: Base-Base interactions energy: -226.237 where: short stacking energy: -102.230 Base-Backbone interact. energy: -0.417 local terms energy: -115.719767 where: bonds (distance) C4'-P energy: -21.426 bonds (distance) P-C4' energy: -24.391 flat angles C4'-P-C4' energy: -27.433 flat angles P-C4'-P energy: -17.238 tors. eta vs tors. theta energy: -25.232 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -322.532401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.532401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.532401 (E_RNA) where: Base-Base interactions energy: -211.994 where: short stacking energy: -108.266 Base-Backbone interact. energy: -0.529 local terms energy: -110.009175 where: bonds (distance) C4'-P energy: -17.160 bonds (distance) P-C4' energy: -25.689 flat angles C4'-P-C4' energy: -27.146 flat angles P-C4'-P energy: -13.014 tors. eta vs tors. theta energy: -26.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -293.935449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.935449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.935449 (E_RNA) where: Base-Base interactions energy: -187.508 where: short stacking energy: -94.857 Base-Backbone interact. energy: -0.344 local terms energy: -106.083115 where: bonds (distance) C4'-P energy: -25.636 bonds (distance) P-C4' energy: -22.203 flat angles C4'-P-C4' energy: -18.985 flat angles P-C4'-P energy: -18.828 tors. eta vs tors. theta energy: -20.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -269.395145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.395145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.420044 (E_RNA) where: Base-Base interactions energy: -161.078 where: short stacking energy: -80.260 Base-Backbone interact. energy: -0.733 local terms energy: -107.608716 where: bonds (distance) C4'-P energy: -19.905 bonds (distance) P-C4' energy: -24.663 flat angles C4'-P-C4' energy: -24.878 flat angles P-C4'-P energy: -15.175 tors. eta vs tors. theta energy: -22.987 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -274.986943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.986943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.986943 (E_RNA) where: Base-Base interactions energy: -174.026 where: short stacking energy: -85.417 Base-Backbone interact. energy: -1.336 local terms energy: -99.624271 where: bonds (distance) C4'-P energy: -15.814 bonds (distance) P-C4' energy: -18.932 flat angles C4'-P-C4' energy: -26.034 flat angles P-C4'-P energy: -16.202 tors. eta vs tors. theta energy: -22.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -209.326479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.326479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.326479 (E_RNA) where: Base-Base interactions energy: -137.951 where: short stacking energy: -71.562 Base-Backbone interact. energy: 0.765 local terms energy: -72.140000 where: bonds (distance) C4'-P energy: -16.936 bonds (distance) P-C4' energy: -14.884 flat angles C4'-P-C4' energy: -22.087 flat angles P-C4'-P energy: -10.892 tors. eta vs tors. theta energy: -7.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -158.390724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.390724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.470783 (E_RNA) where: Base-Base interactions energy: -92.753 where: short stacking energy: -60.402 Base-Backbone interact. energy: 1.138 local terms energy: -66.855176 where: bonds (distance) C4'-P energy: -19.420 bonds (distance) P-C4' energy: -13.013 flat angles C4'-P-C4' energy: -13.418 flat angles P-C4'-P energy: -10.020 tors. eta vs tors. theta energy: -10.984 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -363.260222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.260222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.281199 (E_RNA) where: Base-Base interactions energy: -242.593 where: short stacking energy: -115.365 Base-Backbone interact. energy: -0.316 local terms energy: -120.372588 where: bonds (distance) C4'-P energy: -20.620 bonds (distance) P-C4' energy: -25.383 flat angles C4'-P-C4' energy: -25.577 flat angles P-C4'-P energy: -14.922 tors. eta vs tors. theta energy: -33.869 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -373.699341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.699341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.699341 (E_RNA) where: Base-Base interactions energy: -249.200 where: short stacking energy: -121.182 Base-Backbone interact. energy: -0.469 local terms energy: -124.030597 where: bonds (distance) C4'-P energy: -22.970 bonds (distance) P-C4' energy: -22.574 flat angles C4'-P-C4' energy: -27.838 flat angles P-C4'-P energy: -19.476 tors. eta vs tors. theta energy: -31.173 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -360.812416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.812416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.812416 (E_RNA) where: Base-Base interactions energy: -237.054 where: short stacking energy: -121.514 Base-Backbone interact. energy: -0.816 local terms energy: -122.942698 where: bonds (distance) C4'-P energy: -24.386 bonds (distance) P-C4' energy: -22.818 flat angles C4'-P-C4' energy: -25.580 flat angles P-C4'-P energy: -16.444 tors. eta vs tors. theta energy: -33.714 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -296.837460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.837460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.837460 (E_RNA) where: Base-Base interactions energy: -175.571 where: short stacking energy: -95.908 Base-Backbone interact. energy: -0.037 local terms energy: -121.229034 where: bonds (distance) C4'-P energy: -23.855 bonds (distance) P-C4' energy: -23.992 flat angles C4'-P-C4' energy: -27.857 flat angles P-C4'-P energy: -16.290 tors. eta vs tors. theta energy: -29.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -328.645470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.645470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.708289 (E_RNA) where: Base-Base interactions energy: -214.389 where: short stacking energy: -110.315 Base-Backbone interact. energy: -0.106 local terms energy: -114.213147 where: bonds (distance) C4'-P energy: -19.523 bonds (distance) P-C4' energy: -23.725 flat angles C4'-P-C4' energy: -23.102 flat angles P-C4'-P energy: -17.679 tors. eta vs tors. theta energy: -30.184 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -317.546452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.546452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.563718 (E_RNA) where: Base-Base interactions energy: -201.967 where: short stacking energy: -93.329 Base-Backbone interact. energy: -1.674 local terms energy: -113.922858 where: bonds (distance) C4'-P energy: -20.204 bonds (distance) P-C4' energy: -24.141 flat angles C4'-P-C4' energy: -23.458 flat angles P-C4'-P energy: -18.368 tors. eta vs tors. theta energy: -27.752 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -284.911089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.911089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.091775 (E_RNA) where: Base-Base interactions energy: -181.735 where: short stacking energy: -79.978 Base-Backbone interact. energy: -1.044 local terms energy: -102.312928 where: bonds (distance) C4'-P energy: -26.136 bonds (distance) P-C4' energy: -22.911 flat angles C4'-P-C4' energy: -20.028 flat angles P-C4'-P energy: -17.077 tors. eta vs tors. theta energy: -16.162 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -280.182803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.182803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.182803 (E_RNA) where: Base-Base interactions energy: -185.211 where: short stacking energy: -90.569 Base-Backbone interact. energy: 2.676 local terms energy: -97.648128 where: bonds (distance) C4'-P energy: -19.287 bonds (distance) P-C4' energy: -21.821 flat angles C4'-P-C4' energy: -26.205 flat angles P-C4'-P energy: -5.188 tors. eta vs tors. theta energy: -25.148 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -209.449910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.449910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.449910 (E_RNA) where: Base-Base interactions energy: -136.206 where: short stacking energy: -64.688 Base-Backbone interact. energy: -0.261 local terms energy: -72.982106 where: bonds (distance) C4'-P energy: -10.312 bonds (distance) P-C4' energy: -21.043 flat angles C4'-P-C4' energy: -24.001 flat angles P-C4'-P energy: -7.175 tors. eta vs tors. theta energy: -10.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -141.577930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.577930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.614747 (E_RNA) where: Base-Base interactions energy: -72.302 where: short stacking energy: -48.215 Base-Backbone interact. energy: 0.197 local terms energy: -69.509213 where: bonds (distance) C4'-P energy: -22.816 bonds (distance) P-C4' energy: -17.303 flat angles C4'-P-C4' energy: -21.851 flat angles P-C4'-P energy: -6.495 tors. eta vs tors. theta energy: -1.044 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -382.737636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.737636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.737636 (E_RNA) where: Base-Base interactions energy: -258.331 where: short stacking energy: -126.742 Base-Backbone interact. energy: 0.155 local terms energy: -124.561537 where: bonds (distance) C4'-P energy: -20.072 bonds (distance) P-C4' energy: -24.880 flat angles C4'-P-C4' energy: -26.545 flat angles P-C4'-P energy: -19.523 tors. eta vs tors. theta energy: -33.541 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -370.469172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.469172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.492615 (E_RNA) where: Base-Base interactions energy: -246.570 where: short stacking energy: -124.252 Base-Backbone interact. energy: 0.236 local terms energy: -124.157848 where: bonds (distance) C4'-P energy: -18.142 bonds (distance) P-C4' energy: -24.469 flat angles C4'-P-C4' energy: -23.879 flat angles P-C4'-P energy: -18.407 tors. eta vs tors. theta energy: -39.261 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -362.606924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.606924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.644392 (E_RNA) where: Base-Base interactions energy: -235.412 where: short stacking energy: -115.350 Base-Backbone interact. energy: -0.072 local terms energy: -127.160579 where: bonds (distance) C4'-P energy: -22.134 bonds (distance) P-C4' energy: -22.757 flat angles C4'-P-C4' energy: -27.589 flat angles P-C4'-P energy: -18.143 tors. eta vs tors. theta energy: -36.536 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -329.482109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.482109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.482109 (E_RNA) where: Base-Base interactions energy: -217.731 where: short stacking energy: -101.213 Base-Backbone interact. energy: -0.108 local terms energy: -111.642912 where: bonds (distance) C4'-P energy: -25.897 bonds (distance) P-C4' energy: -20.092 flat angles C4'-P-C4' energy: -22.790 flat angles P-C4'-P energy: -10.061 tors. eta vs tors. theta energy: -32.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -301.246354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.246354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.383309 (E_RNA) where: Base-Base interactions energy: -191.437 where: short stacking energy: -97.870 Base-Backbone interact. energy: -0.654 local terms energy: -109.291772 where: bonds (distance) C4'-P energy: -21.581 bonds (distance) P-C4' energy: -23.460 flat angles C4'-P-C4' energy: -20.740 flat angles P-C4'-P energy: -17.728 tors. eta vs tors. theta energy: -25.782 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -287.945763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.945763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.945763 (E_RNA) where: Base-Base interactions energy: -178.354 where: short stacking energy: -87.760 Base-Backbone interact. energy: -0.067 local terms energy: -109.524494 where: bonds (distance) C4'-P energy: -26.061 bonds (distance) P-C4' energy: -24.723 flat angles C4'-P-C4' energy: -25.431 flat angles P-C4'-P energy: -16.543 tors. eta vs tors. theta energy: -16.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -306.467211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.467211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.497818 (E_RNA) where: Base-Base interactions energy: -198.391 where: short stacking energy: -94.962 Base-Backbone interact. energy: -0.947 local terms energy: -107.159847 where: bonds (distance) C4'-P energy: -14.274 bonds (distance) P-C4' energy: -25.335 flat angles C4'-P-C4' energy: -21.036 flat angles P-C4'-P energy: -17.746 tors. eta vs tors. theta energy: -28.768 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -276.729692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.729692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.764488 (E_RNA) where: Base-Base interactions energy: -181.827 where: short stacking energy: -80.846 Base-Backbone interact. energy: 1.102 local terms energy: -96.040061 where: bonds (distance) C4'-P energy: -17.363 bonds (distance) P-C4' energy: -20.933 flat angles C4'-P-C4' energy: -21.061 flat angles P-C4'-P energy: -16.108 tors. eta vs tors. theta energy: -20.576 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -191.333977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.333977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.333977 (E_RNA) where: Base-Base interactions energy: -100.529 where: short stacking energy: -64.695 Base-Backbone interact. energy: -0.170 local terms energy: -90.634838 where: bonds (distance) C4'-P energy: -17.438 bonds (distance) P-C4' energy: -23.652 flat angles C4'-P-C4' energy: -24.143 flat angles P-C4'-P energy: -12.140 tors. eta vs tors. theta energy: -13.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -136.469830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.469830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.777188 (E_RNA) where: Base-Base interactions energy: -60.279 where: short stacking energy: -47.280 Base-Backbone interact. energy: 0.554 local terms energy: -80.052257 where: bonds (distance) C4'-P energy: -22.119 bonds (distance) P-C4' energy: -24.903 flat angles C4'-P-C4' energy: -22.252 flat angles P-C4'-P energy: -10.722 tors. eta vs tors. theta energy: -0.057 Dist. restrs. and SS energy: 3.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -380.889949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.889949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.889949 (E_RNA) where: Base-Base interactions energy: -257.556 where: short stacking energy: -128.479 Base-Backbone interact. energy: -0.010 local terms energy: -123.324390 where: bonds (distance) C4'-P energy: -18.890 bonds (distance) P-C4' energy: -23.144 flat angles C4'-P-C4' energy: -27.883 flat angles P-C4'-P energy: -14.934 tors. eta vs tors. theta energy: -38.473 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 108 Temperature: 0.950000 Total energy: -369.437276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.437276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.437276 (E_RNA) where: Base-Base interactions energy: -247.841 where: short stacking energy: -129.151 Base-Backbone interact. energy: -1.059 local terms energy: -120.536804 where: bonds (distance) C4'-P energy: -20.020 bonds (distance) P-C4' energy: -22.859 flat angles C4'-P-C4' energy: -25.529 flat angles P-C4'-P energy: -16.376 tors. eta vs tors. theta energy: -35.753 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 108 Temperature: 1.000000 Total energy: -369.248131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.248131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.481268 (E_RNA) where: Base-Base interactions energy: -240.348 where: short stacking energy: -123.153 Base-Backbone interact. energy: -0.145 local terms energy: -128.988179 where: bonds (distance) C4'-P energy: -20.005 bonds (distance) P-C4' energy: -27.664 flat angles C4'-P-C4' energy: -25.274 flat angles P-C4'-P energy: -19.701 tors. eta vs tors. theta energy: -36.345 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 108 Temperature: 1.050000 Total energy: -350.921623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.921623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.995259 (E_RNA) where: Base-Base interactions energy: -228.772 where: short stacking energy: -116.005 Base-Backbone interact. energy: -0.291 local terms energy: -121.931854 where: bonds (distance) C4'-P energy: -21.942 bonds (distance) P-C4' energy: -23.723 flat angles C4'-P-C4' energy: -24.462 flat angles P-C4'-P energy: -15.732 tors. eta vs tors. theta energy: -36.073 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 108 Temperature: 1.100000 Total energy: -271.615657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.615657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.620535 (E_RNA) where: Base-Base interactions energy: -173.604 where: short stacking energy: -94.621 Base-Backbone interact. energy: -0.190 local terms energy: -97.826840 where: bonds (distance) C4'-P energy: -21.879 bonds (distance) P-C4' energy: -22.587 flat angles C4'-P-C4' energy: -19.449 flat angles P-C4'-P energy: -12.718 tors. eta vs tors. theta energy: -21.194 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 108 Temperature: 1.150000 Total energy: -301.168835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.168835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.183393 (E_RNA) where: Base-Base interactions energy: -192.442 where: short stacking energy: -97.863 Base-Backbone interact. energy: -0.704 local terms energy: -108.036901 where: bonds (distance) C4'-P energy: -20.582 bonds (distance) P-C4' energy: -20.469 flat angles C4'-P-C4' energy: -21.347 flat angles P-C4'-P energy: -17.746 tors. eta vs tors. theta energy: -27.893 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 108 Temperature: 1.200000 Total energy: -298.606004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.606004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.606004 (E_RNA) where: Base-Base interactions energy: -182.946 where: short stacking energy: -93.186 Base-Backbone interact. energy: -0.068 local terms energy: -115.592297 where: bonds (distance) C4'-P energy: -23.292 bonds (distance) P-C4' energy: -22.176 flat angles C4'-P-C4' energy: -24.275 flat angles P-C4'-P energy: -18.012 tors. eta vs tors. theta energy: -27.837 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 108 Temperature: 1.250000 Total energy: -264.917897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.917897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.917897 (E_RNA) where: Base-Base interactions energy: -169.143 where: short stacking energy: -86.503 Base-Backbone interact. energy: -0.477 local terms energy: -95.297214 where: bonds (distance) C4'-P energy: -18.639 bonds (distance) P-C4' energy: -22.237 flat angles C4'-P-C4' energy: -21.529 flat angles P-C4'-P energy: -14.020 tors. eta vs tors. theta energy: -18.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 108 Temperature: 1.300000 Total energy: -160.419779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.419779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.548185 (E_RNA) where: Base-Base interactions energy: -82.063 where: short stacking energy: -46.000 Base-Backbone interact. energy: -0.314 local terms energy: -78.170935 where: bonds (distance) C4'-P energy: -21.598 bonds (distance) P-C4' energy: -21.113 flat angles C4'-P-C4' energy: -25.200 flat angles P-C4'-P energy: -10.404 tors. eta vs tors. theta energy: 0.143 Dist. restrs. and SS energy: 0.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -158.109473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.109473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.128378 (E_RNA) where: Base-Base interactions energy: -82.022 where: short stacking energy: -41.845 Base-Backbone interact. energy: 0.845 local terms energy: -76.951976 where: bonds (distance) C4'-P energy: -21.409 bonds (distance) P-C4' energy: -22.165 flat angles C4'-P-C4' energy: -15.489 flat angles P-C4'-P energy: -13.979 tors. eta vs tors. theta energy: -3.909 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 109 Temperature: 0.900000 Total energy: -388.447913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.447913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.454550 (E_RNA) where: Base-Base interactions energy: -259.153 where: short stacking energy: -129.352 Base-Backbone interact. energy: -0.034 local terms energy: -129.267127 where: bonds (distance) C4'-P energy: -22.529 bonds (distance) P-C4' energy: -21.991 flat angles C4'-P-C4' energy: -26.491 flat angles P-C4'-P energy: -18.816 tors. eta vs tors. theta energy: -39.439 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 109 Temperature: 0.950000 Total energy: -373.061444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.061444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.063491 (E_RNA) where: Base-Base interactions energy: -252.969 where: short stacking energy: -118.278 Base-Backbone interact. energy: -0.585 local terms energy: -119.509287 where: bonds (distance) C4'-P energy: -25.862 bonds (distance) P-C4' energy: -14.700 flat angles C4'-P-C4' energy: -27.296 flat angles P-C4'-P energy: -16.055 tors. eta vs tors. theta energy: -35.596 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 109 Temperature: 1.000000 Total energy: -357.313831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.313831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.313831 (E_RNA) where: Base-Base interactions energy: -235.396 where: short stacking energy: -113.557 Base-Backbone interact. energy: -0.237 local terms energy: -121.680449 where: bonds (distance) C4'-P energy: -22.277 bonds (distance) P-C4' energy: -24.660 flat angles C4'-P-C4' energy: -25.714 flat angles P-C4'-P energy: -15.302 tors. eta vs tors. theta energy: -33.727 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 109 Temperature: 1.050000 Total energy: -349.115839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.115839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.115839 (E_RNA) where: Base-Base interactions energy: -225.016 where: short stacking energy: -112.853 Base-Backbone interact. energy: -1.458 local terms energy: -122.641917 where: bonds (distance) C4'-P energy: -21.527 bonds (distance) P-C4' energy: -22.224 flat angles C4'-P-C4' energy: -28.705 flat angles P-C4'-P energy: -16.559 tors. eta vs tors. theta energy: -33.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 109 Temperature: 1.100000 Total energy: -257.450243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.450243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.450243 (E_RNA) where: Base-Base interactions energy: -158.126 where: short stacking energy: -81.249 Base-Backbone interact. energy: -0.311 local terms energy: -99.013526 where: bonds (distance) C4'-P energy: -25.309 bonds (distance) P-C4' energy: -16.439 flat angles C4'-P-C4' energy: -18.680 flat angles P-C4'-P energy: -19.427 tors. eta vs tors. theta energy: -19.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 109 Temperature: 1.150000 Total energy: -332.768475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.768475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.768475 (E_RNA) where: Base-Base interactions energy: -226.828 where: short stacking energy: -105.543 Base-Backbone interact. energy: -1.605 local terms energy: -104.335616 where: bonds (distance) C4'-P energy: -14.308 bonds (distance) P-C4' energy: -28.661 flat angles C4'-P-C4' energy: -24.804 flat angles P-C4'-P energy: -9.993 tors. eta vs tors. theta energy: -26.570 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 109 Temperature: 1.200000 Total energy: -300.675995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.675995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.678629 (E_RNA) where: Base-Base interactions energy: -183.719 where: short stacking energy: -98.773 Base-Backbone interact. energy: -0.507 local terms energy: -116.453387 where: bonds (distance) C4'-P energy: -22.473 bonds (distance) P-C4' energy: -25.043 flat angles C4'-P-C4' energy: -21.995 flat angles P-C4'-P energy: -21.244 tors. eta vs tors. theta energy: -25.700 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 109 Temperature: 1.250000 Total energy: -184.926697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.926697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.027200 (E_RNA) where: Base-Base interactions energy: -104.280 where: short stacking energy: -67.409 Base-Backbone interact. energy: -1.072 local terms energy: -79.675078 where: bonds (distance) C4'-P energy: -19.000 bonds (distance) P-C4' energy: -13.811 flat angles C4'-P-C4' energy: -21.427 flat angles P-C4'-P energy: -12.357 tors. eta vs tors. theta energy: -13.081 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 109 Temperature: 1.300000 Total energy: -254.959537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.959537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.140703 (E_RNA) where: Base-Base interactions energy: -162.451 where: short stacking energy: -74.473 Base-Backbone interact. energy: -0.384 local terms energy: -92.305520 where: bonds (distance) C4'-P energy: -22.095 bonds (distance) P-C4' energy: -22.825 flat angles C4'-P-C4' energy: -22.088 flat angles P-C4'-P energy: -9.609 tors. eta vs tors. theta energy: -15.688 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 109 Temperature: 1.350000 Total energy: -143.009633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.009633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.064701 (E_RNA) where: Base-Base interactions energy: -73.528 where: short stacking energy: -45.573 Base-Backbone interact. energy: -0.302 local terms energy: -69.234070 where: bonds (distance) C4'-P energy: -13.174 bonds (distance) P-C4' energy: -24.016 flat angles C4'-P-C4' energy: -22.152 flat angles P-C4'-P energy: -10.064 tors. eta vs tors. theta energy: 0.172 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 110 Temperature: 0.900000 Total energy: -386.660005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.660005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.660005 (E_RNA) where: Base-Base interactions energy: -254.673 where: short stacking energy: -118.678 Base-Backbone interact. energy: -0.611 local terms energy: -131.376438 where: bonds (distance) C4'-P energy: -23.123 bonds (distance) P-C4' energy: -24.070 flat angles C4'-P-C4' energy: -26.504 flat angles P-C4'-P energy: -20.421 tors. eta vs tors. theta energy: -37.259 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 110 Temperature: 0.950000 Total energy: -373.887865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.887865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.887865 (E_RNA) where: Base-Base interactions energy: -250.570 where: short stacking energy: -124.782 Base-Backbone interact. energy: -1.497 local terms energy: -121.820050 where: bonds (distance) C4'-P energy: -26.655 bonds (distance) P-C4' energy: -24.097 flat angles C4'-P-C4' energy: -21.038 flat angles P-C4'-P energy: -16.866 tors. eta vs tors. theta energy: -33.165 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 110 Temperature: 1.000000 Total energy: -345.027474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.027474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.028216 (E_RNA) where: Base-Base interactions energy: -229.604 where: short stacking energy: -110.137 Base-Backbone interact. energy: -0.219 local terms energy: -115.205196 where: bonds (distance) C4'-P energy: -18.909 bonds (distance) P-C4' energy: -27.886 flat angles C4'-P-C4' energy: -22.350 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -29.395 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 110 Temperature: 1.050000 Total energy: -343.895207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.895207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.896369 (E_RNA) where: Base-Base interactions energy: -226.650 where: short stacking energy: -111.465 Base-Backbone interact. energy: 1.092 local terms energy: -118.338279 where: bonds (distance) C4'-P energy: -22.173 bonds (distance) P-C4' energy: -18.966 flat angles C4'-P-C4' energy: -27.619 flat angles P-C4'-P energy: -17.803 tors. eta vs tors. theta energy: -31.777 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 110 Temperature: 1.100000 Total energy: -345.555784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.555784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.555784 (E_RNA) where: Base-Base interactions energy: -229.610 where: short stacking energy: -110.511 Base-Backbone interact. energy: 0.537 local terms energy: -116.482443 where: bonds (distance) C4'-P energy: -20.543 bonds (distance) P-C4' energy: -24.499 flat angles C4'-P-C4' energy: -27.156 flat angles P-C4'-P energy: -13.323 tors. eta vs tors. theta energy: -30.962 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 110 Temperature: 1.150000 Total energy: -263.675082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.675082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.781685 (E_RNA) where: Base-Base interactions energy: -162.338 where: short stacking energy: -84.853 Base-Backbone interact. energy: -0.321 local terms energy: -101.122926 where: bonds (distance) C4'-P energy: -22.405 bonds (distance) P-C4' energy: -23.291 flat angles C4'-P-C4' energy: -17.168 flat angles P-C4'-P energy: -18.397 tors. eta vs tors. theta energy: -19.862 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 110 Temperature: 1.200000 Total energy: -253.558065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.558065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.558065 (E_RNA) where: Base-Base interactions energy: -170.934 where: short stacking energy: -78.556 Base-Backbone interact. energy: -0.468 local terms energy: -82.155211 where: bonds (distance) C4'-P energy: -17.923 bonds (distance) P-C4' energy: -17.002 flat angles C4'-P-C4' energy: -20.556 flat angles P-C4'-P energy: -10.200 tors. eta vs tors. theta energy: -16.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 110 Temperature: 1.250000 Total energy: -185.485598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.485598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.485598 (E_RNA) where: Base-Base interactions energy: -101.787 where: short stacking energy: -55.427 Base-Backbone interact. energy: -0.995 local terms energy: -82.703549 where: bonds (distance) C4'-P energy: -19.095 bonds (distance) P-C4' energy: -20.779 flat angles C4'-P-C4' energy: -19.156 flat angles P-C4'-P energy: -14.108 tors. eta vs tors. theta energy: -9.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 110 Temperature: 1.300000 Total energy: -215.299348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.299348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.523126 (E_RNA) where: Base-Base interactions energy: -128.425 where: short stacking energy: -62.742 Base-Backbone interact. energy: 0.764 local terms energy: -87.862422 where: bonds (distance) C4'-P energy: -17.153 bonds (distance) P-C4' energy: -18.087 flat angles C4'-P-C4' energy: -21.123 flat angles P-C4'-P energy: -15.329 tors. eta vs tors. theta energy: -16.171 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 110 Temperature: 1.350000 Total energy: -157.693024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.693024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.991741 (E_RNA) where: Base-Base interactions energy: -78.427 where: short stacking energy: -40.631 Base-Backbone interact. energy: 2.376 local terms energy: -81.941412 where: bonds (distance) C4'-P energy: -23.388 bonds (distance) P-C4' energy: -18.671 flat angles C4'-P-C4' energy: -19.886 flat angles P-C4'-P energy: -19.006 tors. eta vs tors. theta energy: -0.991 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 111 Temperature: 0.900000 Total energy: -386.966073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.966073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.969249 (E_RNA) where: Base-Base interactions energy: -264.630 where: short stacking energy: -124.501 Base-Backbone interact. energy: -1.002 local terms energy: -121.338074 where: bonds (distance) C4'-P energy: -26.173 bonds (distance) P-C4' energy: -24.915 flat angles C4'-P-C4' energy: -22.121 flat angles P-C4'-P energy: -16.232 tors. eta vs tors. theta energy: -31.897 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 111 Temperature: 0.950000 Total energy: -350.144432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.144432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.243632 (E_RNA) where: Base-Base interactions energy: -226.557 where: short stacking energy: -113.099 Base-Backbone interact. energy: -0.735 local terms energy: -122.951390 where: bonds (distance) C4'-P energy: -23.720 bonds (distance) P-C4' energy: -27.434 flat angles C4'-P-C4' energy: -24.284 flat angles P-C4'-P energy: -17.487 tors. eta vs tors. theta energy: -30.026 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 111 Temperature: 1.000000 Total energy: -356.046341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.046341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.094558 (E_RNA) where: Base-Base interactions energy: -236.034 where: short stacking energy: -114.060 Base-Backbone interact. energy: 0.685 local terms energy: -120.745686 where: bonds (distance) C4'-P energy: -19.879 bonds (distance) P-C4' energy: -25.240 flat angles C4'-P-C4' energy: -25.426 flat angles P-C4'-P energy: -17.862 tors. eta vs tors. theta energy: -32.338 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 111 Temperature: 1.050000 Total energy: -352.209489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.209489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.330002 (E_RNA) where: Base-Base interactions energy: -239.303 where: short stacking energy: -121.989 Base-Backbone interact. energy: -0.071 local terms energy: -112.955706 where: bonds (distance) C4'-P energy: -23.607 bonds (distance) P-C4' energy: -23.280 flat angles C4'-P-C4' energy: -21.863 flat angles P-C4'-P energy: -13.931 tors. eta vs tors. theta energy: -30.274 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 111 Temperature: 1.100000 Total energy: -339.555667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.555667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.555667 (E_RNA) where: Base-Base interactions energy: -219.325 where: short stacking energy: -97.215 Base-Backbone interact. energy: -0.308 local terms energy: -119.922038 where: bonds (distance) C4'-P energy: -27.013 bonds (distance) P-C4' energy: -14.675 flat angles C4'-P-C4' energy: -27.456 flat angles P-C4'-P energy: -20.550 tors. eta vs tors. theta energy: -30.227 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 111 Temperature: 1.150000 Total energy: -281.075045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.075045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.090159 (E_RNA) where: Base-Base interactions energy: -170.904 where: short stacking energy: -84.302 Base-Backbone interact. energy: -0.298 local terms energy: -109.888544 where: bonds (distance) C4'-P energy: -22.745 bonds (distance) P-C4' energy: -28.118 flat angles C4'-P-C4' energy: -23.659 flat angles P-C4'-P energy: -16.297 tors. eta vs tors. theta energy: -19.069 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 111 Temperature: 1.200000 Total energy: -253.073089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.073089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.079937 (E_RNA) where: Base-Base interactions energy: -160.256 where: short stacking energy: -84.781 Base-Backbone interact. energy: -0.116 local terms energy: -92.707727 where: bonds (distance) C4'-P energy: -16.877 bonds (distance) P-C4' energy: -24.183 flat angles C4'-P-C4' energy: -21.035 flat angles P-C4'-P energy: -11.689 tors. eta vs tors. theta energy: -18.923 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 111 Temperature: 1.250000 Total energy: -214.779749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.779749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.779749 (E_RNA) where: Base-Base interactions energy: -126.577 where: short stacking energy: -62.948 Base-Backbone interact. energy: -0.445 local terms energy: -87.757542 where: bonds (distance) C4'-P energy: -16.229 bonds (distance) P-C4' energy: -17.882 flat angles C4'-P-C4' energy: -23.005 flat angles P-C4'-P energy: -16.678 tors. eta vs tors. theta energy: -13.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 111 Temperature: 1.300000 Total energy: -161.352312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.352312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.377178 (E_RNA) where: Base-Base interactions energy: -93.632 where: short stacking energy: -59.360 Base-Backbone interact. energy: -0.257 local terms energy: -67.487904 where: bonds (distance) C4'-P energy: -17.538 bonds (distance) P-C4' energy: -20.773 flat angles C4'-P-C4' energy: -18.813 flat angles P-C4'-P energy: -5.180 tors. eta vs tors. theta energy: -5.184 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 111 Temperature: 1.350000 Total energy: -137.930945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.930945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.017124 (E_RNA) where: Base-Base interactions energy: -72.640 where: short stacking energy: -45.148 Base-Backbone interact. energy: -0.456 local terms energy: -64.921677 where: bonds (distance) C4'-P energy: -16.478 bonds (distance) P-C4' energy: -23.206 flat angles C4'-P-C4' energy: -14.866 flat angles P-C4'-P energy: -16.149 tors. eta vs tors. theta energy: 5.777 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 112 Temperature: 0.900000 Total energy: -367.392173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.392173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.422683 (E_RNA) where: Base-Base interactions energy: -239.546 where: short stacking energy: -119.136 Base-Backbone interact. energy: -0.583 local terms energy: -127.293987 where: bonds (distance) C4'-P energy: -27.379 bonds (distance) P-C4' energy: -25.696 flat angles C4'-P-C4' energy: -21.275 flat angles P-C4'-P energy: -20.469 tors. eta vs tors. theta energy: -32.475 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 112 Temperature: 0.950000 Total energy: -350.685911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.685911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.685911 (E_RNA) where: Base-Base interactions energy: -233.940 where: short stacking energy: -113.103 Base-Backbone interact. energy: -0.828 local terms energy: -115.917351 where: bonds (distance) C4'-P energy: -21.716 bonds (distance) P-C4' energy: -23.745 flat angles C4'-P-C4' energy: -21.285 flat angles P-C4'-P energy: -16.008 tors. eta vs tors. theta energy: -33.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 112 Temperature: 1.000000 Total energy: -357.088761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.088761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.106049 (E_RNA) where: Base-Base interactions energy: -226.599 where: short stacking energy: -106.478 Base-Backbone interact. energy: -0.903 local terms energy: -129.604418 where: bonds (distance) C4'-P energy: -27.833 bonds (distance) P-C4' energy: -22.370 flat angles C4'-P-C4' energy: -27.358 flat angles P-C4'-P energy: -15.788 tors. eta vs tors. theta energy: -36.254 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 112 Temperature: 1.050000 Total energy: -350.636561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.636561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.636561 (E_RNA) where: Base-Base interactions energy: -230.230 where: short stacking energy: -115.712 Base-Backbone interact. energy: -0.630 local terms energy: -119.776191 where: bonds (distance) C4'-P energy: -26.294 bonds (distance) P-C4' energy: -20.794 flat angles C4'-P-C4' energy: -22.143 flat angles P-C4'-P energy: -17.048 tors. eta vs tors. theta energy: -33.497 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 112 Temperature: 1.100000 Total energy: -294.799501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.799501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.799501 (E_RNA) where: Base-Base interactions energy: -191.072 where: short stacking energy: -92.096 Base-Backbone interact. energy: -0.496 local terms energy: -103.231280 where: bonds (distance) C4'-P energy: -21.801 bonds (distance) P-C4' energy: -21.392 flat angles C4'-P-C4' energy: -22.496 flat angles P-C4'-P energy: -15.783 tors. eta vs tors. theta energy: -21.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 112 Temperature: 1.150000 Total energy: -344.540526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.540526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.540526 (E_RNA) where: Base-Base interactions energy: -233.784 where: short stacking energy: -119.799 Base-Backbone interact. energy: -0.603 local terms energy: -110.153588 where: bonds (distance) C4'-P energy: -23.383 bonds (distance) P-C4' energy: -19.471 flat angles C4'-P-C4' energy: -23.306 flat angles P-C4'-P energy: -17.574 tors. eta vs tors. theta energy: -26.419 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 112 Temperature: 1.200000 Total energy: -260.663729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.663729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.720045 (E_RNA) where: Base-Base interactions energy: -163.924 where: short stacking energy: -75.049 Base-Backbone interact. energy: 0.414 local terms energy: -97.210198 where: bonds (distance) C4'-P energy: -22.023 bonds (distance) P-C4' energy: -16.219 flat angles C4'-P-C4' energy: -20.685 flat angles P-C4'-P energy: -21.796 tors. eta vs tors. theta energy: -16.487 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 112 Temperature: 1.250000 Total energy: -251.131337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.131337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.349843 (E_RNA) where: Base-Base interactions energy: -166.907 where: short stacking energy: -79.842 Base-Backbone interact. energy: 10.519 local terms energy: -94.961698 where: bonds (distance) C4'-P energy: -16.017 bonds (distance) P-C4' energy: -27.484 flat angles C4'-P-C4' energy: -26.004 flat angles P-C4'-P energy: -6.697 tors. eta vs tors. theta energy: -18.760 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 112 Temperature: 1.300000 Total energy: -138.477482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.477482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.279763 (E_RNA) where: Base-Base interactions energy: -64.556 where: short stacking energy: -44.741 Base-Backbone interact. energy: 0.604 local terms energy: -76.327864 where: bonds (distance) C4'-P energy: -22.550 bonds (distance) P-C4' energy: -18.736 flat angles C4'-P-C4' energy: -12.961 flat angles P-C4'-P energy: -14.838 tors. eta vs tors. theta energy: -7.243 Dist. restrs. and SS energy: 1.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 112 Temperature: 1.350000 Total energy: -153.255144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.255144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.255144 (E_RNA) where: Base-Base interactions energy: -90.907 where: short stacking energy: -44.428 Base-Backbone interact. energy: -0.796 local terms energy: -61.552392 where: bonds (distance) C4'-P energy: -20.183 bonds (distance) P-C4' energy: -18.739 flat angles C4'-P-C4' energy: -20.290 flat angles P-C4'-P energy: -6.254 tors. eta vs tors. theta energy: 3.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 113 Temperature: 0.900000 Total energy: -363.985949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.985949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.985949 (E_RNA) where: Base-Base interactions energy: -228.346 where: short stacking energy: -117.485 Base-Backbone interact. energy: -0.385 local terms energy: -135.255686 where: bonds (distance) C4'-P energy: -27.406 bonds (distance) P-C4' energy: -25.784 flat angles C4'-P-C4' energy: -27.613 flat angles P-C4'-P energy: -20.170 tors. eta vs tors. theta energy: -34.283 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 113 Temperature: 0.950000 Total energy: -375.834092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.834092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.960652 (E_RNA) where: Base-Base interactions energy: -247.350 where: short stacking energy: -119.077 Base-Backbone interact. energy: -0.324 local terms energy: -128.286091 where: bonds (distance) C4'-P energy: -24.908 bonds (distance) P-C4' energy: -22.322 flat angles C4'-P-C4' energy: -25.037 flat angles P-C4'-P energy: -23.471 tors. eta vs tors. theta energy: -32.549 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 113 Temperature: 1.000000 Total energy: -354.884854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.884854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.009403 (E_RNA) where: Base-Base interactions energy: -235.923 where: short stacking energy: -120.617 Base-Backbone interact. energy: -1.686 local terms energy: -117.400592 where: bonds (distance) C4'-P energy: -20.890 bonds (distance) P-C4' energy: -20.254 flat angles C4'-P-C4' energy: -25.618 flat angles P-C4'-P energy: -18.804 tors. eta vs tors. theta energy: -31.835 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 113 Temperature: 1.050000 Total energy: -296.312356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.312356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.494160 (E_RNA) where: Base-Base interactions energy: -185.678 where: short stacking energy: -94.968 Base-Backbone interact. energy: -0.789 local terms energy: -110.027721 where: bonds (distance) C4'-P energy: -16.599 bonds (distance) P-C4' energy: -24.555 flat angles C4'-P-C4' energy: -27.354 flat angles P-C4'-P energy: -18.288 tors. eta vs tors. theta energy: -23.231 Dist. restrs. and SS energy: 0.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 113 Temperature: 1.100000 Total energy: -330.440775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.440775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.440775 (E_RNA) where: Base-Base interactions energy: -218.175 where: short stacking energy: -118.090 Base-Backbone interact. energy: 0.477 local terms energy: -112.743355 where: bonds (distance) C4'-P energy: -15.856 bonds (distance) P-C4' energy: -20.078 flat angles C4'-P-C4' energy: -24.668 flat angles P-C4'-P energy: -15.106 tors. eta vs tors. theta energy: -37.036 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 113 Temperature: 1.150000 Total energy: -326.896041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.896041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.944413 (E_RNA) where: Base-Base interactions energy: -212.375 where: short stacking energy: -98.611 Base-Backbone interact. energy: -0.300 local terms energy: -114.268959 where: bonds (distance) C4'-P energy: -18.104 bonds (distance) P-C4' energy: -24.375 flat angles C4'-P-C4' energy: -24.694 flat angles P-C4'-P energy: -19.393 tors. eta vs tors. theta energy: -27.703 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 113 Temperature: 1.200000 Total energy: -234.848827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.848827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.909469 (E_RNA) where: Base-Base interactions energy: -144.615 where: short stacking energy: -73.781 Base-Backbone interact. energy: 0.551 local terms energy: -90.845344 where: bonds (distance) C4'-P energy: -18.514 bonds (distance) P-C4' energy: -24.841 flat angles C4'-P-C4' energy: -21.889 flat angles P-C4'-P energy: -10.505 tors. eta vs tors. theta energy: -15.096 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 113 Temperature: 1.250000 Total energy: -211.747987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.747987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.747987 (E_RNA) where: Base-Base interactions energy: -128.797 where: short stacking energy: -66.967 Base-Backbone interact. energy: 1.175 local terms energy: -84.126264 where: bonds (distance) C4'-P energy: -14.097 bonds (distance) P-C4' energy: -21.367 flat angles C4'-P-C4' energy: -23.306 flat angles P-C4'-P energy: -13.769 tors. eta vs tors. theta energy: -11.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 113 Temperature: 1.300000 Total energy: -154.822938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.822938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.847784 (E_RNA) where: Base-Base interactions energy: -71.868 where: short stacking energy: -53.109 Base-Backbone interact. energy: -0.269 local terms energy: -82.710744 where: bonds (distance) C4'-P energy: -16.695 bonds (distance) P-C4' energy: -26.781 flat angles C4'-P-C4' energy: -18.876 flat angles P-C4'-P energy: -16.226 tors. eta vs tors. theta energy: -4.133 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 113 Temperature: 1.350000 Total energy: -154.474230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.474230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.474230 (E_RNA) where: Base-Base interactions energy: -92.541 where: short stacking energy: -45.453 Base-Backbone interact. energy: -1.627 local terms energy: -60.306122 where: bonds (distance) C4'-P energy: -17.529 bonds (distance) P-C4' energy: -18.462 flat angles C4'-P-C4' energy: -16.129 flat angles P-C4'-P energy: -8.538 tors. eta vs tors. theta energy: 0.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 114 Temperature: 0.900000 Total energy: -376.725687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.725687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.737064 (E_RNA) where: Base-Base interactions energy: -243.707 where: short stacking energy: -123.784 Base-Backbone interact. energy: -0.216 local terms energy: -132.814321 where: bonds (distance) C4'-P energy: -25.209 bonds (distance) P-C4' energy: -24.800 flat angles C4'-P-C4' energy: -28.062 flat angles P-C4'-P energy: -18.341 tors. eta vs tors. theta energy: -36.402 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 114 Temperature: 0.950000 Total energy: -369.764062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.764062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.943089 (E_RNA) where: Base-Base interactions energy: -242.684 where: short stacking energy: -119.877 Base-Backbone interact. energy: -0.641 local terms energy: -126.618529 where: bonds (distance) C4'-P energy: -21.530 bonds (distance) P-C4' energy: -25.250 flat angles C4'-P-C4' energy: -26.426 flat angles P-C4'-P energy: -20.901 tors. eta vs tors. theta energy: -32.511 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 114 Temperature: 1.000000 Total energy: -357.482508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.482508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.584453 (E_RNA) where: Base-Base interactions energy: -244.111 where: short stacking energy: -115.068 Base-Backbone interact. energy: -0.373 local terms energy: -113.100704 where: bonds (distance) C4'-P energy: -20.024 bonds (distance) P-C4' energy: -22.265 flat angles C4'-P-C4' energy: -27.050 flat angles P-C4'-P energy: -12.281 tors. eta vs tors. theta energy: -31.480 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 114 Temperature: 1.050000 Total energy: -299.166606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.166606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.166606 (E_RNA) where: Base-Base interactions energy: -190.848 where: short stacking energy: -102.200 Base-Backbone interact. energy: -0.895 local terms energy: -107.424406 where: bonds (distance) C4'-P energy: -24.501 bonds (distance) P-C4' energy: -20.302 flat angles C4'-P-C4' energy: -21.336 flat angles P-C4'-P energy: -18.320 tors. eta vs tors. theta energy: -22.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 114 Temperature: 1.100000 Total energy: -347.304607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.304607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.304607 (E_RNA) where: Base-Base interactions energy: -229.902 where: short stacking energy: -111.333 Base-Backbone interact. energy: -0.193 local terms energy: -117.209745 where: bonds (distance) C4'-P energy: -19.438 bonds (distance) P-C4' energy: -23.204 flat angles C4'-P-C4' energy: -25.500 flat angles P-C4'-P energy: -16.185 tors. eta vs tors. theta energy: -32.883 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 114 Temperature: 1.150000 Total energy: -337.788014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.788014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.844953 (E_RNA) where: Base-Base interactions energy: -217.903 where: short stacking energy: -108.488 Base-Backbone interact. energy: -0.574 local terms energy: -119.367617 where: bonds (distance) C4'-P energy: -21.612 bonds (distance) P-C4' energy: -26.206 flat angles C4'-P-C4' energy: -24.005 flat angles P-C4'-P energy: -17.930 tors. eta vs tors. theta energy: -29.615 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 114 Temperature: 1.200000 Total energy: -276.636313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.636313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.636313 (E_RNA) where: Base-Base interactions energy: -167.395 where: short stacking energy: -93.678 Base-Backbone interact. energy: -0.235 local terms energy: -109.005536 where: bonds (distance) C4'-P energy: -22.122 bonds (distance) P-C4' energy: -20.358 flat angles C4'-P-C4' energy: -25.690 flat angles P-C4'-P energy: -14.135 tors. eta vs tors. theta energy: -26.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 114 Temperature: 1.250000 Total energy: -182.393754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.393754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.520281 (E_RNA) where: Base-Base interactions energy: -95.343 where: short stacking energy: -64.181 Base-Backbone interact. energy: 0.241 local terms energy: -87.417354 where: bonds (distance) C4'-P energy: -20.413 bonds (distance) P-C4' energy: -21.987 flat angles C4'-P-C4' energy: -23.951 flat angles P-C4'-P energy: -9.820 tors. eta vs tors. theta energy: -11.245 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 114 Temperature: 1.300000 Total energy: -156.183936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.183936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.183936 (E_RNA) where: Base-Base interactions energy: -89.638 where: short stacking energy: -63.189 Base-Backbone interact. energy: 0.026 local terms energy: -66.571717 where: bonds (distance) C4'-P energy: -21.395 bonds (distance) P-C4' energy: -19.848 flat angles C4'-P-C4' energy: -9.988 flat angles P-C4'-P energy: -9.037 tors. eta vs tors. theta energy: -6.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 114 Temperature: 1.350000 Total energy: -151.384081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.384081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.384081 (E_RNA) where: Base-Base interactions energy: -78.622 where: short stacking energy: -47.223 Base-Backbone interact. energy: -0.005 local terms energy: -72.756936 where: bonds (distance) C4'-P energy: -14.664 bonds (distance) P-C4' energy: -23.465 flat angles C4'-P-C4' energy: -17.934 flat angles P-C4'-P energy: -9.321 tors. eta vs tors. theta energy: -7.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 115 Temperature: 0.900000 Total energy: -378.484108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.484108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.506437 (E_RNA) where: Base-Base interactions energy: -248.450 where: short stacking energy: -125.517 Base-Backbone interact. energy: -0.960 local terms energy: -129.096039 where: bonds (distance) C4'-P energy: -27.379 bonds (distance) P-C4' energy: -20.157 flat angles C4'-P-C4' energy: -24.726 flat angles P-C4'-P energy: -19.386 tors. eta vs tors. theta energy: -37.448 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 115 Temperature: 0.950000 Total energy: -370.097584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.097584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.097584 (E_RNA) where: Base-Base interactions energy: -247.288 where: short stacking energy: -118.973 Base-Backbone interact. energy: -0.539 local terms energy: -122.270888 where: bonds (distance) C4'-P energy: -24.203 bonds (distance) P-C4' energy: -20.573 flat angles C4'-P-C4' energy: -25.296 flat angles P-C4'-P energy: -15.900 tors. eta vs tors. theta energy: -36.300 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 115 Temperature: 1.000000 Total energy: -361.746753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.746753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.746753 (E_RNA) where: Base-Base interactions energy: -234.086 where: short stacking energy: -110.069 Base-Backbone interact. energy: -0.003 local terms energy: -127.657315 where: bonds (distance) C4'-P energy: -22.652 bonds (distance) P-C4' energy: -25.807 flat angles C4'-P-C4' energy: -24.449 flat angles P-C4'-P energy: -20.992 tors. eta vs tors. theta energy: -33.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 115 Temperature: 1.050000 Total energy: -353.230341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.230341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.242676 (E_RNA) where: Base-Base interactions energy: -239.068 where: short stacking energy: -113.368 Base-Backbone interact. energy: -0.089 local terms energy: -114.086305 where: bonds (distance) C4'-P energy: -22.005 bonds (distance) P-C4' energy: -19.772 flat angles C4'-P-C4' energy: -19.991 flat angles P-C4'-P energy: -15.893 tors. eta vs tors. theta energy: -36.425 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 115 Temperature: 1.100000 Total energy: -287.121569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.121569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.132000 (E_RNA) where: Base-Base interactions energy: -184.000 where: short stacking energy: -91.872 Base-Backbone interact. energy: -0.142 local terms energy: -102.990278 where: bonds (distance) C4'-P energy: -24.072 bonds (distance) P-C4' energy: -19.571 flat angles C4'-P-C4' energy: -23.493 flat angles P-C4'-P energy: -16.522 tors. eta vs tors. theta energy: -19.332 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 115 Temperature: 1.150000 Total energy: -274.595407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.595407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.595407 (E_RNA) where: Base-Base interactions energy: -178.855 where: short stacking energy: -83.534 Base-Backbone interact. energy: -2.125 local terms energy: -93.615028 where: bonds (distance) C4'-P energy: -15.004 bonds (distance) P-C4' energy: -17.966 flat angles C4'-P-C4' energy: -24.378 flat angles P-C4'-P energy: -12.647 tors. eta vs tors. theta energy: -23.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 115 Temperature: 1.200000 Total energy: -274.857797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.857797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.865565 (E_RNA) where: Base-Base interactions energy: -171.510 where: short stacking energy: -95.958 Base-Backbone interact. energy: -0.841 local terms energy: -102.514347 where: bonds (distance) C4'-P energy: -21.896 bonds (distance) P-C4' energy: -18.950 flat angles C4'-P-C4' energy: -23.752 flat angles P-C4'-P energy: -15.302 tors. eta vs tors. theta energy: -22.615 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 115 Temperature: 1.250000 Total energy: -199.903003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.903003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.932310 (E_RNA) where: Base-Base interactions energy: -108.280 where: short stacking energy: -65.356 Base-Backbone interact. energy: -0.228 local terms energy: -91.424633 where: bonds (distance) C4'-P energy: -16.296 bonds (distance) P-C4' energy: -21.095 flat angles C4'-P-C4' energy: -23.513 flat angles P-C4'-P energy: -16.171 tors. eta vs tors. theta energy: -14.349 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 115 Temperature: 1.300000 Total energy: -165.478057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.478057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.478057 (E_RNA) where: Base-Base interactions energy: -80.122 where: short stacking energy: -53.843 Base-Backbone interact. energy: -1.901 local terms energy: -83.454341 where: bonds (distance) C4'-P energy: -24.976 bonds (distance) P-C4' energy: -25.679 flat angles C4'-P-C4' energy: -16.703 flat angles P-C4'-P energy: -12.922 tors. eta vs tors. theta energy: -3.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 115 Temperature: 1.350000 Total energy: -143.074890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.074890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.074890 (E_RNA) where: Base-Base interactions energy: -70.537 where: short stacking energy: -33.967 Base-Backbone interact. energy: 1.364 local terms energy: -73.902052 where: bonds (distance) C4'-P energy: -17.606 bonds (distance) P-C4' energy: -24.020 flat angles C4'-P-C4' energy: -21.525 flat angles P-C4'-P energy: -11.869 tors. eta vs tors. theta energy: 1.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 116 Temperature: 0.900000 Total energy: -382.337050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.337050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.477482 (E_RNA) where: Base-Base interactions energy: -243.001 where: short stacking energy: -129.090 Base-Backbone interact. energy: -0.040 local terms energy: -139.436968 where: bonds (distance) C4'-P energy: -27.359 bonds (distance) P-C4' energy: -24.020 flat angles C4'-P-C4' energy: -25.504 flat angles P-C4'-P energy: -23.907 tors. eta vs tors. theta energy: -38.648 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 116 Temperature: 0.950000 Total energy: -372.025846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.025846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.083509 (E_RNA) where: Base-Base interactions energy: -246.351 where: short stacking energy: -123.305 Base-Backbone interact. energy: -0.284 local terms energy: -125.448403 where: bonds (distance) C4'-P energy: -18.105 bonds (distance) P-C4' energy: -25.326 flat angles C4'-P-C4' energy: -23.870 flat angles P-C4'-P energy: -17.607 tors. eta vs tors. theta energy: -40.542 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 116 Temperature: 1.000000 Total energy: -348.654410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.654410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.694266 (E_RNA) where: Base-Base interactions energy: -224.692 where: short stacking energy: -111.002 Base-Backbone interact. energy: -0.780 local terms energy: -123.222211 where: bonds (distance) C4'-P energy: -19.124 bonds (distance) P-C4' energy: -27.513 flat angles C4'-P-C4' energy: -26.562 flat angles P-C4'-P energy: -19.419 tors. eta vs tors. theta energy: -30.604 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 116 Temperature: 1.050000 Total energy: -356.664187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.664187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.664187 (E_RNA) where: Base-Base interactions energy: -240.074 where: short stacking energy: -124.983 Base-Backbone interact. energy: -0.605 local terms energy: -115.984828 where: bonds (distance) C4'-P energy: -19.892 bonds (distance) P-C4' energy: -18.149 flat angles C4'-P-C4' energy: -23.609 flat angles P-C4'-P energy: -16.390 tors. eta vs tors. theta energy: -37.946 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 116 Temperature: 1.100000 Total energy: -271.502614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.502614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.713135 (E_RNA) where: Base-Base interactions energy: -160.759 where: short stacking energy: -85.487 Base-Backbone interact. energy: -0.310 local terms energy: -110.643165 where: bonds (distance) C4'-P energy: -24.837 bonds (distance) P-C4' energy: -25.887 flat angles C4'-P-C4' energy: -22.455 flat angles P-C4'-P energy: -12.610 tors. eta vs tors. theta energy: -24.854 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 116 Temperature: 1.150000 Total energy: -321.411833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.411833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.411833 (E_RNA) where: Base-Base interactions energy: -213.952 where: short stacking energy: -107.442 Base-Backbone interact. energy: -1.535 local terms energy: -105.924848 where: bonds (distance) C4'-P energy: -20.934 bonds (distance) P-C4' energy: -25.770 flat angles C4'-P-C4' energy: -24.990 flat angles P-C4'-P energy: -10.629 tors. eta vs tors. theta energy: -23.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 116 Temperature: 1.200000 Total energy: -302.826780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.826780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.015492 (E_RNA) where: Base-Base interactions energy: -199.230 where: short stacking energy: -97.684 Base-Backbone interact. energy: -0.098 local terms energy: -103.687734 where: bonds (distance) C4'-P energy: -19.518 bonds (distance) P-C4' energy: -23.317 flat angles C4'-P-C4' energy: -21.138 flat angles P-C4'-P energy: -14.173 tors. eta vs tors. theta energy: -25.541 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 116 Temperature: 1.250000 Total energy: -183.651024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.651024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.651024 (E_RNA) where: Base-Base interactions energy: -97.346 where: short stacking energy: -63.388 Base-Backbone interact. energy: -0.840 local terms energy: -85.465245 where: bonds (distance) C4'-P energy: -19.915 bonds (distance) P-C4' energy: -23.088 flat angles C4'-P-C4' energy: -24.527 flat angles P-C4'-P energy: -9.944 tors. eta vs tors. theta energy: -7.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 116 Temperature: 1.300000 Total energy: -190.469256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.469256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.567395 (E_RNA) where: Base-Base interactions energy: -120.261 where: short stacking energy: -57.018 Base-Backbone interact. energy: -0.254 local terms energy: -70.052091 where: bonds (distance) C4'-P energy: -17.938 bonds (distance) P-C4' energy: -18.236 flat angles C4'-P-C4' energy: -13.301 flat angles P-C4'-P energy: -12.547 tors. eta vs tors. theta energy: -8.030 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 116 Temperature: 1.350000 Total energy: -196.152124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.152124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.316125 (E_RNA) where: Base-Base interactions energy: -112.081 where: short stacking energy: -62.172 Base-Backbone interact. energy: -0.207 local terms energy: -84.027863 where: bonds (distance) C4'-P energy: -13.903 bonds (distance) P-C4' energy: -22.393 flat angles C4'-P-C4' energy: -23.715 flat angles P-C4'-P energy: -15.178 tors. eta vs tors. theta energy: -8.838 Dist. restrs. and SS energy: 0.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 117 Temperature: 0.900000 Total energy: -377.374458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.374458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.407381 (E_RNA) where: Base-Base interactions energy: -244.892 where: short stacking energy: -119.945 Base-Backbone interact. energy: -0.019 local terms energy: -132.495817 where: bonds (distance) C4'-P energy: -24.774 bonds (distance) P-C4' energy: -27.209 flat angles C4'-P-C4' energy: -27.981 flat angles P-C4'-P energy: -18.324 tors. eta vs tors. theta energy: -34.207 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 117 Temperature: 0.950000 Total energy: -374.780240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.780240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.806025 (E_RNA) where: Base-Base interactions energy: -252.254 where: short stacking energy: -115.842 Base-Backbone interact. energy: -0.301 local terms energy: -122.251207 where: bonds (distance) C4'-P energy: -22.740 bonds (distance) P-C4' energy: -26.109 flat angles C4'-P-C4' energy: -24.904 flat angles P-C4'-P energy: -14.350 tors. eta vs tors. theta energy: -34.147 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 117 Temperature: 1.000000 Total energy: -344.599700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.599700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.682608 (E_RNA) where: Base-Base interactions energy: -226.015 where: short stacking energy: -112.215 Base-Backbone interact. energy: -0.264 local terms energy: -118.403381 where: bonds (distance) C4'-P energy: -24.259 bonds (distance) P-C4' energy: -21.866 flat angles C4'-P-C4' energy: -23.534 flat angles P-C4'-P energy: -16.110 tors. eta vs tors. theta energy: -32.636 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 117 Temperature: 1.050000 Total energy: -358.745935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.745935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.878085 (E_RNA) where: Base-Base interactions energy: -228.320 where: short stacking energy: -117.514 Base-Backbone interact. energy: -0.544 local terms energy: -130.014638 where: bonds (distance) C4'-P energy: -22.369 bonds (distance) P-C4' energy: -27.501 flat angles C4'-P-C4' energy: -25.347 flat angles P-C4'-P energy: -17.982 tors. eta vs tors. theta energy: -36.816 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 117 Temperature: 1.100000 Total energy: -283.682929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.682929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.682929 (E_RNA) where: Base-Base interactions energy: -182.682 where: short stacking energy: -80.319 Base-Backbone interact. energy: 1.854 local terms energy: -102.854846 where: bonds (distance) C4'-P energy: -20.755 bonds (distance) P-C4' energy: -19.948 flat angles C4'-P-C4' energy: -25.084 flat angles P-C4'-P energy: -17.216 tors. eta vs tors. theta energy: -19.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 117 Temperature: 1.150000 Total energy: -281.812894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.812894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.812894 (E_RNA) where: Base-Base interactions energy: -192.159 where: short stacking energy: -84.957 Base-Backbone interact. energy: -1.143 local terms energy: -88.510270 where: bonds (distance) C4'-P energy: -21.314 bonds (distance) P-C4' energy: -16.308 flat angles C4'-P-C4' energy: -20.321 flat angles P-C4'-P energy: -10.683 tors. eta vs tors. theta energy: -19.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 117 Temperature: 1.200000 Total energy: -283.412289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.412289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.412289 (E_RNA) where: Base-Base interactions energy: -188.786 where: short stacking energy: -83.205 Base-Backbone interact. energy: -0.023 local terms energy: -94.603213 where: bonds (distance) C4'-P energy: -23.665 bonds (distance) P-C4' energy: -13.296 flat angles C4'-P-C4' energy: -23.868 flat angles P-C4'-P energy: -13.221 tors. eta vs tors. theta energy: -20.553 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 117 Temperature: 1.250000 Total energy: -175.438603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.438603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.719221 (E_RNA) where: Base-Base interactions energy: -101.658 where: short stacking energy: -64.412 Base-Backbone interact. energy: -0.327 local terms energy: -73.734011 where: bonds (distance) C4'-P energy: -22.277 bonds (distance) P-C4' energy: -12.625 flat angles C4'-P-C4' energy: -21.067 flat angles P-C4'-P energy: -10.332 tors. eta vs tors. theta energy: -7.433 Dist. restrs. and SS energy: 0.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 117 Temperature: 1.300000 Total energy: -163.727472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.727472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.738867 (E_RNA) where: Base-Base interactions energy: -84.683 where: short stacking energy: -50.685 Base-Backbone interact. energy: -2.177 local terms energy: -76.879612 where: bonds (distance) C4'-P energy: -16.883 bonds (distance) P-C4' energy: -27.330 flat angles C4'-P-C4' energy: -22.502 flat angles P-C4'-P energy: -5.704 tors. eta vs tors. theta energy: -4.460 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 117 Temperature: 1.350000 Total energy: -141.940087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.940087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.940087 (E_RNA) where: Base-Base interactions energy: -69.867 where: short stacking energy: -45.132 Base-Backbone interact. energy: -0.519 local terms energy: -71.554475 where: bonds (distance) C4'-P energy: -18.535 bonds (distance) P-C4' energy: -25.048 flat angles C4'-P-C4' energy: -16.659 flat angles P-C4'-P energy: -17.497 tors. eta vs tors. theta energy: 6.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 118 Temperature: 0.900000 Total energy: -374.542417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.542417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.551544 (E_RNA) where: Base-Base interactions energy: -241.260 where: short stacking energy: -120.285 Base-Backbone interact. energy: -0.336 local terms energy: -132.955727 where: bonds (distance) C4'-P energy: -27.806 bonds (distance) P-C4' energy: -22.953 flat angles C4'-P-C4' energy: -27.149 flat angles P-C4'-P energy: -14.999 tors. eta vs tors. theta energy: -40.049 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 118 Temperature: 0.950000 Total energy: -372.453133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.453133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.582803 (E_RNA) where: Base-Base interactions energy: -244.806 where: short stacking energy: -124.113 Base-Backbone interact. energy: -0.050 local terms energy: -127.726741 where: bonds (distance) C4'-P energy: -22.900 bonds (distance) P-C4' energy: -24.177 flat angles C4'-P-C4' energy: -28.034 flat angles P-C4'-P energy: -21.149 tors. eta vs tors. theta energy: -31.467 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 118 Temperature: 1.000000 Total energy: -365.735417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.735417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.735417 (E_RNA) where: Base-Base interactions energy: -243.036 where: short stacking energy: -120.601 Base-Backbone interact. energy: -0.173 local terms energy: -122.526544 where: bonds (distance) C4'-P energy: -25.002 bonds (distance) P-C4' energy: -25.852 flat angles C4'-P-C4' energy: -19.882 flat angles P-C4'-P energy: -16.733 tors. eta vs tors. theta energy: -35.057 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 118 Temperature: 1.050000 Total energy: -344.542021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.542021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.542021 (E_RNA) where: Base-Base interactions energy: -222.895 where: short stacking energy: -116.669 Base-Backbone interact. energy: -0.357 local terms energy: -121.290561 where: bonds (distance) C4'-P energy: -21.429 bonds (distance) P-C4' energy: -25.564 flat angles C4'-P-C4' energy: -26.220 flat angles P-C4'-P energy: -12.491 tors. eta vs tors. theta energy: -35.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 118 Temperature: 1.100000 Total energy: -322.306433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.306433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.364919 (E_RNA) where: Base-Base interactions energy: -211.703 where: short stacking energy: -102.005 Base-Backbone interact. energy: -0.251 local terms energy: -110.411159 where: bonds (distance) C4'-P energy: -25.086 bonds (distance) P-C4' energy: -21.263 flat angles C4'-P-C4' energy: -25.135 flat angles P-C4'-P energy: -12.121 tors. eta vs tors. theta energy: -26.806 Dist. restrs. and SS energy: 0.058 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 118 Temperature: 1.150000 Total energy: -285.044723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.044723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.044723 (E_RNA) where: Base-Base interactions energy: -172.926 where: short stacking energy: -91.173 Base-Backbone interact. energy: 0.783 local terms energy: -112.901388 where: bonds (distance) C4'-P energy: -21.979 bonds (distance) P-C4' energy: -23.947 flat angles C4'-P-C4' energy: -24.584 flat angles P-C4'-P energy: -18.393 tors. eta vs tors. theta energy: -23.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 118 Temperature: 1.200000 Total energy: -282.422538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.422538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.495291 (E_RNA) where: Base-Base interactions energy: -182.868 where: short stacking energy: -97.558 Base-Backbone interact. energy: 0.374 local terms energy: -100.001635 where: bonds (distance) C4'-P energy: -24.891 bonds (distance) P-C4' energy: -18.177 flat angles C4'-P-C4' energy: -22.283 flat angles P-C4'-P energy: -7.864 tors. eta vs tors. theta energy: -26.787 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 118 Temperature: 1.250000 Total energy: -161.393170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.393170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.393170 (E_RNA) where: Base-Base interactions energy: -89.654 where: short stacking energy: -53.402 Base-Backbone interact. energy: -1.175 local terms energy: -70.564081 where: bonds (distance) C4'-P energy: -21.045 bonds (distance) P-C4' energy: -23.806 flat angles C4'-P-C4' energy: -13.633 flat angles P-C4'-P energy: -9.600 tors. eta vs tors. theta energy: -2.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 118 Temperature: 1.300000 Total energy: -183.421237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.421237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.440945 (E_RNA) where: Base-Base interactions energy: -109.232 where: short stacking energy: -68.419 Base-Backbone interact. energy: -0.343 local terms energy: -73.865803 where: bonds (distance) C4'-P energy: -17.180 bonds (distance) P-C4' energy: -24.165 flat angles C4'-P-C4' energy: -20.941 flat angles P-C4'-P energy: -7.067 tors. eta vs tors. theta energy: -4.513 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 118 Temperature: 1.350000 Total energy: -162.639230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.639230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.651490 (E_RNA) where: Base-Base interactions energy: -75.533 where: short stacking energy: -47.971 Base-Backbone interact. energy: -0.404 local terms energy: -86.715058 where: bonds (distance) C4'-P energy: -22.839 bonds (distance) P-C4' energy: -20.852 flat angles C4'-P-C4' energy: -17.607 flat angles P-C4'-P energy: -13.833 tors. eta vs tors. theta energy: -11.583 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 119 Temperature: 0.900000 Total energy: -373.408589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.408589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.409489 (E_RNA) where: Base-Base interactions energy: -249.395 where: short stacking energy: -116.545 Base-Backbone interact. energy: -0.793 local terms energy: -123.221588 where: bonds (distance) C4'-P energy: -21.209 bonds (distance) P-C4' energy: -23.135 flat angles C4'-P-C4' energy: -27.413 flat angles P-C4'-P energy: -21.202 tors. eta vs tors. theta energy: -30.262 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 119 Temperature: 0.950000 Total energy: -383.931510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.931510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.983623 (E_RNA) where: Base-Base interactions energy: -246.764 where: short stacking energy: -119.818 Base-Backbone interact. energy: -0.218 local terms energy: -137.001037 where: bonds (distance) C4'-P energy: -25.134 bonds (distance) P-C4' energy: -26.343 flat angles C4'-P-C4' energy: -27.773 flat angles P-C4'-P energy: -19.673 tors. eta vs tors. theta energy: -38.079 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 119 Temperature: 1.000000 Total energy: -367.653978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.653978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.653978 (E_RNA) where: Base-Base interactions energy: -241.770 where: short stacking energy: -125.299 Base-Backbone interact. energy: -0.573 local terms energy: -125.310730 where: bonds (distance) C4'-P energy: -21.182 bonds (distance) P-C4' energy: -25.339 flat angles C4'-P-C4' energy: -25.471 flat angles P-C4'-P energy: -18.753 tors. eta vs tors. theta energy: -34.567 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 119 Temperature: 1.050000 Total energy: -343.193454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.193454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.198917 (E_RNA) where: Base-Base interactions energy: -216.434 where: short stacking energy: -107.099 Base-Backbone interact. energy: -1.131 local terms energy: -125.633596 where: bonds (distance) C4'-P energy: -17.913 bonds (distance) P-C4' energy: -25.198 flat angles C4'-P-C4' energy: -26.970 flat angles P-C4'-P energy: -18.555 tors. eta vs tors. theta energy: -36.997 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 119 Temperature: 1.100000 Total energy: -314.861408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.861408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.861408 (E_RNA) where: Base-Base interactions energy: -202.159 where: short stacking energy: -97.077 Base-Backbone interact. energy: -1.475 local terms energy: -111.227342 where: bonds (distance) C4'-P energy: -21.218 bonds (distance) P-C4' energy: -28.150 flat angles C4'-P-C4' energy: -22.832 flat angles P-C4'-P energy: -19.049 tors. eta vs tors. theta energy: -19.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 119 Temperature: 1.150000 Total energy: -312.904352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.904352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.904352 (E_RNA) where: Base-Base interactions energy: -205.976 where: short stacking energy: -91.092 Base-Backbone interact. energy: -0.274 local terms energy: -106.654651 where: bonds (distance) C4'-P energy: -22.709 bonds (distance) P-C4' energy: -23.387 flat angles C4'-P-C4' energy: -26.127 flat angles P-C4'-P energy: -12.698 tors. eta vs tors. theta energy: -21.734 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 119 Temperature: 1.200000 Total energy: -247.071062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.071062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.071062 (E_RNA) where: Base-Base interactions energy: -152.230 where: short stacking energy: -82.706 Base-Backbone interact. energy: -0.383 local terms energy: -94.458708 where: bonds (distance) C4'-P energy: -18.692 bonds (distance) P-C4' energy: -22.319 flat angles C4'-P-C4' energy: -25.237 flat angles P-C4'-P energy: -9.916 tors. eta vs tors. theta energy: -18.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 119 Temperature: 1.250000 Total energy: -163.369859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.369859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.370970 (E_RNA) where: Base-Base interactions energy: -80.943 where: short stacking energy: -52.165 Base-Backbone interact. energy: -1.097 local terms energy: -81.331508 where: bonds (distance) C4'-P energy: -19.606 bonds (distance) P-C4' energy: -25.457 flat angles C4'-P-C4' energy: -18.925 flat angles P-C4'-P energy: -11.125 tors. eta vs tors. theta energy: -6.218 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 119 Temperature: 1.300000 Total energy: -161.526913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.526913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.546903 (E_RNA) where: Base-Base interactions energy: -73.165 where: short stacking energy: -51.990 Base-Backbone interact. energy: 1.819 local terms energy: -90.201343 where: bonds (distance) C4'-P energy: -22.803 bonds (distance) P-C4' energy: -22.838 flat angles C4'-P-C4' energy: -19.698 flat angles P-C4'-P energy: -15.789 tors. eta vs tors. theta energy: -9.073 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 119 Temperature: 1.350000 Total energy: -141.434619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.434619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.434619 (E_RNA) where: Base-Base interactions energy: -72.903 where: short stacking energy: -35.138 Base-Backbone interact. energy: -0.331 local terms energy: -68.200575 where: bonds (distance) C4'-P energy: -21.702 bonds (distance) P-C4' energy: -19.285 flat angles C4'-P-C4' energy: -18.916 flat angles P-C4'-P energy: -10.346 tors. eta vs tors. theta energy: 2.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 120 Temperature: 0.900000 Total energy: -384.985881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.985881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.995092 (E_RNA) where: Base-Base interactions energy: -254.993 where: short stacking energy: -123.896 Base-Backbone interact. energy: -0.594 local terms energy: -129.408013 where: bonds (distance) C4'-P energy: -23.786 bonds (distance) P-C4' energy: -22.506 flat angles C4'-P-C4' energy: -27.596 flat angles P-C4'-P energy: -18.968 tors. eta vs tors. theta energy: -36.553 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 120 Temperature: 0.950000 Total energy: -370.870041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.870041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.870041 (E_RNA) where: Base-Base interactions energy: -243.157 where: short stacking energy: -128.871 Base-Backbone interact. energy: -0.329 local terms energy: -127.383540 where: bonds (distance) C4'-P energy: -25.920 bonds (distance) P-C4' energy: -21.786 flat angles C4'-P-C4' energy: -27.131 flat angles P-C4'-P energy: -17.009 tors. eta vs tors. theta energy: -35.538 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 120 Temperature: 1.000000 Total energy: -350.844633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.844633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.957816 (E_RNA) where: Base-Base interactions energy: -226.769 where: short stacking energy: -114.373 Base-Backbone interact. energy: -0.433 local terms energy: -123.755940 where: bonds (distance) C4'-P energy: -15.961 bonds (distance) P-C4' energy: -27.572 flat angles C4'-P-C4' energy: -28.655 flat angles P-C4'-P energy: -19.209 tors. eta vs tors. theta energy: -32.358 Dist. restrs. and SS energy: 0.113 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 120 Temperature: 1.050000 Total energy: -366.840115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.840115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.840115 (E_RNA) where: Base-Base interactions energy: -246.131 where: short stacking energy: -125.296 Base-Backbone interact. energy: -0.031 local terms energy: -120.678983 where: bonds (distance) C4'-P energy: -18.499 bonds (distance) P-C4' energy: -22.465 flat angles C4'-P-C4' energy: -23.799 flat angles P-C4'-P energy: -20.251 tors. eta vs tors. theta energy: -35.666 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 120 Temperature: 1.100000 Total energy: -297.111741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.111741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.119917 (E_RNA) where: Base-Base interactions energy: -180.811 where: short stacking energy: -89.656 Base-Backbone interact. energy: -1.489 local terms energy: -114.819530 where: bonds (distance) C4'-P energy: -22.414 bonds (distance) P-C4' energy: -23.573 flat angles C4'-P-C4' energy: -25.296 flat angles P-C4'-P energy: -18.256 tors. eta vs tors. theta energy: -25.279 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 120 Temperature: 1.150000 Total energy: -299.466836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.466836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.466836 (E_RNA) where: Base-Base interactions energy: -201.935 where: short stacking energy: -89.577 Base-Backbone interact. energy: -0.091 local terms energy: -97.440377 where: bonds (distance) C4'-P energy: -20.959 bonds (distance) P-C4' energy: -18.540 flat angles C4'-P-C4' energy: -24.242 flat angles P-C4'-P energy: -12.047 tors. eta vs tors. theta energy: -21.653 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 120 Temperature: 1.200000 Total energy: -267.677953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.677953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.793862 (E_RNA) where: Base-Base interactions energy: -164.739 where: short stacking energy: -88.864 Base-Backbone interact. energy: 0.469 local terms energy: -103.523218 where: bonds (distance) C4'-P energy: -17.954 bonds (distance) P-C4' energy: -21.565 flat angles C4'-P-C4' energy: -21.873 flat angles P-C4'-P energy: -15.585 tors. eta vs tors. theta energy: -26.546 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 120 Temperature: 1.250000 Total energy: -180.591496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.591496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.591496 (E_RNA) where: Base-Base interactions energy: -93.859 where: short stacking energy: -64.857 Base-Backbone interact. energy: -1.364 local terms energy: -85.368457 where: bonds (distance) C4'-P energy: -20.820 bonds (distance) P-C4' energy: -26.497 flat angles C4'-P-C4' energy: -16.747 flat angles P-C4'-P energy: -11.490 tors. eta vs tors. theta energy: -9.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 120 Temperature: 1.300000 Total energy: -218.340573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.340573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.402386 (E_RNA) where: Base-Base interactions energy: -130.863 where: short stacking energy: -60.697 Base-Backbone interact. energy: 0.047 local terms energy: -87.586192 where: bonds (distance) C4'-P energy: -20.340 bonds (distance) P-C4' energy: -20.895 flat angles C4'-P-C4' energy: -20.792 flat angles P-C4'-P energy: -11.894 tors. eta vs tors. theta energy: -13.666 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 120 Temperature: 1.350000 Total energy: -147.238840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.238840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.243471 (E_RNA) where: Base-Base interactions energy: -68.749 where: short stacking energy: -38.676 Base-Backbone interact. energy: -0.900 local terms energy: -77.594617 where: bonds (distance) C4'-P energy: -23.946 bonds (distance) P-C4' energy: -22.562 flat angles C4'-P-C4' energy: -19.816 flat angles P-C4'-P energy: -13.596 tors. eta vs tors. theta energy: 2.325 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 121 Temperature: 0.900000 Total energy: -379.010889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.010889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.016634 (E_RNA) where: Base-Base interactions energy: -239.700 where: short stacking energy: -119.369 Base-Backbone interact. energy: -0.640 local terms energy: -138.676624 where: bonds (distance) C4'-P energy: -22.476 bonds (distance) P-C4' energy: -26.458 flat angles C4'-P-C4' energy: -30.634 flat angles P-C4'-P energy: -21.093 tors. eta vs tors. theta energy: -38.015 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 121 Temperature: 0.950000 Total energy: -369.822649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.822649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.888291 (E_RNA) where: Base-Base interactions energy: -243.183 where: short stacking energy: -116.416 Base-Backbone interact. energy: -0.767 local terms energy: -125.937867 where: bonds (distance) C4'-P energy: -24.144 bonds (distance) P-C4' energy: -24.765 flat angles C4'-P-C4' energy: -28.636 flat angles P-C4'-P energy: -13.712 tors. eta vs tors. theta energy: -34.680 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 121 Temperature: 1.000000 Total energy: -351.933493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.933493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.933493 (E_RNA) where: Base-Base interactions energy: -229.763 where: short stacking energy: -109.410 Base-Backbone interact. energy: -2.023 local terms energy: -120.147213 where: bonds (distance) C4'-P energy: -23.034 bonds (distance) P-C4' energy: -29.750 flat angles C4'-P-C4' energy: -24.812 flat angles P-C4'-P energy: -14.015 tors. eta vs tors. theta energy: -28.536 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 121 Temperature: 1.050000 Total energy: -354.896626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.896626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.123658 (E_RNA) where: Base-Base interactions energy: -227.456 where: short stacking energy: -110.923 Base-Backbone interact. energy: 0.188 local terms energy: -127.856399 where: bonds (distance) C4'-P energy: -26.285 bonds (distance) P-C4' energy: -25.265 flat angles C4'-P-C4' energy: -25.707 flat angles P-C4'-P energy: -17.478 tors. eta vs tors. theta energy: -33.121 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 121 Temperature: 1.100000 Total energy: -308.701672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.701672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.711554 (E_RNA) where: Base-Base interactions energy: -203.405 where: short stacking energy: -92.478 Base-Backbone interact. energy: -0.903 local terms energy: -104.402883 where: bonds (distance) C4'-P energy: -19.120 bonds (distance) P-C4' energy: -20.100 flat angles C4'-P-C4' energy: -28.014 flat angles P-C4'-P energy: -17.186 tors. eta vs tors. theta energy: -19.982 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 121 Temperature: 1.150000 Total energy: -324.713406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.713406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.749343 (E_RNA) where: Base-Base interactions energy: -210.328 where: short stacking energy: -93.988 Base-Backbone interact. energy: -0.801 local terms energy: -113.620710 where: bonds (distance) C4'-P energy: -23.615 bonds (distance) P-C4' energy: -20.428 flat angles C4'-P-C4' energy: -24.167 flat angles P-C4'-P energy: -15.731 tors. eta vs tors. theta energy: -29.680 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 121 Temperature: 1.200000 Total energy: -240.150078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.150078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.150078 (E_RNA) where: Base-Base interactions energy: -148.136 where: short stacking energy: -72.535 Base-Backbone interact. energy: -0.536 local terms energy: -91.479014 where: bonds (distance) C4'-P energy: -10.732 bonds (distance) P-C4' energy: -25.662 flat angles C4'-P-C4' energy: -21.460 flat angles P-C4'-P energy: -14.861 tors. eta vs tors. theta energy: -18.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 121 Temperature: 1.250000 Total energy: -236.533641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.533641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.694759 (E_RNA) where: Base-Base interactions energy: -140.222 where: short stacking energy: -78.321 Base-Backbone interact. energy: -0.653 local terms energy: -95.819636 where: bonds (distance) C4'-P energy: -20.047 bonds (distance) P-C4' energy: -26.454 flat angles C4'-P-C4' energy: -20.351 flat angles P-C4'-P energy: -11.217 tors. eta vs tors. theta energy: -17.751 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 121 Temperature: 1.300000 Total energy: -166.429014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.429014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.430995 (E_RNA) where: Base-Base interactions energy: -88.239 where: short stacking energy: -60.086 Base-Backbone interact. energy: -0.072 local terms energy: -78.120021 where: bonds (distance) C4'-P energy: -14.386 bonds (distance) P-C4' energy: -20.885 flat angles C4'-P-C4' energy: -21.093 flat angles P-C4'-P energy: -9.668 tors. eta vs tors. theta energy: -12.088 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 121 Temperature: 1.350000 Total energy: -179.088072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.088072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.245513 (E_RNA) where: Base-Base interactions energy: -93.353 where: short stacking energy: -55.873 Base-Backbone interact. energy: -0.119 local terms energy: -85.773044 where: bonds (distance) C4'-P energy: -18.030 bonds (distance) P-C4' energy: -21.562 flat angles C4'-P-C4' energy: -23.396 flat angles P-C4'-P energy: -14.235 tors. eta vs tors. theta energy: -8.551 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 122 Temperature: 0.900000 Total energy: -373.967044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.967044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.967044 (E_RNA) where: Base-Base interactions energy: -236.620 where: short stacking energy: -130.046 Base-Backbone interact. energy: -1.496 local terms energy: -135.851748 where: bonds (distance) C4'-P energy: -24.972 bonds (distance) P-C4' energy: -26.944 flat angles C4'-P-C4' energy: -28.476 flat angles P-C4'-P energy: -18.077 tors. eta vs tors. theta energy: -37.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 122 Temperature: 0.950000 Total energy: -368.428502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.428502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.513428 (E_RNA) where: Base-Base interactions energy: -240.857 where: short stacking energy: -122.519 Base-Backbone interact. energy: 1.639 local terms energy: -129.295081 where: bonds (distance) C4'-P energy: -19.748 bonds (distance) P-C4' energy: -27.088 flat angles C4'-P-C4' energy: -26.905 flat angles P-C4'-P energy: -20.166 tors. eta vs tors. theta energy: -35.389 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 122 Temperature: 1.000000 Total energy: -370.217401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.217401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.218807 (E_RNA) where: Base-Base interactions energy: -252.505 where: short stacking energy: -124.032 Base-Backbone interact. energy: -1.484 local terms energy: -116.229191 where: bonds (distance) C4'-P energy: -17.027 bonds (distance) P-C4' energy: -21.891 flat angles C4'-P-C4' energy: -24.828 flat angles P-C4'-P energy: -16.039 tors. eta vs tors. theta energy: -36.443 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 122 Temperature: 1.050000 Total energy: -344.220077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.220077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.220077 (E_RNA) where: Base-Base interactions energy: -226.651 where: short stacking energy: -106.044 Base-Backbone interact. energy: -0.024 local terms energy: -117.544963 where: bonds (distance) C4'-P energy: -18.152 bonds (distance) P-C4' energy: -26.357 flat angles C4'-P-C4' energy: -24.672 flat angles P-C4'-P energy: -12.743 tors. eta vs tors. theta energy: -35.621 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 122 Temperature: 1.100000 Total energy: -347.664675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.664675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.766356 (E_RNA) where: Base-Base interactions energy: -230.312 where: short stacking energy: -118.121 Base-Backbone interact. energy: -0.056 local terms energy: -117.398324 where: bonds (distance) C4'-P energy: -20.707 bonds (distance) P-C4' energy: -19.179 flat angles C4'-P-C4' energy: -27.104 flat angles P-C4'-P energy: -11.900 tors. eta vs tors. theta energy: -38.508 Dist. restrs. and SS energy: 0.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 122 Temperature: 1.150000 Total energy: -287.000102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.000102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.119836 (E_RNA) where: Base-Base interactions energy: -179.242 where: short stacking energy: -94.227 Base-Backbone interact. energy: -0.535 local terms energy: -107.343076 where: bonds (distance) C4'-P energy: -23.164 bonds (distance) P-C4' energy: -25.050 flat angles C4'-P-C4' energy: -24.843 flat angles P-C4'-P energy: -8.108 tors. eta vs tors. theta energy: -26.178 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 122 Temperature: 1.200000 Total energy: -238.189540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.189540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.222891 (E_RNA) where: Base-Base interactions energy: -154.716 where: short stacking energy: -84.660 Base-Backbone interact. energy: -0.533 local terms energy: -82.973403 where: bonds (distance) C4'-P energy: -15.960 bonds (distance) P-C4' energy: -12.369 flat angles C4'-P-C4' energy: -23.183 flat angles P-C4'-P energy: -12.055 tors. eta vs tors. theta energy: -19.406 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 122 Temperature: 1.250000 Total energy: -256.156596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.156596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.156596 (E_RNA) where: Base-Base interactions energy: -168.082 where: short stacking energy: -77.001 Base-Backbone interact. energy: 1.863 local terms energy: -89.938490 where: bonds (distance) C4'-P energy: -15.839 bonds (distance) P-C4' energy: -24.987 flat angles C4'-P-C4' energy: -16.746 flat angles P-C4'-P energy: -12.439 tors. eta vs tors. theta energy: -19.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 122 Temperature: 1.300000 Total energy: -160.386093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.386093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.402838 (E_RNA) where: Base-Base interactions energy: -90.828 where: short stacking energy: -49.844 Base-Backbone interact. energy: -0.408 local terms energy: -69.166176 where: bonds (distance) C4'-P energy: -15.827 bonds (distance) P-C4' energy: -28.225 flat angles C4'-P-C4' energy: -17.889 flat angles P-C4'-P energy: -9.002 tors. eta vs tors. theta energy: 1.777 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 122 Temperature: 1.350000 Total energy: -163.272920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.272920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.418037 (E_RNA) where: Base-Base interactions energy: -92.301 where: short stacking energy: -45.248 Base-Backbone interact. energy: -0.011 local terms energy: -71.106678 where: bonds (distance) C4'-P energy: -19.971 bonds (distance) P-C4' energy: -24.363 flat angles C4'-P-C4' energy: -19.754 flat angles P-C4'-P energy: -6.427 tors. eta vs tors. theta energy: -0.591 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 123 Temperature: 0.900000 Total energy: -367.118603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.118603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.118603 (E_RNA) where: Base-Base interactions energy: -233.966 where: short stacking energy: -124.623 Base-Backbone interact. energy: -0.486 local terms energy: -132.666175 where: bonds (distance) C4'-P energy: -26.236 bonds (distance) P-C4' energy: -27.191 flat angles C4'-P-C4' energy: -25.004 flat angles P-C4'-P energy: -17.698 tors. eta vs tors. theta energy: -36.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 123 Temperature: 0.950000 Total energy: -369.039919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.039919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.039919 (E_RNA) where: Base-Base interactions energy: -248.804 where: short stacking energy: -117.895 Base-Backbone interact. energy: -0.152 local terms energy: -120.083877 where: bonds (distance) C4'-P energy: -22.311 bonds (distance) P-C4' energy: -24.485 flat angles C4'-P-C4' energy: -24.507 flat angles P-C4'-P energy: -19.596 tors. eta vs tors. theta energy: -29.184 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 123 Temperature: 1.000000 Total energy: -374.464406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.464406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.468201 (E_RNA) where: Base-Base interactions energy: -246.355 where: short stacking energy: -117.815 Base-Backbone interact. energy: -0.753 local terms energy: -127.359894 where: bonds (distance) C4'-P energy: -22.663 bonds (distance) P-C4' energy: -22.719 flat angles C4'-P-C4' energy: -28.988 flat angles P-C4'-P energy: -17.030 tors. eta vs tors. theta energy: -35.960 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 123 Temperature: 1.050000 Total energy: -351.856415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.856415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.926253 (E_RNA) where: Base-Base interactions energy: -234.467 where: short stacking energy: -125.596 Base-Backbone interact. energy: -0.807 local terms energy: -116.652156 where: bonds (distance) C4'-P energy: -16.783 bonds (distance) P-C4' energy: -20.762 flat angles C4'-P-C4' energy: -23.362 flat angles P-C4'-P energy: -20.529 tors. eta vs tors. theta energy: -35.216 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 123 Temperature: 1.100000 Total energy: -338.927122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.927122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.927122 (E_RNA) where: Base-Base interactions energy: -223.027 where: short stacking energy: -103.284 Base-Backbone interact. energy: -0.697 local terms energy: -115.202767 where: bonds (distance) C4'-P energy: -20.120 bonds (distance) P-C4' energy: -24.179 flat angles C4'-P-C4' energy: -25.445 flat angles P-C4'-P energy: -15.715 tors. eta vs tors. theta energy: -29.744 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 123 Temperature: 1.150000 Total energy: -291.256120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.256120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.325609 (E_RNA) where: Base-Base interactions energy: -192.250 where: short stacking energy: -97.173 Base-Backbone interact. energy: -0.354 local terms energy: -98.721643 where: bonds (distance) C4'-P energy: -23.089 bonds (distance) P-C4' energy: -20.170 flat angles C4'-P-C4' energy: -17.291 flat angles P-C4'-P energy: -13.168 tors. eta vs tors. theta energy: -25.005 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 123 Temperature: 1.200000 Total energy: -219.533324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.533324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.688091 (E_RNA) where: Base-Base interactions energy: -132.325 where: short stacking energy: -68.626 Base-Backbone interact. energy: -0.983 local terms energy: -86.380214 where: bonds (distance) C4'-P energy: -21.735 bonds (distance) P-C4' energy: -23.217 flat angles C4'-P-C4' energy: -18.697 flat angles P-C4'-P energy: -12.767 tors. eta vs tors. theta energy: -9.964 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 123 Temperature: 1.250000 Total energy: -282.495434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.495434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.495434 (E_RNA) where: Base-Base interactions energy: -173.939 where: short stacking energy: -102.335 Base-Backbone interact. energy: -0.479 local terms energy: -108.077884 where: bonds (distance) C4'-P energy: -21.764 bonds (distance) P-C4' energy: -18.829 flat angles C4'-P-C4' energy: -23.148 flat angles P-C4'-P energy: -11.771 tors. eta vs tors. theta energy: -32.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 123 Temperature: 1.300000 Total energy: -175.839301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.839301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.946413 (E_RNA) where: Base-Base interactions energy: -90.293 where: short stacking energy: -59.221 Base-Backbone interact. energy: -0.372 local terms energy: -85.281222 where: bonds (distance) C4'-P energy: -16.803 bonds (distance) P-C4' energy: -20.515 flat angles C4'-P-C4' energy: -24.099 flat angles P-C4'-P energy: -9.123 tors. eta vs tors. theta energy: -14.741 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 123 Temperature: 1.350000 Total energy: -162.260209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.260209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.260209 (E_RNA) where: Base-Base interactions energy: -78.213 where: short stacking energy: -48.020 Base-Backbone interact. energy: -1.252 local terms energy: -82.795375 where: bonds (distance) C4'-P energy: -20.585 bonds (distance) P-C4' energy: -18.924 flat angles C4'-P-C4' energy: -21.881 flat angles P-C4'-P energy: -14.643 tors. eta vs tors. theta energy: -6.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 124 Temperature: 0.900000 Total energy: -383.001086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.001086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.001086 (E_RNA) where: Base-Base interactions energy: -252.298 where: short stacking energy: -129.580 Base-Backbone interact. energy: -0.033 local terms energy: -130.670077 where: bonds (distance) C4'-P energy: -24.231 bonds (distance) P-C4' energy: -23.994 flat angles C4'-P-C4' energy: -28.278 flat angles P-C4'-P energy: -16.002 tors. eta vs tors. theta energy: -38.166 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 124 Temperature: 0.950000 Total energy: -358.489461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.489461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.489461 (E_RNA) where: Base-Base interactions energy: -228.994 where: short stacking energy: -109.964 Base-Backbone interact. energy: 2.396 local terms energy: -131.890896 where: bonds (distance) C4'-P energy: -23.831 bonds (distance) P-C4' energy: -27.477 flat angles C4'-P-C4' energy: -22.909 flat angles P-C4'-P energy: -18.173 tors. eta vs tors. theta energy: -39.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 124 Temperature: 1.000000 Total energy: -366.910398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.910398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.910398 (E_RNA) where: Base-Base interactions energy: -239.016 where: short stacking energy: -114.616 Base-Backbone interact. energy: -0.458 local terms energy: -127.436708 where: bonds (distance) C4'-P energy: -19.198 bonds (distance) P-C4' energy: -22.494 flat angles C4'-P-C4' energy: -30.355 flat angles P-C4'-P energy: -18.834 tors. eta vs tors. theta energy: -36.555 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 124 Temperature: 1.050000 Total energy: -353.533844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.533844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.533844 (E_RNA) where: Base-Base interactions energy: -236.602 where: short stacking energy: -120.221 Base-Backbone interact. energy: -0.865 local terms energy: -116.067344 where: bonds (distance) C4'-P energy: -19.173 bonds (distance) P-C4' energy: -25.387 flat angles C4'-P-C4' energy: -20.740 flat angles P-C4'-P energy: -19.744 tors. eta vs tors. theta energy: -31.023 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 124 Temperature: 1.100000 Total energy: -349.097593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.097593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.097593 (E_RNA) where: Base-Base interactions energy: -232.029 where: short stacking energy: -109.451 Base-Backbone interact. energy: -0.603 local terms energy: -116.465323 where: bonds (distance) C4'-P energy: -23.934 bonds (distance) P-C4' energy: -23.496 flat angles C4'-P-C4' energy: -26.577 flat angles P-C4'-P energy: -10.596 tors. eta vs tors. theta energy: -31.862 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 124 Temperature: 1.150000 Total energy: -276.450484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.450484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.450484 (E_RNA) where: Base-Base interactions energy: -170.612 where: short stacking energy: -91.974 Base-Backbone interact. energy: -0.047 local terms energy: -105.791403 where: bonds (distance) C4'-P energy: -20.997 bonds (distance) P-C4' energy: -26.822 flat angles C4'-P-C4' energy: -22.001 flat angles P-C4'-P energy: -12.584 tors. eta vs tors. theta energy: -23.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 124 Temperature: 1.200000 Total energy: -295.862110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.862110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.879611 (E_RNA) where: Base-Base interactions energy: -191.416 where: short stacking energy: -95.759 Base-Backbone interact. energy: 0.610 local terms energy: -105.073638 where: bonds (distance) C4'-P energy: -19.387 bonds (distance) P-C4' energy: -24.546 flat angles C4'-P-C4' energy: -20.988 flat angles P-C4'-P energy: -15.801 tors. eta vs tors. theta energy: -24.352 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 124 Temperature: 1.250000 Total energy: -240.323474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.323474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.323474 (E_RNA) where: Base-Base interactions energy: -152.838 where: short stacking energy: -70.771 Base-Backbone interact. energy: -0.450 local terms energy: -87.035716 where: bonds (distance) C4'-P energy: -17.091 bonds (distance) P-C4' energy: -24.148 flat angles C4'-P-C4' energy: -15.164 flat angles P-C4'-P energy: -16.428 tors. eta vs tors. theta energy: -14.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 124 Temperature: 1.300000 Total energy: -172.213362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.213362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.215478 (E_RNA) where: Base-Base interactions energy: -88.968 where: short stacking energy: -53.012 Base-Backbone interact. energy: 0.210 local terms energy: -83.457293 where: bonds (distance) C4'-P energy: -17.712 bonds (distance) P-C4' energy: -23.674 flat angles C4'-P-C4' energy: -17.891 flat angles P-C4'-P energy: -15.381 tors. eta vs tors. theta energy: -8.799 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 124 Temperature: 1.350000 Total energy: -153.606654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.606654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.654752 (E_RNA) where: Base-Base interactions energy: -74.771 where: short stacking energy: -39.374 Base-Backbone interact. energy: 1.048 local terms energy: -79.931425 where: bonds (distance) C4'-P energy: -23.699 bonds (distance) P-C4' energy: -21.678 flat angles C4'-P-C4' energy: -25.635 flat angles P-C4'-P energy: -9.020 tors. eta vs tors. theta energy: 0.100 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 125 Temperature: 0.900000 Total energy: -381.034617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.034617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.061539 (E_RNA) where: Base-Base interactions energy: -247.627 where: short stacking energy: -124.164 Base-Backbone interact. energy: -0.592 local terms energy: -132.842338 where: bonds (distance) C4'-P energy: -25.370 bonds (distance) P-C4' energy: -28.874 flat angles C4'-P-C4' energy: -26.141 flat angles P-C4'-P energy: -17.624 tors. eta vs tors. theta energy: -34.834 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 125 Temperature: 0.950000 Total energy: -363.823340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.823340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.823340 (E_RNA) where: Base-Base interactions energy: -241.401 where: short stacking energy: -114.806 Base-Backbone interact. energy: -0.658 local terms energy: -121.764207 where: bonds (distance) C4'-P energy: -23.369 bonds (distance) P-C4' energy: -23.676 flat angles C4'-P-C4' energy: -24.582 flat angles P-C4'-P energy: -14.347 tors. eta vs tors. theta energy: -35.790 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 125 Temperature: 1.000000 Total energy: -356.848368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.848368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.848368 (E_RNA) where: Base-Base interactions energy: -235.702 where: short stacking energy: -127.796 Base-Backbone interact. energy: -0.046 local terms energy: -121.100475 where: bonds (distance) C4'-P energy: -22.844 bonds (distance) P-C4' energy: -17.562 flat angles C4'-P-C4' energy: -25.195 flat angles P-C4'-P energy: -15.566 tors. eta vs tors. theta energy: -39.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 125 Temperature: 1.050000 Total energy: -336.052709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.052709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.052709 (E_RNA) where: Base-Base interactions energy: -223.447 where: short stacking energy: -98.727 Base-Backbone interact. energy: 0.704 local terms energy: -113.309509 where: bonds (distance) C4'-P energy: -19.438 bonds (distance) P-C4' energy: -22.786 flat angles C4'-P-C4' energy: -25.980 flat angles P-C4'-P energy: -17.602 tors. eta vs tors. theta energy: -27.503 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 125 Temperature: 1.100000 Total energy: -342.055261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.055261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.063912 (E_RNA) where: Base-Base interactions energy: -221.669 where: short stacking energy: -114.091 Base-Backbone interact. energy: -0.498 local terms energy: -119.896679 where: bonds (distance) C4'-P energy: -18.150 bonds (distance) P-C4' energy: -24.666 flat angles C4'-P-C4' energy: -21.750 flat angles P-C4'-P energy: -19.934 tors. eta vs tors. theta energy: -35.396 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 125 Temperature: 1.150000 Total energy: -305.645361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.645361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.645361 (E_RNA) where: Base-Base interactions energy: -200.972 where: short stacking energy: -98.490 Base-Backbone interact. energy: -0.704 local terms energy: -103.969310 where: bonds (distance) C4'-P energy: -24.182 bonds (distance) P-C4' energy: -21.859 flat angles C4'-P-C4' energy: -20.239 flat angles P-C4'-P energy: -13.221 tors. eta vs tors. theta energy: -24.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 125 Temperature: 1.200000 Total energy: -294.161005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.161005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.161005 (E_RNA) where: Base-Base interactions energy: -199.507 where: short stacking energy: -105.785 Base-Backbone interact. energy: -0.075 local terms energy: -94.579468 where: bonds (distance) C4'-P energy: -15.890 bonds (distance) P-C4' energy: -19.880 flat angles C4'-P-C4' energy: -20.123 flat angles P-C4'-P energy: -15.396 tors. eta vs tors. theta energy: -23.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 125 Temperature: 1.250000 Total energy: -170.874348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.874348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.903994 (E_RNA) where: Base-Base interactions energy: -98.484 where: short stacking energy: -49.009 Base-Backbone interact. energy: -0.721 local terms energy: -71.698076 where: bonds (distance) C4'-P energy: -16.888 bonds (distance) P-C4' energy: -23.065 flat angles C4'-P-C4' energy: -14.800 flat angles P-C4'-P energy: -10.883 tors. eta vs tors. theta energy: -6.063 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 125 Temperature: 1.300000 Total energy: -253.563733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.563733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.563733 (E_RNA) where: Base-Base interactions energy: -149.905 where: short stacking energy: -80.618 Base-Backbone interact. energy: -0.148 local terms energy: -103.510718 where: bonds (distance) C4'-P energy: -23.818 bonds (distance) P-C4' energy: -17.702 flat angles C4'-P-C4' energy: -21.765 flat angles P-C4'-P energy: -13.416 tors. eta vs tors. theta energy: -26.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 125 Temperature: 1.350000 Total energy: -171.718916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.718916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.718916 (E_RNA) where: Base-Base interactions energy: -98.962 where: short stacking energy: -60.346 Base-Backbone interact. energy: -1.460 local terms energy: -71.297780 where: bonds (distance) C4'-P energy: -23.522 bonds (distance) P-C4' energy: -19.946 flat angles C4'-P-C4' energy: -14.207 flat angles P-C4'-P energy: -11.317 tors. eta vs tors. theta energy: -2.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 126 Temperature: 0.900000 Total energy: -385.672041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.672041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.672041 (E_RNA) where: Base-Base interactions energy: -251.668 where: short stacking energy: -131.403 Base-Backbone interact. energy: -0.315 local terms energy: -133.688716 where: bonds (distance) C4'-P energy: -25.307 bonds (distance) P-C4' energy: -24.482 flat angles C4'-P-C4' energy: -26.397 flat angles P-C4'-P energy: -19.690 tors. eta vs tors. theta energy: -37.813 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 126 Temperature: 0.950000 Total energy: -377.681639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.681639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.888603 (E_RNA) where: Base-Base interactions energy: -239.016 where: short stacking energy: -129.275 Base-Backbone interact. energy: -1.361 local terms energy: -137.511399 where: bonds (distance) C4'-P energy: -25.135 bonds (distance) P-C4' energy: -23.307 flat angles C4'-P-C4' energy: -27.527 flat angles P-C4'-P energy: -22.628 tors. eta vs tors. theta energy: -38.914 Dist. restrs. and SS energy: 0.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 126 Temperature: 1.000000 Total energy: -340.257284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.257284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.450212 (E_RNA) where: Base-Base interactions energy: -224.133 where: short stacking energy: -103.780 Base-Backbone interact. energy: -1.187 local terms energy: -115.130823 where: bonds (distance) C4'-P energy: -22.258 bonds (distance) P-C4' energy: -25.126 flat angles C4'-P-C4' energy: -25.785 flat angles P-C4'-P energy: -16.589 tors. eta vs tors. theta energy: -25.372 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 126 Temperature: 1.050000 Total energy: -335.442052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.442052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.442052 (E_RNA) where: Base-Base interactions energy: -221.966 where: short stacking energy: -103.212 Base-Backbone interact. energy: -0.625 local terms energy: -112.850878 where: bonds (distance) C4'-P energy: -24.094 bonds (distance) P-C4' energy: -23.929 flat angles C4'-P-C4' energy: -20.517 flat angles P-C4'-P energy: -15.311 tors. eta vs tors. theta energy: -28.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 126 Temperature: 1.100000 Total energy: -350.976340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.976340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.976340 (E_RNA) where: Base-Base interactions energy: -232.900 where: short stacking energy: -103.376 Base-Backbone interact. energy: 0.459 local terms energy: -118.535850 where: bonds (distance) C4'-P energy: -21.256 bonds (distance) P-C4' energy: -27.787 flat angles C4'-P-C4' energy: -19.269 flat angles P-C4'-P energy: -17.693 tors. eta vs tors. theta energy: -32.531 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 126 Temperature: 1.150000 Total energy: -318.613547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.613547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.613547 (E_RNA) where: Base-Base interactions energy: -202.504 where: short stacking energy: -97.158 Base-Backbone interact. energy: -0.943 local terms energy: -115.165872 where: bonds (distance) C4'-P energy: -27.881 bonds (distance) P-C4' energy: -21.349 flat angles C4'-P-C4' energy: -20.775 flat angles P-C4'-P energy: -15.302 tors. eta vs tors. theta energy: -29.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 126 Temperature: 1.200000 Total energy: -279.519831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.519831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.600447 (E_RNA) where: Base-Base interactions energy: -173.123 where: short stacking energy: -87.217 Base-Backbone interact. energy: -0.680 local terms energy: -105.797552 where: bonds (distance) C4'-P energy: -16.873 bonds (distance) P-C4' energy: -24.628 flat angles C4'-P-C4' energy: -18.640 flat angles P-C4'-P energy: -17.699 tors. eta vs tors. theta energy: -27.957 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 126 Temperature: 1.250000 Total energy: -169.215568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.215568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.449835 (E_RNA) where: Base-Base interactions energy: -95.955 where: short stacking energy: -64.612 Base-Backbone interact. energy: -0.215 local terms energy: -73.279845 where: bonds (distance) C4'-P energy: -17.658 bonds (distance) P-C4' energy: -22.797 flat angles C4'-P-C4' energy: -26.027 flat angles P-C4'-P energy: -1.503 tors. eta vs tors. theta energy: -5.295 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 126 Temperature: 1.300000 Total energy: -223.467445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.467445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.572258 (E_RNA) where: Base-Base interactions energy: -129.296 where: short stacking energy: -70.823 Base-Backbone interact. energy: 1.053 local terms energy: -95.329988 where: bonds (distance) C4'-P energy: -21.691 bonds (distance) P-C4' energy: -21.265 flat angles C4'-P-C4' energy: -23.217 flat angles P-C4'-P energy: -13.565 tors. eta vs tors. theta energy: -15.592 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 126 Temperature: 1.350000 Total energy: -162.593826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.593826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.865935 (E_RNA) where: Base-Base interactions energy: -101.753 where: short stacking energy: -58.859 Base-Backbone interact. energy: -1.706 local terms energy: -59.406788 where: bonds (distance) C4'-P energy: -10.597 bonds (distance) P-C4' energy: -16.686 flat angles C4'-P-C4' energy: -14.544 flat angles P-C4'-P energy: -12.851 tors. eta vs tors. theta energy: -4.730 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 127 Temperature: 0.900000 Total energy: -390.088885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.088885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.088885 (E_RNA) where: Base-Base interactions energy: -256.125 where: short stacking energy: -113.427 Base-Backbone interact. energy: -0.017 local terms energy: -133.946704 where: bonds (distance) C4'-P energy: -20.801 bonds (distance) P-C4' energy: -29.009 flat angles C4'-P-C4' energy: -26.100 flat angles P-C4'-P energy: -20.168 tors. eta vs tors. theta energy: -37.870 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 127 Temperature: 0.950000 Total energy: -361.638256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.638256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.638256 (E_RNA) where: Base-Base interactions energy: -235.610 where: short stacking energy: -120.933 Base-Backbone interact. energy: -0.818 local terms energy: -125.209768 where: bonds (distance) C4'-P energy: -25.184 bonds (distance) P-C4' energy: -20.480 flat angles C4'-P-C4' energy: -25.748 flat angles P-C4'-P energy: -17.694 tors. eta vs tors. theta energy: -36.105 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 127 Temperature: 1.000000 Total energy: -366.267580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.267580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.298628 (E_RNA) where: Base-Base interactions energy: -241.852 where: short stacking energy: -110.313 Base-Backbone interact. energy: -0.289 local terms energy: -124.158315 where: bonds (distance) C4'-P energy: -20.762 bonds (distance) P-C4' energy: -20.880 flat angles C4'-P-C4' energy: -28.205 flat angles P-C4'-P energy: -19.668 tors. eta vs tors. theta energy: -34.644 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 127 Temperature: 1.050000 Total energy: -335.574026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.574026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.654865 (E_RNA) where: Base-Base interactions energy: -224.535 where: short stacking energy: -103.264 Base-Backbone interact. energy: -0.529 local terms energy: -110.591036 where: bonds (distance) C4'-P energy: -19.562 bonds (distance) P-C4' energy: -24.736 flat angles C4'-P-C4' energy: -18.880 flat angles P-C4'-P energy: -21.311 tors. eta vs tors. theta energy: -26.103 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 127 Temperature: 1.100000 Total energy: -332.980607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.980607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.011286 (E_RNA) where: Base-Base interactions energy: -224.255 where: short stacking energy: -114.909 Base-Backbone interact. energy: -1.006 local terms energy: -107.750399 where: bonds (distance) C4'-P energy: -23.022 bonds (distance) P-C4' energy: -10.907 flat angles C4'-P-C4' energy: -24.944 flat angles P-C4'-P energy: -18.086 tors. eta vs tors. theta energy: -30.791 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 127 Temperature: 1.150000 Total energy: -299.921523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.921523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.921523 (E_RNA) where: Base-Base interactions energy: -192.205 where: short stacking energy: -92.683 Base-Backbone interact. energy: -0.275 local terms energy: -107.441548 where: bonds (distance) C4'-P energy: -22.604 bonds (distance) P-C4' energy: -21.450 flat angles C4'-P-C4' energy: -22.063 flat angles P-C4'-P energy: -15.004 tors. eta vs tors. theta energy: -26.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 127 Temperature: 1.200000 Total energy: -278.042499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.042499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.042499 (E_RNA) where: Base-Base interactions energy: -181.809 where: short stacking energy: -88.010 Base-Backbone interact. energy: -0.116 local terms energy: -96.117032 where: bonds (distance) C4'-P energy: -13.290 bonds (distance) P-C4' energy: -24.079 flat angles C4'-P-C4' energy: -20.739 flat angles P-C4'-P energy: -13.825 tors. eta vs tors. theta energy: -24.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 127 Temperature: 1.250000 Total energy: -243.882162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.882162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.917568 (E_RNA) where: Base-Base interactions energy: -154.828 where: short stacking energy: -68.682 Base-Backbone interact. energy: -0.474 local terms energy: -88.615144 where: bonds (distance) C4'-P energy: -13.737 bonds (distance) P-C4' energy: -24.765 flat angles C4'-P-C4' energy: -22.079 flat angles P-C4'-P energy: -12.394 tors. eta vs tors. theta energy: -15.639 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 127 Temperature: 1.300000 Total energy: -152.690695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.690695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.870898 (E_RNA) where: Base-Base interactions energy: -85.666 where: short stacking energy: -38.884 Base-Backbone interact. energy: -0.333 local terms energy: -66.871776 where: bonds (distance) C4'-P energy: -16.695 bonds (distance) P-C4' energy: -23.500 flat angles C4'-P-C4' energy: -16.109 flat angles P-C4'-P energy: -14.938 tors. eta vs tors. theta energy: 4.370 Dist. restrs. and SS energy: 0.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 127 Temperature: 1.350000 Total energy: -159.035591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.035591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.035591 (E_RNA) where: Base-Base interactions energy: -89.905 where: short stacking energy: -59.928 Base-Backbone interact. energy: -0.243 local terms energy: -68.887605 where: bonds (distance) C4'-P energy: -14.925 bonds (distance) P-C4' energy: -25.069 flat angles C4'-P-C4' energy: -14.630 flat angles P-C4'-P energy: -12.666 tors. eta vs tors. theta energy: -1.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 128 Temperature: 0.900000 Total energy: -373.507434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.507434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.585328 (E_RNA) where: Base-Base interactions energy: -244.295 where: short stacking energy: -125.088 Base-Backbone interact. energy: -0.038 local terms energy: -129.251799 where: bonds (distance) C4'-P energy: -24.612 bonds (distance) P-C4' energy: -23.201 flat angles C4'-P-C4' energy: -25.353 flat angles P-C4'-P energy: -17.460 tors. eta vs tors. theta energy: -38.626 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 128 Temperature: 0.950000 Total energy: -375.297311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.297311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.297311 (E_RNA) where: Base-Base interactions energy: -244.300 where: short stacking energy: -117.647 Base-Backbone interact. energy: -1.055 local terms energy: -129.942382 where: bonds (distance) C4'-P energy: -25.628 bonds (distance) P-C4' energy: -28.231 flat angles C4'-P-C4' energy: -27.049 flat angles P-C4'-P energy: -17.044 tors. eta vs tors. theta energy: -31.991 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 128 Temperature: 1.000000 Total energy: -353.432986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.432986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.432986 (E_RNA) where: Base-Base interactions energy: -239.175 where: short stacking energy: -106.894 Base-Backbone interact. energy: -0.511 local terms energy: -113.747341 where: bonds (distance) C4'-P energy: -19.592 bonds (distance) P-C4' energy: -21.904 flat angles C4'-P-C4' energy: -24.899 flat angles P-C4'-P energy: -18.413 tors. eta vs tors. theta energy: -28.940 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 128 Temperature: 1.050000 Total energy: -324.151650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.151650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.151650 (E_RNA) where: Base-Base interactions energy: -221.035 where: short stacking energy: -112.468 Base-Backbone interact. energy: -0.081 local terms energy: -103.036311 where: bonds (distance) C4'-P energy: -18.386 bonds (distance) P-C4' energy: -21.540 flat angles C4'-P-C4' energy: -24.897 flat angles P-C4'-P energy: -11.948 tors. eta vs tors. theta energy: -26.266 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 128 Temperature: 1.100000 Total energy: -343.133714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.133714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.136771 (E_RNA) where: Base-Base interactions energy: -234.104 where: short stacking energy: -127.587 Base-Backbone interact. energy: -0.389 local terms energy: -108.643730 where: bonds (distance) C4'-P energy: -19.785 bonds (distance) P-C4' energy: -19.863 flat angles C4'-P-C4' energy: -24.570 flat angles P-C4'-P energy: -9.442 tors. eta vs tors. theta energy: -34.984 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 128 Temperature: 1.150000 Total energy: -271.524505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.524505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.568102 (E_RNA) where: Base-Base interactions energy: -168.312 where: short stacking energy: -95.447 Base-Backbone interact. energy: 0.963 local terms energy: -104.218881 where: bonds (distance) C4'-P energy: -20.522 bonds (distance) P-C4' energy: -27.703 flat angles C4'-P-C4' energy: -19.374 flat angles P-C4'-P energy: -13.516 tors. eta vs tors. theta energy: -23.104 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 128 Temperature: 1.200000 Total energy: -234.945282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.945282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.243454 (E_RNA) where: Base-Base interactions energy: -141.091 where: short stacking energy: -69.733 Base-Backbone interact. energy: -1.014 local terms energy: -93.138592 where: bonds (distance) C4'-P energy: -21.261 bonds (distance) P-C4' energy: -23.612 flat angles C4'-P-C4' energy: -18.470 flat angles P-C4'-P energy: -18.584 tors. eta vs tors. theta energy: -11.212 Dist. restrs. and SS energy: 0.298 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 128 Temperature: 1.250000 Total energy: -240.400242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.400242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.412891 (E_RNA) where: Base-Base interactions energy: -143.944 where: short stacking energy: -74.179 Base-Backbone interact. energy: -0.561 local terms energy: -95.907542 where: bonds (distance) C4'-P energy: -21.037 bonds (distance) P-C4' energy: -19.954 flat angles C4'-P-C4' energy: -23.729 flat angles P-C4'-P energy: -15.764 tors. eta vs tors. theta energy: -15.424 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 128 Temperature: 1.300000 Total energy: -175.269165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.269165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.311964 (E_RNA) where: Base-Base interactions energy: -95.574 where: short stacking energy: -63.171 Base-Backbone interact. energy: 1.014 local terms energy: -80.752629 where: bonds (distance) C4'-P energy: -14.527 bonds (distance) P-C4' energy: -20.524 flat angles C4'-P-C4' energy: -18.321 flat angles P-C4'-P energy: -14.855 tors. eta vs tors. theta energy: -12.526 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 128 Temperature: 1.350000 Total energy: -145.980489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.980489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.980489 (E_RNA) where: Base-Base interactions energy: -73.211 where: short stacking energy: -40.608 Base-Backbone interact. energy: -1.342 local terms energy: -71.428187 where: bonds (distance) C4'-P energy: -17.454 bonds (distance) P-C4' energy: -23.139 flat angles C4'-P-C4' energy: -19.926 flat angles P-C4'-P energy: -9.193 tors. eta vs tors. theta energy: -1.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 129 Temperature: 0.900000 Total energy: -374.701985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.701985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.701985 (E_RNA) where: Base-Base interactions energy: -244.599 where: short stacking energy: -128.328 Base-Backbone interact. energy: -0.022 local terms energy: -130.080997 where: bonds (distance) C4'-P energy: -26.017 bonds (distance) P-C4' energy: -20.180 flat angles C4'-P-C4' energy: -30.044 flat angles P-C4'-P energy: -21.367 tors. eta vs tors. theta energy: -32.474 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 129 Temperature: 0.950000 Total energy: -362.844689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.844689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.852422 (E_RNA) where: Base-Base interactions energy: -248.029 where: short stacking energy: -114.290 Base-Backbone interact. energy: -1.232 local terms energy: -113.590956 where: bonds (distance) C4'-P energy: -19.164 bonds (distance) P-C4' energy: -23.819 flat angles C4'-P-C4' energy: -23.631 flat angles P-C4'-P energy: -14.741 tors. eta vs tors. theta energy: -32.235 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 129 Temperature: 1.000000 Total energy: -370.278308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.278308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.300224 (E_RNA) where: Base-Base interactions energy: -243.396 where: short stacking energy: -110.767 Base-Backbone interact. energy: -0.458 local terms energy: -126.445968 where: bonds (distance) C4'-P energy: -22.565 bonds (distance) P-C4' energy: -24.480 flat angles C4'-P-C4' energy: -25.649 flat angles P-C4'-P energy: -21.489 tors. eta vs tors. theta energy: -32.264 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 129 Temperature: 1.050000 Total energy: -350.941958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.941958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.941958 (E_RNA) where: Base-Base interactions energy: -227.107 where: short stacking energy: -113.929 Base-Backbone interact. energy: -0.261 local terms energy: -123.574167 where: bonds (distance) C4'-P energy: -27.191 bonds (distance) P-C4' energy: -21.360 flat angles C4'-P-C4' energy: -26.537 flat angles P-C4'-P energy: -16.601 tors. eta vs tors. theta energy: -31.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 129 Temperature: 1.100000 Total energy: -353.803968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.803968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.807815 (E_RNA) where: Base-Base interactions energy: -230.977 where: short stacking energy: -110.965 Base-Backbone interact. energy: -0.863 local terms energy: -121.967120 where: bonds (distance) C4'-P energy: -19.325 bonds (distance) P-C4' energy: -23.679 flat angles C4'-P-C4' energy: -22.025 flat angles P-C4'-P energy: -21.480 tors. eta vs tors. theta energy: -35.458 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 129 Temperature: 1.150000 Total energy: -268.495457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.495457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.665627 (E_RNA) where: Base-Base interactions energy: -162.553 where: short stacking energy: -85.655 Base-Backbone interact. energy: -0.074 local terms energy: -106.039033 where: bonds (distance) C4'-P energy: -23.256 bonds (distance) P-C4' energy: -18.125 flat angles C4'-P-C4' energy: -24.984 flat angles P-C4'-P energy: -18.328 tors. eta vs tors. theta energy: -21.346 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 129 Temperature: 1.200000 Total energy: -219.903033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.903033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.903033 (E_RNA) where: Base-Base interactions energy: -124.047 where: short stacking energy: -79.524 Base-Backbone interact. energy: -0.976 local terms energy: -94.879777 where: bonds (distance) C4'-P energy: -22.811 bonds (distance) P-C4' energy: -23.527 flat angles C4'-P-C4' energy: -26.972 flat angles P-C4'-P energy: -3.738 tors. eta vs tors. theta energy: -17.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 129 Temperature: 1.250000 Total energy: -238.238319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.238319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.277313 (E_RNA) where: Base-Base interactions energy: -152.624 where: short stacking energy: -79.095 Base-Backbone interact. energy: 0.410 local terms energy: -86.064080 where: bonds (distance) C4'-P energy: -15.560 bonds (distance) P-C4' energy: -24.263 flat angles C4'-P-C4' energy: -17.759 flat angles P-C4'-P energy: -11.542 tors. eta vs tors. theta energy: -16.941 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 129 Temperature: 1.300000 Total energy: -203.423935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.423935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.730750 (E_RNA) where: Base-Base interactions energy: -117.669 where: short stacking energy: -73.048 Base-Backbone interact. energy: -0.522 local terms energy: -85.539091 where: bonds (distance) C4'-P energy: -9.717 bonds (distance) P-C4' energy: -22.730 flat angles C4'-P-C4' energy: -25.347 flat angles P-C4'-P energy: -10.896 tors. eta vs tors. theta energy: -16.849 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 129 Temperature: 1.350000 Total energy: -149.470367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.470367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.470367 (E_RNA) where: Base-Base interactions energy: -77.821 where: short stacking energy: -48.985 Base-Backbone interact. energy: -0.118 local terms energy: -71.530878 where: bonds (distance) C4'-P energy: -15.508 bonds (distance) P-C4' energy: -24.703 flat angles C4'-P-C4' energy: -14.690 flat angles P-C4'-P energy: -10.586 tors. eta vs tors. theta energy: -6.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 130 Temperature: 0.900000 Total energy: -383.227031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.227031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.227031 (E_RNA) where: Base-Base interactions energy: -246.232 where: short stacking energy: -121.051 Base-Backbone interact. energy: -0.536 local terms energy: -136.459127 where: bonds (distance) C4'-P energy: -25.523 bonds (distance) P-C4' energy: -28.216 flat angles C4'-P-C4' energy: -29.558 flat angles P-C4'-P energy: -17.769 tors. eta vs tors. theta energy: -35.393 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 130 Temperature: 0.950000 Total energy: -375.659821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.659821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.659821 (E_RNA) where: Base-Base interactions energy: -243.275 where: short stacking energy: -114.839 Base-Backbone interact. energy: -0.226 local terms energy: -132.158460 where: bonds (distance) C4'-P energy: -24.431 bonds (distance) P-C4' energy: -23.938 flat angles C4'-P-C4' energy: -25.596 flat angles P-C4'-P energy: -20.232 tors. eta vs tors. theta energy: -37.962 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 130 Temperature: 1.000000 Total energy: -360.926987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.926987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.996804 (E_RNA) where: Base-Base interactions energy: -240.517 where: short stacking energy: -122.200 Base-Backbone interact. energy: -2.269 local terms energy: -118.211117 where: bonds (distance) C4'-P energy: -16.529 bonds (distance) P-C4' energy: -25.201 flat angles C4'-P-C4' energy: -25.619 flat angles P-C4'-P energy: -17.501 tors. eta vs tors. theta energy: -33.361 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 130 Temperature: 1.050000 Total energy: -357.675861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.675861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.722830 (E_RNA) where: Base-Base interactions energy: -243.889 where: short stacking energy: -122.470 Base-Backbone interact. energy: -0.124 local terms energy: -113.709340 where: bonds (distance) C4'-P energy: -16.440 bonds (distance) P-C4' energy: -20.968 flat angles C4'-P-C4' energy: -21.740 flat angles P-C4'-P energy: -18.204 tors. eta vs tors. theta energy: -36.357 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 130 Temperature: 1.100000 Total energy: -340.818344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.818344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.865481 (E_RNA) where: Base-Base interactions energy: -228.717 where: short stacking energy: -103.216 Base-Backbone interact. energy: -0.515 local terms energy: -111.634223 where: bonds (distance) C4'-P energy: -19.573 bonds (distance) P-C4' energy: -21.793 flat angles C4'-P-C4' energy: -23.591 flat angles P-C4'-P energy: -12.985 tors. eta vs tors. theta energy: -33.692 Dist. restrs. and SS energy: 0.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 130 Temperature: 1.150000 Total energy: -273.825488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.825488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.825488 (E_RNA) where: Base-Base interactions energy: -167.616 where: short stacking energy: -87.349 Base-Backbone interact. energy: -0.116 local terms energy: -106.093739 where: bonds (distance) C4'-P energy: -21.877 bonds (distance) P-C4' energy: -24.987 flat angles C4'-P-C4' energy: -20.233 flat angles P-C4'-P energy: -13.552 tors. eta vs tors. theta energy: -25.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 130 Temperature: 1.200000 Total energy: -255.835978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.835978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.835978 (E_RNA) where: Base-Base interactions energy: -158.838 where: short stacking energy: -72.150 Base-Backbone interact. energy: -1.062 local terms energy: -95.935290 where: bonds (distance) C4'-P energy: -20.902 bonds (distance) P-C4' energy: -21.432 flat angles C4'-P-C4' energy: -26.897 flat angles P-C4'-P energy: -15.214 tors. eta vs tors. theta energy: -11.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 130 Temperature: 1.250000 Total energy: -225.391370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.391370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.500327 (E_RNA) where: Base-Base interactions energy: -137.946 where: short stacking energy: -72.449 Base-Backbone interact. energy: -0.616 local terms energy: -86.938873 where: bonds (distance) C4'-P energy: -16.621 bonds (distance) P-C4' energy: -24.150 flat angles C4'-P-C4' energy: -19.331 flat angles P-C4'-P energy: -11.253 tors. eta vs tors. theta energy: -15.584 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 130 Temperature: 1.300000 Total energy: -162.717974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.717974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.773831 (E_RNA) where: Base-Base interactions energy: -80.657 where: short stacking energy: -41.255 Base-Backbone interact. energy: -0.889 local terms energy: -81.227688 where: bonds (distance) C4'-P energy: -20.050 bonds (distance) P-C4' energy: -26.346 flat angles C4'-P-C4' energy: -19.974 flat angles P-C4'-P energy: -16.134 tors. eta vs tors. theta energy: 1.277 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 130 Temperature: 1.350000 Total energy: -152.219845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.219845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.269112 (E_RNA) where: Base-Base interactions energy: -76.925 where: short stacking energy: -39.381 Base-Backbone interact. energy: -0.845 local terms energy: -74.499040 where: bonds (distance) C4'-P energy: -17.839 bonds (distance) P-C4' energy: -17.894 flat angles C4'-P-C4' energy: -24.029 flat angles P-C4'-P energy: -12.749 tors. eta vs tors. theta energy: -1.987 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 131 Temperature: 0.900000 Total energy: -384.212466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.212466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.212466 (E_RNA) where: Base-Base interactions energy: -258.180 where: short stacking energy: -127.082 Base-Backbone interact. energy: -0.421 local terms energy: -125.611437 where: bonds (distance) C4'-P energy: -26.981 bonds (distance) P-C4' energy: -20.064 flat angles C4'-P-C4' energy: -27.007 flat angles P-C4'-P energy: -17.629 tors. eta vs tors. theta energy: -33.929 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 131 Temperature: 0.950000 Total energy: -378.643979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.643979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.678874 (E_RNA) where: Base-Base interactions energy: -245.068 where: short stacking energy: -116.994 Base-Backbone interact. energy: -0.129 local terms energy: -133.481940 where: bonds (distance) C4'-P energy: -24.351 bonds (distance) P-C4' energy: -26.677 flat angles C4'-P-C4' energy: -27.603 flat angles P-C4'-P energy: -21.920 tors. eta vs tors. theta energy: -32.931 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 131 Temperature: 1.000000 Total energy: -350.094955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.094955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.388053 (E_RNA) where: Base-Base interactions energy: -223.630 where: short stacking energy: -118.453 Base-Backbone interact. energy: -1.516 local terms energy: -125.241505 where: bonds (distance) C4'-P energy: -19.797 bonds (distance) P-C4' energy: -26.498 flat angles C4'-P-C4' energy: -25.646 flat angles P-C4'-P energy: -14.164 tors. eta vs tors. theta energy: -39.137 Dist. restrs. and SS energy: 0.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 131 Temperature: 1.050000 Total energy: -346.640268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.640268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.640268 (E_RNA) where: Base-Base interactions energy: -234.318 where: short stacking energy: -111.035 Base-Backbone interact. energy: -0.004 local terms energy: -112.318092 where: bonds (distance) C4'-P energy: -20.279 bonds (distance) P-C4' energy: -24.138 flat angles C4'-P-C4' energy: -22.007 flat angles P-C4'-P energy: -11.122 tors. eta vs tors. theta energy: -34.773 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 131 Temperature: 1.100000 Total energy: -353.901002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.901002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.991853 (E_RNA) where: Base-Base interactions energy: -241.478 where: short stacking energy: -120.099 Base-Backbone interact. energy: -0.646 local terms energy: -111.868149 where: bonds (distance) C4'-P energy: -20.841 bonds (distance) P-C4' energy: -21.877 flat angles C4'-P-C4' energy: -23.405 flat angles P-C4'-P energy: -13.086 tors. eta vs tors. theta energy: -32.658 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 131 Temperature: 1.150000 Total energy: -278.564497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.564497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.564497 (E_RNA) where: Base-Base interactions energy: -189.399 where: short stacking energy: -93.382 Base-Backbone interact. energy: -0.528 local terms energy: -88.637510 where: bonds (distance) C4'-P energy: -22.948 bonds (distance) P-C4' energy: -14.647 flat angles C4'-P-C4' energy: -16.274 flat angles P-C4'-P energy: -15.443 tors. eta vs tors. theta energy: -19.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 131 Temperature: 1.200000 Total energy: -275.812998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.812998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.021284 (E_RNA) where: Base-Base interactions energy: -173.640 where: short stacking energy: -91.652 Base-Backbone interact. energy: -0.214 local terms energy: -102.166976 where: bonds (distance) C4'-P energy: -24.369 bonds (distance) P-C4' energy: -19.656 flat angles C4'-P-C4' energy: -26.416 flat angles P-C4'-P energy: -12.033 tors. eta vs tors. theta energy: -19.693 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 131 Temperature: 1.250000 Total energy: -180.033905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.033905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.108820 (E_RNA) where: Base-Base interactions energy: -107.335 where: short stacking energy: -62.899 Base-Backbone interact. energy: -0.636 local terms energy: -72.137474 where: bonds (distance) C4'-P energy: -10.461 bonds (distance) P-C4' energy: -22.163 flat angles C4'-P-C4' energy: -16.361 flat angles P-C4'-P energy: -14.766 tors. eta vs tors. theta energy: -8.386 Dist. restrs. and SS energy: 0.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 131 Temperature: 1.300000 Total energy: -218.311789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.311789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.364234 (E_RNA) where: Base-Base interactions energy: -138.208 where: short stacking energy: -72.685 Base-Backbone interact. energy: -1.073 local terms energy: -79.083939 where: bonds (distance) C4'-P energy: -15.414 bonds (distance) P-C4' energy: -26.734 flat angles C4'-P-C4' energy: -17.724 flat angles P-C4'-P energy: -11.449 tors. eta vs tors. theta energy: -7.763 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 131 Temperature: 1.350000 Total energy: -144.872055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.872055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.978832 (E_RNA) where: Base-Base interactions energy: -87.065 where: short stacking energy: -62.063 Base-Backbone interact. energy: 0.304 local terms energy: -58.218042 where: bonds (distance) C4'-P energy: -15.512 bonds (distance) P-C4' energy: -21.904 flat angles C4'-P-C4' energy: -11.751 flat angles P-C4'-P energy: -1.545 tors. eta vs tors. theta energy: -7.506 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 132 Temperature: 0.900000 Total energy: -372.804028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.804028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.858088 (E_RNA) where: Base-Base interactions energy: -246.431 where: short stacking energy: -120.551 Base-Backbone interact. energy: -0.516 local terms energy: -125.910861 where: bonds (distance) C4'-P energy: -23.579 bonds (distance) P-C4' energy: -22.941 flat angles C4'-P-C4' energy: -26.593 flat angles P-C4'-P energy: -15.703 tors. eta vs tors. theta energy: -37.095 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 132 Temperature: 0.950000 Total energy: -372.720610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.720610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.748586 (E_RNA) where: Base-Base interactions energy: -240.370 where: short stacking energy: -122.952 Base-Backbone interact. energy: -1.238 local terms energy: -131.140985 where: bonds (distance) C4'-P energy: -23.237 bonds (distance) P-C4' energy: -24.879 flat angles C4'-P-C4' energy: -28.660 flat angles P-C4'-P energy: -16.953 tors. eta vs tors. theta energy: -37.412 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 132 Temperature: 1.000000 Total energy: -359.059400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.059400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.068653 (E_RNA) where: Base-Base interactions energy: -231.893 where: short stacking energy: -118.674 Base-Backbone interact. energy: -0.057 local terms energy: -127.118975 where: bonds (distance) C4'-P energy: -24.650 bonds (distance) P-C4' energy: -21.286 flat angles C4'-P-C4' energy: -29.132 flat angles P-C4'-P energy: -18.752 tors. eta vs tors. theta energy: -33.299 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 132 Temperature: 1.050000 Total energy: -350.265279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.265279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.469954 (E_RNA) where: Base-Base interactions energy: -227.256 where: short stacking energy: -110.068 Base-Backbone interact. energy: -0.012 local terms energy: -123.201858 where: bonds (distance) C4'-P energy: -22.856 bonds (distance) P-C4' energy: -24.644 flat angles C4'-P-C4' energy: -23.830 flat angles P-C4'-P energy: -19.055 tors. eta vs tors. theta energy: -32.816 Dist. restrs. and SS energy: 0.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 132 Temperature: 1.100000 Total energy: -345.810062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.810062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.810062 (E_RNA) where: Base-Base interactions energy: -232.902 where: short stacking energy: -104.785 Base-Backbone interact. energy: -0.307 local terms energy: -112.600555 where: bonds (distance) C4'-P energy: -16.167 bonds (distance) P-C4' energy: -25.373 flat angles C4'-P-C4' energy: -22.902 flat angles P-C4'-P energy: -17.329 tors. eta vs tors. theta energy: -30.830 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 132 Temperature: 1.150000 Total energy: -289.219120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.219120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.219120 (E_RNA) where: Base-Base interactions energy: -194.454 where: short stacking energy: -102.529 Base-Backbone interact. energy: -0.126 local terms energy: -94.639328 where: bonds (distance) C4'-P energy: -18.940 bonds (distance) P-C4' energy: -16.737 flat angles C4'-P-C4' energy: -19.638 flat angles P-C4'-P energy: -16.479 tors. eta vs tors. theta energy: -22.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 132 Temperature: 1.200000 Total energy: -284.601732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.601732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.690418 (E_RNA) where: Base-Base interactions energy: -182.676 where: short stacking energy: -100.423 Base-Backbone interact. energy: -0.097 local terms energy: -101.917585 where: bonds (distance) C4'-P energy: -23.204 bonds (distance) P-C4' energy: -20.609 flat angles C4'-P-C4' energy: -23.822 flat angles P-C4'-P energy: -10.752 tors. eta vs tors. theta energy: -23.530 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 132 Temperature: 1.250000 Total energy: -178.599134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.599134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.599134 (E_RNA) where: Base-Base interactions energy: -99.573 where: short stacking energy: -61.372 Base-Backbone interact. energy: -0.140 local terms energy: -78.886078 where: bonds (distance) C4'-P energy: -17.791 bonds (distance) P-C4' energy: -15.117 flat angles C4'-P-C4' energy: -25.000 flat angles P-C4'-P energy: -11.944 tors. eta vs tors. theta energy: -9.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 132 Temperature: 1.300000 Total energy: -234.728605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.728605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.728605 (E_RNA) where: Base-Base interactions energy: -145.508 where: short stacking energy: -70.960 Base-Backbone interact. energy: 0.173 local terms energy: -89.393823 where: bonds (distance) C4'-P energy: -17.314 bonds (distance) P-C4' energy: -18.243 flat angles C4'-P-C4' energy: -25.335 flat angles P-C4'-P energy: -5.383 tors. eta vs tors. theta energy: -23.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 132 Temperature: 1.350000 Total energy: -159.958571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.958571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.989229 (E_RNA) where: Base-Base interactions energy: -80.583 where: short stacking energy: -50.478 Base-Backbone interact. energy: -0.296 local terms energy: -79.110548 where: bonds (distance) C4'-P energy: -17.368 bonds (distance) P-C4' energy: -17.870 flat angles C4'-P-C4' energy: -23.632 flat angles P-C4'-P energy: -16.348 tors. eta vs tors. theta energy: -3.893 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 133 Temperature: 0.900000 Total energy: -374.432274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.432274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.662083 (E_RNA) where: Base-Base interactions energy: -239.293 where: short stacking energy: -122.351 Base-Backbone interact. energy: -1.461 local terms energy: -133.908614 where: bonds (distance) C4'-P energy: -27.469 bonds (distance) P-C4' energy: -24.951 flat angles C4'-P-C4' energy: -24.814 flat angles P-C4'-P energy: -22.231 tors. eta vs tors. theta energy: -34.444 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 133 Temperature: 0.950000 Total energy: -366.736398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.736398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.761151 (E_RNA) where: Base-Base interactions energy: -233.830 where: short stacking energy: -116.440 Base-Backbone interact. energy: -1.725 local terms energy: -131.206314 where: bonds (distance) C4'-P energy: -25.134 bonds (distance) P-C4' energy: -25.666 flat angles C4'-P-C4' energy: -25.830 flat angles P-C4'-P energy: -18.102 tors. eta vs tors. theta energy: -36.475 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 133 Temperature: 1.000000 Total energy: -343.447274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.447274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.677418 (E_RNA) where: Base-Base interactions energy: -221.197 where: short stacking energy: -114.169 Base-Backbone interact. energy: -0.870 local terms energy: -121.611129 where: bonds (distance) C4'-P energy: -19.525 bonds (distance) P-C4' energy: -26.595 flat angles C4'-P-C4' energy: -26.069 flat angles P-C4'-P energy: -19.813 tors. eta vs tors. theta energy: -29.609 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 133 Temperature: 1.050000 Total energy: -346.295374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.295374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.326025 (E_RNA) where: Base-Base interactions energy: -230.422 where: short stacking energy: -111.491 Base-Backbone interact. energy: -0.413 local terms energy: -115.490886 where: bonds (distance) C4'-P energy: -18.535 bonds (distance) P-C4' energy: -23.099 flat angles C4'-P-C4' energy: -24.319 flat angles P-C4'-P energy: -21.101 tors. eta vs tors. theta energy: -28.438 Dist. restrs. and SS energy: 0.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 133 Temperature: 1.100000 Total energy: -336.418439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.418439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.418439 (E_RNA) where: Base-Base interactions energy: -222.896 where: short stacking energy: -103.881 Base-Backbone interact. energy: -0.255 local terms energy: -113.266997 where: bonds (distance) C4'-P energy: -21.749 bonds (distance) P-C4' energy: -17.840 flat angles C4'-P-C4' energy: -23.920 flat angles P-C4'-P energy: -17.615 tors. eta vs tors. theta energy: -32.143 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 133 Temperature: 1.150000 Total energy: -274.424395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.424395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.444436 (E_RNA) where: Base-Base interactions energy: -167.143 where: short stacking energy: -88.000 Base-Backbone interact. energy: -0.197 local terms energy: -107.104297 where: bonds (distance) C4'-P energy: -23.361 bonds (distance) P-C4' energy: -17.993 flat angles C4'-P-C4' energy: -25.012 flat angles P-C4'-P energy: -17.139 tors. eta vs tors. theta energy: -23.600 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 133 Temperature: 1.200000 Total energy: -258.534715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.534715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.534715 (E_RNA) where: Base-Base interactions energy: -164.530 where: short stacking energy: -84.576 Base-Backbone interact. energy: -1.811 local terms energy: -92.194028 where: bonds (distance) C4'-P energy: -14.639 bonds (distance) P-C4' energy: -21.045 flat angles C4'-P-C4' energy: -20.097 flat angles P-C4'-P energy: -15.177 tors. eta vs tors. theta energy: -21.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 133 Temperature: 1.250000 Total energy: -243.834616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.834616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.912317 (E_RNA) where: Base-Base interactions energy: -148.400 where: short stacking energy: -75.493 Base-Backbone interact. energy: -0.419 local terms energy: -95.093294 where: bonds (distance) C4'-P energy: -18.964 bonds (distance) P-C4' energy: -22.855 flat angles C4'-P-C4' energy: -20.448 flat angles P-C4'-P energy: -12.734 tors. eta vs tors. theta energy: -20.092 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 133 Temperature: 1.300000 Total energy: -166.905264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.905264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.944830 (E_RNA) where: Base-Base interactions energy: -84.102 where: short stacking energy: -47.203 Base-Backbone interact. energy: -0.327 local terms energy: -82.515223 where: bonds (distance) C4'-P energy: -17.599 bonds (distance) P-C4' energy: -24.817 flat angles C4'-P-C4' energy: -20.396 flat angles P-C4'-P energy: -8.793 tors. eta vs tors. theta energy: -10.910 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 133 Temperature: 1.350000 Total energy: -164.118912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.118912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.137348 (E_RNA) where: Base-Base interactions energy: -76.547 where: short stacking energy: -55.052 Base-Backbone interact. energy: -1.173 local terms energy: -86.416736 where: bonds (distance) C4'-P energy: -24.384 bonds (distance) P-C4' energy: -19.526 flat angles C4'-P-C4' energy: -18.365 flat angles P-C4'-P energy: -15.840 tors. eta vs tors. theta energy: -8.302 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 134 Temperature: 0.900000 Total energy: -373.845508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.845508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.874176 (E_RNA) where: Base-Base interactions energy: -243.737 where: short stacking energy: -114.157 Base-Backbone interact. energy: -0.028 local terms energy: -130.109396 where: bonds (distance) C4'-P energy: -23.110 bonds (distance) P-C4' energy: -27.621 flat angles C4'-P-C4' energy: -24.792 flat angles P-C4'-P energy: -18.964 tors. eta vs tors. theta energy: -35.622 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 134 Temperature: 0.950000 Total energy: -371.239647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.239647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.275940 (E_RNA) where: Base-Base interactions energy: -246.769 where: short stacking energy: -117.249 Base-Backbone interact. energy: -0.009 local terms energy: -124.497907 where: bonds (distance) C4'-P energy: -24.314 bonds (distance) P-C4' energy: -23.919 flat angles C4'-P-C4' energy: -19.448 flat angles P-C4'-P energy: -19.676 tors. eta vs tors. theta energy: -37.140 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 134 Temperature: 1.000000 Total energy: -349.165750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.165750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.170593 (E_RNA) where: Base-Base interactions energy: -235.846 where: short stacking energy: -115.837 Base-Backbone interact. energy: -0.644 local terms energy: -112.680411 where: bonds (distance) C4'-P energy: -21.078 bonds (distance) P-C4' energy: -18.872 flat angles C4'-P-C4' energy: -21.024 flat angles P-C4'-P energy: -18.894 tors. eta vs tors. theta energy: -32.812 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 134 Temperature: 1.050000 Total energy: -345.323574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.323574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.323574 (E_RNA) where: Base-Base interactions energy: -221.305 where: short stacking energy: -110.380 Base-Backbone interact. energy: -0.016 local terms energy: -124.002801 where: bonds (distance) C4'-P energy: -23.029 bonds (distance) P-C4' energy: -23.401 flat angles C4'-P-C4' energy: -23.812 flat angles P-C4'-P energy: -17.514 tors. eta vs tors. theta energy: -36.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 134 Temperature: 1.100000 Total energy: -325.693097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.693097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.700904 (E_RNA) where: Base-Base interactions energy: -209.830 where: short stacking energy: -110.469 Base-Backbone interact. energy: -0.695 local terms energy: -115.175313 where: bonds (distance) C4'-P energy: -20.286 bonds (distance) P-C4' energy: -21.976 flat angles C4'-P-C4' energy: -22.554 flat angles P-C4'-P energy: -14.895 tors. eta vs tors. theta energy: -35.464 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 134 Temperature: 1.150000 Total energy: -296.345427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.345427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.345427 (E_RNA) where: Base-Base interactions energy: -189.907 where: short stacking energy: -96.822 Base-Backbone interact. energy: -0.490 local terms energy: -105.947846 where: bonds (distance) C4'-P energy: -19.924 bonds (distance) P-C4' energy: -24.578 flat angles C4'-P-C4' energy: -21.756 flat angles P-C4'-P energy: -14.990 tors. eta vs tors. theta energy: -24.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 134 Temperature: 1.200000 Total energy: -307.618267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.618267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.618267 (E_RNA) where: Base-Base interactions energy: -194.134 where: short stacking energy: -106.920 Base-Backbone interact. energy: -0.019 local terms energy: -113.464796 where: bonds (distance) C4'-P energy: -22.078 bonds (distance) P-C4' energy: -22.110 flat angles C4'-P-C4' energy: -22.782 flat angles P-C4'-P energy: -17.801 tors. eta vs tors. theta energy: -28.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 134 Temperature: 1.250000 Total energy: -244.110147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.110147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.232085 (E_RNA) where: Base-Base interactions energy: -137.192 where: short stacking energy: -71.248 Base-Backbone interact. energy: -1.276 local terms energy: -105.764107 where: bonds (distance) C4'-P energy: -25.495 bonds (distance) P-C4' energy: -25.486 flat angles C4'-P-C4' energy: -24.042 flat angles P-C4'-P energy: -11.059 tors. eta vs tors. theta energy: -19.683 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 134 Temperature: 1.300000 Total energy: -172.978926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.978926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.978926 (E_RNA) where: Base-Base interactions energy: -97.517 where: short stacking energy: -56.166 Base-Backbone interact. energy: -0.446 local terms energy: -75.015927 where: bonds (distance) C4'-P energy: -16.122 bonds (distance) P-C4' energy: -19.632 flat angles C4'-P-C4' energy: -19.279 flat angles P-C4'-P energy: -16.553 tors. eta vs tors. theta energy: -3.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 134 Temperature: 1.350000 Total energy: -162.417736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.417736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.417736 (E_RNA) where: Base-Base interactions energy: -79.564 where: short stacking energy: -52.477 Base-Backbone interact. energy: -0.290 local terms energy: -82.563971 where: bonds (distance) C4'-P energy: -17.107 bonds (distance) P-C4' energy: -17.186 flat angles C4'-P-C4' energy: -21.492 flat angles P-C4'-P energy: -16.216 tors. eta vs tors. theta energy: -10.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 135 Temperature: 0.900000 Total energy: -373.176148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.176148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.192429 (E_RNA) where: Base-Base interactions energy: -248.446 where: short stacking energy: -128.255 Base-Backbone interact. energy: -0.380 local terms energy: -124.367036 where: bonds (distance) C4'-P energy: -25.436 bonds (distance) P-C4' energy: -22.999 flat angles C4'-P-C4' energy: -26.756 flat angles P-C4'-P energy: -18.085 tors. eta vs tors. theta energy: -31.091 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 135 Temperature: 0.950000 Total energy: -378.360058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.360058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.384343 (E_RNA) where: Base-Base interactions energy: -247.441 where: short stacking energy: -128.749 Base-Backbone interact. energy: -0.709 local terms energy: -130.234384 where: bonds (distance) C4'-P energy: -25.581 bonds (distance) P-C4' energy: -25.443 flat angles C4'-P-C4' energy: -24.860 flat angles P-C4'-P energy: -16.014 tors. eta vs tors. theta energy: -38.336 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 135 Temperature: 1.000000 Total energy: -360.248909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.248909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.248909 (E_RNA) where: Base-Base interactions energy: -232.946 where: short stacking energy: -112.053 Base-Backbone interact. energy: -0.616 local terms energy: -126.687293 where: bonds (distance) C4'-P energy: -23.271 bonds (distance) P-C4' energy: -24.254 flat angles C4'-P-C4' energy: -24.434 flat angles P-C4'-P energy: -19.877 tors. eta vs tors. theta energy: -34.852 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 135 Temperature: 1.050000 Total energy: -343.584754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.584754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.589299 (E_RNA) where: Base-Base interactions energy: -222.237 where: short stacking energy: -116.573 Base-Backbone interact. energy: -0.122 local terms energy: -121.230219 where: bonds (distance) C4'-P energy: -21.892 bonds (distance) P-C4' energy: -25.167 flat angles C4'-P-C4' energy: -26.047 flat angles P-C4'-P energy: -16.511 tors. eta vs tors. theta energy: -31.613 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 135 Temperature: 1.100000 Total energy: -322.958044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.958044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.958044 (E_RNA) where: Base-Base interactions energy: -208.855 where: short stacking energy: -93.722 Base-Backbone interact. energy: -0.956 local terms energy: -113.147900 where: bonds (distance) C4'-P energy: -25.978 bonds (distance) P-C4' energy: -22.262 flat angles C4'-P-C4' energy: -27.174 flat angles P-C4'-P energy: -8.553 tors. eta vs tors. theta energy: -29.181 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 135 Temperature: 1.150000 Total energy: -300.922077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.922077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.051551 (E_RNA) where: Base-Base interactions energy: -187.537 where: short stacking energy: -89.631 Base-Backbone interact. energy: -0.869 local terms energy: -112.645515 where: bonds (distance) C4'-P energy: -21.596 bonds (distance) P-C4' energy: -23.223 flat angles C4'-P-C4' energy: -24.397 flat angles P-C4'-P energy: -15.579 tors. eta vs tors. theta energy: -27.851 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 135 Temperature: 1.200000 Total energy: -262.610379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.610379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.726256 (E_RNA) where: Base-Base interactions energy: -166.979 where: short stacking energy: -82.015 Base-Backbone interact. energy: -0.787 local terms energy: -94.960816 where: bonds (distance) C4'-P energy: -19.993 bonds (distance) P-C4' energy: -18.703 flat angles C4'-P-C4' energy: -22.540 flat angles P-C4'-P energy: -15.414 tors. eta vs tors. theta energy: -18.311 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 135 Temperature: 1.250000 Total energy: -169.090560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.090560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.090560 (E_RNA) where: Base-Base interactions energy: -90.221 where: short stacking energy: -47.533 Base-Backbone interact. energy: -0.536 local terms energy: -78.333121 where: bonds (distance) C4'-P energy: -18.970 bonds (distance) P-C4' energy: -22.429 flat angles C4'-P-C4' energy: -20.417 flat angles P-C4'-P energy: -17.727 tors. eta vs tors. theta energy: 1.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 135 Temperature: 1.300000 Total energy: -268.243761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.243761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.272979 (E_RNA) where: Base-Base interactions energy: -170.905 where: short stacking energy: -92.374 Base-Backbone interact. energy: -0.654 local terms energy: -96.714437 where: bonds (distance) C4'-P energy: -19.239 bonds (distance) P-C4' energy: -25.247 flat angles C4'-P-C4' energy: -23.075 flat angles P-C4'-P energy: -6.231 tors. eta vs tors. theta energy: -22.923 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 135 Temperature: 1.350000 Total energy: -149.158998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.158998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.194253 (E_RNA) where: Base-Base interactions energy: -87.950 where: short stacking energy: -61.510 Base-Backbone interact. energy: 1.087 local terms energy: -62.331935 where: bonds (distance) C4'-P energy: -14.826 bonds (distance) P-C4' energy: -17.040 flat angles C4'-P-C4' energy: -13.365 flat angles P-C4'-P energy: -12.839 tors. eta vs tors. theta energy: -4.263 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 136 Temperature: 0.900000 Total energy: -385.828688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.828688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.160006 (E_RNA) where: Base-Base interactions energy: -254.057 where: short stacking energy: -138.173 Base-Backbone interact. energy: -0.427 local terms energy: -131.675968 where: bonds (distance) C4'-P energy: -25.073 bonds (distance) P-C4' energy: -22.016 flat angles C4'-P-C4' energy: -25.675 flat angles P-C4'-P energy: -18.752 tors. eta vs tors. theta energy: -40.160 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 136 Temperature: 0.950000 Total energy: -379.038983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.038983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.052954 (E_RNA) where: Base-Base interactions energy: -242.687 where: short stacking energy: -123.857 Base-Backbone interact. energy: -0.720 local terms energy: -135.645620 where: bonds (distance) C4'-P energy: -27.716 bonds (distance) P-C4' energy: -27.696 flat angles C4'-P-C4' energy: -27.694 flat angles P-C4'-P energy: -15.962 tors. eta vs tors. theta energy: -36.578 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 136 Temperature: 1.000000 Total energy: -361.944342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.944342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.075012 (E_RNA) where: Base-Base interactions energy: -237.064 where: short stacking energy: -121.066 Base-Backbone interact. energy: 3.942 local terms energy: -128.953378 where: bonds (distance) C4'-P energy: -21.241 bonds (distance) P-C4' energy: -23.880 flat angles C4'-P-C4' energy: -28.642 flat angles P-C4'-P energy: -20.099 tors. eta vs tors. theta energy: -35.091 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 136 Temperature: 1.050000 Total energy: -353.960706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.960706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.960706 (E_RNA) where: Base-Base interactions energy: -237.015 where: short stacking energy: -114.512 Base-Backbone interact. energy: -0.988 local terms energy: -115.957480 where: bonds (distance) C4'-P energy: -21.818 bonds (distance) P-C4' energy: -23.907 flat angles C4'-P-C4' energy: -24.090 flat angles P-C4'-P energy: -15.666 tors. eta vs tors. theta energy: -30.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 136 Temperature: 1.100000 Total energy: -336.063378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.063378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.064264 (E_RNA) where: Base-Base interactions energy: -222.283 where: short stacking energy: -104.785 Base-Backbone interact. energy: -0.093 local terms energy: -113.688147 where: bonds (distance) C4'-P energy: -18.534 bonds (distance) P-C4' energy: -22.728 flat angles C4'-P-C4' energy: -24.281 flat angles P-C4'-P energy: -20.282 tors. eta vs tors. theta energy: -27.863 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 136 Temperature: 1.150000 Total energy: -313.962177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.962177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.962177 (E_RNA) where: Base-Base interactions energy: -197.034 where: short stacking energy: -96.023 Base-Backbone interact. energy: -0.208 local terms energy: -116.720204 where: bonds (distance) C4'-P energy: -21.984 bonds (distance) P-C4' energy: -21.020 flat angles C4'-P-C4' energy: -22.790 flat angles P-C4'-P energy: -20.190 tors. eta vs tors. theta energy: -30.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 136 Temperature: 1.200000 Total energy: -236.397149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.397149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.397149 (E_RNA) where: Base-Base interactions energy: -141.114 where: short stacking energy: -74.076 Base-Backbone interact. energy: -0.395 local terms energy: -94.888533 where: bonds (distance) C4'-P energy: -20.167 bonds (distance) P-C4' energy: -24.728 flat angles C4'-P-C4' energy: -23.064 flat angles P-C4'-P energy: -10.805 tors. eta vs tors. theta energy: -16.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 136 Temperature: 1.250000 Total energy: -187.105488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.105488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.105488 (E_RNA) where: Base-Base interactions energy: -104.753 where: short stacking energy: -56.821 Base-Backbone interact. energy: -0.682 local terms energy: -81.671390 where: bonds (distance) C4'-P energy: -16.937 bonds (distance) P-C4' energy: -22.821 flat angles C4'-P-C4' energy: -15.327 flat angles P-C4'-P energy: -14.994 tors. eta vs tors. theta energy: -11.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 136 Temperature: 1.300000 Total energy: -233.239989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.239989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.239989 (E_RNA) where: Base-Base interactions energy: -144.027 where: short stacking energy: -65.567 Base-Backbone interact. energy: -0.940 local terms energy: -88.273028 where: bonds (distance) C4'-P energy: -22.888 bonds (distance) P-C4' energy: -18.056 flat angles C4'-P-C4' energy: -24.931 flat angles P-C4'-P energy: -16.668 tors. eta vs tors. theta energy: -5.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 136 Temperature: 1.350000 Total energy: -165.499962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.499962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.598246 (E_RNA) where: Base-Base interactions energy: -93.677 where: short stacking energy: -60.891 Base-Backbone interact. energy: -0.246 local terms energy: -71.675296 where: bonds (distance) C4'-P energy: -21.777 bonds (distance) P-C4' energy: -12.247 flat angles C4'-P-C4' energy: -18.274 flat angles P-C4'-P energy: -9.543 tors. eta vs tors. theta energy: -9.834 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 137 Temperature: 0.900000 Total energy: -364.405351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.405351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.405351 (E_RNA) where: Base-Base interactions energy: -241.823 where: short stacking energy: -123.494 Base-Backbone interact. energy: -0.447 local terms energy: -122.135053 where: bonds (distance) C4'-P energy: -21.357 bonds (distance) P-C4' energy: -23.300 flat angles C4'-P-C4' energy: -25.951 flat angles P-C4'-P energy: -15.928 tors. eta vs tors. theta energy: -35.600 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 137 Temperature: 0.950000 Total energy: -366.738724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.738724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.738724 (E_RNA) where: Base-Base interactions energy: -236.536 where: short stacking energy: -119.668 Base-Backbone interact. energy: -0.494 local terms energy: -129.708353 where: bonds (distance) C4'-P energy: -25.118 bonds (distance) P-C4' energy: -24.997 flat angles C4'-P-C4' energy: -25.968 flat angles P-C4'-P energy: -19.206 tors. eta vs tors. theta energy: -34.419 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 137 Temperature: 1.000000 Total energy: -351.668786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.668786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.668786 (E_RNA) where: Base-Base interactions energy: -229.636 where: short stacking energy: -112.832 Base-Backbone interact. energy: -0.953 local terms energy: -121.079659 where: bonds (distance) C4'-P energy: -24.919 bonds (distance) P-C4' energy: -17.699 flat angles C4'-P-C4' energy: -27.359 flat angles P-C4'-P energy: -17.839 tors. eta vs tors. theta energy: -33.264 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 137 Temperature: 1.050000 Total energy: -340.771286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.771286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.771286 (E_RNA) where: Base-Base interactions energy: -218.894 where: short stacking energy: -101.993 Base-Backbone interact. energy: -0.525 local terms energy: -121.352679 where: bonds (distance) C4'-P energy: -24.706 bonds (distance) P-C4' energy: -19.690 flat angles C4'-P-C4' energy: -27.088 flat angles P-C4'-P energy: -18.802 tors. eta vs tors. theta energy: -31.067 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 137 Temperature: 1.100000 Total energy: -334.248625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.248625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.272091 (E_RNA) where: Base-Base interactions energy: -213.789 where: short stacking energy: -113.897 Base-Backbone interact. energy: -0.021 local terms energy: -120.462064 where: bonds (distance) C4'-P energy: -19.463 bonds (distance) P-C4' energy: -21.076 flat angles C4'-P-C4' energy: -25.120 flat angles P-C4'-P energy: -18.166 tors. eta vs tors. theta energy: -36.638 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 137 Temperature: 1.150000 Total energy: -305.298639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.298639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.383028 (E_RNA) where: Base-Base interactions energy: -195.057 where: short stacking energy: -90.070 Base-Backbone interact. energy: -0.748 local terms energy: -109.578108 where: bonds (distance) C4'-P energy: -22.696 bonds (distance) P-C4' energy: -25.325 flat angles C4'-P-C4' energy: -21.749 flat angles P-C4'-P energy: -14.896 tors. eta vs tors. theta energy: -24.912 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 137 Temperature: 1.200000 Total energy: -250.920211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.920211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.920211 (E_RNA) where: Base-Base interactions energy: -155.092 where: short stacking energy: -85.697 Base-Backbone interact. energy: -0.314 local terms energy: -95.513946 where: bonds (distance) C4'-P energy: -23.372 bonds (distance) P-C4' energy: -22.557 flat angles C4'-P-C4' energy: -17.022 flat angles P-C4'-P energy: -16.228 tors. eta vs tors. theta energy: -16.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 137 Temperature: 1.250000 Total energy: -255.095984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.095984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.136006 (E_RNA) where: Base-Base interactions energy: -161.862 where: short stacking energy: -82.697 Base-Backbone interact. energy: -0.873 local terms energy: -92.400253 where: bonds (distance) C4'-P energy: -23.202 bonds (distance) P-C4' energy: -21.184 flat angles C4'-P-C4' energy: -16.397 flat angles P-C4'-P energy: -10.738 tors. eta vs tors. theta energy: -20.879 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 137 Temperature: 1.300000 Total energy: -181.867141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.867141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.922678 (E_RNA) where: Base-Base interactions energy: -97.121 where: short stacking energy: -68.428 Base-Backbone interact. energy: -0.208 local terms energy: -84.593217 where: bonds (distance) C4'-P energy: -19.006 bonds (distance) P-C4' energy: -21.038 flat angles C4'-P-C4' energy: -18.893 flat angles P-C4'-P energy: -13.168 tors. eta vs tors. theta energy: -12.488 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 137 Temperature: 1.350000 Total energy: -140.818612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.818612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.834503 (E_RNA) where: Base-Base interactions energy: -79.708 where: short stacking energy: -42.843 Base-Backbone interact. energy: -0.385 local terms energy: -60.742294 where: bonds (distance) C4'-P energy: -15.523 bonds (distance) P-C4' energy: -23.434 flat angles C4'-P-C4' energy: -17.553 flat angles P-C4'-P energy: -8.171 tors. eta vs tors. theta energy: 3.939 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 138 Temperature: 0.900000 Total energy: -377.078418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.078418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.078418 (E_RNA) where: Base-Base interactions energy: -254.553 where: short stacking energy: -119.693 Base-Backbone interact. energy: -2.346 local terms energy: -120.179150 where: bonds (distance) C4'-P energy: -24.551 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -26.949 flat angles P-C4'-P energy: -17.623 tors. eta vs tors. theta energy: -35.267 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 138 Temperature: 0.950000 Total energy: -366.010602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.010602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.043512 (E_RNA) where: Base-Base interactions energy: -239.238 where: short stacking energy: -114.028 Base-Backbone interact. energy: -0.748 local terms energy: -126.057358 where: bonds (distance) C4'-P energy: -26.934 bonds (distance) P-C4' energy: -22.045 flat angles C4'-P-C4' energy: -28.673 flat angles P-C4'-P energy: -17.797 tors. eta vs tors. theta energy: -30.608 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 138 Temperature: 1.000000 Total energy: -365.968399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.968399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.968399 (E_RNA) where: Base-Base interactions energy: -238.311 where: short stacking energy: -119.757 Base-Backbone interact. energy: -0.844 local terms energy: -126.813678 where: bonds (distance) C4'-P energy: -18.515 bonds (distance) P-C4' energy: -26.754 flat angles C4'-P-C4' energy: -23.401 flat angles P-C4'-P energy: -19.729 tors. eta vs tors. theta energy: -38.415 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 138 Temperature: 1.050000 Total energy: -357.166700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.166700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.166700 (E_RNA) where: Base-Base interactions energy: -236.404 where: short stacking energy: -107.433 Base-Backbone interact. energy: -0.087 local terms energy: -120.675840 where: bonds (distance) C4'-P energy: -21.736 bonds (distance) P-C4' energy: -21.787 flat angles C4'-P-C4' energy: -23.408 flat angles P-C4'-P energy: -19.223 tors. eta vs tors. theta energy: -34.522 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 138 Temperature: 1.100000 Total energy: -321.578396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.578396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.727550 (E_RNA) where: Base-Base interactions energy: -214.486 where: short stacking energy: -96.874 Base-Backbone interact. energy: -0.139 local terms energy: -107.101622 where: bonds (distance) C4'-P energy: -18.941 bonds (distance) P-C4' energy: -22.612 flat angles C4'-P-C4' energy: -20.454 flat angles P-C4'-P energy: -14.258 tors. eta vs tors. theta energy: -30.837 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 138 Temperature: 1.150000 Total energy: -284.569294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.569294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.594878 (E_RNA) where: Base-Base interactions energy: -187.110 where: short stacking energy: -87.652 Base-Backbone interact. energy: -1.701 local terms energy: -95.784171 where: bonds (distance) C4'-P energy: -22.832 bonds (distance) P-C4' energy: -14.396 flat angles C4'-P-C4' energy: -18.650 flat angles P-C4'-P energy: -16.409 tors. eta vs tors. theta energy: -23.498 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 138 Temperature: 1.200000 Total energy: -231.887757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.887757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.887757 (E_RNA) where: Base-Base interactions energy: -132.676 where: short stacking energy: -65.701 Base-Backbone interact. energy: 0.678 local terms energy: -99.889801 where: bonds (distance) C4'-P energy: -24.894 bonds (distance) P-C4' energy: -23.543 flat angles C4'-P-C4' energy: -19.173 flat angles P-C4'-P energy: -17.194 tors. eta vs tors. theta energy: -15.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 138 Temperature: 1.250000 Total energy: -228.272207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.272207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.287485 (E_RNA) where: Base-Base interactions energy: -146.649 where: short stacking energy: -82.304 Base-Backbone interact. energy: -0.146 local terms energy: -81.492348 where: bonds (distance) C4'-P energy: -22.885 bonds (distance) P-C4' energy: -12.674 flat angles C4'-P-C4' energy: -19.118 flat angles P-C4'-P energy: -12.583 tors. eta vs tors. theta energy: -14.233 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 138 Temperature: 1.300000 Total energy: -164.885960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.885960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.905023 (E_RNA) where: Base-Base interactions energy: -82.784 where: short stacking energy: -46.225 Base-Backbone interact. energy: 0.121 local terms energy: -82.241522 where: bonds (distance) C4'-P energy: -20.110 bonds (distance) P-C4' energy: -18.164 flat angles C4'-P-C4' energy: -22.410 flat angles P-C4'-P energy: -17.264 tors. eta vs tors. theta energy: -4.293 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 138 Temperature: 1.350000 Total energy: -121.735706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.735706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.871392 (E_RNA) where: Base-Base interactions energy: -54.737 where: short stacking energy: -40.280 Base-Backbone interact. energy: 0.166 local terms energy: -67.300715 where: bonds (distance) C4'-P energy: -17.189 bonds (distance) P-C4' energy: -23.468 flat angles C4'-P-C4' energy: -12.116 flat angles P-C4'-P energy: -16.523 tors. eta vs tors. theta energy: 1.996 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 139 Temperature: 0.900000 Total energy: -372.262485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.262485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.265099 (E_RNA) where: Base-Base interactions energy: -246.015 where: short stacking energy: -116.628 Base-Backbone interact. energy: -0.362 local terms energy: -125.887660 where: bonds (distance) C4'-P energy: -23.003 bonds (distance) P-C4' energy: -20.424 flat angles C4'-P-C4' energy: -25.700 flat angles P-C4'-P energy: -20.215 tors. eta vs tors. theta energy: -36.546 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 139 Temperature: 0.950000 Total energy: -373.212264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.212264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.229992 (E_RNA) where: Base-Base interactions energy: -241.543 where: short stacking energy: -124.666 Base-Backbone interact. energy: -0.434 local terms energy: -131.252704 where: bonds (distance) C4'-P energy: -25.256 bonds (distance) P-C4' energy: -25.266 flat angles C4'-P-C4' energy: -26.566 flat angles P-C4'-P energy: -20.133 tors. eta vs tors. theta energy: -34.032 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 139 Temperature: 1.000000 Total energy: -377.159194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.159194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.174592 (E_RNA) where: Base-Base interactions energy: -248.567 where: short stacking energy: -129.730 Base-Backbone interact. energy: -0.613 local terms energy: -127.994459 where: bonds (distance) C4'-P energy: -19.645 bonds (distance) P-C4' energy: -25.504 flat angles C4'-P-C4' energy: -26.605 flat angles P-C4'-P energy: -17.140 tors. eta vs tors. theta energy: -39.099 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 139 Temperature: 1.050000 Total energy: -338.524607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.524607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.524607 (E_RNA) where: Base-Base interactions energy: -216.536 where: short stacking energy: -104.358 Base-Backbone interact. energy: -1.547 local terms energy: -120.440673 where: bonds (distance) C4'-P energy: -23.462 bonds (distance) P-C4' energy: -23.509 flat angles C4'-P-C4' energy: -25.279 flat angles P-C4'-P energy: -13.323 tors. eta vs tors. theta energy: -34.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 139 Temperature: 1.100000 Total energy: -354.402043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.402043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.623056 (E_RNA) where: Base-Base interactions energy: -233.563 where: short stacking energy: -117.184 Base-Backbone interact. energy: -0.166 local terms energy: -120.893588 where: bonds (distance) C4'-P energy: -25.470 bonds (distance) P-C4' energy: -24.641 flat angles C4'-P-C4' energy: -18.079 flat angles P-C4'-P energy: -19.125 tors. eta vs tors. theta energy: -33.579 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 139 Temperature: 1.150000 Total energy: -273.640449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.640449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.640449 (E_RNA) where: Base-Base interactions energy: -177.834 where: short stacking energy: -85.652 Base-Backbone interact. energy: 0.300 local terms energy: -96.106114 where: bonds (distance) C4'-P energy: -16.565 bonds (distance) P-C4' energy: -21.025 flat angles C4'-P-C4' energy: -21.947 flat angles P-C4'-P energy: -12.247 tors. eta vs tors. theta energy: -24.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 139 Temperature: 1.200000 Total energy: -280.105439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.105439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.105439 (E_RNA) where: Base-Base interactions energy: -182.042 where: short stacking energy: -91.917 Base-Backbone interact. energy: -0.465 local terms energy: -97.598673 where: bonds (distance) C4'-P energy: -17.847 bonds (distance) P-C4' energy: -24.419 flat angles C4'-P-C4' energy: -23.290 flat angles P-C4'-P energy: -14.290 tors. eta vs tors. theta energy: -17.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 139 Temperature: 1.250000 Total energy: -252.510605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.510605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.518697 (E_RNA) where: Base-Base interactions energy: -163.168 where: short stacking energy: -87.026 Base-Backbone interact. energy: -0.127 local terms energy: -89.223182 where: bonds (distance) C4'-P energy: -18.755 bonds (distance) P-C4' energy: -19.827 flat angles C4'-P-C4' energy: -19.116 flat angles P-C4'-P energy: -14.095 tors. eta vs tors. theta energy: -17.431 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 139 Temperature: 1.300000 Total energy: -158.978571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.978571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.179335 (E_RNA) where: Base-Base interactions energy: -85.932 where: short stacking energy: -45.432 Base-Backbone interact. energy: -0.609 local terms energy: -72.638047 where: bonds (distance) C4'-P energy: -20.130 bonds (distance) P-C4' energy: -14.470 flat angles C4'-P-C4' energy: -15.943 flat angles P-C4'-P energy: -12.923 tors. eta vs tors. theta energy: -9.172 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 139 Temperature: 1.350000 Total energy: -122.186081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.186081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.199450 (E_RNA) where: Base-Base interactions energy: -49.818 where: short stacking energy: -29.495 Base-Backbone interact. energy: -1.286 local terms energy: -71.095836 where: bonds (distance) C4'-P energy: -16.566 bonds (distance) P-C4' energy: -22.226 flat angles C4'-P-C4' energy: -19.962 flat angles P-C4'-P energy: -18.481 tors. eta vs tors. theta energy: 6.140 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 140 Temperature: 0.900000 Total energy: -379.859224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.859224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.924998 (E_RNA) where: Base-Base interactions energy: -251.328 where: short stacking energy: -114.315 Base-Backbone interact. energy: -0.901 local terms energy: -127.695781 where: bonds (distance) C4'-P energy: -25.175 bonds (distance) P-C4' energy: -26.476 flat angles C4'-P-C4' energy: -24.760 flat angles P-C4'-P energy: -19.156 tors. eta vs tors. theta energy: -32.129 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 140 Temperature: 0.950000 Total energy: -364.664700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.664700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.683393 (E_RNA) where: Base-Base interactions energy: -240.403 where: short stacking energy: -117.448 Base-Backbone interact. energy: -0.823 local terms energy: -123.456925 where: bonds (distance) C4'-P energy: -19.296 bonds (distance) P-C4' energy: -26.616 flat angles C4'-P-C4' energy: -23.216 flat angles P-C4'-P energy: -16.495 tors. eta vs tors. theta energy: -37.835 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 140 Temperature: 1.000000 Total energy: -354.590019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.590019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.819889 (E_RNA) where: Base-Base interactions energy: -232.016 where: short stacking energy: -117.818 Base-Backbone interact. energy: -0.035 local terms energy: -122.768723 where: bonds (distance) C4'-P energy: -20.398 bonds (distance) P-C4' energy: -23.858 flat angles C4'-P-C4' energy: -26.073 flat angles P-C4'-P energy: -14.331 tors. eta vs tors. theta energy: -38.108 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 140 Temperature: 1.050000 Total energy: -339.918891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.918891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.918891 (E_RNA) where: Base-Base interactions energy: -227.730 where: short stacking energy: -115.891 Base-Backbone interact. energy: 0.235 local terms energy: -112.423311 where: bonds (distance) C4'-P energy: -25.349 bonds (distance) P-C4' energy: -15.245 flat angles C4'-P-C4' energy: -22.341 flat angles P-C4'-P energy: -16.747 tors. eta vs tors. theta energy: -32.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 140 Temperature: 1.100000 Total energy: -348.011788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.011788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.082682 (E_RNA) where: Base-Base interactions energy: -239.569 where: short stacking energy: -113.384 Base-Backbone interact. energy: -0.479 local terms energy: -108.035059 where: bonds (distance) C4'-P energy: -16.970 bonds (distance) P-C4' energy: -16.512 flat angles C4'-P-C4' energy: -22.687 flat angles P-C4'-P energy: -21.893 tors. eta vs tors. theta energy: -29.973 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 140 Temperature: 1.150000 Total energy: -267.878900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.878900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.884206 (E_RNA) where: Base-Base interactions energy: -167.242 where: short stacking energy: -90.209 Base-Backbone interact. energy: -0.269 local terms energy: -100.373629 where: bonds (distance) C4'-P energy: -22.973 bonds (distance) P-C4' energy: -17.852 flat angles C4'-P-C4' energy: -24.066 flat angles P-C4'-P energy: -13.759 tors. eta vs tors. theta energy: -21.724 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 140 Temperature: 1.200000 Total energy: -264.677175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.677175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.677175 (E_RNA) where: Base-Base interactions energy: -157.145 where: short stacking energy: -72.457 Base-Backbone interact. energy: -0.809 local terms energy: -106.723472 where: bonds (distance) C4'-P energy: -23.466 bonds (distance) P-C4' energy: -22.282 flat angles C4'-P-C4' energy: -26.177 flat angles P-C4'-P energy: -11.601 tors. eta vs tors. theta energy: -23.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 140 Temperature: 1.250000 Total energy: -219.359266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.359266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.394569 (E_RNA) where: Base-Base interactions energy: -137.721 where: short stacking energy: -74.158 Base-Backbone interact. energy: -1.314 local terms energy: -80.359114 where: bonds (distance) C4'-P energy: -20.353 bonds (distance) P-C4' energy: -16.226 flat angles C4'-P-C4' energy: -14.992 flat angles P-C4'-P energy: -12.722 tors. eta vs tors. theta energy: -16.067 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 140 Temperature: 1.300000 Total energy: -170.201994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.201994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.226919 (E_RNA) where: Base-Base interactions energy: -95.869 where: short stacking energy: -62.793 Base-Backbone interact. energy: -0.644 local terms energy: -73.713250 where: bonds (distance) C4'-P energy: -19.067 bonds (distance) P-C4' energy: -20.396 flat angles C4'-P-C4' energy: -19.305 flat angles P-C4'-P energy: -7.933 tors. eta vs tors. theta energy: -7.012 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 140 Temperature: 1.350000 Total energy: -137.668341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.668341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.010621 (E_RNA) where: Base-Base interactions energy: -67.358 where: short stacking energy: -35.463 Base-Backbone interact. energy: -0.325 local terms energy: -71.327707 where: bonds (distance) C4'-P energy: -18.279 bonds (distance) P-C4' energy: -21.388 flat angles C4'-P-C4' energy: -17.497 flat angles P-C4'-P energy: -15.129 tors. eta vs tors. theta energy: 0.965 Dist. restrs. and SS energy: 1.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 141 Temperature: 0.900000 Total energy: -383.944216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.944216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.944216 (E_RNA) where: Base-Base interactions energy: -253.597 where: short stacking energy: -119.628 Base-Backbone interact. energy: -2.627 local terms energy: -127.720077 where: bonds (distance) C4'-P energy: -25.723 bonds (distance) P-C4' energy: -26.914 flat angles C4'-P-C4' energy: -24.047 flat angles P-C4'-P energy: -18.124 tors. eta vs tors. theta energy: -32.912 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 141 Temperature: 0.950000 Total energy: -362.766314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.766314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.787661 (E_RNA) where: Base-Base interactions energy: -237.754 where: short stacking energy: -112.700 Base-Backbone interact. energy: -0.488 local terms energy: -124.546149 where: bonds (distance) C4'-P energy: -23.383 bonds (distance) P-C4' energy: -22.503 flat angles C4'-P-C4' energy: -23.898 flat angles P-C4'-P energy: -19.295 tors. eta vs tors. theta energy: -35.467 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 141 Temperature: 1.000000 Total energy: -364.067138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.067138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.087461 (E_RNA) where: Base-Base interactions energy: -234.014 where: short stacking energy: -110.913 Base-Backbone interact. energy: -0.002 local terms energy: -130.071737 where: bonds (distance) C4'-P energy: -24.194 bonds (distance) P-C4' energy: -22.448 flat angles C4'-P-C4' energy: -29.475 flat angles P-C4'-P energy: -17.625 tors. eta vs tors. theta energy: -36.330 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 141 Temperature: 1.050000 Total energy: -362.972222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.972222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.972222 (E_RNA) where: Base-Base interactions energy: -240.894 where: short stacking energy: -117.806 Base-Backbone interact. energy: -0.057 local terms energy: -122.021665 where: bonds (distance) C4'-P energy: -18.212 bonds (distance) P-C4' energy: -23.610 flat angles C4'-P-C4' energy: -24.359 flat angles P-C4'-P energy: -20.059 tors. eta vs tors. theta energy: -35.782 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 141 Temperature: 1.100000 Total energy: -320.612464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.612464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.649016 (E_RNA) where: Base-Base interactions energy: -214.449 where: short stacking energy: -108.350 Base-Backbone interact. energy: -0.385 local terms energy: -105.815301 where: bonds (distance) C4'-P energy: -19.015 bonds (distance) P-C4' energy: -19.603 flat angles C4'-P-C4' energy: -22.938 flat angles P-C4'-P energy: -13.020 tors. eta vs tors. theta energy: -31.239 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 141 Temperature: 1.150000 Total energy: -268.043036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.043036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.043036 (E_RNA) where: Base-Base interactions energy: -164.502 where: short stacking energy: -82.105 Base-Backbone interact. energy: -0.087 local terms energy: -103.454006 where: bonds (distance) C4'-P energy: -19.459 bonds (distance) P-C4' energy: -23.711 flat angles C4'-P-C4' energy: -18.090 flat angles P-C4'-P energy: -19.415 tors. eta vs tors. theta energy: -22.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 141 Temperature: 1.200000 Total energy: -259.267894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.267894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.304588 (E_RNA) where: Base-Base interactions energy: -157.448 where: short stacking energy: -73.579 Base-Backbone interact. energy: -0.077 local terms energy: -101.778761 where: bonds (distance) C4'-P energy: -17.518 bonds (distance) P-C4' energy: -25.008 flat angles C4'-P-C4' energy: -24.165 flat angles P-C4'-P energy: -17.587 tors. eta vs tors. theta energy: -17.500 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 141 Temperature: 1.250000 Total energy: -233.890956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.890956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.060866 (E_RNA) where: Base-Base interactions energy: -138.207 where: short stacking energy: -64.928 Base-Backbone interact. energy: -0.292 local terms energy: -95.562302 where: bonds (distance) C4'-P energy: -16.258 bonds (distance) P-C4' energy: -25.932 flat angles C4'-P-C4' energy: -20.773 flat angles P-C4'-P energy: -14.578 tors. eta vs tors. theta energy: -18.022 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 141 Temperature: 1.300000 Total energy: -172.452549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.452549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.485383 (E_RNA) where: Base-Base interactions energy: -100.442 where: short stacking energy: -58.189 Base-Backbone interact. energy: -0.237 local terms energy: -71.806254 where: bonds (distance) C4'-P energy: -18.500 bonds (distance) P-C4' energy: -18.476 flat angles C4'-P-C4' energy: -13.612 flat angles P-C4'-P energy: -17.030 tors. eta vs tors. theta energy: -4.189 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 141 Temperature: 1.350000 Total energy: -126.925315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.925315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.627576 (E_RNA) where: Base-Base interactions energy: -56.318 where: short stacking energy: -50.528 Base-Backbone interact. energy: -0.724 local terms energy: -73.585469 where: bonds (distance) C4'-P energy: -19.020 bonds (distance) P-C4' energy: -18.476 flat angles C4'-P-C4' energy: -21.067 flat angles P-C4'-P energy: -6.949 tors. eta vs tors. theta energy: -8.074 Dist. restrs. and SS energy: 3.702 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 142 Temperature: 0.900000 Total energy: -365.543666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.543666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.545011 (E_RNA) where: Base-Base interactions energy: -245.620 where: short stacking energy: -116.495 Base-Backbone interact. energy: -0.104 local terms energy: -119.821366 where: bonds (distance) C4'-P energy: -18.610 bonds (distance) P-C4' energy: -25.451 flat angles C4'-P-C4' energy: -27.199 flat angles P-C4'-P energy: -17.388 tors. eta vs tors. theta energy: -31.173 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 142 Temperature: 0.950000 Total energy: -369.849639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.849639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.849639 (E_RNA) where: Base-Base interactions energy: -247.771 where: short stacking energy: -113.260 Base-Backbone interact. energy: -0.057 local terms energy: -122.021421 where: bonds (distance) C4'-P energy: -20.398 bonds (distance) P-C4' energy: -24.948 flat angles C4'-P-C4' energy: -24.265 flat angles P-C4'-P energy: -20.445 tors. eta vs tors. theta energy: -31.965 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 142 Temperature: 1.000000 Total energy: -365.664586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.664586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.664586 (E_RNA) where: Base-Base interactions energy: -240.874 where: short stacking energy: -112.647 Base-Backbone interact. energy: -0.283 local terms energy: -124.507533 where: bonds (distance) C4'-P energy: -24.196 bonds (distance) P-C4' energy: -21.066 flat angles C4'-P-C4' energy: -26.558 flat angles P-C4'-P energy: -16.602 tors. eta vs tors. theta energy: -36.086 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 142 Temperature: 1.050000 Total energy: -373.454300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.454300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.455385 (E_RNA) where: Base-Base interactions energy: -250.804 where: short stacking energy: -123.941 Base-Backbone interact. energy: -0.435 local terms energy: -122.216315 where: bonds (distance) C4'-P energy: -23.651 bonds (distance) P-C4' energy: -18.067 flat angles C4'-P-C4' energy: -28.600 flat angles P-C4'-P energy: -18.992 tors. eta vs tors. theta energy: -32.906 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 142 Temperature: 1.100000 Total energy: -281.755755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.755755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.853461 (E_RNA) where: Base-Base interactions energy: -171.115 where: short stacking energy: -86.966 Base-Backbone interact. energy: -1.485 local terms energy: -109.253246 where: bonds (distance) C4'-P energy: -23.751 bonds (distance) P-C4' energy: -25.523 flat angles C4'-P-C4' energy: -18.070 flat angles P-C4'-P energy: -18.230 tors. eta vs tors. theta energy: -23.679 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 142 Temperature: 1.150000 Total energy: -276.677272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.677272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.677688 (E_RNA) where: Base-Base interactions energy: -173.461 where: short stacking energy: -88.422 Base-Backbone interact. energy: -0.438 local terms energy: -102.779331 where: bonds (distance) C4'-P energy: -22.873 bonds (distance) P-C4' energy: -23.436 flat angles C4'-P-C4' energy: -19.542 flat angles P-C4'-P energy: -14.774 tors. eta vs tors. theta energy: -22.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 142 Temperature: 1.200000 Total energy: -258.619122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.619122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.619122 (E_RNA) where: Base-Base interactions energy: -149.626 where: short stacking energy: -75.095 Base-Backbone interact. energy: -1.817 local terms energy: -107.176038 where: bonds (distance) C4'-P energy: -23.840 bonds (distance) P-C4' energy: -25.797 flat angles C4'-P-C4' energy: -26.053 flat angles P-C4'-P energy: -12.883 tors. eta vs tors. theta energy: -18.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 142 Temperature: 1.250000 Total energy: -220.956090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.956090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.956090 (E_RNA) where: Base-Base interactions energy: -127.425 where: short stacking energy: -53.773 Base-Backbone interact. energy: -0.534 local terms energy: -92.996871 where: bonds (distance) C4'-P energy: -13.168 bonds (distance) P-C4' energy: -26.118 flat angles C4'-P-C4' energy: -19.754 flat angles P-C4'-P energy: -16.375 tors. eta vs tors. theta energy: -17.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 142 Temperature: 1.300000 Total energy: -172.924704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.924704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.924704 (E_RNA) where: Base-Base interactions energy: -88.053 where: short stacking energy: -51.576 Base-Backbone interact. energy: -0.158 local terms energy: -84.713671 where: bonds (distance) C4'-P energy: -25.140 bonds (distance) P-C4' energy: -22.894 flat angles C4'-P-C4' energy: -18.601 flat angles P-C4'-P energy: -10.605 tors. eta vs tors. theta energy: -7.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 142 Temperature: 1.350000 Total energy: -116.608404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.608404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.365717 (E_RNA) where: Base-Base interactions energy: -47.368 where: short stacking energy: -26.553 Base-Backbone interact. energy: 0.468 local terms energy: -72.465574 where: bonds (distance) C4'-P energy: -14.880 bonds (distance) P-C4' energy: -21.039 flat angles C4'-P-C4' energy: -18.142 flat angles P-C4'-P energy: -15.294 tors. eta vs tors. theta energy: -3.111 Dist. restrs. and SS energy: 2.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 143 Temperature: 0.900000 Total energy: -371.508089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.508089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.578756 (E_RNA) where: Base-Base interactions energy: -247.989 where: short stacking energy: -116.501 Base-Backbone interact. energy: -0.025 local terms energy: -123.565064 where: bonds (distance) C4'-P energy: -24.901 bonds (distance) P-C4' energy: -26.339 flat angles C4'-P-C4' energy: -23.752 flat angles P-C4'-P energy: -18.324 tors. eta vs tors. theta energy: -30.249 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 143 Temperature: 0.950000 Total energy: -370.710005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.710005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.722376 (E_RNA) where: Base-Base interactions energy: -240.916 where: short stacking energy: -111.952 Base-Backbone interact. energy: -0.004 local terms energy: -129.802252 where: bonds (distance) C4'-P energy: -25.742 bonds (distance) P-C4' energy: -21.447 flat angles C4'-P-C4' energy: -27.283 flat angles P-C4'-P energy: -22.405 tors. eta vs tors. theta energy: -32.925 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 143 Temperature: 1.000000 Total energy: -359.740540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.740540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.782295 (E_RNA) where: Base-Base interactions energy: -234.766 where: short stacking energy: -111.567 Base-Backbone interact. energy: 0.011 local terms energy: -125.027391 where: bonds (distance) C4'-P energy: -21.363 bonds (distance) P-C4' energy: -26.001 flat angles C4'-P-C4' energy: -24.192 flat angles P-C4'-P energy: -20.267 tors. eta vs tors. theta energy: -33.205 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 143 Temperature: 1.050000 Total energy: -353.729979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.729979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.729979 (E_RNA) where: Base-Base interactions energy: -229.593 where: short stacking energy: -112.595 Base-Backbone interact. energy: -0.634 local terms energy: -123.503020 where: bonds (distance) C4'-P energy: -20.098 bonds (distance) P-C4' energy: -23.812 flat angles C4'-P-C4' energy: -25.256 flat angles P-C4'-P energy: -21.376 tors. eta vs tors. theta energy: -32.960 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 143 Temperature: 1.100000 Total energy: -317.088225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.088225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.090840 (E_RNA) where: Base-Base interactions energy: -193.728 where: short stacking energy: -101.919 Base-Backbone interact. energy: -0.030 local terms energy: -123.332860 where: bonds (distance) C4'-P energy: -22.814 bonds (distance) P-C4' energy: -26.297 flat angles C4'-P-C4' energy: -25.949 flat angles P-C4'-P energy: -13.557 tors. eta vs tors. theta energy: -34.716 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 143 Temperature: 1.150000 Total energy: -267.652394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.652394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.692407 (E_RNA) where: Base-Base interactions energy: -172.788 where: short stacking energy: -75.185 Base-Backbone interact. energy: -1.281 local terms energy: -93.623997 where: bonds (distance) C4'-P energy: -23.077 bonds (distance) P-C4' energy: -21.968 flat angles C4'-P-C4' energy: -24.353 flat angles P-C4'-P energy: -10.885 tors. eta vs tors. theta energy: -13.341 Dist. restrs. and SS energy: 0.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 143 Temperature: 1.200000 Total energy: -295.859692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.859692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.859692 (E_RNA) where: Base-Base interactions energy: -196.272 where: short stacking energy: -106.965 Base-Backbone interact. energy: -0.074 local terms energy: -99.514500 where: bonds (distance) C4'-P energy: -20.524 bonds (distance) P-C4' energy: -21.895 flat angles C4'-P-C4' energy: -20.750 flat angles P-C4'-P energy: -9.028 tors. eta vs tors. theta energy: -27.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 143 Temperature: 1.250000 Total energy: -228.074904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.074904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.100054 (E_RNA) where: Base-Base interactions energy: -139.495 where: short stacking energy: -70.166 Base-Backbone interact. energy: -2.762 local terms energy: -85.843631 where: bonds (distance) C4'-P energy: -22.052 bonds (distance) P-C4' energy: -19.276 flat angles C4'-P-C4' energy: -19.136 flat angles P-C4'-P energy: -9.151 tors. eta vs tors. theta energy: -16.228 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 143 Temperature: 1.300000 Total energy: -171.716884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.716884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.857067 (E_RNA) where: Base-Base interactions energy: -100.484 where: short stacking energy: -56.415 Base-Backbone interact. energy: -1.091 local terms energy: -70.283024 where: bonds (distance) C4'-P energy: -14.901 bonds (distance) P-C4' energy: -20.089 flat angles C4'-P-C4' energy: -16.092 flat angles P-C4'-P energy: -9.590 tors. eta vs tors. theta energy: -9.611 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 143 Temperature: 1.350000 Total energy: -136.320987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.320987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.813928 (E_RNA) where: Base-Base interactions energy: -62.281 where: short stacking energy: -37.470 Base-Backbone interact. energy: -1.461 local terms energy: -79.072263 where: bonds (distance) C4'-P energy: -23.379 bonds (distance) P-C4' energy: -21.305 flat angles C4'-P-C4' energy: -12.084 flat angles P-C4'-P energy: -16.578 tors. eta vs tors. theta energy: -5.727 Dist. restrs. and SS energy: 6.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 144 Temperature: 0.900000 Total energy: -373.006298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.006298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.072382 (E_RNA) where: Base-Base interactions energy: -239.530 where: short stacking energy: -116.098 Base-Backbone interact. energy: -1.492 local terms energy: -132.050677 where: bonds (distance) C4'-P energy: -22.219 bonds (distance) P-C4' energy: -27.693 flat angles C4'-P-C4' energy: -27.798 flat angles P-C4'-P energy: -19.111 tors. eta vs tors. theta energy: -35.230 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 144 Temperature: 0.950000 Total energy: -366.301037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.301037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.307115 (E_RNA) where: Base-Base interactions energy: -237.712 where: short stacking energy: -120.134 Base-Backbone interact. energy: -1.705 local terms energy: -126.890864 where: bonds (distance) C4'-P energy: -25.437 bonds (distance) P-C4' energy: -26.656 flat angles C4'-P-C4' energy: -28.526 flat angles P-C4'-P energy: -12.485 tors. eta vs tors. theta energy: -33.787 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 144 Temperature: 1.000000 Total energy: -368.728828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.728828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.728828 (E_RNA) where: Base-Base interactions energy: -240.570 where: short stacking energy: -109.803 Base-Backbone interact. energy: -0.803 local terms energy: -127.356495 where: bonds (distance) C4'-P energy: -18.928 bonds (distance) P-C4' energy: -28.290 flat angles C4'-P-C4' energy: -25.505 flat angles P-C4'-P energy: -16.587 tors. eta vs tors. theta energy: -38.047 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 144 Temperature: 1.050000 Total energy: -358.759333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.759333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.767953 (E_RNA) where: Base-Base interactions energy: -244.005 where: short stacking energy: -115.081 Base-Backbone interact. energy: -0.163 local terms energy: -114.599575 where: bonds (distance) C4'-P energy: -18.109 bonds (distance) P-C4' energy: -19.521 flat angles C4'-P-C4' energy: -25.045 flat angles P-C4'-P energy: -19.010 tors. eta vs tors. theta energy: -32.915 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 144 Temperature: 1.100000 Total energy: -319.972829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.972829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.018062 (E_RNA) where: Base-Base interactions energy: -211.336 where: short stacking energy: -104.294 Base-Backbone interact. energy: -0.108 local terms energy: -108.574034 where: bonds (distance) C4'-P energy: -18.242 bonds (distance) P-C4' energy: -23.476 flat angles C4'-P-C4' energy: -27.563 flat angles P-C4'-P energy: -10.953 tors. eta vs tors. theta energy: -28.341 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 144 Temperature: 1.150000 Total energy: -255.183466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.183466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.183466 (E_RNA) where: Base-Base interactions energy: -158.962 where: short stacking energy: -68.360 Base-Backbone interact. energy: -0.214 local terms energy: -96.007632 where: bonds (distance) C4'-P energy: -20.037 bonds (distance) P-C4' energy: -24.638 flat angles C4'-P-C4' energy: -19.335 flat angles P-C4'-P energy: -16.999 tors. eta vs tors. theta energy: -14.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 144 Temperature: 1.200000 Total energy: -283.721261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.721261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.801545 (E_RNA) where: Base-Base interactions energy: -183.081 where: short stacking energy: -81.837 Base-Backbone interact. energy: -0.512 local terms energy: -100.208406 where: bonds (distance) C4'-P energy: -19.019 bonds (distance) P-C4' energy: -21.871 flat angles C4'-P-C4' energy: -23.430 flat angles P-C4'-P energy: -9.483 tors. eta vs tors. theta energy: -26.405 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 144 Temperature: 1.250000 Total energy: -187.431709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.431709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.431709 (E_RNA) where: Base-Base interactions energy: -104.314 where: short stacking energy: -51.096 Base-Backbone interact. energy: 0.529 local terms energy: -83.646886 where: bonds (distance) C4'-P energy: -23.823 bonds (distance) P-C4' energy: -21.345 flat angles C4'-P-C4' energy: -22.683 flat angles P-C4'-P energy: -13.505 tors. eta vs tors. theta energy: -2.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 144 Temperature: 1.300000 Total energy: -149.895408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.895408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.000146 (E_RNA) where: Base-Base interactions energy: -79.014 where: short stacking energy: -56.017 Base-Backbone interact. energy: -0.459 local terms energy: -70.526782 where: bonds (distance) C4'-P energy: -19.877 bonds (distance) P-C4' energy: -27.460 flat angles C4'-P-C4' energy: -5.824 flat angles P-C4'-P energy: -12.177 tors. eta vs tors. theta energy: -5.188 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 144 Temperature: 1.350000 Total energy: -147.253085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.253085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.338055 (E_RNA) where: Base-Base interactions energy: -77.913 where: short stacking energy: -47.894 Base-Backbone interact. energy: -2.084 local terms energy: -67.341346 where: bonds (distance) C4'-P energy: -14.483 bonds (distance) P-C4' energy: -17.479 flat angles C4'-P-C4' energy: -21.155 flat angles P-C4'-P energy: -14.653 tors. eta vs tors. theta energy: 0.429 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 145 Temperature: 0.900000 Total energy: -374.165651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.165651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.165651 (E_RNA) where: Base-Base interactions energy: -249.002 where: short stacking energy: -124.264 Base-Backbone interact. energy: -0.092 local terms energy: -125.071431 where: bonds (distance) C4'-P energy: -23.454 bonds (distance) P-C4' energy: -26.123 flat angles C4'-P-C4' energy: -24.228 flat angles P-C4'-P energy: -18.014 tors. eta vs tors. theta energy: -33.252 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 145 Temperature: 0.950000 Total energy: -365.617051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.617051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.617051 (E_RNA) where: Base-Base interactions energy: -238.532 where: short stacking energy: -114.414 Base-Backbone interact. energy: -0.055 local terms energy: -127.030289 where: bonds (distance) C4'-P energy: -25.916 bonds (distance) P-C4' energy: -26.412 flat angles C4'-P-C4' energy: -22.480 flat angles P-C4'-P energy: -17.936 tors. eta vs tors. theta energy: -34.287 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 145 Temperature: 1.000000 Total energy: -363.765010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.765010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.765010 (E_RNA) where: Base-Base interactions energy: -239.966 where: short stacking energy: -122.155 Base-Backbone interact. energy: -0.519 local terms energy: -123.279322 where: bonds (distance) C4'-P energy: -25.018 bonds (distance) P-C4' energy: -19.682 flat angles C4'-P-C4' energy: -26.518 flat angles P-C4'-P energy: -19.945 tors. eta vs tors. theta energy: -32.117 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 145 Temperature: 1.050000 Total energy: -353.957620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.957620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.030433 (E_RNA) where: Base-Base interactions energy: -241.961 where: short stacking energy: -121.264 Base-Backbone interact. energy: -0.002 local terms energy: -112.067657 where: bonds (distance) C4'-P energy: -19.888 bonds (distance) P-C4' energy: -22.764 flat angles C4'-P-C4' energy: -20.453 flat angles P-C4'-P energy: -13.597 tors. eta vs tors. theta energy: -35.366 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 145 Temperature: 1.100000 Total energy: -310.760213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.760213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.760213 (E_RNA) where: Base-Base interactions energy: -186.964 where: short stacking energy: -100.380 Base-Backbone interact. energy: -0.713 local terms energy: -123.083579 where: bonds (distance) C4'-P energy: -21.657 bonds (distance) P-C4' energy: -28.153 flat angles C4'-P-C4' energy: -26.795 flat angles P-C4'-P energy: -18.872 tors. eta vs tors. theta energy: -27.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 145 Temperature: 1.150000 Total energy: -301.255745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.255745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.255745 (E_RNA) where: Base-Base interactions energy: -181.161 where: short stacking energy: -99.992 Base-Backbone interact. energy: -0.738 local terms energy: -119.357455 where: bonds (distance) C4'-P energy: -21.935 bonds (distance) P-C4' energy: -27.314 flat angles C4'-P-C4' energy: -19.305 flat angles P-C4'-P energy: -18.354 tors. eta vs tors. theta energy: -32.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 145 Temperature: 1.200000 Total energy: -226.159656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.159656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.159656 (E_RNA) where: Base-Base interactions energy: -123.150 where: short stacking energy: -59.976 Base-Backbone interact. energy: 0.571 local terms energy: -103.580140 where: bonds (distance) C4'-P energy: -28.471 bonds (distance) P-C4' energy: -21.326 flat angles C4'-P-C4' energy: -23.211 flat angles P-C4'-P energy: -16.386 tors. eta vs tors. theta energy: -14.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 145 Temperature: 1.250000 Total energy: -192.343780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.343780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.618725 (E_RNA) where: Base-Base interactions energy: -111.871 where: short stacking energy: -53.378 Base-Backbone interact. energy: 1.014 local terms energy: -81.761586 where: bonds (distance) C4'-P energy: -20.253 bonds (distance) P-C4' energy: -22.400 flat angles C4'-P-C4' energy: -22.978 flat angles P-C4'-P energy: -16.089 tors. eta vs tors. theta energy: -0.042 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 145 Temperature: 1.300000 Total energy: -184.305980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.305980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.308047 (E_RNA) where: Base-Base interactions energy: -104.252 where: short stacking energy: -57.253 Base-Backbone interact. energy: -0.402 local terms energy: -79.654466 where: bonds (distance) C4'-P energy: -23.371 bonds (distance) P-C4' energy: -16.324 flat angles C4'-P-C4' energy: -18.960 flat angles P-C4'-P energy: -11.669 tors. eta vs tors. theta energy: -9.330 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 145 Temperature: 1.350000 Total energy: -166.028327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.028327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.073597 (E_RNA) where: Base-Base interactions energy: -94.389 where: short stacking energy: -58.220 Base-Backbone interact. energy: -0.899 local terms energy: -70.785412 where: bonds (distance) C4'-P energy: -14.396 bonds (distance) P-C4' energy: -19.985 flat angles C4'-P-C4' energy: -19.121 flat angles P-C4'-P energy: -14.033 tors. eta vs tors. theta energy: -3.252 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 146 Temperature: 0.900000 Total energy: -383.865619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.865619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.865619 (E_RNA) where: Base-Base interactions energy: -246.641 where: short stacking energy: -117.869 Base-Backbone interact. energy: -0.123 local terms energy: -137.101564 where: bonds (distance) C4'-P energy: -23.602 bonds (distance) P-C4' energy: -27.001 flat angles C4'-P-C4' energy: -26.598 flat angles P-C4'-P energy: -21.252 tors. eta vs tors. theta energy: -38.649 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 146 Temperature: 0.950000 Total energy: -376.676797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.676797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.676797 (E_RNA) where: Base-Base interactions energy: -238.793 where: short stacking energy: -119.270 Base-Backbone interact. energy: -0.307 local terms energy: -137.577008 where: bonds (distance) C4'-P energy: -24.174 bonds (distance) P-C4' energy: -27.287 flat angles C4'-P-C4' energy: -27.985 flat angles P-C4'-P energy: -17.968 tors. eta vs tors. theta energy: -40.162 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 146 Temperature: 1.000000 Total energy: -360.355935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.355935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.390255 (E_RNA) where: Base-Base interactions energy: -234.853 where: short stacking energy: -129.230 Base-Backbone interact. energy: 0.344 local terms energy: -125.881892 where: bonds (distance) C4'-P energy: -24.342 bonds (distance) P-C4' energy: -21.498 flat angles C4'-P-C4' energy: -23.183 flat angles P-C4'-P energy: -20.753 tors. eta vs tors. theta energy: -36.106 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 146 Temperature: 1.050000 Total energy: -365.057005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.057005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.057005 (E_RNA) where: Base-Base interactions energy: -242.461 where: short stacking energy: -124.275 Base-Backbone interact. energy: -0.047 local terms energy: -122.549450 where: bonds (distance) C4'-P energy: -23.662 bonds (distance) P-C4' energy: -27.663 flat angles C4'-P-C4' energy: -23.226 flat angles P-C4'-P energy: -15.585 tors. eta vs tors. theta energy: -32.414 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 146 Temperature: 1.100000 Total energy: -318.434145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.434145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.434875 (E_RNA) where: Base-Base interactions energy: -205.763 where: short stacking energy: -101.405 Base-Backbone interact. energy: -1.612 local terms energy: -111.060493 where: bonds (distance) C4'-P energy: -18.829 bonds (distance) P-C4' energy: -23.785 flat angles C4'-P-C4' energy: -24.290 flat angles P-C4'-P energy: -15.680 tors. eta vs tors. theta energy: -28.477 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 146 Temperature: 1.150000 Total energy: -329.128381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.128381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.129888 (E_RNA) where: Base-Base interactions energy: -211.501 where: short stacking energy: -108.282 Base-Backbone interact. energy: -0.269 local terms energy: -117.360093 where: bonds (distance) C4'-P energy: -24.559 bonds (distance) P-C4' energy: -21.371 flat angles C4'-P-C4' energy: -27.259 flat angles P-C4'-P energy: -15.626 tors. eta vs tors. theta energy: -28.545 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 146 Temperature: 1.200000 Total energy: -238.427070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.427070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.427070 (E_RNA) where: Base-Base interactions energy: -145.887 where: short stacking energy: -84.007 Base-Backbone interact. energy: 0.084 local terms energy: -92.624126 where: bonds (distance) C4'-P energy: -21.121 bonds (distance) P-C4' energy: -19.441 flat angles C4'-P-C4' energy: -22.804 flat angles P-C4'-P energy: -7.548 tors. eta vs tors. theta energy: -21.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 146 Temperature: 1.250000 Total energy: -190.142280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.142280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.167794 (E_RNA) where: Base-Base interactions energy: -120.935 where: short stacking energy: -63.757 Base-Backbone interact. energy: -1.873 local terms energy: -67.359861 where: bonds (distance) C4'-P energy: -11.894 bonds (distance) P-C4' energy: -20.723 flat angles C4'-P-C4' energy: -20.196 flat angles P-C4'-P energy: -11.719 tors. eta vs tors. theta energy: -2.827 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 146 Temperature: 1.300000 Total energy: -218.529304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.529304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.529304 (E_RNA) where: Base-Base interactions energy: -127.021 where: short stacking energy: -62.528 Base-Backbone interact. energy: -0.375 local terms energy: -91.132907 where: bonds (distance) C4'-P energy: -19.516 bonds (distance) P-C4' energy: -18.117 flat angles C4'-P-C4' energy: -23.423 flat angles P-C4'-P energy: -14.297 tors. eta vs tors. theta energy: -15.781 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 146 Temperature: 1.350000 Total energy: -169.862315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.862315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.862315 (E_RNA) where: Base-Base interactions energy: -81.289 where: short stacking energy: -44.737 Base-Backbone interact. energy: -1.614 local terms energy: -86.959859 where: bonds (distance) C4'-P energy: -25.184 bonds (distance) P-C4' energy: -25.164 flat angles C4'-P-C4' energy: -17.385 flat angles P-C4'-P energy: -14.934 tors. eta vs tors. theta energy: -4.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 147 Temperature: 0.900000 Total energy: -376.588202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.588202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.611913 (E_RNA) where: Base-Base interactions energy: -247.692 where: short stacking energy: -121.282 Base-Backbone interact. energy: -0.509 local terms energy: -128.411236 where: bonds (distance) C4'-P energy: -18.522 bonds (distance) P-C4' energy: -22.334 flat angles C4'-P-C4' energy: -28.020 flat angles P-C4'-P energy: -21.082 tors. eta vs tors. theta energy: -38.452 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 147 Temperature: 0.950000 Total energy: -369.412931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.412931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.413745 (E_RNA) where: Base-Base interactions energy: -245.926 where: short stacking energy: -130.508 Base-Backbone interact. energy: -0.043 local terms energy: -123.444453 where: bonds (distance) C4'-P energy: -21.147 bonds (distance) P-C4' energy: -25.285 flat angles C4'-P-C4' energy: -24.514 flat angles P-C4'-P energy: -14.720 tors. eta vs tors. theta energy: -37.778 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 147 Temperature: 1.000000 Total energy: -361.096260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.096260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.152404 (E_RNA) where: Base-Base interactions energy: -237.566 where: short stacking energy: -120.675 Base-Backbone interact. energy: 0.574 local terms energy: -124.161325 where: bonds (distance) C4'-P energy: -23.872 bonds (distance) P-C4' energy: -21.346 flat angles C4'-P-C4' energy: -26.497 flat angles P-C4'-P energy: -17.893 tors. eta vs tors. theta energy: -34.553 Dist. restrs. and SS energy: 0.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 147 Temperature: 1.050000 Total energy: -348.811034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.811034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.838049 (E_RNA) where: Base-Base interactions energy: -229.531 where: short stacking energy: -105.686 Base-Backbone interact. energy: -0.013 local terms energy: -119.293129 where: bonds (distance) C4'-P energy: -23.192 bonds (distance) P-C4' energy: -22.108 flat angles C4'-P-C4' energy: -21.315 flat angles P-C4'-P energy: -17.517 tors. eta vs tors. theta energy: -35.161 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 147 Temperature: 1.100000 Total energy: -326.263824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.263824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.281005 (E_RNA) where: Base-Base interactions energy: -210.642 where: short stacking energy: -104.606 Base-Backbone interact. energy: -0.006 local terms energy: -115.632348 where: bonds (distance) C4'-P energy: -22.490 bonds (distance) P-C4' energy: -20.484 flat angles C4'-P-C4' energy: -24.227 flat angles P-C4'-P energy: -16.328 tors. eta vs tors. theta energy: -32.103 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 147 Temperature: 1.150000 Total energy: -313.620666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.620666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.650664 (E_RNA) where: Base-Base interactions energy: -202.786 where: short stacking energy: -98.292 Base-Backbone interact. energy: 1.900 local terms energy: -112.764333 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -24.713 flat angles C4'-P-C4' energy: -15.927 flat angles P-C4'-P energy: -20.944 tors. eta vs tors. theta energy: -26.716 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 147 Temperature: 1.200000 Total energy: -252.826873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.826873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.828564 (E_RNA) where: Base-Base interactions energy: -148.671 where: short stacking energy: -83.916 Base-Backbone interact. energy: -0.110 local terms energy: -104.047332 where: bonds (distance) C4'-P energy: -20.618 bonds (distance) P-C4' energy: -24.739 flat angles C4'-P-C4' energy: -22.063 flat angles P-C4'-P energy: -14.461 tors. eta vs tors. theta energy: -22.167 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 147 Temperature: 1.250000 Total energy: -236.618874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.618874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.624803 (E_RNA) where: Base-Base interactions energy: -149.231 where: short stacking energy: -68.878 Base-Backbone interact. energy: -0.508 local terms energy: -86.885947 where: bonds (distance) C4'-P energy: -18.651 bonds (distance) P-C4' energy: -21.868 flat angles C4'-P-C4' energy: -22.639 flat angles P-C4'-P energy: -13.404 tors. eta vs tors. theta energy: -10.324 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 147 Temperature: 1.300000 Total energy: -157.568637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.568637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.726498 (E_RNA) where: Base-Base interactions energy: -76.074 where: short stacking energy: -48.973 Base-Backbone interact. energy: -0.117 local terms energy: -81.535939 where: bonds (distance) C4'-P energy: -20.521 bonds (distance) P-C4' energy: -27.458 flat angles C4'-P-C4' energy: -15.249 flat angles P-C4'-P energy: -12.012 tors. eta vs tors. theta energy: -6.297 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 147 Temperature: 1.350000 Total energy: -172.039565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.039565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.234171 (E_RNA) where: Base-Base interactions energy: -96.355 where: short stacking energy: -40.231 Base-Backbone interact. energy: -0.602 local terms energy: -75.277930 where: bonds (distance) C4'-P energy: -22.067 bonds (distance) P-C4' energy: -24.403 flat angles C4'-P-C4' energy: -19.007 flat angles P-C4'-P energy: -9.491 tors. eta vs tors. theta energy: -0.310 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 148 Temperature: 0.900000 Total energy: -370.627272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.627272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.773766 (E_RNA) where: Base-Base interactions energy: -236.428 where: short stacking energy: -121.872 Base-Backbone interact. energy: -0.491 local terms energy: -133.854369 where: bonds (distance) C4'-P energy: -25.230 bonds (distance) P-C4' energy: -22.270 flat angles C4'-P-C4' energy: -28.379 flat angles P-C4'-P energy: -21.343 tors. eta vs tors. theta energy: -36.632 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 148 Temperature: 0.950000 Total energy: -372.162794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.162794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.225885 (E_RNA) where: Base-Base interactions energy: -246.785 where: short stacking energy: -124.436 Base-Backbone interact. energy: -0.749 local terms energy: -124.691713 where: bonds (distance) C4'-P energy: -20.948 bonds (distance) P-C4' energy: -27.034 flat angles C4'-P-C4' energy: -26.527 flat angles P-C4'-P energy: -13.399 tors. eta vs tors. theta energy: -36.783 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 148 Temperature: 1.000000 Total energy: -350.989570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.989570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.989570 (E_RNA) where: Base-Base interactions energy: -236.267 where: short stacking energy: -111.446 Base-Backbone interact. energy: -0.635 local terms energy: -114.088157 where: bonds (distance) C4'-P energy: -18.685 bonds (distance) P-C4' energy: -26.536 flat angles C4'-P-C4' energy: -23.101 flat angles P-C4'-P energy: -16.298 tors. eta vs tors. theta energy: -29.469 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 148 Temperature: 1.050000 Total energy: -335.351927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.351927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.364446 (E_RNA) where: Base-Base interactions energy: -214.408 where: short stacking energy: -94.470 Base-Backbone interact. energy: -0.629 local terms energy: -120.326502 where: bonds (distance) C4'-P energy: -24.454 bonds (distance) P-C4' energy: -23.887 flat angles C4'-P-C4' energy: -25.434 flat angles P-C4'-P energy: -18.755 tors. eta vs tors. theta energy: -27.796 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 148 Temperature: 1.100000 Total energy: -321.868547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.868547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.868547 (E_RNA) where: Base-Base interactions energy: -208.231 where: short stacking energy: -100.855 Base-Backbone interact. energy: -0.161 local terms energy: -113.476456 where: bonds (distance) C4'-P energy: -22.282 bonds (distance) P-C4' energy: -26.104 flat angles C4'-P-C4' energy: -24.746 flat angles P-C4'-P energy: -15.539 tors. eta vs tors. theta energy: -24.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 148 Temperature: 1.150000 Total energy: -336.149264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.149264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.149264 (E_RNA) where: Base-Base interactions energy: -218.825 where: short stacking energy: -115.294 Base-Backbone interact. energy: 0.111 local terms energy: -117.435229 where: bonds (distance) C4'-P energy: -24.164 bonds (distance) P-C4' energy: -16.993 flat angles C4'-P-C4' energy: -26.589 flat angles P-C4'-P energy: -16.259 tors. eta vs tors. theta energy: -33.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 148 Temperature: 1.200000 Total energy: -257.420279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.420279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.420279 (E_RNA) where: Base-Base interactions energy: -158.745 where: short stacking energy: -82.581 Base-Backbone interact. energy: -0.571 local terms energy: -98.104587 where: bonds (distance) C4'-P energy: -16.353 bonds (distance) P-C4' energy: -24.857 flat angles C4'-P-C4' energy: -21.323 flat angles P-C4'-P energy: -13.367 tors. eta vs tors. theta energy: -22.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 148 Temperature: 1.250000 Total energy: -227.414094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.414094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.473467 (E_RNA) where: Base-Base interactions energy: -132.518 where: short stacking energy: -75.870 Base-Backbone interact. energy: -0.710 local terms energy: -94.245372 where: bonds (distance) C4'-P energy: -20.878 bonds (distance) P-C4' energy: -20.719 flat angles C4'-P-C4' energy: -22.025 flat angles P-C4'-P energy: -14.672 tors. eta vs tors. theta energy: -15.950 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 148 Temperature: 1.300000 Total energy: -167.085413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.085413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.092083 (E_RNA) where: Base-Base interactions energy: -91.166 where: short stacking energy: -62.346 Base-Backbone interact. energy: -0.779 local terms energy: -75.147810 where: bonds (distance) C4'-P energy: -24.075 bonds (distance) P-C4' energy: -24.555 flat angles C4'-P-C4' energy: -12.663 flat angles P-C4'-P energy: -11.944 tors. eta vs tors. theta energy: -1.911 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 148 Temperature: 1.350000 Total energy: -147.896430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.896430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.959504 (E_RNA) where: Base-Base interactions energy: -69.580 where: short stacking energy: -39.814 Base-Backbone interact. energy: -0.207 local terms energy: -78.172960 where: bonds (distance) C4'-P energy: -24.436 bonds (distance) P-C4' energy: -23.585 flat angles C4'-P-C4' energy: -15.441 flat angles P-C4'-P energy: -15.985 tors. eta vs tors. theta energy: 1.274 Dist. restrs. and SS energy: 0.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 149 Temperature: 0.900000 Total energy: -373.280381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.280381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.280381 (E_RNA) where: Base-Base interactions energy: -245.080 where: short stacking energy: -120.584 Base-Backbone interact. energy: 1.477 local terms energy: -129.676657 where: bonds (distance) C4'-P energy: -21.933 bonds (distance) P-C4' energy: -26.695 flat angles C4'-P-C4' energy: -25.055 flat angles P-C4'-P energy: -22.337 tors. eta vs tors. theta energy: -33.657 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 149 Temperature: 0.950000 Total energy: -373.929757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.929757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.929757 (E_RNA) where: Base-Base interactions energy: -249.526 where: short stacking energy: -116.720 Base-Backbone interact. energy: -0.377 local terms energy: -124.026528 where: bonds (distance) C4'-P energy: -19.546 bonds (distance) P-C4' energy: -19.313 flat angles C4'-P-C4' energy: -25.384 flat angles P-C4'-P energy: -20.873 tors. eta vs tors. theta energy: -38.911 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 149 Temperature: 1.000000 Total energy: -357.766402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.766402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.766402 (E_RNA) where: Base-Base interactions energy: -229.344 where: short stacking energy: -120.512 Base-Backbone interact. energy: -1.467 local terms energy: -126.955571 where: bonds (distance) C4'-P energy: -25.994 bonds (distance) P-C4' energy: -26.131 flat angles C4'-P-C4' energy: -23.415 flat angles P-C4'-P energy: -18.730 tors. eta vs tors. theta energy: -32.685 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 149 Temperature: 1.050000 Total energy: -331.161889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.161889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.161889 (E_RNA) where: Base-Base interactions energy: -220.078 where: short stacking energy: -116.161 Base-Backbone interact. energy: -0.264 local terms energy: -110.819978 where: bonds (distance) C4'-P energy: -26.278 bonds (distance) P-C4' energy: -15.367 flat angles C4'-P-C4' energy: -21.604 flat angles P-C4'-P energy: -19.323 tors. eta vs tors. theta energy: -28.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 149 Temperature: 1.100000 Total energy: -310.910463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.910463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.935120 (E_RNA) where: Base-Base interactions energy: -205.437 where: short stacking energy: -85.647 Base-Backbone interact. energy: -0.317 local terms energy: -105.181112 where: bonds (distance) C4'-P energy: -17.977 bonds (distance) P-C4' energy: -25.881 flat angles C4'-P-C4' energy: -21.820 flat angles P-C4'-P energy: -15.315 tors. eta vs tors. theta energy: -24.189 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 149 Temperature: 1.150000 Total energy: -309.008808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.008808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.056695 (E_RNA) where: Base-Base interactions energy: -210.745 where: short stacking energy: -100.482 Base-Backbone interact. energy: -0.282 local terms energy: -98.029870 where: bonds (distance) C4'-P energy: -20.901 bonds (distance) P-C4' energy: -14.462 flat angles C4'-P-C4' energy: -25.569 flat angles P-C4'-P energy: -15.536 tors. eta vs tors. theta energy: -21.561 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 149 Temperature: 1.200000 Total energy: -254.902467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.902467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.934496 (E_RNA) where: Base-Base interactions energy: -151.842 where: short stacking energy: -86.016 Base-Backbone interact. energy: -0.197 local terms energy: -102.895482 where: bonds (distance) C4'-P energy: -21.892 bonds (distance) P-C4' energy: -18.646 flat angles C4'-P-C4' energy: -26.355 flat angles P-C4'-P energy: -16.086 tors. eta vs tors. theta energy: -19.917 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 149 Temperature: 1.250000 Total energy: -194.990007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.990007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.103722 (E_RNA) where: Base-Base interactions energy: -113.533 where: short stacking energy: -56.637 Base-Backbone interact. energy: -0.098 local terms energy: -81.472709 where: bonds (distance) C4'-P energy: -22.750 bonds (distance) P-C4' energy: -19.383 flat angles C4'-P-C4' energy: -14.550 flat angles P-C4'-P energy: -12.932 tors. eta vs tors. theta energy: -11.858 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 149 Temperature: 1.300000 Total energy: -219.446976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.446976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.446976 (E_RNA) where: Base-Base interactions energy: -127.111 where: short stacking energy: -72.091 Base-Backbone interact. energy: -0.814 local terms energy: -91.521631 where: bonds (distance) C4'-P energy: -23.756 bonds (distance) P-C4' energy: -19.137 flat angles C4'-P-C4' energy: -22.701 flat angles P-C4'-P energy: -12.937 tors. eta vs tors. theta energy: -12.991 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 149 Temperature: 1.350000 Total energy: -141.403456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.403456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.425351 (E_RNA) where: Base-Base interactions energy: -71.676 where: short stacking energy: -44.172 Base-Backbone interact. energy: 2.195 local terms energy: -71.945070 where: bonds (distance) C4'-P energy: -16.561 bonds (distance) P-C4' energy: -20.761 flat angles C4'-P-C4' energy: -24.424 flat angles P-C4'-P energy: -10.894 tors. eta vs tors. theta energy: 0.695 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 150 Temperature: 0.900000 Total energy: -378.568125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.568125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.568125 (E_RNA) where: Base-Base interactions energy: -243.113 where: short stacking energy: -123.055 Base-Backbone interact. energy: -0.017 local terms energy: -135.438178 where: bonds (distance) C4'-P energy: -24.570 bonds (distance) P-C4' energy: -24.221 flat angles C4'-P-C4' energy: -27.999 flat angles P-C4'-P energy: -22.081 tors. eta vs tors. theta energy: -36.568 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 150 Temperature: 0.950000 Total energy: -367.310522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.310522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.310522 (E_RNA) where: Base-Base interactions energy: -237.275 where: short stacking energy: -116.784 Base-Backbone interact. energy: -0.725 local terms energy: -129.309747 where: bonds (distance) C4'-P energy: -19.205 bonds (distance) P-C4' energy: -28.700 flat angles C4'-P-C4' energy: -26.920 flat angles P-C4'-P energy: -21.583 tors. eta vs tors. theta energy: -32.901 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 150 Temperature: 1.000000 Total energy: -366.507923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.507923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.507923 (E_RNA) where: Base-Base interactions energy: -244.124 where: short stacking energy: -115.086 Base-Backbone interact. energy: -1.341 local terms energy: -121.042758 where: bonds (distance) C4'-P energy: -26.223 bonds (distance) P-C4' energy: -16.939 flat angles C4'-P-C4' energy: -23.281 flat angles P-C4'-P energy: -17.420 tors. eta vs tors. theta energy: -37.180 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 150 Temperature: 1.050000 Total energy: -340.360909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.360909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.360909 (E_RNA) where: Base-Base interactions energy: -211.542 where: short stacking energy: -110.739 Base-Backbone interact. energy: -0.611 local terms energy: -128.207999 where: bonds (distance) C4'-P energy: -18.080 bonds (distance) P-C4' energy: -27.496 flat angles C4'-P-C4' energy: -27.965 flat angles P-C4'-P energy: -20.411 tors. eta vs tors. theta energy: -34.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 150 Temperature: 1.100000 Total energy: -340.930030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.930030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.930030 (E_RNA) where: Base-Base interactions energy: -229.649 where: short stacking energy: -107.669 Base-Backbone interact. energy: -0.171 local terms energy: -111.109917 where: bonds (distance) C4'-P energy: -23.717 bonds (distance) P-C4' energy: -19.124 flat angles C4'-P-C4' energy: -19.371 flat angles P-C4'-P energy: -17.032 tors. eta vs tors. theta energy: -31.866 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 150 Temperature: 1.150000 Total energy: -319.932464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.932464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.937154 (E_RNA) where: Base-Base interactions energy: -214.482 where: short stacking energy: -106.564 Base-Backbone interact. energy: -0.422 local terms energy: -105.033664 where: bonds (distance) C4'-P energy: -16.953 bonds (distance) P-C4' energy: -22.582 flat angles C4'-P-C4' energy: -21.913 flat angles P-C4'-P energy: -14.134 tors. eta vs tors. theta energy: -29.451 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 150 Temperature: 1.200000 Total energy: -247.316771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.316771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.316771 (E_RNA) where: Base-Base interactions energy: -154.251 where: short stacking energy: -76.238 Base-Backbone interact. energy: 3.948 local terms energy: -97.013826 where: bonds (distance) C4'-P energy: -20.423 bonds (distance) P-C4' energy: -22.547 flat angles C4'-P-C4' energy: -22.559 flat angles P-C4'-P energy: -16.938 tors. eta vs tors. theta energy: -14.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 150 Temperature: 1.250000 Total energy: -201.320640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -201.320640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -201.320640 (E_RNA) where: Base-Base interactions energy: -131.275 where: short stacking energy: -68.540 Base-Backbone interact. energy: 1.334 local terms energy: -71.379694 where: bonds (distance) C4'-P energy: -15.767 bonds (distance) P-C4' energy: -23.390 flat angles C4'-P-C4' energy: -14.655 flat angles P-C4'-P energy: -14.935 tors. eta vs tors. theta energy: -2.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 150 Temperature: 1.300000 Total energy: -227.818376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.818376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.818376 (E_RNA) where: Base-Base interactions energy: -134.801 where: short stacking energy: -67.892 Base-Backbone interact. energy: -0.029 local terms energy: -92.987943 where: bonds (distance) C4'-P energy: -19.678 bonds (distance) P-C4' energy: -22.869 flat angles C4'-P-C4' energy: -21.350 flat angles P-C4'-P energy: -7.786 tors. eta vs tors. theta energy: -21.305 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 150 Temperature: 1.350000 Total energy: -155.919725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.919725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.961636 (E_RNA) where: Base-Base interactions energy: -69.684 where: short stacking energy: -43.642 Base-Backbone interact. energy: -0.701 local terms energy: -85.576314 where: bonds (distance) C4'-P energy: -20.395 bonds (distance) P-C4' energy: -25.960 flat angles C4'-P-C4' energy: -19.858 flat angles P-C4'-P energy: -13.353 tors. eta vs tors. theta energy: -6.010 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 151 Temperature: 0.900000 Total energy: -373.879888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.879888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.944031 (E_RNA) where: Base-Base interactions energy: -247.767 where: short stacking energy: -129.013 Base-Backbone interact. energy: -0.162 local terms energy: -126.014605 where: bonds (distance) C4'-P energy: -24.117 bonds (distance) P-C4' energy: -27.381 flat angles C4'-P-C4' energy: -22.976 flat angles P-C4'-P energy: -16.666 tors. eta vs tors. theta energy: -34.875 Dist. restrs. and SS energy: 0.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 151 Temperature: 0.950000 Total energy: -383.711959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.711959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.739676 (E_RNA) where: Base-Base interactions energy: -252.154 where: short stacking energy: -124.553 Base-Backbone interact. energy: -2.022 local terms energy: -129.563856 where: bonds (distance) C4'-P energy: -23.578 bonds (distance) P-C4' energy: -24.207 flat angles C4'-P-C4' energy: -23.659 flat angles P-C4'-P energy: -19.647 tors. eta vs tors. theta energy: -38.473 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 151 Temperature: 1.000000 Total energy: -366.622050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.622050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.622050 (E_RNA) where: Base-Base interactions energy: -238.438 where: short stacking energy: -109.033 Base-Backbone interact. energy: -0.908 local terms energy: -127.275756 where: bonds (distance) C4'-P energy: -24.100 bonds (distance) P-C4' energy: -28.253 flat angles C4'-P-C4' energy: -27.059 flat angles P-C4'-P energy: -14.101 tors. eta vs tors. theta energy: -33.762 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 151 Temperature: 1.050000 Total energy: -355.871572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.871572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.426791 (E_RNA) where: Base-Base interactions energy: -243.853 where: short stacking energy: -119.052 Base-Backbone interact. energy: -0.025 local terms energy: -112.548252 where: bonds (distance) C4'-P energy: -18.659 bonds (distance) P-C4' energy: -24.003 flat angles C4'-P-C4' energy: -21.423 flat angles P-C4'-P energy: -14.925 tors. eta vs tors. theta energy: -33.539 Dist. restrs. and SS energy: 0.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 151 Temperature: 1.100000 Total energy: -332.479225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.479225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.479225 (E_RNA) where: Base-Base interactions energy: -218.576 where: short stacking energy: -104.794 Base-Backbone interact. energy: -1.484 local terms energy: -112.419420 where: bonds (distance) C4'-P energy: -18.461 bonds (distance) P-C4' energy: -19.003 flat angles C4'-P-C4' energy: -22.818 flat angles P-C4'-P energy: -15.408 tors. eta vs tors. theta energy: -36.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 151 Temperature: 1.150000 Total energy: -321.029227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.029227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.044779 (E_RNA) where: Base-Base interactions energy: -212.045 where: short stacking energy: -109.534 Base-Backbone interact. energy: -0.009 local terms energy: -108.990685 where: bonds (distance) C4'-P energy: -15.060 bonds (distance) P-C4' energy: -20.055 flat angles C4'-P-C4' energy: -23.640 flat angles P-C4'-P energy: -18.290 tors. eta vs tors. theta energy: -31.945 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 151 Temperature: 1.200000 Total energy: -258.676176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.676176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.720341 (E_RNA) where: Base-Base interactions energy: -156.434 where: short stacking energy: -86.334 Base-Backbone interact. energy: -0.535 local terms energy: -101.750884 where: bonds (distance) C4'-P energy: -21.615 bonds (distance) P-C4' energy: -23.717 flat angles C4'-P-C4' energy: -22.649 flat angles P-C4'-P energy: -16.581 tors. eta vs tors. theta energy: -17.189 Dist. restrs. and SS energy: 0.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 151 Temperature: 1.250000 Total energy: -251.835024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.835024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.886658 (E_RNA) where: Base-Base interactions energy: -167.233 where: short stacking energy: -89.110 Base-Backbone interact. energy: -0.016 local terms energy: -84.637866 where: bonds (distance) C4'-P energy: -21.028 bonds (distance) P-C4' energy: -20.423 flat angles C4'-P-C4' energy: -14.236 flat angles P-C4'-P energy: -10.634 tors. eta vs tors. theta energy: -18.317 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 151 Temperature: 1.300000 Total energy: -162.623803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.623803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.790386 (E_RNA) where: Base-Base interactions energy: -83.692 where: short stacking energy: -54.749 Base-Backbone interact. energy: -0.086 local terms energy: -79.012527 where: bonds (distance) C4'-P energy: -18.196 bonds (distance) P-C4' energy: -16.685 flat angles C4'-P-C4' energy: -24.023 flat angles P-C4'-P energy: -10.674 tors. eta vs tors. theta energy: -9.435 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 151 Temperature: 1.350000 Total energy: -163.825821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.825821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.860354 (E_RNA) where: Base-Base interactions energy: -88.259 where: short stacking energy: -53.554 Base-Backbone interact. energy: -0.133 local terms energy: -75.467931 where: bonds (distance) C4'-P energy: -17.251 bonds (distance) P-C4' energy: -16.723 flat angles C4'-P-C4' energy: -18.378 flat angles P-C4'-P energy: -15.090 tors. eta vs tors. theta energy: -8.026 Dist. restrs. and SS energy: 0.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 152 Temperature: 0.900000 Total energy: -386.006464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.006464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.006464 (E_RNA) where: Base-Base interactions energy: -252.261 where: short stacking energy: -125.764 Base-Backbone interact. energy: -0.265 local terms energy: -133.480118 where: bonds (distance) C4'-P energy: -24.903 bonds (distance) P-C4' energy: -22.898 flat angles C4'-P-C4' energy: -25.867 flat angles P-C4'-P energy: -20.850 tors. eta vs tors. theta energy: -38.962 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 152 Temperature: 0.950000 Total energy: -391.692846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.692846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.801969 (E_RNA) where: Base-Base interactions energy: -252.405 where: short stacking energy: -123.802 Base-Backbone interact. energy: -0.941 local terms energy: -138.455462 where: bonds (distance) C4'-P energy: -25.762 bonds (distance) P-C4' energy: -24.902 flat angles C4'-P-C4' energy: -29.467 flat angles P-C4'-P energy: -18.725 tors. eta vs tors. theta energy: -39.600 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 152 Temperature: 1.000000 Total energy: -357.686250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.686250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.686250 (E_RNA) where: Base-Base interactions energy: -235.900 where: short stacking energy: -123.307 Base-Backbone interact. energy: -1.283 local terms energy: -120.503407 where: bonds (distance) C4'-P energy: -23.548 bonds (distance) P-C4' energy: -23.257 flat angles C4'-P-C4' energy: -24.116 flat angles P-C4'-P energy: -14.696 tors. eta vs tors. theta energy: -34.886 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 152 Temperature: 1.050000 Total energy: -360.481025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.481025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.547890 (E_RNA) where: Base-Base interactions energy: -233.686 where: short stacking energy: -107.963 Base-Backbone interact. energy: -0.268 local terms energy: -126.593963 where: bonds (distance) C4'-P energy: -20.679 bonds (distance) P-C4' energy: -27.069 flat angles C4'-P-C4' energy: -25.075 flat angles P-C4'-P energy: -17.613 tors. eta vs tors. theta energy: -36.158 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 152 Temperature: 1.100000 Total energy: -333.011342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.011342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.325982 (E_RNA) where: Base-Base interactions energy: -223.756 where: short stacking energy: -101.913 Base-Backbone interact. energy: -2.189 local terms energy: -107.381756 where: bonds (distance) C4'-P energy: -21.971 bonds (distance) P-C4' energy: -16.330 flat angles C4'-P-C4' energy: -24.629 flat angles P-C4'-P energy: -14.770 tors. eta vs tors. theta energy: -29.681 Dist. restrs. and SS energy: 0.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 152 Temperature: 1.150000 Total energy: -311.681331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.681331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.742491 (E_RNA) where: Base-Base interactions energy: -200.197 where: short stacking energy: -95.642 Base-Backbone interact. energy: -0.641 local terms energy: -110.904594 where: bonds (distance) C4'-P energy: -23.763 bonds (distance) P-C4' energy: -21.101 flat angles C4'-P-C4' energy: -23.996 flat angles P-C4'-P energy: -19.550 tors. eta vs tors. theta energy: -22.495 Dist. restrs. and SS energy: 0.061 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 152 Temperature: 1.200000 Total energy: -269.147386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.147386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.172940 (E_RNA) where: Base-Base interactions energy: -161.686 where: short stacking energy: -84.836 Base-Backbone interact. energy: -0.382 local terms energy: -107.105107 where: bonds (distance) C4'-P energy: -18.099 bonds (distance) P-C4' energy: -23.743 flat angles C4'-P-C4' energy: -27.851 flat angles P-C4'-P energy: -15.528 tors. eta vs tors. theta energy: -21.884 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 152 Temperature: 1.250000 Total energy: -232.115227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.115227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.140983 (E_RNA) where: Base-Base interactions energy: -138.071 where: short stacking energy: -74.869 Base-Backbone interact. energy: -0.173 local terms energy: -93.896424 where: bonds (distance) C4'-P energy: -19.904 bonds (distance) P-C4' energy: -20.104 flat angles C4'-P-C4' energy: -21.702 flat angles P-C4'-P energy: -13.630 tors. eta vs tors. theta energy: -18.557 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 152 Temperature: 1.300000 Total energy: -194.634677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.634677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.667834 (E_RNA) where: Base-Base interactions energy: -117.469 where: short stacking energy: -62.143 Base-Backbone interact. energy: -1.739 local terms energy: -75.459053 where: bonds (distance) C4'-P energy: -19.546 bonds (distance) P-C4' energy: -9.412 flat angles C4'-P-C4' energy: -21.038 flat angles P-C4'-P energy: -13.952 tors. eta vs tors. theta energy: -11.511 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 152 Temperature: 1.350000 Total energy: -151.356016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.356016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.399280 (E_RNA) where: Base-Base interactions energy: -78.280 where: short stacking energy: -45.189 Base-Backbone interact. energy: -0.529 local terms energy: -72.590046 where: bonds (distance) C4'-P energy: -22.285 bonds (distance) P-C4' energy: -13.798 flat angles C4'-P-C4' energy: -20.826 flat angles P-C4'-P energy: -11.324 tors. eta vs tors. theta energy: -4.356 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 153 Temperature: 0.900000 Total energy: -372.605734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.605734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.654019 (E_RNA) where: Base-Base interactions energy: -245.519 where: short stacking energy: -122.041 Base-Backbone interact. energy: -0.000 local terms energy: -127.134267 where: bonds (distance) C4'-P energy: -21.772 bonds (distance) P-C4' energy: -24.354 flat angles C4'-P-C4' energy: -26.041 flat angles P-C4'-P energy: -20.456 tors. eta vs tors. theta energy: -34.511 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 153 Temperature: 0.950000 Total energy: -357.428642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.428642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.591985 (E_RNA) where: Base-Base interactions energy: -233.122 where: short stacking energy: -117.311 Base-Backbone interact. energy: -0.026 local terms energy: -124.443528 where: bonds (distance) C4'-P energy: -25.312 bonds (distance) P-C4' energy: -19.048 flat angles C4'-P-C4' energy: -25.705 flat angles P-C4'-P energy: -20.204 tors. eta vs tors. theta energy: -34.175 Dist. restrs. and SS energy: 0.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 153 Temperature: 1.000000 Total energy: -374.216195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.216195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.298562 (E_RNA) where: Base-Base interactions energy: -240.707 where: short stacking energy: -123.686 Base-Backbone interact. energy: -0.528 local terms energy: -133.063650 where: bonds (distance) C4'-P energy: -25.826 bonds (distance) P-C4' energy: -25.173 flat angles C4'-P-C4' energy: -26.424 flat angles P-C4'-P energy: -17.975 tors. eta vs tors. theta energy: -37.666 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 153 Temperature: 1.050000 Total energy: -358.345953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.345953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.345953 (E_RNA) where: Base-Base interactions energy: -235.671 where: short stacking energy: -118.852 Base-Backbone interact. energy: -0.009 local terms energy: -122.666039 where: bonds (distance) C4'-P energy: -19.988 bonds (distance) P-C4' energy: -22.782 flat angles C4'-P-C4' energy: -25.031 flat angles P-C4'-P energy: -17.497 tors. eta vs tors. theta energy: -37.367 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 153 Temperature: 1.100000 Total energy: -319.737910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.737910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.741517 (E_RNA) where: Base-Base interactions energy: -205.369 where: short stacking energy: -95.041 Base-Backbone interact. energy: -0.552 local terms energy: -113.820090 where: bonds (distance) C4'-P energy: -22.468 bonds (distance) P-C4' energy: -21.627 flat angles C4'-P-C4' energy: -24.351 flat angles P-C4'-P energy: -12.198 tors. eta vs tors. theta energy: -33.176 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 153 Temperature: 1.150000 Total energy: -323.441976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.441976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.441976 (E_RNA) where: Base-Base interactions energy: -213.956 where: short stacking energy: -110.874 Base-Backbone interact. energy: -0.870 local terms energy: -108.615349 where: bonds (distance) C4'-P energy: -15.832 bonds (distance) P-C4' energy: -24.787 flat angles C4'-P-C4' energy: -24.716 flat angles P-C4'-P energy: -9.246 tors. eta vs tors. theta energy: -34.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 153 Temperature: 1.200000 Total energy: -249.927875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.927875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.927875 (E_RNA) where: Base-Base interactions energy: -153.949 where: short stacking energy: -79.536 Base-Backbone interact. energy: -0.681 local terms energy: -95.298245 where: bonds (distance) C4'-P energy: -24.256 bonds (distance) P-C4' energy: -20.793 flat angles C4'-P-C4' energy: -21.182 flat angles P-C4'-P energy: -12.804 tors. eta vs tors. theta energy: -16.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 153 Temperature: 1.250000 Total energy: -229.617244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.617244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.901191 (E_RNA) where: Base-Base interactions energy: -145.826 where: short stacking energy: -76.186 Base-Backbone interact. energy: 0.389 local terms energy: -84.463928 where: bonds (distance) C4'-P energy: -24.934 bonds (distance) P-C4' energy: -16.854 flat angles C4'-P-C4' energy: -15.021 flat angles P-C4'-P energy: -9.054 tors. eta vs tors. theta energy: -18.600 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 153 Temperature: 1.300000 Total energy: -204.745218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.745218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.763832 (E_RNA) where: Base-Base interactions energy: -119.541 where: short stacking energy: -50.594 Base-Backbone interact. energy: -0.826 local terms energy: -84.397498 where: bonds (distance) C4'-P energy: -19.739 bonds (distance) P-C4' energy: -26.936 flat angles C4'-P-C4' energy: -19.982 flat angles P-C4'-P energy: -12.726 tors. eta vs tors. theta energy: -5.014 Dist. restrs. and SS energy: 0.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 153 Temperature: 1.350000 Total energy: -169.700757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.700757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.859439 (E_RNA) where: Base-Base interactions energy: -90.025 where: short stacking energy: -57.159 Base-Backbone interact. energy: -1.061 local terms energy: -78.773583 where: bonds (distance) C4'-P energy: -20.241 bonds (distance) P-C4' energy: -22.770 flat angles C4'-P-C4' energy: -20.329 flat angles P-C4'-P energy: -11.057 tors. eta vs tors. theta energy: -4.376 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 154 Temperature: 0.900000 Total energy: -374.695102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.695102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.695102 (E_RNA) where: Base-Base interactions energy: -240.219 where: short stacking energy: -118.805 Base-Backbone interact. energy: -0.083 local terms energy: -134.393855 where: bonds (distance) C4'-P energy: -25.743 bonds (distance) P-C4' energy: -26.665 flat angles C4'-P-C4' energy: -26.776 flat angles P-C4'-P energy: -19.349 tors. eta vs tors. theta energy: -35.860 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 154 Temperature: 0.950000 Total energy: -365.357680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.357680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.456139 (E_RNA) where: Base-Base interactions energy: -242.827 where: short stacking energy: -123.443 Base-Backbone interact. energy: -0.009 local terms energy: -122.620336 where: bonds (distance) C4'-P energy: -22.176 bonds (distance) P-C4' energy: -25.079 flat angles C4'-P-C4' energy: -24.874 flat angles P-C4'-P energy: -16.396 tors. eta vs tors. theta energy: -34.095 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 154 Temperature: 1.000000 Total energy: -368.445857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.445857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.445857 (E_RNA) where: Base-Base interactions energy: -247.116 where: short stacking energy: -121.340 Base-Backbone interact. energy: -0.727 local terms energy: -120.603083 where: bonds (distance) C4'-P energy: -23.450 bonds (distance) P-C4' energy: -26.373 flat angles C4'-P-C4' energy: -23.931 flat angles P-C4'-P energy: -16.427 tors. eta vs tors. theta energy: -30.422 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 154 Temperature: 1.050000 Total energy: -353.513232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.513232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.587178 (E_RNA) where: Base-Base interactions energy: -236.104 where: short stacking energy: -120.197 Base-Backbone interact. energy: -0.091 local terms energy: -117.391854 where: bonds (distance) C4'-P energy: -19.806 bonds (distance) P-C4' energy: -19.152 flat angles C4'-P-C4' energy: -25.995 flat angles P-C4'-P energy: -15.516 tors. eta vs tors. theta energy: -36.922 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 154 Temperature: 1.100000 Total energy: -323.500188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.500188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.500188 (E_RNA) where: Base-Base interactions energy: -208.080 where: short stacking energy: -104.383 Base-Backbone interact. energy: -0.939 local terms energy: -114.480898 where: bonds (distance) C4'-P energy: -21.513 bonds (distance) P-C4' energy: -21.550 flat angles C4'-P-C4' energy: -24.327 flat angles P-C4'-P energy: -14.945 tors. eta vs tors. theta energy: -32.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 154 Temperature: 1.150000 Total energy: -321.141431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.141431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.152780 (E_RNA) where: Base-Base interactions energy: -202.233 where: short stacking energy: -105.648 Base-Backbone interact. energy: -1.986 local terms energy: -116.934074 where: bonds (distance) C4'-P energy: -23.991 bonds (distance) P-C4' energy: -21.448 flat angles C4'-P-C4' energy: -27.063 flat angles P-C4'-P energy: -14.387 tors. eta vs tors. theta energy: -30.045 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 154 Temperature: 1.200000 Total energy: -240.937270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.937270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.969450 (E_RNA) where: Base-Base interactions energy: -140.865 where: short stacking energy: -73.175 Base-Backbone interact. energy: -0.361 local terms energy: -99.743118 where: bonds (distance) C4'-P energy: -17.654 bonds (distance) P-C4' energy: -24.796 flat angles C4'-P-C4' energy: -23.009 flat angles P-C4'-P energy: -20.481 tors. eta vs tors. theta energy: -13.803 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 154 Temperature: 1.250000 Total energy: -239.689227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.689227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.815376 (E_RNA) where: Base-Base interactions energy: -150.438 where: short stacking energy: -79.415 Base-Backbone interact. energy: -0.959 local terms energy: -88.418326 where: bonds (distance) C4'-P energy: -15.543 bonds (distance) P-C4' energy: -15.930 flat angles C4'-P-C4' energy: -21.559 flat angles P-C4'-P energy: -17.224 tors. eta vs tors. theta energy: -18.162 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 154 Temperature: 1.300000 Total energy: -220.382941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.382941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.560006 (E_RNA) where: Base-Base interactions energy: -124.553 where: short stacking energy: -61.880 Base-Backbone interact. energy: 0.198 local terms energy: -96.205684 where: bonds (distance) C4'-P energy: -21.216 bonds (distance) P-C4' energy: -23.103 flat angles C4'-P-C4' energy: -19.411 flat angles P-C4'-P energy: -19.647 tors. eta vs tors. theta energy: -12.828 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 154 Temperature: 1.350000 Total energy: -151.043890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.043890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.043890 (E_RNA) where: Base-Base interactions energy: -83.962 where: short stacking energy: -50.534 Base-Backbone interact. energy: -0.459 local terms energy: -66.622685 where: bonds (distance) C4'-P energy: -18.530 bonds (distance) P-C4' energy: -25.851 flat angles C4'-P-C4' energy: -21.154 flat angles P-C4'-P energy: -3.908 tors. eta vs tors. theta energy: 2.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 155 Temperature: 0.900000 Total energy: -377.952942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.952942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.269164 (E_RNA) where: Base-Base interactions energy: -241.600 where: short stacking energy: -120.361 Base-Backbone interact. energy: -0.484 local terms energy: -136.184729 where: bonds (distance) C4'-P energy: -21.296 bonds (distance) P-C4' energy: -24.450 flat angles C4'-P-C4' energy: -27.259 flat angles P-C4'-P energy: -23.358 tors. eta vs tors. theta energy: -39.821 Dist. restrs. and SS energy: 0.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 155 Temperature: 0.950000 Total energy: -373.878520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.878520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.878520 (E_RNA) where: Base-Base interactions energy: -247.342 where: short stacking energy: -124.082 Base-Backbone interact. energy: -0.001 local terms energy: -126.536157 where: bonds (distance) C4'-P energy: -22.548 bonds (distance) P-C4' energy: -24.506 flat angles C4'-P-C4' energy: -25.312 flat angles P-C4'-P energy: -16.918 tors. eta vs tors. theta energy: -37.252 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 155 Temperature: 1.000000 Total energy: -365.456667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.456667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.460150 (E_RNA) where: Base-Base interactions energy: -237.727 where: short stacking energy: -114.780 Base-Backbone interact. energy: -0.632 local terms energy: -127.100904 where: bonds (distance) C4'-P energy: -26.435 bonds (distance) P-C4' energy: -24.966 flat angles C4'-P-C4' energy: -25.985 flat angles P-C4'-P energy: -14.655 tors. eta vs tors. theta energy: -35.061 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 155 Temperature: 1.050000 Total energy: -340.597726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.597726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.597726 (E_RNA) where: Base-Base interactions energy: -214.633 where: short stacking energy: -110.055 Base-Backbone interact. energy: 0.114 local terms energy: -126.078590 where: bonds (distance) C4'-P energy: -22.951 bonds (distance) P-C4' energy: -27.929 flat angles C4'-P-C4' energy: -23.637 flat angles P-C4'-P energy: -17.100 tors. eta vs tors. theta energy: -34.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 155 Temperature: 1.100000 Total energy: -339.030160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.030160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.043542 (E_RNA) where: Base-Base interactions energy: -223.331 where: short stacking energy: -116.189 Base-Backbone interact. energy: -0.011 local terms energy: -115.701765 where: bonds (distance) C4'-P energy: -12.553 bonds (distance) P-C4' energy: -24.463 flat angles C4'-P-C4' energy: -22.558 flat angles P-C4'-P energy: -20.793 tors. eta vs tors. theta energy: -35.335 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 155 Temperature: 1.150000 Total energy: -268.351630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.351630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.485524 (E_RNA) where: Base-Base interactions energy: -158.947 where: short stacking energy: -91.119 Base-Backbone interact. energy: -0.069 local terms energy: -109.469904 where: bonds (distance) C4'-P energy: -19.664 bonds (distance) P-C4' energy: -22.012 flat angles C4'-P-C4' energy: -21.352 flat angles P-C4'-P energy: -13.699 tors. eta vs tors. theta energy: -32.744 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 155 Temperature: 1.200000 Total energy: -290.980830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.980830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.980830 (E_RNA) where: Base-Base interactions energy: -182.872 where: short stacking energy: -80.659 Base-Backbone interact. energy: -1.134 local terms energy: -106.975050 where: bonds (distance) C4'-P energy: -25.375 bonds (distance) P-C4' energy: -24.813 flat angles C4'-P-C4' energy: -22.545 flat angles P-C4'-P energy: -11.090 tors. eta vs tors. theta energy: -23.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 155 Temperature: 1.250000 Total energy: -238.473876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.473876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.499224 (E_RNA) where: Base-Base interactions energy: -140.280 where: short stacking energy: -75.786 Base-Backbone interact. energy: -0.599 local terms energy: -97.620424 where: bonds (distance) C4'-P energy: -24.816 bonds (distance) P-C4' energy: -20.163 flat angles C4'-P-C4' energy: -22.552 flat angles P-C4'-P energy: -15.097 tors. eta vs tors. theta energy: -14.993 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 155 Temperature: 1.300000 Total energy: -210.695195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.695195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.705917 (E_RNA) where: Base-Base interactions energy: -126.834 where: short stacking energy: -65.176 Base-Backbone interact. energy: -0.235 local terms energy: -83.636598 where: bonds (distance) C4'-P energy: -24.314 bonds (distance) P-C4' energy: -28.380 flat angles C4'-P-C4' energy: -18.455 flat angles P-C4'-P energy: -2.786 tors. eta vs tors. theta energy: -9.702 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 155 Temperature: 1.350000 Total energy: -153.648692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.648692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.787123 (E_RNA) where: Base-Base interactions energy: -78.172 where: short stacking energy: -50.635 Base-Backbone interact. energy: -0.436 local terms energy: -75.179738 where: bonds (distance) C4'-P energy: -16.655 bonds (distance) P-C4' energy: -25.504 flat angles C4'-P-C4' energy: -16.651 flat angles P-C4'-P energy: -13.646 tors. eta vs tors. theta energy: -2.725 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 156 Temperature: 0.900000 Total energy: -387.292651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.292651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.301885 (E_RNA) where: Base-Base interactions energy: -256.862 where: short stacking energy: -135.216 Base-Backbone interact. energy: -0.061 local terms energy: -130.379338 where: bonds (distance) C4'-P energy: -24.059 bonds (distance) P-C4' energy: -24.709 flat angles C4'-P-C4' energy: -25.366 flat angles P-C4'-P energy: -18.122 tors. eta vs tors. theta energy: -38.122 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 156 Temperature: 0.950000 Total energy: -371.864042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.864042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.864042 (E_RNA) where: Base-Base interactions energy: -247.491 where: short stacking energy: -123.648 Base-Backbone interact. energy: -1.145 local terms energy: -123.227813 where: bonds (distance) C4'-P energy: -17.558 bonds (distance) P-C4' energy: -24.763 flat angles C4'-P-C4' energy: -26.637 flat angles P-C4'-P energy: -20.134 tors. eta vs tors. theta energy: -34.137 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 156 Temperature: 1.000000 Total energy: -361.335427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.335427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.335427 (E_RNA) where: Base-Base interactions energy: -241.433 where: short stacking energy: -120.611 Base-Backbone interact. energy: -0.662 local terms energy: -119.240898 where: bonds (distance) C4'-P energy: -22.704 bonds (distance) P-C4' energy: -24.430 flat angles C4'-P-C4' energy: -20.886 flat angles P-C4'-P energy: -16.557 tors. eta vs tors. theta energy: -34.664 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 156 Temperature: 1.050000 Total energy: -326.691964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.691964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.691964 (E_RNA) where: Base-Base interactions energy: -215.068 where: short stacking energy: -95.905 Base-Backbone interact. energy: -0.008 local terms energy: -111.615561 where: bonds (distance) C4'-P energy: -24.369 bonds (distance) P-C4' energy: -22.396 flat angles C4'-P-C4' energy: -26.439 flat angles P-C4'-P energy: -13.742 tors. eta vs tors. theta energy: -24.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 156 Temperature: 1.100000 Total energy: -337.092817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.092817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.239272 (E_RNA) where: Base-Base interactions energy: -218.474 where: short stacking energy: -110.680 Base-Backbone interact. energy: -0.183 local terms energy: -118.581903 where: bonds (distance) C4'-P energy: -23.560 bonds (distance) P-C4' energy: -24.176 flat angles C4'-P-C4' energy: -21.309 flat angles P-C4'-P energy: -17.041 tors. eta vs tors. theta energy: -32.496 Dist. restrs. and SS energy: 0.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 156 Temperature: 1.150000 Total energy: -271.240839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.240839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.243801 (E_RNA) where: Base-Base interactions energy: -169.521 where: short stacking energy: -86.156 Base-Backbone interact. energy: -0.251 local terms energy: -101.471819 where: bonds (distance) C4'-P energy: -22.689 bonds (distance) P-C4' energy: -21.481 flat angles C4'-P-C4' energy: -23.787 flat angles P-C4'-P energy: -12.835 tors. eta vs tors. theta energy: -20.681 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 156 Temperature: 1.200000 Total energy: -232.280680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.280680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.321444 (E_RNA) where: Base-Base interactions energy: -140.193 where: short stacking energy: -61.442 Base-Backbone interact. energy: -0.370 local terms energy: -91.758872 where: bonds (distance) C4'-P energy: -24.595 bonds (distance) P-C4' energy: -21.691 flat angles C4'-P-C4' energy: -23.175 flat angles P-C4'-P energy: -11.137 tors. eta vs tors. theta energy: -11.161 Dist. restrs. and SS energy: 0.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 156 Temperature: 1.250000 Total energy: -255.732402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.732402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.789185 (E_RNA) where: Base-Base interactions energy: -158.629 where: short stacking energy: -82.952 Base-Backbone interact. energy: -0.268 local terms energy: -96.892768 where: bonds (distance) C4'-P energy: -19.852 bonds (distance) P-C4' energy: -18.257 flat angles C4'-P-C4' energy: -24.548 flat angles P-C4'-P energy: -11.892 tors. eta vs tors. theta energy: -22.344 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 156 Temperature: 1.300000 Total energy: -173.541988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.541988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.569562 (E_RNA) where: Base-Base interactions energy: -91.699 where: short stacking energy: -52.769 Base-Backbone interact. energy: 4.834 local terms energy: -86.704209 where: bonds (distance) C4'-P energy: -19.219 bonds (distance) P-C4' energy: -22.982 flat angles C4'-P-C4' energy: -18.659 flat angles P-C4'-P energy: -12.781 tors. eta vs tors. theta energy: -13.063 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 156 Temperature: 1.350000 Total energy: -205.514498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.514498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.517802 (E_RNA) where: Base-Base interactions energy: -119.750 where: short stacking energy: -62.653 Base-Backbone interact. energy: 2.330 local terms energy: -88.098048 where: bonds (distance) C4'-P energy: -19.781 bonds (distance) P-C4' energy: -22.341 flat angles C4'-P-C4' energy: -20.506 flat angles P-C4'-P energy: -17.270 tors. eta vs tors. theta energy: -8.199 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 157 Temperature: 0.900000 Total energy: -387.651828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.651828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.651828 (E_RNA) where: Base-Base interactions energy: -254.963 where: short stacking energy: -131.039 Base-Backbone interact. energy: -0.003 local terms energy: -132.686038 where: bonds (distance) C4'-P energy: -22.443 bonds (distance) P-C4' energy: -28.819 flat angles C4'-P-C4' energy: -27.161 flat angles P-C4'-P energy: -20.241 tors. eta vs tors. theta energy: -34.022 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 157 Temperature: 0.950000 Total energy: -379.447280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.447280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.476134 (E_RNA) where: Base-Base interactions energy: -250.596 where: short stacking energy: -127.228 Base-Backbone interact. energy: -0.042 local terms energy: -128.838504 where: bonds (distance) C4'-P energy: -27.043 bonds (distance) P-C4' energy: -22.346 flat angles C4'-P-C4' energy: -28.294 flat angles P-C4'-P energy: -16.509 tors. eta vs tors. theta energy: -34.647 Dist. restrs. and SS energy: 0.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 157 Temperature: 1.000000 Total energy: -357.576602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.576602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.576602 (E_RNA) where: Base-Base interactions energy: -239.650 where: short stacking energy: -125.566 Base-Backbone interact. energy: -0.360 local terms energy: -117.566239 where: bonds (distance) C4'-P energy: -20.940 bonds (distance) P-C4' energy: -25.176 flat angles C4'-P-C4' energy: -20.886 flat angles P-C4'-P energy: -17.346 tors. eta vs tors. theta energy: -33.218 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 157 Temperature: 1.050000 Total energy: -362.099031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.099031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.099031 (E_RNA) where: Base-Base interactions energy: -243.436 where: short stacking energy: -121.044 Base-Backbone interact. energy: -0.149 local terms energy: -118.514494 where: bonds (distance) C4'-P energy: -16.505 bonds (distance) P-C4' energy: -19.924 flat angles C4'-P-C4' energy: -27.705 flat angles P-C4'-P energy: -18.000 tors. eta vs tors. theta energy: -36.380 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 157 Temperature: 1.100000 Total energy: -326.796917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.796917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.796917 (E_RNA) where: Base-Base interactions energy: -207.811 where: short stacking energy: -109.470 Base-Backbone interact. energy: -0.133 local terms energy: -118.853045 where: bonds (distance) C4'-P energy: -24.091 bonds (distance) P-C4' energy: -26.557 flat angles C4'-P-C4' energy: -22.156 flat angles P-C4'-P energy: -17.240 tors. eta vs tors. theta energy: -28.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 157 Temperature: 1.150000 Total energy: -250.900255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.900255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.015176 (E_RNA) where: Base-Base interactions energy: -151.871 where: short stacking energy: -91.783 Base-Backbone interact. energy: -0.154 local terms energy: -98.989670 where: bonds (distance) C4'-P energy: -23.341 bonds (distance) P-C4' energy: -21.945 flat angles C4'-P-C4' energy: -22.411 flat angles P-C4'-P energy: -10.678 tors. eta vs tors. theta energy: -20.615 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 157 Temperature: 1.200000 Total energy: -248.743210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.743210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.757327 (E_RNA) where: Base-Base interactions energy: -147.191 where: short stacking energy: -81.282 Base-Backbone interact. energy: -0.208 local terms energy: -101.358817 where: bonds (distance) C4'-P energy: -21.281 bonds (distance) P-C4' energy: -18.873 flat angles C4'-P-C4' energy: -23.389 flat angles P-C4'-P energy: -17.782 tors. eta vs tors. theta energy: -20.034 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 157 Temperature: 1.250000 Total energy: -240.669639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.669639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.787404 (E_RNA) where: Base-Base interactions energy: -145.161 where: short stacking energy: -84.256 Base-Backbone interact. energy: -0.044 local terms energy: -95.582034 where: bonds (distance) C4'-P energy: -18.488 bonds (distance) P-C4' energy: -19.087 flat angles C4'-P-C4' energy: -16.042 flat angles P-C4'-P energy: -18.928 tors. eta vs tors. theta energy: -23.036 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 157 Temperature: 1.300000 Total energy: -171.623782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.623782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.648718 (E_RNA) where: Base-Base interactions energy: -85.159 where: short stacking energy: -55.724 Base-Backbone interact. energy: -0.125 local terms energy: -86.364928 where: bonds (distance) C4'-P energy: -25.614 bonds (distance) P-C4' energy: -17.882 flat angles C4'-P-C4' energy: -16.041 flat angles P-C4'-P energy: -14.785 tors. eta vs tors. theta energy: -12.043 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 157 Temperature: 1.350000 Total energy: -155.349637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.349637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.395762 (E_RNA) where: Base-Base interactions energy: -83.520 where: short stacking energy: -42.984 Base-Backbone interact. energy: -0.873 local terms energy: -71.003203 where: bonds (distance) C4'-P energy: -18.493 bonds (distance) P-C4' energy: -23.470 flat angles C4'-P-C4' energy: -23.243 flat angles P-C4'-P energy: -7.812 tors. eta vs tors. theta energy: 2.016 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 158 Temperature: 0.900000 Total energy: -384.262199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.262199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.285307 (E_RNA) where: Base-Base interactions energy: -248.524 where: short stacking energy: -118.744 Base-Backbone interact. energy: -0.657 local terms energy: -135.104450 where: bonds (distance) C4'-P energy: -24.505 bonds (distance) P-C4' energy: -29.091 flat angles C4'-P-C4' energy: -28.565 flat angles P-C4'-P energy: -18.644 tors. eta vs tors. theta energy: -34.299 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 158 Temperature: 0.950000 Total energy: -361.971490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.971490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.971490 (E_RNA) where: Base-Base interactions energy: -237.431 where: short stacking energy: -118.166 Base-Backbone interact. energy: -0.829 local terms energy: -123.711950 where: bonds (distance) C4'-P energy: -22.885 bonds (distance) P-C4' energy: -27.150 flat angles C4'-P-C4' energy: -24.648 flat angles P-C4'-P energy: -17.265 tors. eta vs tors. theta energy: -31.764 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 158 Temperature: 1.000000 Total energy: -370.644957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.644957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.677411 (E_RNA) where: Base-Base interactions energy: -241.433 where: short stacking energy: -120.920 Base-Backbone interact. energy: -1.865 local terms energy: -127.379801 where: bonds (distance) C4'-P energy: -20.484 bonds (distance) P-C4' energy: -23.350 flat angles C4'-P-C4' energy: -27.539 flat angles P-C4'-P energy: -17.600 tors. eta vs tors. theta energy: -38.407 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 158 Temperature: 1.050000 Total energy: -356.080705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.080705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.080705 (E_RNA) where: Base-Base interactions energy: -246.078 where: short stacking energy: -122.984 Base-Backbone interact. energy: -0.064 local terms energy: -109.938048 where: bonds (distance) C4'-P energy: -17.695 bonds (distance) P-C4' energy: -17.713 flat angles C4'-P-C4' energy: -27.044 flat angles P-C4'-P energy: -15.344 tors. eta vs tors. theta energy: -32.144 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 158 Temperature: 1.100000 Total energy: -326.080066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.080066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.080066 (E_RNA) where: Base-Base interactions energy: -220.639 where: short stacking energy: -110.860 Base-Backbone interact. energy: -0.524 local terms energy: -104.917093 where: bonds (distance) C4'-P energy: -23.475 bonds (distance) P-C4' energy: -17.099 flat angles C4'-P-C4' energy: -14.743 flat angles P-C4'-P energy: -17.933 tors. eta vs tors. theta energy: -31.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 158 Temperature: 1.150000 Total energy: -250.272182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.272182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.272182 (E_RNA) where: Base-Base interactions energy: -149.637 where: short stacking energy: -73.774 Base-Backbone interact. energy: -0.057 local terms energy: -100.578669 where: bonds (distance) C4'-P energy: -18.586 bonds (distance) P-C4' energy: -23.967 flat angles C4'-P-C4' energy: -22.598 flat angles P-C4'-P energy: -17.569 tors. eta vs tors. theta energy: -17.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 158 Temperature: 1.200000 Total energy: -281.610703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.610703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.648825 (E_RNA) where: Base-Base interactions energy: -180.954 where: short stacking energy: -89.161 Base-Backbone interact. energy: -0.008 local terms energy: -100.687186 where: bonds (distance) C4'-P energy: -19.940 bonds (distance) P-C4' energy: -14.003 flat angles C4'-P-C4' energy: -21.128 flat angles P-C4'-P energy: -18.939 tors. eta vs tors. theta energy: -26.676 Dist. restrs. and SS energy: 0.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 158 Temperature: 1.250000 Total energy: -268.992361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.992361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.992361 (E_RNA) where: Base-Base interactions energy: -174.667 where: short stacking energy: -85.916 Base-Backbone interact. energy: -0.464 local terms energy: -93.861418 where: bonds (distance) C4'-P energy: -17.731 bonds (distance) P-C4' energy: -15.178 flat angles C4'-P-C4' energy: -26.447 flat angles P-C4'-P energy: -14.938 tors. eta vs tors. theta energy: -19.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 158 Temperature: 1.300000 Total energy: -176.869729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.869729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.869729 (E_RNA) where: Base-Base interactions energy: -87.675 where: short stacking energy: -64.114 Base-Backbone interact. energy: -0.052 local terms energy: -89.143277 where: bonds (distance) C4'-P energy: -23.400 bonds (distance) P-C4' energy: -25.808 flat angles C4'-P-C4' energy: -16.171 flat angles P-C4'-P energy: -14.551 tors. eta vs tors. theta energy: -9.212 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 158 Temperature: 1.350000 Total energy: -158.813502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.813502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.847305 (E_RNA) where: Base-Base interactions energy: -79.474 where: short stacking energy: -46.608 Base-Backbone interact. energy: 2.772 local terms energy: -82.145610 where: bonds (distance) C4'-P energy: -18.850 bonds (distance) P-C4' energy: -25.490 flat angles C4'-P-C4' energy: -20.546 flat angles P-C4'-P energy: -12.511 tors. eta vs tors. theta energy: -4.748 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 159 Temperature: 0.900000 Total energy: -385.583241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.583241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.662940 (E_RNA) where: Base-Base interactions energy: -262.986 where: short stacking energy: -127.153 Base-Backbone interact. energy: -0.836 local terms energy: -121.840896 where: bonds (distance) C4'-P energy: -20.435 bonds (distance) P-C4' energy: -24.158 flat angles C4'-P-C4' energy: -25.987 flat angles P-C4'-P energy: -17.502 tors. eta vs tors. theta energy: -33.759 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 159 Temperature: 0.950000 Total energy: -381.914097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.914097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.931658 (E_RNA) where: Base-Base interactions energy: -248.632 where: short stacking energy: -125.982 Base-Backbone interact. energy: -0.716 local terms energy: -132.584139 where: bonds (distance) C4'-P energy: -23.234 bonds (distance) P-C4' energy: -26.075 flat angles C4'-P-C4' energy: -28.059 flat angles P-C4'-P energy: -16.634 tors. eta vs tors. theta energy: -38.582 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 159 Temperature: 1.000000 Total energy: -359.225301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.225301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.225301 (E_RNA) where: Base-Base interactions energy: -238.570 where: short stacking energy: -116.669 Base-Backbone interact. energy: 0.716 local terms energy: -121.371191 where: bonds (distance) C4'-P energy: -24.294 bonds (distance) P-C4' energy: -21.975 flat angles C4'-P-C4' energy: -22.091 flat angles P-C4'-P energy: -18.039 tors. eta vs tors. theta energy: -34.972 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 159 Temperature: 1.050000 Total energy: -353.103220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.103220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.214173 (E_RNA) where: Base-Base interactions energy: -238.630 where: short stacking energy: -112.001 Base-Backbone interact. energy: -0.333 local terms energy: -114.251327 where: bonds (distance) C4'-P energy: -18.844 bonds (distance) P-C4' energy: -22.586 flat angles C4'-P-C4' energy: -26.409 flat angles P-C4'-P energy: -15.967 tors. eta vs tors. theta energy: -30.447 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 159 Temperature: 1.100000 Total energy: -317.209897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.209897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.371598 (E_RNA) where: Base-Base interactions energy: -209.435 where: short stacking energy: -106.846 Base-Backbone interact. energy: -0.211 local terms energy: -107.726459 where: bonds (distance) C4'-P energy: -19.711 bonds (distance) P-C4' energy: -22.646 flat angles C4'-P-C4' energy: -18.237 flat angles P-C4'-P energy: -18.235 tors. eta vs tors. theta energy: -28.898 Dist. restrs. and SS energy: 0.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 159 Temperature: 1.150000 Total energy: -323.982437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.982437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.982437 (E_RNA) where: Base-Base interactions energy: -216.612 where: short stacking energy: -108.285 Base-Backbone interact. energy: -0.447 local terms energy: -106.923388 where: bonds (distance) C4'-P energy: -23.832 bonds (distance) P-C4' energy: -20.568 flat angles C4'-P-C4' energy: -16.776 flat angles P-C4'-P energy: -13.227 tors. eta vs tors. theta energy: -32.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 159 Temperature: 1.200000 Total energy: -235.338308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.338308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.379858 (E_RNA) where: Base-Base interactions energy: -146.157 where: short stacking energy: -80.273 Base-Backbone interact. energy: -0.039 local terms energy: -89.183275 where: bonds (distance) C4'-P energy: -21.540 bonds (distance) P-C4' energy: -14.027 flat angles C4'-P-C4' energy: -22.139 flat angles P-C4'-P energy: -15.151 tors. eta vs tors. theta energy: -16.326 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 159 Temperature: 1.250000 Total energy: -244.945606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.945606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.116918 (E_RNA) where: Base-Base interactions energy: -139.432 where: short stacking energy: -69.647 Base-Backbone interact. energy: -0.604 local terms energy: -105.080740 where: bonds (distance) C4'-P energy: -21.763 bonds (distance) P-C4' energy: -26.542 flat angles C4'-P-C4' energy: -24.023 flat angles P-C4'-P energy: -13.634 tors. eta vs tors. theta energy: -19.119 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 159 Temperature: 1.300000 Total energy: -183.744872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.744872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.744872 (E_RNA) where: Base-Base interactions energy: -99.878 where: short stacking energy: -67.205 Base-Backbone interact. energy: -1.397 local terms energy: -82.469701 where: bonds (distance) C4'-P energy: -16.204 bonds (distance) P-C4' energy: -23.552 flat angles C4'-P-C4' energy: -21.324 flat angles P-C4'-P energy: -16.107 tors. eta vs tors. theta energy: -5.282 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 159 Temperature: 1.350000 Total energy: -143.786788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.786788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.786788 (E_RNA) where: Base-Base interactions energy: -78.602 where: short stacking energy: -49.995 Base-Backbone interact. energy: 2.255 local terms energy: -67.439623 where: bonds (distance) C4'-P energy: -15.255 bonds (distance) P-C4' energy: -14.813 flat angles C4'-P-C4' energy: -21.316 flat angles P-C4'-P energy: -10.228 tors. eta vs tors. theta energy: -5.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 160 Temperature: 0.900000 Total energy: -385.631868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.631868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.657956 (E_RNA) where: Base-Base interactions energy: -254.248 where: short stacking energy: -130.098 Base-Backbone interact. energy: -0.060 local terms energy: -131.350068 where: bonds (distance) C4'-P energy: -23.180 bonds (distance) P-C4' energy: -28.238 flat angles C4'-P-C4' energy: -27.958 flat angles P-C4'-P energy: -14.908 tors. eta vs tors. theta energy: -37.067 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 160 Temperature: 0.950000 Total energy: -375.197522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.197522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.288636 (E_RNA) where: Base-Base interactions energy: -253.606 where: short stacking energy: -126.864 Base-Backbone interact. energy: -0.997 local terms energy: -120.685549 where: bonds (distance) C4'-P energy: -22.614 bonds (distance) P-C4' energy: -14.166 flat angles C4'-P-C4' energy: -28.896 flat angles P-C4'-P energy: -19.882 tors. eta vs tors. theta energy: -35.128 Dist. restrs. and SS energy: 0.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 160 Temperature: 1.000000 Total energy: -353.298120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.298120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.298120 (E_RNA) where: Base-Base interactions energy: -231.971 where: short stacking energy: -106.187 Base-Backbone interact. energy: -0.279 local terms energy: -121.047906 where: bonds (distance) C4'-P energy: -24.451 bonds (distance) P-C4' energy: -28.408 flat angles C4'-P-C4' energy: -24.046 flat angles P-C4'-P energy: -18.796 tors. eta vs tors. theta energy: -25.348 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 160 Temperature: 1.050000 Total energy: -360.549222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.549222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.574337 (E_RNA) where: Base-Base interactions energy: -238.710 where: short stacking energy: -118.983 Base-Backbone interact. energy: -0.126 local terms energy: -121.738886 where: bonds (distance) C4'-P energy: -20.908 bonds (distance) P-C4' energy: -22.895 flat angles C4'-P-C4' energy: -21.663 flat angles P-C4'-P energy: -22.659 tors. eta vs tors. theta energy: -33.615 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 160 Temperature: 1.100000 Total energy: -322.505913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.505913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.628690 (E_RNA) where: Base-Base interactions energy: -211.858 where: short stacking energy: -108.588 Base-Backbone interact. energy: -0.469 local terms energy: -110.301608 where: bonds (distance) C4'-P energy: -20.663 bonds (distance) P-C4' energy: -20.428 flat angles C4'-P-C4' energy: -26.081 flat angles P-C4'-P energy: -13.280 tors. eta vs tors. theta energy: -29.850 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 160 Temperature: 1.150000 Total energy: -298.797852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.797852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.797852 (E_RNA) where: Base-Base interactions energy: -196.865 where: short stacking energy: -100.843 Base-Backbone interact. energy: -0.107 local terms energy: -101.826369 where: bonds (distance) C4'-P energy: -12.558 bonds (distance) P-C4' energy: -17.850 flat angles C4'-P-C4' energy: -24.786 flat angles P-C4'-P energy: -18.996 tors. eta vs tors. theta energy: -27.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 160 Temperature: 1.200000 Total energy: -287.565659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.565659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.565659 (E_RNA) where: Base-Base interactions energy: -180.282 where: short stacking energy: -95.887 Base-Backbone interact. energy: -0.061 local terms energy: -107.222602 where: bonds (distance) C4'-P energy: -26.447 bonds (distance) P-C4' energy: -18.702 flat angles C4'-P-C4' energy: -22.441 flat angles P-C4'-P energy: -14.653 tors. eta vs tors. theta energy: -24.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 160 Temperature: 1.250000 Total energy: -225.351857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.351857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.351857 (E_RNA) where: Base-Base interactions energy: -124.820 where: short stacking energy: -73.928 Base-Backbone interact. energy: -0.259 local terms energy: -100.272698 where: bonds (distance) C4'-P energy: -24.869 bonds (distance) P-C4' energy: -23.378 flat angles C4'-P-C4' energy: -23.581 flat angles P-C4'-P energy: -13.338 tors. eta vs tors. theta energy: -15.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 160 Temperature: 1.300000 Total energy: -161.050412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.050412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.105128 (E_RNA) where: Base-Base interactions energy: -90.753 where: short stacking energy: -54.817 Base-Backbone interact. energy: -2.262 local terms energy: -68.090319 where: bonds (distance) C4'-P energy: -18.997 bonds (distance) P-C4' energy: -23.606 flat angles C4'-P-C4' energy: -10.490 flat angles P-C4'-P energy: -11.989 tors. eta vs tors. theta energy: -3.009 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 160 Temperature: 1.350000 Total energy: -159.466757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.466757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.466757 (E_RNA) where: Base-Base interactions energy: -82.447 where: short stacking energy: -40.173 Base-Backbone interact. energy: -0.444 local terms energy: -76.575556 where: bonds (distance) C4'-P energy: -17.209 bonds (distance) P-C4' energy: -20.218 flat angles C4'-P-C4' energy: -17.365 flat angles P-C4'-P energy: -11.455 tors. eta vs tors. theta energy: -10.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 161 Temperature: 0.900000 Total energy: -380.044983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.044983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.070583 (E_RNA) where: Base-Base interactions energy: -245.684 where: short stacking energy: -122.871 Base-Backbone interact. energy: -0.324 local terms energy: -134.062584 where: bonds (distance) C4'-P energy: -22.393 bonds (distance) P-C4' energy: -30.486 flat angles C4'-P-C4' energy: -25.886 flat angles P-C4'-P energy: -18.513 tors. eta vs tors. theta energy: -36.784 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 161 Temperature: 0.950000 Total energy: -359.415943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.415943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.415943 (E_RNA) where: Base-Base interactions energy: -237.061 where: short stacking energy: -116.106 Base-Backbone interact. energy: -0.800 local terms energy: -121.554786 where: bonds (distance) C4'-P energy: -24.802 bonds (distance) P-C4' energy: -23.666 flat angles C4'-P-C4' energy: -25.544 flat angles P-C4'-P energy: -19.539 tors. eta vs tors. theta energy: -28.003 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 161 Temperature: 1.000000 Total energy: -361.710725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.710725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.710725 (E_RNA) where: Base-Base interactions energy: -234.772 where: short stacking energy: -115.477 Base-Backbone interact. energy: -0.282 local terms energy: -126.657341 where: bonds (distance) C4'-P energy: -25.520 bonds (distance) P-C4' energy: -24.908 flat angles C4'-P-C4' energy: -25.649 flat angles P-C4'-P energy: -14.454 tors. eta vs tors. theta energy: -36.127 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 161 Temperature: 1.050000 Total energy: -360.032065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.032065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.032065 (E_RNA) where: Base-Base interactions energy: -249.536 where: short stacking energy: -111.594 Base-Backbone interact. energy: -0.593 local terms energy: -109.903012 where: bonds (distance) C4'-P energy: -16.896 bonds (distance) P-C4' energy: -20.984 flat angles C4'-P-C4' energy: -23.303 flat angles P-C4'-P energy: -15.657 tors. eta vs tors. theta energy: -33.063 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 161 Temperature: 1.100000 Total energy: -330.140258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.140258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.155352 (E_RNA) where: Base-Base interactions energy: -217.649 where: short stacking energy: -110.019 Base-Backbone interact. energy: -0.079 local terms energy: -112.427741 where: bonds (distance) C4'-P energy: -21.242 bonds (distance) P-C4' energy: -26.434 flat angles C4'-P-C4' energy: -19.819 flat angles P-C4'-P energy: -14.270 tors. eta vs tors. theta energy: -30.663 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 161 Temperature: 1.150000 Total energy: -311.862591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.862591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.877835 (E_RNA) where: Base-Base interactions energy: -204.463 where: short stacking energy: -99.506 Base-Backbone interact. energy: 0.961 local terms energy: -108.375165 where: bonds (distance) C4'-P energy: -17.351 bonds (distance) P-C4' energy: -29.700 flat angles C4'-P-C4' energy: -21.338 flat angles P-C4'-P energy: -15.061 tors. eta vs tors. theta energy: -24.925 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 161 Temperature: 1.200000 Total energy: -260.704392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.704392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.747255 (E_RNA) where: Base-Base interactions energy: -155.389 where: short stacking energy: -80.015 Base-Backbone interact. energy: 0.063 local terms energy: -105.420813 where: bonds (distance) C4'-P energy: -22.385 bonds (distance) P-C4' energy: -25.342 flat angles C4'-P-C4' energy: -22.250 flat angles P-C4'-P energy: -10.944 tors. eta vs tors. theta energy: -24.500 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 161 Temperature: 1.250000 Total energy: -163.868739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.868739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.870872 (E_RNA) where: Base-Base interactions energy: -96.296 where: short stacking energy: -57.874 Base-Backbone interact. energy: -2.249 local terms energy: -65.325923 where: bonds (distance) C4'-P energy: -10.438 bonds (distance) P-C4' energy: -21.194 flat angles C4'-P-C4' energy: -16.418 flat angles P-C4'-P energy: -11.506 tors. eta vs tors. theta energy: -5.770 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 161 Temperature: 1.300000 Total energy: -222.775576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.775576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.827537 (E_RNA) where: Base-Base interactions energy: -141.465 where: short stacking energy: -81.309 Base-Backbone interact. energy: -0.313 local terms energy: -81.049361 where: bonds (distance) C4'-P energy: -19.938 bonds (distance) P-C4' energy: -17.675 flat angles C4'-P-C4' energy: -12.793 flat angles P-C4'-P energy: -10.053 tors. eta vs tors. theta energy: -20.591 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 161 Temperature: 1.350000 Total energy: -151.605936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.605936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.610954 (E_RNA) where: Base-Base interactions energy: -69.572 where: short stacking energy: -38.009 Base-Backbone interact. energy: -0.531 local terms energy: -81.508438 where: bonds (distance) C4'-P energy: -26.153 bonds (distance) P-C4' energy: -23.909 flat angles C4'-P-C4' energy: -22.056 flat angles P-C4'-P energy: -9.594 tors. eta vs tors. theta energy: 0.203 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 162 Temperature: 0.900000 Total energy: -381.958220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.958220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.970737 (E_RNA) where: Base-Base interactions energy: -255.166 where: short stacking energy: -129.262 Base-Backbone interact. energy: -0.306 local terms energy: -126.498476 where: bonds (distance) C4'-P energy: -19.593 bonds (distance) P-C4' energy: -23.050 flat angles C4'-P-C4' energy: -27.102 flat angles P-C4'-P energy: -19.538 tors. eta vs tors. theta energy: -37.216 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 162 Temperature: 0.950000 Total energy: -359.595856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.595856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.596188 (E_RNA) where: Base-Base interactions energy: -242.905 where: short stacking energy: -115.994 Base-Backbone interact. energy: -0.662 local terms energy: -116.029375 where: bonds (distance) C4'-P energy: -20.805 bonds (distance) P-C4' energy: -23.030 flat angles C4'-P-C4' energy: -25.352 flat angles P-C4'-P energy: -18.026 tors. eta vs tors. theta energy: -28.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 162 Temperature: 1.000000 Total energy: -367.427783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.427783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.427783 (E_RNA) where: Base-Base interactions energy: -251.412 where: short stacking energy: -119.957 Base-Backbone interact. energy: -0.249 local terms energy: -115.767094 where: bonds (distance) C4'-P energy: -19.666 bonds (distance) P-C4' energy: -24.043 flat angles C4'-P-C4' energy: -26.554 flat angles P-C4'-P energy: -14.908 tors. eta vs tors. theta energy: -30.596 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 162 Temperature: 1.050000 Total energy: -353.724474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.724474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.724474 (E_RNA) where: Base-Base interactions energy: -225.643 where: short stacking energy: -104.687 Base-Backbone interact. energy: -0.823 local terms energy: -127.257980 where: bonds (distance) C4'-P energy: -25.869 bonds (distance) P-C4' energy: -26.000 flat angles C4'-P-C4' energy: -27.509 flat angles P-C4'-P energy: -16.895 tors. eta vs tors. theta energy: -30.985 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 162 Temperature: 1.100000 Total energy: -336.972218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.972218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.973718 (E_RNA) where: Base-Base interactions energy: -220.023 where: short stacking energy: -105.020 Base-Backbone interact. energy: -0.538 local terms energy: -116.412318 where: bonds (distance) C4'-P energy: -23.702 bonds (distance) P-C4' energy: -19.905 flat angles C4'-P-C4' energy: -24.364 flat angles P-C4'-P energy: -15.765 tors. eta vs tors. theta energy: -32.676 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 162 Temperature: 1.150000 Total energy: -320.910487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.910487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.989201 (E_RNA) where: Base-Base interactions energy: -215.891 where: short stacking energy: -101.772 Base-Backbone interact. energy: 1.050 local terms energy: -106.148544 where: bonds (distance) C4'-P energy: -15.240 bonds (distance) P-C4' energy: -16.574 flat angles C4'-P-C4' energy: -26.814 flat angles P-C4'-P energy: -14.733 tors. eta vs tors. theta energy: -32.788 Dist. restrs. and SS energy: 0.079 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 162 Temperature: 1.200000 Total energy: -256.900530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.900530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.900530 (E_RNA) where: Base-Base interactions energy: -159.350 where: short stacking energy: -80.345 Base-Backbone interact. energy: -0.773 local terms energy: -96.777729 where: bonds (distance) C4'-P energy: -18.778 bonds (distance) P-C4' energy: -17.881 flat angles C4'-P-C4' energy: -25.599 flat angles P-C4'-P energy: -18.042 tors. eta vs tors. theta energy: -16.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 162 Temperature: 1.250000 Total energy: -178.253553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.253553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.302261 (E_RNA) where: Base-Base interactions energy: -94.760 where: short stacking energy: -49.998 Base-Backbone interact. energy: -0.406 local terms energy: -83.136317 where: bonds (distance) C4'-P energy: -19.818 bonds (distance) P-C4' energy: -23.321 flat angles C4'-P-C4' energy: -23.559 flat angles P-C4'-P energy: -15.799 tors. eta vs tors. theta energy: -0.640 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 162 Temperature: 1.300000 Total energy: -206.706540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.706540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.865390 (E_RNA) where: Base-Base interactions energy: -120.443 where: short stacking energy: -69.567 Base-Backbone interact. energy: -0.013 local terms energy: -86.409066 where: bonds (distance) C4'-P energy: -19.395 bonds (distance) P-C4' energy: -20.400 flat angles C4'-P-C4' energy: -17.720 flat angles P-C4'-P energy: -12.000 tors. eta vs tors. theta energy: -16.895 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 162 Temperature: 1.350000 Total energy: -153.029306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.029306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.208640 (E_RNA) where: Base-Base interactions energy: -82.223 where: short stacking energy: -54.967 Base-Backbone interact. energy: -0.279 local terms energy: -70.707081 where: bonds (distance) C4'-P energy: -17.936 bonds (distance) P-C4' energy: -20.018 flat angles C4'-P-C4' energy: -11.324 flat angles P-C4'-P energy: -13.403 tors. eta vs tors. theta energy: -8.026 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 163 Temperature: 0.900000 Total energy: -377.831777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.831777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.855907 (E_RNA) where: Base-Base interactions energy: -255.376 where: short stacking energy: -131.414 Base-Backbone interact. energy: 0.351 local terms energy: -122.831251 where: bonds (distance) C4'-P energy: -21.390 bonds (distance) P-C4' energy: -21.932 flat angles C4'-P-C4' energy: -26.925 flat angles P-C4'-P energy: -17.830 tors. eta vs tors. theta energy: -34.753 Dist. restrs. and SS energy: 0.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 163 Temperature: 0.950000 Total energy: -372.234311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.234311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.239908 (E_RNA) where: Base-Base interactions energy: -241.027 where: short stacking energy: -118.055 Base-Backbone interact. energy: -0.227 local terms energy: -130.986226 where: bonds (distance) C4'-P energy: -22.652 bonds (distance) P-C4' energy: -25.237 flat angles C4'-P-C4' energy: -30.932 flat angles P-C4'-P energy: -20.670 tors. eta vs tors. theta energy: -31.496 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 163 Temperature: 1.000000 Total energy: -365.209844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.209844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.231438 (E_RNA) where: Base-Base interactions energy: -248.078 where: short stacking energy: -125.143 Base-Backbone interact. energy: 0.317 local terms energy: -117.470843 where: bonds (distance) C4'-P energy: -26.057 bonds (distance) P-C4' energy: -22.253 flat angles C4'-P-C4' energy: -19.228 flat angles P-C4'-P energy: -17.748 tors. eta vs tors. theta energy: -32.184 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 163 Temperature: 1.050000 Total energy: -350.401540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.401540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.467843 (E_RNA) where: Base-Base interactions energy: -231.146 where: short stacking energy: -125.060 Base-Backbone interact. energy: -0.706 local terms energy: -118.615407 where: bonds (distance) C4'-P energy: -23.254 bonds (distance) P-C4' energy: -19.733 flat angles C4'-P-C4' energy: -23.958 flat angles P-C4'-P energy: -14.759 tors. eta vs tors. theta energy: -36.911 Dist. restrs. and SS energy: 0.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 163 Temperature: 1.100000 Total energy: -349.741058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.741058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.741058 (E_RNA) where: Base-Base interactions energy: -228.071 where: short stacking energy: -105.969 Base-Backbone interact. energy: -0.982 local terms energy: -120.687997 where: bonds (distance) C4'-P energy: -19.644 bonds (distance) P-C4' energy: -25.024 flat angles C4'-P-C4' energy: -25.536 flat angles P-C4'-P energy: -16.669 tors. eta vs tors. theta energy: -33.814 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 163 Temperature: 1.150000 Total energy: -306.043451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.043451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.152047 (E_RNA) where: Base-Base interactions energy: -201.508 where: short stacking energy: -100.072 Base-Backbone interact. energy: -0.352 local terms energy: -104.291659 where: bonds (distance) C4'-P energy: -25.333 bonds (distance) P-C4' energy: -25.349 flat angles C4'-P-C4' energy: -21.809 flat angles P-C4'-P energy: -3.338 tors. eta vs tors. theta energy: -28.463 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 163 Temperature: 1.200000 Total energy: -260.763955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.763955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.765031 (E_RNA) where: Base-Base interactions energy: -168.736 where: short stacking energy: -93.963 Base-Backbone interact. energy: 0.500 local terms energy: -92.528982 where: bonds (distance) C4'-P energy: -18.233 bonds (distance) P-C4' energy: -23.724 flat angles C4'-P-C4' energy: -17.021 flat angles P-C4'-P energy: -17.347 tors. eta vs tors. theta energy: -16.204 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 163 Temperature: 1.250000 Total energy: -200.896072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.896072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.896072 (E_RNA) where: Base-Base interactions energy: -109.313 where: short stacking energy: -55.089 Base-Backbone interact. energy: -0.709 local terms energy: -90.873693 where: bonds (distance) C4'-P energy: -21.181 bonds (distance) P-C4' energy: -21.646 flat angles C4'-P-C4' energy: -22.836 flat angles P-C4'-P energy: -15.326 tors. eta vs tors. theta energy: -9.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 163 Temperature: 1.300000 Total energy: -180.244863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.244863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.244863 (E_RNA) where: Base-Base interactions energy: -97.991 where: short stacking energy: -55.791 Base-Backbone interact. energy: -0.630 local terms energy: -81.624075 where: bonds (distance) C4'-P energy: -21.360 bonds (distance) P-C4' energy: -22.482 flat angles C4'-P-C4' energy: -20.122 flat angles P-C4'-P energy: -10.334 tors. eta vs tors. theta energy: -7.325 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 163 Temperature: 1.350000 Total energy: -159.280625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.280625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.286822 (E_RNA) where: Base-Base interactions energy: -80.385 where: short stacking energy: -37.991 Base-Backbone interact. energy: -0.685 local terms energy: -78.216237 where: bonds (distance) C4'-P energy: -19.537 bonds (distance) P-C4' energy: -22.801 flat angles C4'-P-C4' energy: -18.947 flat angles P-C4'-P energy: -15.400 tors. eta vs tors. theta energy: -1.532 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 164 Temperature: 0.900000 Total energy: -382.168079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.168079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.206633 (E_RNA) where: Base-Base interactions energy: -248.399 where: short stacking energy: -126.434 Base-Backbone interact. energy: -0.027 local terms energy: -133.780143 where: bonds (distance) C4'-P energy: -25.356 bonds (distance) P-C4' energy: -25.877 flat angles C4'-P-C4' energy: -25.767 flat angles P-C4'-P energy: -19.769 tors. eta vs tors. theta energy: -37.010 Dist. restrs. and SS energy: 0.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 164 Temperature: 0.950000 Total energy: -370.736519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.736519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.736519 (E_RNA) where: Base-Base interactions energy: -250.456 where: short stacking energy: -120.951 Base-Backbone interact. energy: -0.025 local terms energy: -120.255664 where: bonds (distance) C4'-P energy: -20.523 bonds (distance) P-C4' energy: -26.573 flat angles C4'-P-C4' energy: -24.762 flat angles P-C4'-P energy: -14.767 tors. eta vs tors. theta energy: -33.631 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 164 Temperature: 1.000000 Total energy: -364.062991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.062991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.115917 (E_RNA) where: Base-Base interactions energy: -234.637 where: short stacking energy: -111.890 Base-Backbone interact. energy: -0.078 local terms energy: -129.400470 where: bonds (distance) C4'-P energy: -22.915 bonds (distance) P-C4' energy: -26.995 flat angles C4'-P-C4' energy: -25.663 flat angles P-C4'-P energy: -16.660 tors. eta vs tors. theta energy: -37.167 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 164 Temperature: 1.050000 Total energy: -362.921944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.921944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.929107 (E_RNA) where: Base-Base interactions energy: -240.748 where: short stacking energy: -103.824 Base-Backbone interact. energy: -0.530 local terms energy: -121.650309 where: bonds (distance) C4'-P energy: -19.698 bonds (distance) P-C4' energy: -27.170 flat angles C4'-P-C4' energy: -26.687 flat angles P-C4'-P energy: -18.421 tors. eta vs tors. theta energy: -29.674 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 164 Temperature: 1.100000 Total energy: -340.931621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.931621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.029762 (E_RNA) where: Base-Base interactions energy: -227.966 where: short stacking energy: -104.889 Base-Backbone interact. energy: -0.333 local terms energy: -112.730171 where: bonds (distance) C4'-P energy: -16.020 bonds (distance) P-C4' energy: -23.234 flat angles C4'-P-C4' energy: -26.580 flat angles P-C4'-P energy: -16.680 tors. eta vs tors. theta energy: -30.216 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 164 Temperature: 1.150000 Total energy: -309.884793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.884793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.952281 (E_RNA) where: Base-Base interactions energy: -199.584 where: short stacking energy: -99.255 Base-Backbone interact. energy: -1.632 local terms energy: -108.736333 where: bonds (distance) C4'-P energy: -12.772 bonds (distance) P-C4' energy: -22.373 flat angles C4'-P-C4' energy: -26.256 flat angles P-C4'-P energy: -15.694 tors. eta vs tors. theta energy: -31.641 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 164 Temperature: 1.200000 Total energy: -255.182317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.182317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.182317 (E_RNA) where: Base-Base interactions energy: -145.867 where: short stacking energy: -85.291 Base-Backbone interact. energy: -0.527 local terms energy: -108.788281 where: bonds (distance) C4'-P energy: -27.370 bonds (distance) P-C4' energy: -19.086 flat angles C4'-P-C4' energy: -21.574 flat angles P-C4'-P energy: -13.326 tors. eta vs tors. theta energy: -27.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 164 Temperature: 1.250000 Total energy: -219.846330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.846330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.846330 (E_RNA) where: Base-Base interactions energy: -130.876 where: short stacking energy: -61.016 Base-Backbone interact. energy: -0.385 local terms energy: -88.585725 where: bonds (distance) C4'-P energy: -21.303 bonds (distance) P-C4' energy: -24.606 flat angles C4'-P-C4' energy: -20.230 flat angles P-C4'-P energy: -15.134 tors. eta vs tors. theta energy: -7.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 164 Temperature: 1.300000 Total energy: -167.166266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.166266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.327687 (E_RNA) where: Base-Base interactions energy: -87.751 where: short stacking energy: -53.410 Base-Backbone interact. energy: -0.076 local terms energy: -79.500950 where: bonds (distance) C4'-P energy: -20.431 bonds (distance) P-C4' energy: -21.236 flat angles C4'-P-C4' energy: -15.247 flat angles P-C4'-P energy: -14.389 tors. eta vs tors. theta energy: -8.198 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 164 Temperature: 1.350000 Total energy: -160.752840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.752840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.971217 (E_RNA) where: Base-Base interactions energy: -77.988 where: short stacking energy: -52.191 Base-Backbone interact. energy: -0.719 local terms energy: -82.264506 where: bonds (distance) C4'-P energy: -20.589 bonds (distance) P-C4' energy: -22.355 flat angles C4'-P-C4' energy: -17.662 flat angles P-C4'-P energy: -16.155 tors. eta vs tors. theta energy: -5.504 Dist. restrs. and SS energy: 0.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 165 Temperature: 0.900000 Total energy: -385.917718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.917718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.012915 (E_RNA) where: Base-Base interactions energy: -252.261 where: short stacking energy: -119.617 Base-Backbone interact. energy: -0.215 local terms energy: -133.537334 where: bonds (distance) C4'-P energy: -23.407 bonds (distance) P-C4' energy: -25.317 flat angles C4'-P-C4' energy: -27.962 flat angles P-C4'-P energy: -21.545 tors. eta vs tors. theta energy: -35.306 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 165 Temperature: 0.950000 Total energy: -369.521575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.521575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.521575 (E_RNA) where: Base-Base interactions energy: -243.151 where: short stacking energy: -116.957 Base-Backbone interact. energy: -0.033 local terms energy: -126.338007 where: bonds (distance) C4'-P energy: -25.532 bonds (distance) P-C4' energy: -23.464 flat angles C4'-P-C4' energy: -24.516 flat angles P-C4'-P energy: -15.105 tors. eta vs tors. theta energy: -37.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 165 Temperature: 1.000000 Total energy: -362.503569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.503569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.503569 (E_RNA) where: Base-Base interactions energy: -238.846 where: short stacking energy: -117.246 Base-Backbone interact. energy: -1.414 local terms energy: -122.243079 where: bonds (distance) C4'-P energy: -21.624 bonds (distance) P-C4' energy: -24.686 flat angles C4'-P-C4' energy: -25.757 flat angles P-C4'-P energy: -15.328 tors. eta vs tors. theta energy: -34.849 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 165 Temperature: 1.050000 Total energy: -348.077267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.077267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.113738 (E_RNA) where: Base-Base interactions energy: -235.815 where: short stacking energy: -105.343 Base-Backbone interact. energy: -0.059 local terms energy: -112.240085 where: bonds (distance) C4'-P energy: -20.408 bonds (distance) P-C4' energy: -20.813 flat angles C4'-P-C4' energy: -23.952 flat angles P-C4'-P energy: -19.029 tors. eta vs tors. theta energy: -28.038 Dist. restrs. and SS energy: 0.036 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 165 Temperature: 1.100000 Total energy: -337.299842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.299842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.305090 (E_RNA) where: Base-Base interactions energy: -224.074 where: short stacking energy: -96.761 Base-Backbone interact. energy: -0.639 local terms energy: -112.592296 where: bonds (distance) C4'-P energy: -19.004 bonds (distance) P-C4' energy: -22.509 flat angles C4'-P-C4' energy: -25.040 flat angles P-C4'-P energy: -19.477 tors. eta vs tors. theta energy: -26.563 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 165 Temperature: 1.150000 Total energy: -292.609137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.609137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.610081 (E_RNA) where: Base-Base interactions energy: -187.574 where: short stacking energy: -101.353 Base-Backbone interact. energy: -0.053 local terms energy: -104.982524 where: bonds (distance) C4'-P energy: -16.742 bonds (distance) P-C4' energy: -22.149 flat angles C4'-P-C4' energy: -24.699 flat angles P-C4'-P energy: -12.233 tors. eta vs tors. theta energy: -29.159 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 165 Temperature: 1.200000 Total energy: -260.208560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.208560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.251470 (E_RNA) where: Base-Base interactions energy: -170.106 where: short stacking energy: -86.169 Base-Backbone interact. energy: -0.695 local terms energy: -89.450481 where: bonds (distance) C4'-P energy: -18.354 bonds (distance) P-C4' energy: -13.696 flat angles C4'-P-C4' energy: -25.078 flat angles P-C4'-P energy: -11.454 tors. eta vs tors. theta energy: -20.869 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 165 Temperature: 1.250000 Total energy: -212.142419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.142419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.142419 (E_RNA) where: Base-Base interactions energy: -118.667 where: short stacking energy: -55.048 Base-Backbone interact. energy: -1.128 local terms energy: -92.348091 where: bonds (distance) C4'-P energy: -27.068 bonds (distance) P-C4' energy: -21.184 flat angles C4'-P-C4' energy: -20.577 flat angles P-C4'-P energy: -13.333 tors. eta vs tors. theta energy: -10.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 165 Temperature: 1.300000 Total energy: -173.266815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.266815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.266815 (E_RNA) where: Base-Base interactions energy: -82.491 where: short stacking energy: -41.568 Base-Backbone interact. energy: -0.053 local terms energy: -90.723365 where: bonds (distance) C4'-P energy: -24.132 bonds (distance) P-C4' energy: -25.293 flat angles C4'-P-C4' energy: -21.009 flat angles P-C4'-P energy: -14.797 tors. eta vs tors. theta energy: -5.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 165 Temperature: 1.350000 Total energy: -149.257286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.257286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.271248 (E_RNA) where: Base-Base interactions energy: -84.123 where: short stacking energy: -57.245 Base-Backbone interact. energy: -0.111 local terms energy: -65.037961 where: bonds (distance) C4'-P energy: -18.056 bonds (distance) P-C4' energy: -19.668 flat angles C4'-P-C4' energy: -17.229 flat angles P-C4'-P energy: -9.513 tors. eta vs tors. theta energy: -0.572 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 166 Temperature: 0.900000 Total energy: -374.554471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.554471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.572207 (E_RNA) where: Base-Base interactions energy: -243.548 where: short stacking energy: -125.768 Base-Backbone interact. energy: -0.384 local terms energy: -130.640263 where: bonds (distance) C4'-P energy: -25.387 bonds (distance) P-C4' energy: -22.731 flat angles C4'-P-C4' energy: -28.543 flat angles P-C4'-P energy: -18.351 tors. eta vs tors. theta energy: -35.627 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 166 Temperature: 0.950000 Total energy: -372.804672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.804672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.818392 (E_RNA) where: Base-Base interactions energy: -235.689 where: short stacking energy: -126.310 Base-Backbone interact. energy: -0.893 local terms energy: -136.236063 where: bonds (distance) C4'-P energy: -23.856 bonds (distance) P-C4' energy: -27.309 flat angles C4'-P-C4' energy: -27.076 flat angles P-C4'-P energy: -19.122 tors. eta vs tors. theta energy: -38.873 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 166 Temperature: 1.000000 Total energy: -359.604226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.604226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.604226 (E_RNA) where: Base-Base interactions energy: -241.435 where: short stacking energy: -121.698 Base-Backbone interact. energy: 1.042 local terms energy: -119.210782 where: bonds (distance) C4'-P energy: -16.677 bonds (distance) P-C4' energy: -26.589 flat angles C4'-P-C4' energy: -23.263 flat angles P-C4'-P energy: -17.450 tors. eta vs tors. theta energy: -35.232 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 166 Temperature: 1.050000 Total energy: -358.484912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.484912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.484912 (E_RNA) where: Base-Base interactions energy: -232.973 where: short stacking energy: -123.321 Base-Backbone interact. energy: -0.036 local terms energy: -125.475845 where: bonds (distance) C4'-P energy: -21.180 bonds (distance) P-C4' energy: -23.254 flat angles C4'-P-C4' energy: -27.891 flat angles P-C4'-P energy: -16.592 tors. eta vs tors. theta energy: -36.558 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 166 Temperature: 1.100000 Total energy: -312.194149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.194149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.242532 (E_RNA) where: Base-Base interactions energy: -198.473 where: short stacking energy: -108.819 Base-Backbone interact. energy: -0.020 local terms energy: -113.749467 where: bonds (distance) C4'-P energy: -16.456 bonds (distance) P-C4' energy: -26.923 flat angles C4'-P-C4' energy: -23.971 flat angles P-C4'-P energy: -17.132 tors. eta vs tors. theta energy: -29.267 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 166 Temperature: 1.150000 Total energy: -307.096965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.096965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.096965 (E_RNA) where: Base-Base interactions energy: -202.299 where: short stacking energy: -90.730 Base-Backbone interact. energy: -0.487 local terms energy: -104.310582 where: bonds (distance) C4'-P energy: -24.739 bonds (distance) P-C4' energy: -20.941 flat angles C4'-P-C4' energy: -22.279 flat angles P-C4'-P energy: -16.367 tors. eta vs tors. theta energy: -19.985 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 166 Temperature: 1.200000 Total energy: -240.579829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.579829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.660460 (E_RNA) where: Base-Base interactions energy: -154.884 where: short stacking energy: -67.244 Base-Backbone interact. energy: -0.054 local terms energy: -85.722856 where: bonds (distance) C4'-P energy: -14.213 bonds (distance) P-C4' energy: -14.537 flat angles C4'-P-C4' energy: -25.249 flat angles P-C4'-P energy: -16.272 tors. eta vs tors. theta energy: -15.452 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 166 Temperature: 1.250000 Total energy: -263.637623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.637623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.637623 (E_RNA) where: Base-Base interactions energy: -164.307 where: short stacking energy: -80.585 Base-Backbone interact. energy: -0.317 local terms energy: -99.013898 where: bonds (distance) C4'-P energy: -18.110 bonds (distance) P-C4' energy: -23.989 flat angles C4'-P-C4' energy: -19.363 flat angles P-C4'-P energy: -13.702 tors. eta vs tors. theta energy: -23.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 166 Temperature: 1.300000 Total energy: -211.414378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.414378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.494952 (E_RNA) where: Base-Base interactions energy: -126.532 where: short stacking energy: -70.639 Base-Backbone interact. energy: 0.957 local terms energy: -85.919505 where: bonds (distance) C4'-P energy: -20.513 bonds (distance) P-C4' energy: -24.037 flat angles C4'-P-C4' energy: -22.037 flat angles P-C4'-P energy: -10.049 tors. eta vs tors. theta energy: -9.284 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 166 Temperature: 1.350000 Total energy: -160.573946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.573946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.687540 (E_RNA) where: Base-Base interactions energy: -92.750 where: short stacking energy: -51.518 Base-Backbone interact. energy: 1.982 local terms energy: -69.919207 where: bonds (distance) C4'-P energy: -14.631 bonds (distance) P-C4' energy: -22.165 flat angles C4'-P-C4' energy: -15.971 flat angles P-C4'-P energy: -8.156 tors. eta vs tors. theta energy: -8.996 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 167 Temperature: 0.900000 Total energy: -376.705886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.705886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.721634 (E_RNA) where: Base-Base interactions energy: -242.564 where: short stacking energy: -120.203 Base-Backbone interact. energy: -0.361 local terms energy: -133.796012 where: bonds (distance) C4'-P energy: -24.392 bonds (distance) P-C4' energy: -27.772 flat angles C4'-P-C4' energy: -25.888 flat angles P-C4'-P energy: -18.327 tors. eta vs tors. theta energy: -37.417 Dist. restrs. and SS energy: 0.016 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 167 Temperature: 0.950000 Total energy: -371.892720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.892720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.892720 (E_RNA) where: Base-Base interactions energy: -246.709 where: short stacking energy: -117.283 Base-Backbone interact. energy: -0.253 local terms energy: -124.930695 where: bonds (distance) C4'-P energy: -25.900 bonds (distance) P-C4' energy: -25.534 flat angles C4'-P-C4' energy: -22.232 flat angles P-C4'-P energy: -19.438 tors. eta vs tors. theta energy: -31.825 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 167 Temperature: 1.000000 Total energy: -365.454478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.454478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.464135 (E_RNA) where: Base-Base interactions energy: -238.879 where: short stacking energy: -122.485 Base-Backbone interact. energy: -0.027 local terms energy: -126.557768 where: bonds (distance) C4'-P energy: -21.896 bonds (distance) P-C4' energy: -24.722 flat angles C4'-P-C4' energy: -22.108 flat angles P-C4'-P energy: -22.258 tors. eta vs tors. theta energy: -35.573 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 167 Temperature: 1.050000 Total energy: -351.263501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.263501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.374609 (E_RNA) where: Base-Base interactions energy: -233.833 where: short stacking energy: -102.275 Base-Backbone interact. energy: -0.556 local terms energy: -116.985008 where: bonds (distance) C4'-P energy: -20.907 bonds (distance) P-C4' energy: -18.917 flat angles C4'-P-C4' energy: -27.100 flat angles P-C4'-P energy: -15.956 tors. eta vs tors. theta energy: -34.105 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 167 Temperature: 1.100000 Total energy: -335.953988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.953988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.093820 (E_RNA) where: Base-Base interactions energy: -210.579 where: short stacking energy: -106.568 Base-Backbone interact. energy: -0.447 local terms energy: -125.067223 where: bonds (distance) C4'-P energy: -23.318 bonds (distance) P-C4' energy: -24.192 flat angles C4'-P-C4' energy: -25.107 flat angles P-C4'-P energy: -18.154 tors. eta vs tors. theta energy: -34.296 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 167 Temperature: 1.150000 Total energy: -317.803490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.803490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.803490 (E_RNA) where: Base-Base interactions energy: -221.592 where: short stacking energy: -102.766 Base-Backbone interact. energy: -1.016 local terms energy: -95.196013 where: bonds (distance) C4'-P energy: -15.547 bonds (distance) P-C4' energy: -13.438 flat angles C4'-P-C4' energy: -23.295 flat angles P-C4'-P energy: -18.152 tors. eta vs tors. theta energy: -24.763 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 167 Temperature: 1.200000 Total energy: -221.791197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.791197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.791197 (E_RNA) where: Base-Base interactions energy: -122.580 where: short stacking energy: -75.822 Base-Backbone interact. energy: -0.777 local terms energy: -98.433348 where: bonds (distance) C4'-P energy: -22.761 bonds (distance) P-C4' energy: -18.442 flat angles C4'-P-C4' energy: -20.627 flat angles P-C4'-P energy: -15.477 tors. eta vs tors. theta energy: -21.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 167 Temperature: 1.250000 Total energy: -231.690745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.690745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.690745 (E_RNA) where: Base-Base interactions energy: -142.320 where: short stacking energy: -81.208 Base-Backbone interact. energy: -0.412 local terms energy: -88.958930 where: bonds (distance) C4'-P energy: -19.688 bonds (distance) P-C4' energy: -16.191 flat angles C4'-P-C4' energy: -18.934 flat angles P-C4'-P energy: -18.429 tors. eta vs tors. theta energy: -15.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 167 Temperature: 1.300000 Total energy: -237.162727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.162727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.221462 (E_RNA) where: Base-Base interactions energy: -138.491 where: short stacking energy: -70.794 Base-Backbone interact. energy: -0.046 local terms energy: -98.684460 where: bonds (distance) C4'-P energy: -24.634 bonds (distance) P-C4' energy: -29.367 flat angles C4'-P-C4' energy: -22.238 flat angles P-C4'-P energy: -14.827 tors. eta vs tors. theta energy: -7.618 Dist. restrs. and SS energy: 0.059 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 167 Temperature: 1.350000 Total energy: -164.012820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.012820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.013825 (E_RNA) where: Base-Base interactions energy: -87.288 where: short stacking energy: -56.252 Base-Backbone interact. energy: -0.318 local terms energy: -76.408224 where: bonds (distance) C4'-P energy: -19.591 bonds (distance) P-C4' energy: -25.426 flat angles C4'-P-C4' energy: -13.757 flat angles P-C4'-P energy: -11.797 tors. eta vs tors. theta energy: -5.837 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 168 Temperature: 0.900000 Total energy: -387.878630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.878630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.878630 (E_RNA) where: Base-Base interactions energy: -256.630 where: short stacking energy: -126.441 Base-Backbone interact. energy: -0.389 local terms energy: -130.859283 where: bonds (distance) C4'-P energy: -23.785 bonds (distance) P-C4' energy: -24.496 flat angles C4'-P-C4' energy: -27.218 flat angles P-C4'-P energy: -19.491 tors. eta vs tors. theta energy: -35.869 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 168 Temperature: 0.950000 Total energy: -363.731665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.731665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.731665 (E_RNA) where: Base-Base interactions energy: -245.471 where: short stacking energy: -116.727 Base-Backbone interact. energy: -0.165 local terms energy: -118.096086 where: bonds (distance) C4'-P energy: -17.956 bonds (distance) P-C4' energy: -22.940 flat angles C4'-P-C4' energy: -26.795 flat angles P-C4'-P energy: -18.904 tors. eta vs tors. theta energy: -31.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 168 Temperature: 1.000000 Total energy: -370.102396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.102396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.127181 (E_RNA) where: Base-Base interactions energy: -249.560 where: short stacking energy: -118.405 Base-Backbone interact. energy: -0.942 local terms energy: -119.625017 where: bonds (distance) C4'-P energy: -25.647 bonds (distance) P-C4' energy: -21.795 flat angles C4'-P-C4' energy: -25.835 flat angles P-C4'-P energy: -13.404 tors. eta vs tors. theta energy: -32.944 Dist. restrs. and SS energy: 0.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 168 Temperature: 1.050000 Total energy: -347.941176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.941176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.941176 (E_RNA) where: Base-Base interactions energy: -222.438 where: short stacking energy: -113.470 Base-Backbone interact. energy: -0.277 local terms energy: -125.226183 where: bonds (distance) C4'-P energy: -22.016 bonds (distance) P-C4' energy: -23.473 flat angles C4'-P-C4' energy: -28.588 flat angles P-C4'-P energy: -15.919 tors. eta vs tors. theta energy: -35.230 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 168 Temperature: 1.100000 Total energy: -345.656123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.656123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.726907 (E_RNA) where: Base-Base interactions energy: -227.357 where: short stacking energy: -113.729 Base-Backbone interact. energy: -0.330 local terms energy: -118.040009 where: bonds (distance) C4'-P energy: -23.272 bonds (distance) P-C4' energy: -21.440 flat angles C4'-P-C4' energy: -25.631 flat angles P-C4'-P energy: -13.925 tors. eta vs tors. theta energy: -33.772 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 168 Temperature: 1.150000 Total energy: -319.290902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.290902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.304050 (E_RNA) where: Base-Base interactions energy: -205.382 where: short stacking energy: -103.231 Base-Backbone interact. energy: -0.460 local terms energy: -113.461848 where: bonds (distance) C4'-P energy: -13.314 bonds (distance) P-C4' energy: -24.953 flat angles C4'-P-C4' energy: -27.207 flat angles P-C4'-P energy: -18.405 tors. eta vs tors. theta energy: -29.582 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 168 Temperature: 1.200000 Total energy: -231.110637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.110637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.237095 (E_RNA) where: Base-Base interactions energy: -145.720 where: short stacking energy: -77.024 Base-Backbone interact. energy: -0.748 local terms energy: -84.769333 where: bonds (distance) C4'-P energy: -19.603 bonds (distance) P-C4' energy: -19.984 flat angles C4'-P-C4' energy: -18.347 flat angles P-C4'-P energy: -10.511 tors. eta vs tors. theta energy: -16.324 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 168 Temperature: 1.250000 Total energy: -228.620826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.620826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.815179 (E_RNA) where: Base-Base interactions energy: -134.479 where: short stacking energy: -74.709 Base-Backbone interact. energy: 0.441 local terms energy: -94.778019 where: bonds (distance) C4'-P energy: -17.653 bonds (distance) P-C4' energy: -19.963 flat angles C4'-P-C4' energy: -22.478 flat angles P-C4'-P energy: -15.866 tors. eta vs tors. theta energy: -18.818 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 168 Temperature: 1.300000 Total energy: -185.836382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.836382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.858457 (E_RNA) where: Base-Base interactions energy: -99.117 where: short stacking energy: -71.638 Base-Backbone interact. energy: -0.508 local terms energy: -86.233527 where: bonds (distance) C4'-P energy: -23.449 bonds (distance) P-C4' energy: -20.419 flat angles C4'-P-C4' energy: -23.444 flat angles P-C4'-P energy: -6.368 tors. eta vs tors. theta energy: -12.554 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 168 Temperature: 1.350000 Total energy: -153.816483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.816483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.816483 (E_RNA) where: Base-Base interactions energy: -75.505 where: short stacking energy: -47.041 Base-Backbone interact. energy: 6.039 local terms energy: -84.350843 where: bonds (distance) C4'-P energy: -23.424 bonds (distance) P-C4' energy: -29.051 flat angles C4'-P-C4' energy: -19.796 flat angles P-C4'-P energy: -6.377 tors. eta vs tors. theta energy: -5.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 169 Temperature: 0.900000 Total energy: -374.646499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.646499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.654231 (E_RNA) where: Base-Base interactions energy: -253.196 where: short stacking energy: -132.499 Base-Backbone interact. energy: -0.630 local terms energy: -120.828128 where: bonds (distance) C4'-P energy: -21.904 bonds (distance) P-C4' energy: -19.849 flat angles C4'-P-C4' energy: -27.288 flat angles P-C4'-P energy: -14.457 tors. eta vs tors. theta energy: -37.331 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 169 Temperature: 0.950000 Total energy: -370.799029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.799029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.816762 (E_RNA) where: Base-Base interactions energy: -247.262 where: short stacking energy: -114.318 Base-Backbone interact. energy: -0.042 local terms energy: -123.512525 where: bonds (distance) C4'-P energy: -18.862 bonds (distance) P-C4' energy: -26.624 flat angles C4'-P-C4' energy: -24.734 flat angles P-C4'-P energy: -19.524 tors. eta vs tors. theta energy: -33.769 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 169 Temperature: 1.000000 Total energy: -364.844132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.844132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.078280 (E_RNA) where: Base-Base interactions energy: -241.589 where: short stacking energy: -123.910 Base-Backbone interact. energy: -0.216 local terms energy: -123.273434 where: bonds (distance) C4'-P energy: -20.066 bonds (distance) P-C4' energy: -22.023 flat angles C4'-P-C4' energy: -25.662 flat angles P-C4'-P energy: -21.582 tors. eta vs tors. theta energy: -33.940 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 169 Temperature: 1.050000 Total energy: -349.048722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.048722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.071237 (E_RNA) where: Base-Base interactions energy: -234.027 where: short stacking energy: -110.672 Base-Backbone interact. energy: -0.169 local terms energy: -114.875098 where: bonds (distance) C4'-P energy: -20.485 bonds (distance) P-C4' energy: -23.204 flat angles C4'-P-C4' energy: -22.740 flat angles P-C4'-P energy: -17.297 tors. eta vs tors. theta energy: -31.149 Dist. restrs. and SS energy: 0.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 169 Temperature: 1.100000 Total energy: -341.297017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.297017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.297017 (E_RNA) where: Base-Base interactions energy: -237.574 where: short stacking energy: -120.170 Base-Backbone interact. energy: 2.181 local terms energy: -105.903700 where: bonds (distance) C4'-P energy: -21.362 bonds (distance) P-C4' energy: -13.730 flat angles C4'-P-C4' energy: -24.276 flat angles P-C4'-P energy: -16.288 tors. eta vs tors. theta energy: -30.248 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 169 Temperature: 1.150000 Total energy: -303.166187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.166187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.166187 (E_RNA) where: Base-Base interactions energy: -208.980 where: short stacking energy: -93.073 Base-Backbone interact. energy: -0.905 local terms energy: -93.281041 where: bonds (distance) C4'-P energy: -12.362 bonds (distance) P-C4' energy: -21.985 flat angles C4'-P-C4' energy: -20.517 flat angles P-C4'-P energy: -8.257 tors. eta vs tors. theta energy: -30.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 169 Temperature: 1.200000 Total energy: -225.576771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.576771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.576771 (E_RNA) where: Base-Base interactions energy: -144.421 where: short stacking energy: -73.332 Base-Backbone interact. energy: -0.302 local terms energy: -80.853681 where: bonds (distance) C4'-P energy: -17.131 bonds (distance) P-C4' energy: -24.750 flat angles C4'-P-C4' energy: -18.583 flat angles P-C4'-P energy: -4.641 tors. eta vs tors. theta energy: -15.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 169 Temperature: 1.250000 Total energy: -236.693045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.693045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.702561 (E_RNA) where: Base-Base interactions energy: -147.599 where: short stacking energy: -80.331 Base-Backbone interact. energy: -0.137 local terms energy: -88.966793 where: bonds (distance) C4'-P energy: -24.039 bonds (distance) P-C4' energy: -13.893 flat angles C4'-P-C4' energy: -21.686 flat angles P-C4'-P energy: -11.126 tors. eta vs tors. theta energy: -18.222 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 169 Temperature: 1.300000 Total energy: -177.725361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.725361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.732610 (E_RNA) where: Base-Base interactions energy: -89.031 where: short stacking energy: -62.621 Base-Backbone interact. energy: 0.549 local terms energy: -89.250526 where: bonds (distance) C4'-P energy: -18.753 bonds (distance) P-C4' energy: -25.631 flat angles C4'-P-C4' energy: -23.192 flat angles P-C4'-P energy: -11.295 tors. eta vs tors. theta energy: -10.379 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 169 Temperature: 1.350000 Total energy: -156.436974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.436974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.517270 (E_RNA) where: Base-Base interactions energy: -78.083 where: short stacking energy: -54.620 Base-Backbone interact. energy: -0.506 local terms energy: -77.928009 where: bonds (distance) C4'-P energy: -13.148 bonds (distance) P-C4' energy: -26.871 flat angles C4'-P-C4' energy: -21.344 flat angles P-C4'-P energy: -13.656 tors. eta vs tors. theta energy: -2.908 Dist. restrs. and SS energy: 0.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 170 Temperature: 0.900000 Total energy: -387.335427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.335427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.344029 (E_RNA) where: Base-Base interactions energy: -259.776 where: short stacking energy: -131.240 Base-Backbone interact. energy: -0.223 local terms energy: -127.344446 where: bonds (distance) C4'-P energy: -23.073 bonds (distance) P-C4' energy: -22.649 flat angles C4'-P-C4' energy: -26.411 flat angles P-C4'-P energy: -17.102 tors. eta vs tors. theta energy: -38.110 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 170 Temperature: 0.950000 Total energy: -375.462449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.462449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.466841 (E_RNA) where: Base-Base interactions energy: -243.655 where: short stacking energy: -124.344 Base-Backbone interact. energy: -0.029 local terms energy: -131.782210 where: bonds (distance) C4'-P energy: -23.562 bonds (distance) P-C4' energy: -26.905 flat angles C4'-P-C4' energy: -27.244 flat angles P-C4'-P energy: -18.252 tors. eta vs tors. theta energy: -35.819 Dist. restrs. and SS energy: 0.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 170 Temperature: 1.000000 Total energy: -354.971573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.971573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.971573 (E_RNA) where: Base-Base interactions energy: -237.693 where: short stacking energy: -113.855 Base-Backbone interact. energy: -0.322 local terms energy: -116.956653 where: bonds (distance) C4'-P energy: -20.961 bonds (distance) P-C4' energy: -21.207 flat angles C4'-P-C4' energy: -21.229 flat angles P-C4'-P energy: -17.371 tors. eta vs tors. theta energy: -36.188 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 170 Temperature: 1.050000 Total energy: -355.288326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.288326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.304828 (E_RNA) where: Base-Base interactions energy: -226.593 where: short stacking energy: -109.521 Base-Backbone interact. energy: -0.877 local terms energy: -127.834776 where: bonds (distance) C4'-P energy: -24.736 bonds (distance) P-C4' energy: -20.550 flat angles C4'-P-C4' energy: -28.959 flat angles P-C4'-P energy: -19.664 tors. eta vs tors. theta energy: -33.925 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 170 Temperature: 1.100000 Total energy: -337.032075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.032075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.038614 (E_RNA) where: Base-Base interactions energy: -215.561 where: short stacking energy: -105.087 Base-Backbone interact. energy: -0.257 local terms energy: -121.220510 where: bonds (distance) C4'-P energy: -24.627 bonds (distance) P-C4' energy: -23.913 flat angles C4'-P-C4' energy: -20.846 flat angles P-C4'-P energy: -21.459 tors. eta vs tors. theta energy: -30.376 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 170 Temperature: 1.150000 Total energy: -286.769948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.769948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.781573 (E_RNA) where: Base-Base interactions energy: -176.406 where: short stacking energy: -103.820 Base-Backbone interact. energy: -0.065 local terms energy: -110.310423 where: bonds (distance) C4'-P energy: -21.718 bonds (distance) P-C4' energy: -18.936 flat angles C4'-P-C4' energy: -21.463 flat angles P-C4'-P energy: -19.773 tors. eta vs tors. theta energy: -28.421 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 170 Temperature: 1.200000 Total energy: -239.973521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.973521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.985859 (E_RNA) where: Base-Base interactions energy: -148.953 where: short stacking energy: -72.295 Base-Backbone interact. energy: -0.322 local terms energy: -90.710146 where: bonds (distance) C4'-P energy: -19.508 bonds (distance) P-C4' energy: -17.349 flat angles C4'-P-C4' energy: -24.297 flat angles P-C4'-P energy: -17.337 tors. eta vs tors. theta energy: -12.218 Dist. restrs. and SS energy: 0.012 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 170 Temperature: 1.250000 Total energy: -225.505936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.505936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.527554 (E_RNA) where: Base-Base interactions energy: -135.930 where: short stacking energy: -75.020 Base-Backbone interact. energy: -1.096 local terms energy: -88.501540 where: bonds (distance) C4'-P energy: -19.274 bonds (distance) P-C4' energy: -17.869 flat angles C4'-P-C4' energy: -19.938 flat angles P-C4'-P energy: -15.770 tors. eta vs tors. theta energy: -15.650 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 170 Temperature: 1.300000 Total energy: -149.435272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.435272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.435272 (E_RNA) where: Base-Base interactions energy: -76.086 where: short stacking energy: -48.506 Base-Backbone interact. energy: -0.489 local terms energy: -72.860061 where: bonds (distance) C4'-P energy: -17.463 bonds (distance) P-C4' energy: -19.703 flat angles C4'-P-C4' energy: -18.500 flat angles P-C4'-P energy: -10.168 tors. eta vs tors. theta energy: -7.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 170 Temperature: 1.350000 Total energy: -160.580594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.580594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.580594 (E_RNA) where: Base-Base interactions energy: -82.298 where: short stacking energy: -52.385 Base-Backbone interact. energy: -0.566 local terms energy: -77.716727 where: bonds (distance) C4'-P energy: -23.482 bonds (distance) P-C4' energy: -22.324 flat angles C4'-P-C4' energy: -19.501 flat angles P-C4'-P energy: -7.602 tors. eta vs tors. theta energy: -4.808 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 171 Temperature: 0.900000 Total energy: -376.244142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.244142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.258988 (E_RNA) where: Base-Base interactions energy: -247.901 where: short stacking energy: -127.218 Base-Backbone interact. energy: -0.023 local terms energy: -128.334158 where: bonds (distance) C4'-P energy: -24.137 bonds (distance) P-C4' energy: -26.409 flat angles C4'-P-C4' energy: -28.196 flat angles P-C4'-P energy: -13.136 tors. eta vs tors. theta energy: -36.455 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 171 Temperature: 0.950000 Total energy: -375.603934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.603934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.603934 (E_RNA) where: Base-Base interactions energy: -252.148 where: short stacking energy: -119.811 Base-Backbone interact. energy: -1.318 local terms energy: -122.137976 where: bonds (distance) C4'-P energy: -20.053 bonds (distance) P-C4' energy: -23.342 flat angles C4'-P-C4' energy: -25.312 flat angles P-C4'-P energy: -17.412 tors. eta vs tors. theta energy: -36.018 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 171 Temperature: 1.000000 Total energy: -367.316190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.316190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.526107 (E_RNA) where: Base-Base interactions energy: -244.430 where: short stacking energy: -126.027 Base-Backbone interact. energy: -0.216 local terms energy: -122.880000 where: bonds (distance) C4'-P energy: -15.634 bonds (distance) P-C4' energy: -25.604 flat angles C4'-P-C4' energy: -27.332 flat angles P-C4'-P energy: -17.084 tors. eta vs tors. theta energy: -37.226 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 171 Temperature: 1.050000 Total energy: -357.384688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.384688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.384688 (E_RNA) where: Base-Base interactions energy: -238.284 where: short stacking energy: -107.327 Base-Backbone interact. energy: -0.614 local terms energy: -118.487399 where: bonds (distance) C4'-P energy: -20.736 bonds (distance) P-C4' energy: -18.673 flat angles C4'-P-C4' energy: -26.659 flat angles P-C4'-P energy: -18.086 tors. eta vs tors. theta energy: -34.334 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 171 Temperature: 1.100000 Total energy: -350.737286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.737286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.890768 (E_RNA) where: Base-Base interactions energy: -232.633 where: short stacking energy: -111.959 Base-Backbone interact. energy: -0.189 local terms energy: -118.068228 where: bonds (distance) C4'-P energy: -22.162 bonds (distance) P-C4' energy: -21.958 flat angles C4'-P-C4' energy: -22.396 flat angles P-C4'-P energy: -16.097 tors. eta vs tors. theta energy: -35.455 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 171 Temperature: 1.150000 Total energy: -310.011053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.011053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.011053 (E_RNA) where: Base-Base interactions energy: -205.336 where: short stacking energy: -93.482 Base-Backbone interact. energy: 0.190 local terms energy: -104.864950 where: bonds (distance) C4'-P energy: -25.707 bonds (distance) P-C4' energy: -15.585 flat angles C4'-P-C4' energy: -16.059 flat angles P-C4'-P energy: -15.143 tors. eta vs tors. theta energy: -32.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 171 Temperature: 1.200000 Total energy: -240.419682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.419682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.419682 (E_RNA) where: Base-Base interactions energy: -141.928 where: short stacking energy: -74.567 Base-Backbone interact. energy: -0.598 local terms energy: -97.893572 where: bonds (distance) C4'-P energy: -24.090 bonds (distance) P-C4' energy: -24.979 flat angles C4'-P-C4' energy: -19.055 flat angles P-C4'-P energy: -12.892 tors. eta vs tors. theta energy: -16.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 171 Temperature: 1.250000 Total energy: -164.158329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.158329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.317440 (E_RNA) where: Base-Base interactions energy: -93.341 where: short stacking energy: -51.942 Base-Backbone interact. energy: -0.268 local terms energy: -70.708407 where: bonds (distance) C4'-P energy: -19.605 bonds (distance) P-C4' energy: -18.107 flat angles C4'-P-C4' energy: -18.401 flat angles P-C4'-P energy: -6.284 tors. eta vs tors. theta energy: -8.311 Dist. restrs. and SS energy: 0.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 171 Temperature: 1.300000 Total energy: -202.003768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.003768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.018444 (E_RNA) where: Base-Base interactions energy: -120.537 where: short stacking energy: -58.791 Base-Backbone interact. energy: -0.421 local terms energy: -81.060470 where: bonds (distance) C4'-P energy: -17.500 bonds (distance) P-C4' energy: -16.108 flat angles C4'-P-C4' energy: -18.603 flat angles P-C4'-P energy: -17.144 tors. eta vs tors. theta energy: -11.705 Dist. restrs. and SS energy: 0.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 171 Temperature: 1.350000 Total energy: -167.088934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.088934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.132236 (E_RNA) where: Base-Base interactions energy: -95.500 where: short stacking energy: -56.561 Base-Backbone interact. energy: -0.546 local terms energy: -71.085867 where: bonds (distance) C4'-P energy: -20.846 bonds (distance) P-C4' energy: -24.163 flat angles C4'-P-C4' energy: -11.724 flat angles P-C4'-P energy: -11.972 tors. eta vs tors. theta energy: -2.381 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 172 Temperature: 0.900000 Total energy: -389.893138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.893138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.893138 (E_RNA) where: Base-Base interactions energy: -250.417 where: short stacking energy: -122.796 Base-Backbone interact. energy: -0.005 local terms energy: -139.470985 where: bonds (distance) C4'-P energy: -27.461 bonds (distance) P-C4' energy: -27.735 flat angles C4'-P-C4' energy: -23.972 flat angles P-C4'-P energy: -23.409 tors. eta vs tors. theta energy: -36.895 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 172 Temperature: 0.950000 Total energy: -368.885086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.885086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.890516 (E_RNA) where: Base-Base interactions energy: -234.841 where: short stacking energy: -119.343 Base-Backbone interact. energy: -0.461 local terms energy: -133.587784 where: bonds (distance) C4'-P energy: -24.828 bonds (distance) P-C4' energy: -27.671 flat angles C4'-P-C4' energy: -24.540 flat angles P-C4'-P energy: -17.595 tors. eta vs tors. theta energy: -38.954 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 172 Temperature: 1.000000 Total energy: -364.785817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.785817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.785817 (E_RNA) where: Base-Base interactions energy: -237.568 where: short stacking energy: -118.216 Base-Backbone interact. energy: -0.058 local terms energy: -127.159283 where: bonds (distance) C4'-P energy: -24.449 bonds (distance) P-C4' energy: -23.747 flat angles C4'-P-C4' energy: -25.326 flat angles P-C4'-P energy: -17.038 tors. eta vs tors. theta energy: -36.599 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 172 Temperature: 1.050000 Total energy: -343.370575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.370575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.403594 (E_RNA) where: Base-Base interactions energy: -218.735 where: short stacking energy: -116.315 Base-Backbone interact. energy: -1.681 local terms energy: -122.987599 where: bonds (distance) C4'-P energy: -23.613 bonds (distance) P-C4' energy: -24.578 flat angles C4'-P-C4' energy: -22.856 flat angles P-C4'-P energy: -18.644 tors. eta vs tors. theta energy: -33.297 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 172 Temperature: 1.100000 Total energy: -356.725704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.725704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.870061 (E_RNA) where: Base-Base interactions energy: -235.482 where: short stacking energy: -106.799 Base-Backbone interact. energy: -1.394 local terms energy: -119.994337 where: bonds (distance) C4'-P energy: -16.867 bonds (distance) P-C4' energy: -21.704 flat angles C4'-P-C4' energy: -27.310 flat angles P-C4'-P energy: -19.110 tors. eta vs tors. theta energy: -35.004 Dist. restrs. and SS energy: 0.144 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 172 Temperature: 1.150000 Total energy: -321.453667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.453667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.521036 (E_RNA) where: Base-Base interactions energy: -215.307 where: short stacking energy: -97.300 Base-Backbone interact. energy: -0.122 local terms energy: -106.092667 where: bonds (distance) C4'-P energy: -24.713 bonds (distance) P-C4' energy: -16.954 flat angles C4'-P-C4' energy: -23.391 flat angles P-C4'-P energy: -13.656 tors. eta vs tors. theta energy: -27.378 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 172 Temperature: 1.200000 Total energy: -216.400856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.400856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.400856 (E_RNA) where: Base-Base interactions energy: -113.480 where: short stacking energy: -47.909 Base-Backbone interact. energy: -1.144 local terms energy: -101.776657 where: bonds (distance) C4'-P energy: -24.089 bonds (distance) P-C4' energy: -25.842 flat angles C4'-P-C4' energy: -26.686 flat angles P-C4'-P energy: -16.103 tors. eta vs tors. theta energy: -9.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 172 Temperature: 1.250000 Total energy: -182.233116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.233116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.333934 (E_RNA) where: Base-Base interactions energy: -111.496 where: short stacking energy: -55.739 Base-Backbone interact. energy: -0.137 local terms energy: -70.700730 where: bonds (distance) C4'-P energy: -20.180 bonds (distance) P-C4' energy: -21.195 flat angles C4'-P-C4' energy: -18.285 flat angles P-C4'-P energy: -9.497 tors. eta vs tors. theta energy: -1.544 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 172 Temperature: 1.300000 Total energy: -232.112038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.112038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.112038 (E_RNA) where: Base-Base interactions energy: -137.889 where: short stacking energy: -65.095 Base-Backbone interact. energy: -1.377 local terms energy: -92.845966 where: bonds (distance) C4'-P energy: -17.280 bonds (distance) P-C4' energy: -22.827 flat angles C4'-P-C4' energy: -22.483 flat angles P-C4'-P energy: -11.266 tors. eta vs tors. theta energy: -18.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 172 Temperature: 1.350000 Total energy: -179.984938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.984938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.011535 (E_RNA) where: Base-Base interactions energy: -110.414 where: short stacking energy: -62.219 Base-Backbone interact. energy: -0.267 local terms energy: -69.329880 where: bonds (distance) C4'-P energy: -15.086 bonds (distance) P-C4' energy: -22.733 flat angles C4'-P-C4' energy: -14.465 flat angles P-C4'-P energy: -7.299 tors. eta vs tors. theta energy: -9.747 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 173 Temperature: 0.900000 Total energy: -379.203388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.203388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.204255 (E_RNA) where: Base-Base interactions energy: -257.518 where: short stacking energy: -116.978 Base-Backbone interact. energy: -1.093 local terms energy: -120.592692 where: bonds (distance) C4'-P energy: -23.609 bonds (distance) P-C4' energy: -23.640 flat angles C4'-P-C4' energy: -21.306 flat angles P-C4'-P energy: -19.622 tors. eta vs tors. theta energy: -32.416 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 173 Temperature: 0.950000 Total energy: -364.670502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.670502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.725253 (E_RNA) where: Base-Base interactions energy: -239.446 where: short stacking energy: -115.076 Base-Backbone interact. energy: -0.001 local terms energy: -125.278293 where: bonds (distance) C4'-P energy: -17.931 bonds (distance) P-C4' energy: -24.317 flat angles C4'-P-C4' energy: -26.038 flat angles P-C4'-P energy: -20.943 tors. eta vs tors. theta energy: -36.050 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 173 Temperature: 1.000000 Total energy: -364.004415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.004415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.004415 (E_RNA) where: Base-Base interactions energy: -238.715 where: short stacking energy: -114.115 Base-Backbone interact. energy: 0.663 local terms energy: -125.952045 where: bonds (distance) C4'-P energy: -24.648 bonds (distance) P-C4' energy: -23.506 flat angles C4'-P-C4' energy: -27.219 flat angles P-C4'-P energy: -17.047 tors. eta vs tors. theta energy: -33.532 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 173 Temperature: 1.050000 Total energy: -353.034343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.034343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.034343 (E_RNA) where: Base-Base interactions energy: -229.743 where: short stacking energy: -112.820 Base-Backbone interact. energy: -0.461 local terms energy: -122.830049 where: bonds (distance) C4'-P energy: -19.398 bonds (distance) P-C4' energy: -24.542 flat angles C4'-P-C4' energy: -26.709 flat angles P-C4'-P energy: -19.280 tors. eta vs tors. theta energy: -32.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 173 Temperature: 1.100000 Total energy: -327.546434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.546434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.546434 (E_RNA) where: Base-Base interactions energy: -215.972 where: short stacking energy: -90.507 Base-Backbone interact. energy: -0.882 local terms energy: -110.692488 where: bonds (distance) C4'-P energy: -20.123 bonds (distance) P-C4' energy: -21.028 flat angles C4'-P-C4' energy: -24.861 flat angles P-C4'-P energy: -10.085 tors. eta vs tors. theta energy: -34.595 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 173 Temperature: 1.150000 Total energy: -321.860024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.860024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.860024 (E_RNA) where: Base-Base interactions energy: -209.031 where: short stacking energy: -103.067 Base-Backbone interact. energy: -1.473 local terms energy: -111.355055 where: bonds (distance) C4'-P energy: -21.089 bonds (distance) P-C4' energy: -22.565 flat angles C4'-P-C4' energy: -26.721 flat angles P-C4'-P energy: -14.413 tors. eta vs tors. theta energy: -26.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 173 Temperature: 1.200000 Total energy: -239.428250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.428250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.431698 (E_RNA) where: Base-Base interactions energy: -151.213 where: short stacking energy: -79.110 Base-Backbone interact. energy: -1.018 local terms energy: -87.200702 where: bonds (distance) C4'-P energy: -16.572 bonds (distance) P-C4' energy: -21.647 flat angles C4'-P-C4' energy: -19.449 flat angles P-C4'-P energy: -13.484 tors. eta vs tors. theta energy: -16.050 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 173 Temperature: 1.250000 Total energy: -259.444194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.444194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.498505 (E_RNA) where: Base-Base interactions energy: -157.323 where: short stacking energy: -80.068 Base-Backbone interact. energy: 0.503 local terms energy: -102.678348 where: bonds (distance) C4'-P energy: -22.381 bonds (distance) P-C4' energy: -22.024 flat angles C4'-P-C4' energy: -21.708 flat angles P-C4'-P energy: -12.634 tors. eta vs tors. theta energy: -23.931 Dist. restrs. and SS energy: 0.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 173 Temperature: 1.300000 Total energy: -174.918174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.918174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.918174 (E_RNA) where: Base-Base interactions energy: -95.834 where: short stacking energy: -45.091 Base-Backbone interact. energy: -1.690 local terms energy: -77.394553 where: bonds (distance) C4'-P energy: -17.930 bonds (distance) P-C4' energy: -26.678 flat angles C4'-P-C4' energy: -18.544 flat angles P-C4'-P energy: -9.393 tors. eta vs tors. theta energy: -4.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 173 Temperature: 1.350000 Total energy: -160.598175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.598175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.679562 (E_RNA) where: Base-Base interactions energy: -88.273 where: short stacking energy: -56.332 Base-Backbone interact. energy: -0.858 local terms energy: -71.548344 where: bonds (distance) C4'-P energy: -18.685 bonds (distance) P-C4' energy: -18.931 flat angles C4'-P-C4' energy: -18.558 flat angles P-C4'-P energy: -12.399 tors. eta vs tors. theta energy: -2.977 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 174 Temperature: 0.900000 Total energy: -383.612354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.612354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.658727 (E_RNA) where: Base-Base interactions energy: -248.697 where: short stacking energy: -131.286 Base-Backbone interact. energy: -0.019 local terms energy: -134.942148 where: bonds (distance) C4'-P energy: -23.579 bonds (distance) P-C4' energy: -28.715 flat angles C4'-P-C4' energy: -27.064 flat angles P-C4'-P energy: -17.288 tors. eta vs tors. theta energy: -38.296 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 174 Temperature: 0.950000 Total energy: -364.838407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.838407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.838407 (E_RNA) where: Base-Base interactions energy: -241.127 where: short stacking energy: -123.463 Base-Backbone interact. energy: 0.948 local terms energy: -124.659579 where: bonds (distance) C4'-P energy: -22.509 bonds (distance) P-C4' energy: -25.114 flat angles C4'-P-C4' energy: -29.579 flat angles P-C4'-P energy: -13.592 tors. eta vs tors. theta energy: -33.866 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 174 Temperature: 1.000000 Total energy: -368.701779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.701779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.704091 (E_RNA) where: Base-Base interactions energy: -236.021 where: short stacking energy: -118.153 Base-Backbone interact. energy: -0.071 local terms energy: -132.612238 where: bonds (distance) C4'-P energy: -26.085 bonds (distance) P-C4' energy: -23.579 flat angles C4'-P-C4' energy: -26.394 flat angles P-C4'-P energy: -20.706 tors. eta vs tors. theta energy: -35.849 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 174 Temperature: 1.050000 Total energy: -363.345272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.345272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.445173 (E_RNA) where: Base-Base interactions energy: -225.956 where: short stacking energy: -113.809 Base-Backbone interact. energy: -0.768 local terms energy: -136.720694 where: bonds (distance) C4'-P energy: -25.639 bonds (distance) P-C4' energy: -27.731 flat angles C4'-P-C4' energy: -28.276 flat angles P-C4'-P energy: -16.135 tors. eta vs tors. theta energy: -38.939 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 174 Temperature: 1.100000 Total energy: -322.986802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.986802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.177861 (E_RNA) where: Base-Base interactions energy: -212.136 where: short stacking energy: -109.678 Base-Backbone interact. energy: -0.315 local terms energy: -110.727198 where: bonds (distance) C4'-P energy: -22.701 bonds (distance) P-C4' energy: -12.857 flat angles C4'-P-C4' energy: -24.114 flat angles P-C4'-P energy: -19.613 tors. eta vs tors. theta energy: -31.441 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 174 Temperature: 1.150000 Total energy: -319.958287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.958287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.009837 (E_RNA) where: Base-Base interactions energy: -216.719 where: short stacking energy: -101.842 Base-Backbone interact. energy: -0.306 local terms energy: -102.984630 where: bonds (distance) C4'-P energy: -20.252 bonds (distance) P-C4' energy: -19.826 flat angles C4'-P-C4' energy: -20.722 flat angles P-C4'-P energy: -16.770 tors. eta vs tors. theta energy: -25.416 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 174 Temperature: 1.200000 Total energy: -247.366131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.366131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.366131 (E_RNA) where: Base-Base interactions energy: -150.662 where: short stacking energy: -76.768 Base-Backbone interact. energy: -0.116 local terms energy: -96.587661 where: bonds (distance) C4'-P energy: -21.571 bonds (distance) P-C4' energy: -18.746 flat angles C4'-P-C4' energy: -20.779 flat angles P-C4'-P energy: -14.630 tors. eta vs tors. theta energy: -20.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 174 Temperature: 1.250000 Total energy: -229.059041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.059041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.089054 (E_RNA) where: Base-Base interactions energy: -135.824 where: short stacking energy: -74.935 Base-Backbone interact. energy: -0.651 local terms energy: -92.614172 where: bonds (distance) C4'-P energy: -18.846 bonds (distance) P-C4' energy: -21.573 flat angles C4'-P-C4' energy: -21.232 flat angles P-C4'-P energy: -11.846 tors. eta vs tors. theta energy: -19.117 Dist. restrs. and SS energy: 0.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 174 Temperature: 1.300000 Total energy: -150.121678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.121678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.243961 (E_RNA) where: Base-Base interactions energy: -69.577 where: short stacking energy: -45.808 Base-Backbone interact. energy: 0.492 local terms energy: -81.159050 where: bonds (distance) C4'-P energy: -20.564 bonds (distance) P-C4' energy: -24.144 flat angles C4'-P-C4' energy: -17.881 flat angles P-C4'-P energy: -12.670 tors. eta vs tors. theta energy: -5.901 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 174 Temperature: 1.350000 Total energy: -163.034577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.034577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.134352 (E_RNA) where: Base-Base interactions energy: -92.503 where: short stacking energy: -56.608 Base-Backbone interact. energy: -0.213 local terms energy: -70.418416 where: bonds (distance) C4'-P energy: -12.243 bonds (distance) P-C4' energy: -22.185 flat angles C4'-P-C4' energy: -16.166 flat angles P-C4'-P energy: -11.899 tors. eta vs tors. theta energy: -7.925 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 175 Temperature: 0.900000 Total energy: -391.239676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.239676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.239676 (E_RNA) where: Base-Base interactions energy: -252.600 where: short stacking energy: -125.201 Base-Backbone interact. energy: -1.012 local terms energy: -137.627462 where: bonds (distance) C4'-P energy: -25.303 bonds (distance) P-C4' energy: -30.099 flat angles C4'-P-C4' energy: -28.038 flat angles P-C4'-P energy: -19.805 tors. eta vs tors. theta energy: -34.383 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 175 Temperature: 0.950000 Total energy: -371.371098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.371098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.371098 (E_RNA) where: Base-Base interactions energy: -243.482 where: short stacking energy: -121.217 Base-Backbone interact. energy: -1.040 local terms energy: -126.849865 where: bonds (distance) C4'-P energy: -21.147 bonds (distance) P-C4' energy: -25.940 flat angles C4'-P-C4' energy: -24.484 flat angles P-C4'-P energy: -19.906 tors. eta vs tors. theta energy: -35.372 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 175 Temperature: 1.000000 Total energy: -366.874736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.874736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.874736 (E_RNA) where: Base-Base interactions energy: -243.327 where: short stacking energy: -118.962 Base-Backbone interact. energy: -0.802 local terms energy: -122.746242 where: bonds (distance) C4'-P energy: -18.843 bonds (distance) P-C4' energy: -24.814 flat angles C4'-P-C4' energy: -25.864 flat angles P-C4'-P energy: -17.323 tors. eta vs tors. theta energy: -35.903 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 175 Temperature: 1.050000 Total energy: -352.743797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.743797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.743797 (E_RNA) where: Base-Base interactions energy: -233.446 where: short stacking energy: -110.420 Base-Backbone interact. energy: -0.103 local terms energy: -119.194501 where: bonds (distance) C4'-P energy: -26.206 bonds (distance) P-C4' energy: -21.372 flat angles C4'-P-C4' energy: -23.958 flat angles P-C4'-P energy: -19.086 tors. eta vs tors. theta energy: -28.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 175 Temperature: 1.100000 Total energy: -285.741192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.741192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.906214 (E_RNA) where: Base-Base interactions energy: -180.450 where: short stacking energy: -97.144 Base-Backbone interact. energy: -1.221 local terms energy: -104.235274 where: bonds (distance) C4'-P energy: -18.362 bonds (distance) P-C4' energy: -23.758 flat angles C4'-P-C4' energy: -22.983 flat angles P-C4'-P energy: -15.878 tors. eta vs tors. theta energy: -23.254 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 175 Temperature: 1.150000 Total energy: -294.278326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.278326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.755857 (E_RNA) where: Base-Base interactions energy: -189.964 where: short stacking energy: -93.683 Base-Backbone interact. energy: -1.951 local terms energy: -102.840759 where: bonds (distance) C4'-P energy: -21.407 bonds (distance) P-C4' energy: -22.194 flat angles C4'-P-C4' energy: -21.522 flat angles P-C4'-P energy: -13.797 tors. eta vs tors. theta energy: -23.922 Dist. restrs. and SS energy: 0.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 175 Temperature: 1.200000 Total energy: -248.552726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.552726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.552726 (E_RNA) where: Base-Base interactions energy: -158.103 where: short stacking energy: -78.658 Base-Backbone interact. energy: -0.637 local terms energy: -89.812889 where: bonds (distance) C4'-P energy: -17.765 bonds (distance) P-C4' energy: -20.186 flat angles C4'-P-C4' energy: -18.320 flat angles P-C4'-P energy: -13.471 tors. eta vs tors. theta energy: -20.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 175 Temperature: 1.250000 Total energy: -257.232403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.232403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.232403 (E_RNA) where: Base-Base interactions energy: -159.695 where: short stacking energy: -93.321 Base-Backbone interact. energy: -0.121 local terms energy: -97.417029 where: bonds (distance) C4'-P energy: -17.694 bonds (distance) P-C4' energy: -22.545 flat angles C4'-P-C4' energy: -19.572 flat angles P-C4'-P energy: -15.579 tors. eta vs tors. theta energy: -22.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 175 Temperature: 1.300000 Total energy: -175.967702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.967702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.233959 (E_RNA) where: Base-Base interactions energy: -90.954 where: short stacking energy: -49.499 Base-Backbone interact. energy: -0.444 local terms energy: -84.835804 where: bonds (distance) C4'-P energy: -17.769 bonds (distance) P-C4' energy: -24.959 flat angles C4'-P-C4' energy: -23.066 flat angles P-C4'-P energy: -18.035 tors. eta vs tors. theta energy: -1.007 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 175 Temperature: 1.350000 Total energy: -153.891419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.891419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.948334 (E_RNA) where: Base-Base interactions energy: -73.593 where: short stacking energy: -53.151 Base-Backbone interact. energy: -0.332 local terms energy: -80.023770 where: bonds (distance) C4'-P energy: -16.315 bonds (distance) P-C4' energy: -25.044 flat angles C4'-P-C4' energy: -20.108 flat angles P-C4'-P energy: -11.176 tors. eta vs tors. theta energy: -7.381 Dist. restrs. and SS energy: 0.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 176 Temperature: 0.900000 Total energy: -380.653958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.653958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.653958 (E_RNA) where: Base-Base interactions energy: -250.955 where: short stacking energy: -124.077 Base-Backbone interact. energy: -0.004 local terms energy: -129.695070 where: bonds (distance) C4'-P energy: -21.119 bonds (distance) P-C4' energy: -27.472 flat angles C4'-P-C4' energy: -26.185 flat angles P-C4'-P energy: -16.141 tors. eta vs tors. theta energy: -38.778 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 176 Temperature: 0.950000 Total energy: -378.102749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.102749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.130317 (E_RNA) where: Base-Base interactions energy: -252.040 where: short stacking energy: -127.802 Base-Backbone interact. energy: -0.124 local terms energy: -125.966827 where: bonds (distance) C4'-P energy: -19.806 bonds (distance) P-C4' energy: -27.734 flat angles C4'-P-C4' energy: -21.512 flat angles P-C4'-P energy: -17.632 tors. eta vs tors. theta energy: -39.282 Dist. restrs. and SS energy: 0.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 176 Temperature: 1.000000 Total energy: -365.658433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.658433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.658433 (E_RNA) where: Base-Base interactions energy: -244.172 where: short stacking energy: -118.671 Base-Backbone interact. energy: -0.578 local terms energy: -120.908838 where: bonds (distance) C4'-P energy: -21.884 bonds (distance) P-C4' energy: -24.411 flat angles C4'-P-C4' energy: -23.787 flat angles P-C4'-P energy: -17.603 tors. eta vs tors. theta energy: -33.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 176 Temperature: 1.050000 Total energy: -341.097559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.097559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.097559 (E_RNA) where: Base-Base interactions energy: -222.722 where: short stacking energy: -97.037 Base-Backbone interact. energy: -0.784 local terms energy: -117.591773 where: bonds (distance) C4'-P energy: -23.844 bonds (distance) P-C4' energy: -20.370 flat angles C4'-P-C4' energy: -28.865 flat angles P-C4'-P energy: -15.880 tors. eta vs tors. theta energy: -28.633 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 176 Temperature: 1.100000 Total energy: -292.568345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.568345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.568345 (E_RNA) where: Base-Base interactions energy: -178.765 where: short stacking energy: -93.512 Base-Backbone interact. energy: -0.080 local terms energy: -113.723129 where: bonds (distance) C4'-P energy: -21.271 bonds (distance) P-C4' energy: -21.442 flat angles C4'-P-C4' energy: -25.903 flat angles P-C4'-P energy: -16.749 tors. eta vs tors. theta energy: -28.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 176 Temperature: 1.150000 Total energy: -319.667909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.667909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.667909 (E_RNA) where: Base-Base interactions energy: -196.090 where: short stacking energy: -102.498 Base-Backbone interact. energy: -1.612 local terms energy: -121.965809 where: bonds (distance) C4'-P energy: -20.531 bonds (distance) P-C4' energy: -26.369 flat angles C4'-P-C4' energy: -29.034 flat angles P-C4'-P energy: -17.933 tors. eta vs tors. theta energy: -28.100 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 176 Temperature: 1.200000 Total energy: -275.620946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.620946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.818045 (E_RNA) where: Base-Base interactions energy: -173.592 where: short stacking energy: -89.803 Base-Backbone interact. energy: -1.057 local terms energy: -101.169520 where: bonds (distance) C4'-P energy: -18.509 bonds (distance) P-C4' energy: -21.166 flat angles C4'-P-C4' energy: -23.993 flat angles P-C4'-P energy: -11.348 tors. eta vs tors. theta energy: -26.153 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 176 Temperature: 1.250000 Total energy: -277.120159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.120159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.120159 (E_RNA) where: Base-Base interactions energy: -182.009 where: short stacking energy: -87.786 Base-Backbone interact. energy: -1.038 local terms energy: -94.073842 where: bonds (distance) C4'-P energy: -22.771 bonds (distance) P-C4' energy: -15.752 flat angles C4'-P-C4' energy: -24.397 flat angles P-C4'-P energy: -12.371 tors. eta vs tors. theta energy: -18.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 176 Temperature: 1.300000 Total energy: -163.247525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.247525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.343271 (E_RNA) where: Base-Base interactions energy: -90.217 where: short stacking energy: -63.073 Base-Backbone interact. energy: -1.422 local terms energy: -71.703576 where: bonds (distance) C4'-P energy: -12.823 bonds (distance) P-C4' energy: -28.627 flat angles C4'-P-C4' energy: -16.867 flat angles P-C4'-P energy: -4.290 tors. eta vs tors. theta energy: -9.097 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 176 Temperature: 1.350000 Total energy: -162.207559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.207559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.207559 (E_RNA) where: Base-Base interactions energy: -74.751 where: short stacking energy: -46.627 Base-Backbone interact. energy: -1.041 local terms energy: -86.415507 where: bonds (distance) C4'-P energy: -23.336 bonds (distance) P-C4' energy: -21.417 flat angles C4'-P-C4' energy: -21.660 flat angles P-C4'-P energy: -16.148 tors. eta vs tors. theta energy: -3.855 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 177 Temperature: 0.900000 Total energy: -380.474470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.474470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.516462 (E_RNA) where: Base-Base interactions energy: -260.050 where: short stacking energy: -129.419 Base-Backbone interact. energy: -0.008 local terms energy: -120.459274 where: bonds (distance) C4'-P energy: -21.400 bonds (distance) P-C4' energy: -24.049 flat angles C4'-P-C4' energy: -25.798 flat angles P-C4'-P energy: -15.668 tors. eta vs tors. theta energy: -33.544 Dist. restrs. and SS energy: 0.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 177 Temperature: 0.950000 Total energy: -374.386466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.386466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.432414 (E_RNA) where: Base-Base interactions energy: -245.785 where: short stacking energy: -119.251 Base-Backbone interact. energy: -0.253 local terms energy: -128.394559 where: bonds (distance) C4'-P energy: -25.644 bonds (distance) P-C4' energy: -24.416 flat angles C4'-P-C4' energy: -25.453 flat angles P-C4'-P energy: -18.760 tors. eta vs tors. theta energy: -34.122 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 177 Temperature: 1.000000 Total energy: -363.373402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.373402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.373402 (E_RNA) where: Base-Base interactions energy: -240.234 where: short stacking energy: -115.830 Base-Backbone interact. energy: -0.052 local terms energy: -123.087009 where: bonds (distance) C4'-P energy: -22.696 bonds (distance) P-C4' energy: -21.939 flat angles C4'-P-C4' energy: -22.123 flat angles P-C4'-P energy: -21.759 tors. eta vs tors. theta energy: -34.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 177 Temperature: 1.050000 Total energy: -348.842435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.842435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.842435 (E_RNA) where: Base-Base interactions energy: -229.191 where: short stacking energy: -107.867 Base-Backbone interact. energy: -0.155 local terms energy: -119.496686 where: bonds (distance) C4'-P energy: -20.124 bonds (distance) P-C4' energy: -23.531 flat angles C4'-P-C4' energy: -26.937 flat angles P-C4'-P energy: -18.990 tors. eta vs tors. theta energy: -29.915 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 177 Temperature: 1.100000 Total energy: -298.350464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.350464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.350464 (E_RNA) where: Base-Base interactions energy: -185.820 where: short stacking energy: -94.424 Base-Backbone interact. energy: -0.276 local terms energy: -112.254317 where: bonds (distance) C4'-P energy: -15.985 bonds (distance) P-C4' energy: -29.112 flat angles C4'-P-C4' energy: -26.180 flat angles P-C4'-P energy: -15.796 tors. eta vs tors. theta energy: -25.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 177 Temperature: 1.150000 Total energy: -296.879285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.879285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.879285 (E_RNA) where: Base-Base interactions energy: -191.603 where: short stacking energy: -88.813 Base-Backbone interact. energy: -0.083 local terms energy: -105.193468 where: bonds (distance) C4'-P energy: -21.022 bonds (distance) P-C4' energy: -19.390 flat angles C4'-P-C4' energy: -27.210 flat angles P-C4'-P energy: -16.004 tors. eta vs tors. theta energy: -21.568 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 177 Temperature: 1.200000 Total energy: -262.008953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.008953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.008953 (E_RNA) where: Base-Base interactions energy: -153.599 where: short stacking energy: -79.067 Base-Backbone interact. energy: -0.788 local terms energy: -107.622171 where: bonds (distance) C4'-P energy: -20.194 bonds (distance) P-C4' energy: -23.994 flat angles C4'-P-C4' energy: -24.893 flat angles P-C4'-P energy: -16.717 tors. eta vs tors. theta energy: -21.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 177 Temperature: 1.250000 Total energy: -239.432219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.432219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.432219 (E_RNA) where: Base-Base interactions energy: -141.431 where: short stacking energy: -62.134 Base-Backbone interact. energy: -0.476 local terms energy: -97.525131 where: bonds (distance) C4'-P energy: -21.736 bonds (distance) P-C4' energy: -25.119 flat angles C4'-P-C4' energy: -21.705 flat angles P-C4'-P energy: -14.383 tors. eta vs tors. theta energy: -14.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 177 Temperature: 1.300000 Total energy: -169.035452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.035452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.042260 (E_RNA) where: Base-Base interactions energy: -95.285 where: short stacking energy: -56.393 Base-Backbone interact. energy: -0.136 local terms energy: -73.621568 where: bonds (distance) C4'-P energy: -18.465 bonds (distance) P-C4' energy: -19.657 flat angles C4'-P-C4' energy: -18.301 flat angles P-C4'-P energy: -10.764 tors. eta vs tors. theta energy: -6.435 Dist. restrs. and SS energy: 0.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 177 Temperature: 1.350000 Total energy: -166.263991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.263991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.263991 (E_RNA) where: Base-Base interactions energy: -87.931 where: short stacking energy: -53.703 Base-Backbone interact. energy: -0.365 local terms energy: -77.967931 where: bonds (distance) C4'-P energy: -22.125 bonds (distance) P-C4' energy: -18.884 flat angles C4'-P-C4' energy: -14.504 flat angles P-C4'-P energy: -13.644 tors. eta vs tors. theta energy: -8.811 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 178 Temperature: 0.900000 Total energy: -376.715098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.715098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.715098 (E_RNA) where: Base-Base interactions energy: -250.445 where: short stacking energy: -124.988 Base-Backbone interact. energy: -1.029 local terms energy: -125.240817 where: bonds (distance) C4'-P energy: -23.520 bonds (distance) P-C4' energy: -24.900 flat angles C4'-P-C4' energy: -27.019 flat angles P-C4'-P energy: -17.196 tors. eta vs tors. theta energy: -32.606 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 178 Temperature: 0.950000 Total energy: -364.934149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.934149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.934149 (E_RNA) where: Base-Base interactions energy: -246.719 where: short stacking energy: -122.137 Base-Backbone interact. energy: -0.056 local terms energy: -118.159534 where: bonds (distance) C4'-P energy: -22.721 bonds (distance) P-C4' energy: -22.864 flat angles C4'-P-C4' energy: -19.542 flat angles P-C4'-P energy: -17.292 tors. eta vs tors. theta energy: -35.741 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 178 Temperature: 1.000000 Total energy: -363.898176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.898176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.943173 (E_RNA) where: Base-Base interactions energy: -241.470 where: short stacking energy: -119.863 Base-Backbone interact. energy: -0.707 local terms energy: -121.766981 where: bonds (distance) C4'-P energy: -21.213 bonds (distance) P-C4' energy: -23.345 flat angles C4'-P-C4' energy: -28.039 flat angles P-C4'-P energy: -17.675 tors. eta vs tors. theta energy: -31.494 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 178 Temperature: 1.050000 Total energy: -344.301064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.301064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.309863 (E_RNA) where: Base-Base interactions energy: -227.361 where: short stacking energy: -102.589 Base-Backbone interact. energy: 0.665 local terms energy: -117.613158 where: bonds (distance) C4'-P energy: -18.728 bonds (distance) P-C4' energy: -23.596 flat angles C4'-P-C4' energy: -21.564 flat angles P-C4'-P energy: -21.058 tors. eta vs tors. theta energy: -32.668 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 178 Temperature: 1.100000 Total energy: -319.072636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.072636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.072636 (E_RNA) where: Base-Base interactions energy: -201.703 where: short stacking energy: -99.668 Base-Backbone interact. energy: -1.107 local terms energy: -116.262214 where: bonds (distance) C4'-P energy: -25.300 bonds (distance) P-C4' energy: -19.830 flat angles C4'-P-C4' energy: -26.684 flat angles P-C4'-P energy: -17.449 tors. eta vs tors. theta energy: -26.999 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 178 Temperature: 1.150000 Total energy: -287.925039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.925039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.926353 (E_RNA) where: Base-Base interactions energy: -177.944 where: short stacking energy: -99.972 Base-Backbone interact. energy: -0.183 local terms energy: -109.798592 where: bonds (distance) C4'-P energy: -21.213 bonds (distance) P-C4' energy: -23.415 flat angles C4'-P-C4' energy: -24.981 flat angles P-C4'-P energy: -15.696 tors. eta vs tors. theta energy: -24.494 Dist. restrs. and SS energy: 0.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 178 Temperature: 1.200000 Total energy: -253.387182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.387182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.654994 (E_RNA) where: Base-Base interactions energy: -162.036 where: short stacking energy: -85.239 Base-Backbone interact. energy: -0.577 local terms energy: -91.041855 where: bonds (distance) C4'-P energy: -19.358 bonds (distance) P-C4' energy: -22.063 flat angles C4'-P-C4' energy: -13.354 flat angles P-C4'-P energy: -16.871 tors. eta vs tors. theta energy: -19.395 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 178 Temperature: 1.250000 Total energy: -244.081482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.081482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.204765 (E_RNA) where: Base-Base interactions energy: -148.672 where: short stacking energy: -69.984 Base-Backbone interact. energy: -0.033 local terms energy: -95.499351 where: bonds (distance) C4'-P energy: -22.311 bonds (distance) P-C4' energy: -24.277 flat angles C4'-P-C4' energy: -12.578 flat angles P-C4'-P energy: -16.329 tors. eta vs tors. theta energy: -20.003 Dist. restrs. and SS energy: 0.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 178 Temperature: 1.300000 Total energy: -208.378395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.378395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.513533 (E_RNA) where: Base-Base interactions energy: -115.276 where: short stacking energy: -64.077 Base-Backbone interact. energy: -0.154 local terms energy: -93.083692 where: bonds (distance) C4'-P energy: -26.206 bonds (distance) P-C4' energy: -22.389 flat angles C4'-P-C4' energy: -19.729 flat angles P-C4'-P energy: -14.752 tors. eta vs tors. theta energy: -10.008 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 178 Temperature: 1.350000 Total energy: -131.880134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.880134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.023155 (E_RNA) where: Base-Base interactions energy: -63.494 where: short stacking energy: -40.066 Base-Backbone interact. energy: 0.765 local terms energy: -69.294135 where: bonds (distance) C4'-P energy: -20.570 bonds (distance) P-C4' energy: -20.023 flat angles C4'-P-C4' energy: -19.168 flat angles P-C4'-P energy: -11.038 tors. eta vs tors. theta energy: 1.505 Dist. restrs. and SS energy: 0.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 179 Temperature: 0.900000 Total energy: -374.420299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.420299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.420299 (E_RNA) where: Base-Base interactions energy: -242.546 where: short stacking energy: -114.397 Base-Backbone interact. energy: -0.731 local terms energy: -131.142649 where: bonds (distance) C4'-P energy: -22.781 bonds (distance) P-C4' energy: -23.290 flat angles C4'-P-C4' energy: -29.522 flat angles P-C4'-P energy: -22.095 tors. eta vs tors. theta energy: -33.455 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 179 Temperature: 0.950000 Total energy: -359.764035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.764035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.778282 (E_RNA) where: Base-Base interactions energy: -230.692 where: short stacking energy: -114.009 Base-Backbone interact. energy: -0.130 local terms energy: -128.956589 where: bonds (distance) C4'-P energy: -23.574 bonds (distance) P-C4' energy: -22.554 flat angles C4'-P-C4' energy: -27.012 flat angles P-C4'-P energy: -18.940 tors. eta vs tors. theta energy: -36.875 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 179 Temperature: 1.000000 Total energy: -344.655978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.655978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.659348 (E_RNA) where: Base-Base interactions energy: -221.461 where: short stacking energy: -104.183 Base-Backbone interact. energy: -0.116 local terms energy: -123.081811 where: bonds (distance) C4'-P energy: -24.040 bonds (distance) P-C4' energy: -25.917 flat angles C4'-P-C4' energy: -19.857 flat angles P-C4'-P energy: -20.781 tors. eta vs tors. theta energy: -32.487 Dist. restrs. and SS energy: 0.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 179 Temperature: 1.050000 Total energy: -349.113350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.113350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.118470 (E_RNA) where: Base-Base interactions energy: -230.031 where: short stacking energy: -106.820 Base-Backbone interact. energy: 0.330 local terms energy: -119.417220 where: bonds (distance) C4'-P energy: -22.562 bonds (distance) P-C4' energy: -24.148 flat angles C4'-P-C4' energy: -21.190 flat angles P-C4'-P energy: -18.472 tors. eta vs tors. theta energy: -33.046 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 179 Temperature: 1.100000 Total energy: -319.717936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.717936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.717936 (E_RNA) where: Base-Base interactions energy: -215.544 where: short stacking energy: -100.323 Base-Backbone interact. energy: -0.646 local terms energy: -103.527079 where: bonds (distance) C4'-P energy: -19.819 bonds (distance) P-C4' energy: -16.183 flat angles C4'-P-C4' energy: -21.533 flat angles P-C4'-P energy: -13.229 tors. eta vs tors. theta energy: -32.763 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 179 Temperature: 1.150000 Total energy: -291.881923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.881923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.888206 (E_RNA) where: Base-Base interactions energy: -188.248 where: short stacking energy: -102.049 Base-Backbone interact. energy: -1.139 local terms energy: -102.500534 where: bonds (distance) C4'-P energy: -17.509 bonds (distance) P-C4' energy: -20.820 flat angles C4'-P-C4' energy: -24.156 flat angles P-C4'-P energy: -14.700 tors. eta vs tors. theta energy: -25.315 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 179 Temperature: 1.200000 Total energy: -251.459673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.459673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.459673 (E_RNA) where: Base-Base interactions energy: -156.841 where: short stacking energy: -76.412 Base-Backbone interact. energy: -0.533 local terms energy: -94.085368 where: bonds (distance) C4'-P energy: -24.163 bonds (distance) P-C4' energy: -18.570 flat angles C4'-P-C4' energy: -17.404 flat angles P-C4'-P energy: -13.844 tors. eta vs tors. theta energy: -20.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 179 Temperature: 1.250000 Total energy: -212.764156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.764156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.783844 (E_RNA) where: Base-Base interactions energy: -117.812 where: short stacking energy: -61.976 Base-Backbone interact. energy: -0.795 local terms energy: -94.176867 where: bonds (distance) C4'-P energy: -22.393 bonds (distance) P-C4' energy: -23.128 flat angles C4'-P-C4' energy: -22.599 flat angles P-C4'-P energy: -14.047 tors. eta vs tors. theta energy: -12.010 Dist. restrs. and SS energy: 0.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 179 Temperature: 1.300000 Total energy: -220.907092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.907092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.940995 (E_RNA) where: Base-Base interactions energy: -133.911 where: short stacking energy: -76.787 Base-Backbone interact. energy: 0.143 local terms energy: -87.173334 where: bonds (distance) C4'-P energy: -18.150 bonds (distance) P-C4' energy: -19.932 flat angles C4'-P-C4' energy: -15.260 flat angles P-C4'-P energy: -17.782 tors. eta vs tors. theta energy: -16.049 Dist. restrs. and SS energy: 0.034 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 179 Temperature: 1.350000 Total energy: -157.184381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.184381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.184381 (E_RNA) where: Base-Base interactions energy: -80.567 where: short stacking energy: -51.442 Base-Backbone interact. energy: -0.248 local terms energy: -76.369474 where: bonds (distance) C4'-P energy: -14.999 bonds (distance) P-C4' energy: -25.176 flat angles C4'-P-C4' energy: -20.315 flat angles P-C4'-P energy: -11.679 tors. eta vs tors. theta energy: -4.200 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 180 Temperature: 0.900000 Total energy: -377.635562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.635562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.656794 (E_RNA) where: Base-Base interactions energy: -239.461 where: short stacking energy: -116.241 Base-Backbone interact. energy: -0.394 local terms energy: -137.801444 where: bonds (distance) C4'-P energy: -26.232 bonds (distance) P-C4' energy: -24.562 flat angles C4'-P-C4' energy: -30.544 flat angles P-C4'-P energy: -19.520 tors. eta vs tors. theta energy: -36.944 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 180 Temperature: 0.950000 Total energy: -379.291532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.291532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.291532 (E_RNA) where: Base-Base interactions energy: -246.213 where: short stacking energy: -125.308 Base-Backbone interact. energy: -0.066 local terms energy: -133.011854 where: bonds (distance) C4'-P energy: -24.426 bonds (distance) P-C4' energy: -25.249 flat angles C4'-P-C4' energy: -28.191 flat angles P-C4'-P energy: -18.350 tors. eta vs tors. theta energy: -36.797 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 180 Temperature: 1.000000 Total energy: -357.256445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.256445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.256445 (E_RNA) where: Base-Base interactions energy: -235.557 where: short stacking energy: -111.174 Base-Backbone interact. energy: -0.598 local terms energy: -121.101916 where: bonds (distance) C4'-P energy: -23.450 bonds (distance) P-C4' energy: -20.875 flat angles C4'-P-C4' energy: -23.936 flat angles P-C4'-P energy: -17.371 tors. eta vs tors. theta energy: -35.469 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 180 Temperature: 1.050000 Total energy: -328.285232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.285232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.361157 (E_RNA) where: Base-Base interactions energy: -208.582 where: short stacking energy: -109.203 Base-Backbone interact. energy: -0.288 local terms energy: -119.491147 where: bonds (distance) C4'-P energy: -23.169 bonds (distance) P-C4' energy: -25.874 flat angles C4'-P-C4' energy: -23.212 flat angles P-C4'-P energy: -20.040 tors. eta vs tors. theta energy: -27.196 Dist. restrs. and SS energy: 0.076 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 180 Temperature: 1.100000 Total energy: -347.826528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.826528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.863218 (E_RNA) where: Base-Base interactions energy: -223.201 where: short stacking energy: -103.497 Base-Backbone interact. energy: -0.882 local terms energy: -123.779707 where: bonds (distance) C4'-P energy: -26.330 bonds (distance) P-C4' energy: -26.415 flat angles C4'-P-C4' energy: -22.683 flat angles P-C4'-P energy: -14.347 tors. eta vs tors. theta energy: -34.004 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 180 Temperature: 1.150000 Total energy: -302.982413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.982413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.034901 (E_RNA) where: Base-Base interactions energy: -195.465 where: short stacking energy: -96.706 Base-Backbone interact. energy: -0.702 local terms energy: -106.867885 where: bonds (distance) C4'-P energy: -18.397 bonds (distance) P-C4' energy: -19.567 flat angles C4'-P-C4' energy: -25.598 flat angles P-C4'-P energy: -18.350 tors. eta vs tors. theta energy: -24.956 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 180 Temperature: 1.200000 Total energy: -232.777948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.777948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.777948 (E_RNA) where: Base-Base interactions energy: -142.940 where: short stacking energy: -78.234 Base-Backbone interact. energy: -0.892 local terms energy: -88.945817 where: bonds (distance) C4'-P energy: -16.568 bonds (distance) P-C4' energy: -16.404 flat angles C4'-P-C4' energy: -19.876 flat angles P-C4'-P energy: -18.955 tors. eta vs tors. theta energy: -17.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 180 Temperature: 1.250000 Total energy: -251.256856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.256856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.308536 (E_RNA) where: Base-Base interactions energy: -156.333 where: short stacking energy: -83.790 Base-Backbone interact. energy: 0.449 local terms energy: -95.424100 where: bonds (distance) C4'-P energy: -21.781 bonds (distance) P-C4' energy: -15.663 flat angles C4'-P-C4' energy: -18.102 flat angles P-C4'-P energy: -15.727 tors. eta vs tors. theta energy: -24.151 Dist. restrs. and SS energy: 0.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 180 Temperature: 1.300000 Total energy: -249.853558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.853558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.906893 (E_RNA) where: Base-Base interactions energy: -159.675 where: short stacking energy: -78.989 Base-Backbone interact. energy: -0.210 local terms energy: -90.022087 where: bonds (distance) C4'-P energy: -22.954 bonds (distance) P-C4' energy: -15.331 flat angles C4'-P-C4' energy: -24.381 flat angles P-C4'-P energy: -12.186 tors. eta vs tors. theta energy: -15.169 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 180 Temperature: 1.350000 Total energy: -178.462563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.462563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.462563 (E_RNA) where: Base-Base interactions energy: -93.774 where: short stacking energy: -62.257 Base-Backbone interact. energy: -0.104 local terms energy: -84.584796 where: bonds (distance) C4'-P energy: -22.013 bonds (distance) P-C4' energy: -27.629 flat angles C4'-P-C4' energy: -26.997 flat angles P-C4'-P energy: -5.200 tors. eta vs tors. theta energy: -2.746 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 181 Temperature: 0.900000 Total energy: -375.418502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.418502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.463537 (E_RNA) where: Base-Base interactions energy: -239.840 where: short stacking energy: -116.912 Base-Backbone interact. energy: -0.030 local terms energy: -135.594058 where: bonds (distance) C4'-P energy: -26.985 bonds (distance) P-C4' energy: -25.151 flat angles C4'-P-C4' energy: -25.343 flat angles P-C4'-P energy: -20.749 tors. eta vs tors. theta energy: -37.366 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 181 Temperature: 0.950000 Total energy: -365.895959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.895959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.895959 (E_RNA) where: Base-Base interactions energy: -243.805 where: short stacking energy: -124.765 Base-Backbone interact. energy: -0.052 local terms energy: -122.039360 where: bonds (distance) C4'-P energy: -21.312 bonds (distance) P-C4' energy: -21.446 flat angles C4'-P-C4' energy: -26.747 flat angles P-C4'-P energy: -17.894 tors. eta vs tors. theta energy: -34.640 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 181 Temperature: 1.000000 Total energy: -352.345007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.345007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.393505 (E_RNA) where: Base-Base interactions energy: -230.252 where: short stacking energy: -117.830 Base-Backbone interact. energy: -0.046 local terms energy: -122.095140 where: bonds (distance) C4'-P energy: -22.119 bonds (distance) P-C4' energy: -18.548 flat angles C4'-P-C4' energy: -26.361 flat angles P-C4'-P energy: -19.974 tors. eta vs tors. theta energy: -35.093 Dist. restrs. and SS energy: 0.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 181 Temperature: 1.050000 Total energy: -345.229609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.229609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.229609 (E_RNA) where: Base-Base interactions energy: -229.975 where: short stacking energy: -100.892 Base-Backbone interact. energy: -0.249 local terms energy: -115.005623 where: bonds (distance) C4'-P energy: -19.064 bonds (distance) P-C4' energy: -25.466 flat angles C4'-P-C4' energy: -25.426 flat angles P-C4'-P energy: -15.023 tors. eta vs tors. theta energy: -30.026 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 181 Temperature: 1.100000 Total energy: -322.784982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.784982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.794174 (E_RNA) where: Base-Base interactions energy: -219.478 where: short stacking energy: -101.255 Base-Backbone interact. energy: -0.727 local terms energy: -102.589096 where: bonds (distance) C4'-P energy: -14.831 bonds (distance) P-C4' energy: -24.998 flat angles C4'-P-C4' energy: -22.003 flat angles P-C4'-P energy: -10.655 tors. eta vs tors. theta energy: -30.103 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 181 Temperature: 1.150000 Total energy: -331.712398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.712398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.712398 (E_RNA) where: Base-Base interactions energy: -213.999 where: short stacking energy: -116.003 Base-Backbone interact. energy: -0.176 local terms energy: -117.536926 where: bonds (distance) C4'-P energy: -23.466 bonds (distance) P-C4' energy: -20.891 flat angles C4'-P-C4' energy: -24.281 flat angles P-C4'-P energy: -14.933 tors. eta vs tors. theta energy: -33.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 181 Temperature: 1.200000 Total energy: -235.647123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.647123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.665110 (E_RNA) where: Base-Base interactions energy: -143.154 where: short stacking energy: -71.405 Base-Backbone interact. energy: -0.279 local terms energy: -92.232046 where: bonds (distance) C4'-P energy: -14.339 bonds (distance) P-C4' energy: -24.285 flat angles C4'-P-C4' energy: -24.397 flat angles P-C4'-P energy: -12.968 tors. eta vs tors. theta energy: -16.243 Dist. restrs. and SS energy: 0.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 181 Temperature: 1.250000 Total energy: -240.319832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.319832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.458644 (E_RNA) where: Base-Base interactions energy: -147.922 where: short stacking energy: -81.686 Base-Backbone interact. energy: -0.443 local terms energy: -92.093612 where: bonds (distance) C4'-P energy: -20.755 bonds (distance) P-C4' energy: -18.147 flat angles C4'-P-C4' energy: -18.782 flat angles P-C4'-P energy: -12.438 tors. eta vs tors. theta energy: -21.972 Dist. restrs. and SS energy: 0.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 181 Temperature: 1.300000 Total energy: -238.937367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.937367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.937367 (E_RNA) where: Base-Base interactions energy: -148.234 where: short stacking energy: -75.587 Base-Backbone interact. energy: 0.001 local terms energy: -90.704006 where: bonds (distance) C4'-P energy: -23.408 bonds (distance) P-C4' energy: -19.502 flat angles C4'-P-C4' energy: -10.990 flat angles P-C4'-P energy: -14.200 tors. eta vs tors. theta energy: -22.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 181 Temperature: 1.350000 Total energy: -163.894155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.894155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.095573 (E_RNA) where: Base-Base interactions energy: -80.732 where: short stacking energy: -43.812 Base-Backbone interact. energy: 0.107 local terms energy: -83.470309 where: bonds (distance) C4'-P energy: -21.308 bonds (distance) P-C4' energy: -21.762 flat angles C4'-P-C4' energy: -24.012 flat angles P-C4'-P energy: -8.900 tors. eta vs tors. theta energy: -7.488 Dist. restrs. and SS energy: 0.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 182 Temperature: 0.900000 Total energy: -381.819244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.819244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.871953 (E_RNA) where: Base-Base interactions energy: -246.776 where: short stacking energy: -121.578 Base-Backbone interact. energy: -0.032 local terms energy: -135.063951 where: bonds (distance) C4'-P energy: -21.926 bonds (distance) P-C4' energy: -28.551 flat angles C4'-P-C4' energy: -28.849 flat angles P-C4'-P energy: -17.630 tors. eta vs tors. theta energy: -38.108 Dist. restrs. and SS energy: 0.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 182 Temperature: 0.950000 Total energy: -361.758703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.758703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.843777 (E_RNA) where: Base-Base interactions energy: -237.907 where: short stacking energy: -115.908 Base-Backbone interact. energy: -2.236 local terms energy: -121.700911 where: bonds (distance) C4'-P energy: -24.738 bonds (distance) P-C4' energy: -21.592 flat angles C4'-P-C4' energy: -21.667 flat angles P-C4'-P energy: -20.359 tors. eta vs tors. theta energy: -33.345 Dist. restrs. and SS energy: 0.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 182 Temperature: 1.000000 Total energy: -365.206522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.206522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.206522 (E_RNA) where: Base-Base interactions energy: -239.859 where: short stacking energy: -117.581 Base-Backbone interact. energy: -0.199 local terms energy: -125.148453 where: bonds (distance) C4'-P energy: -25.491 bonds (distance) P-C4' energy: -25.537 flat angles C4'-P-C4' energy: -26.004 flat angles P-C4'-P energy: -13.657 tors. eta vs tors. theta energy: -34.459 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 182 Temperature: 1.050000 Total energy: -354.713998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.713998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.713998 (E_RNA) where: Base-Base interactions energy: -230.568 where: short stacking energy: -111.852 Base-Backbone interact. energy: -1.254 local terms energy: -122.891230 where: bonds (distance) C4'-P energy: -21.598 bonds (distance) P-C4' energy: -23.987 flat angles C4'-P-C4' energy: -26.616 flat angles P-C4'-P energy: -17.083 tors. eta vs tors. theta energy: -33.607 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 182 Temperature: 1.100000 Total energy: -353.410675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.410675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.410675 (E_RNA) where: Base-Base interactions energy: -233.637 where: short stacking energy: -113.010 Base-Backbone interact. energy: -0.076 local terms energy: -119.697785 where: bonds (distance) C4'-P energy: -18.589 bonds (distance) P-C4' energy: -20.093 flat angles C4'-P-C4' energy: -28.516 flat angles P-C4'-P energy: -17.304 tors. eta vs tors. theta energy: -35.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 182 Temperature: 1.150000 Total energy: -340.839862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.839862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.839862 (E_RNA) where: Base-Base interactions energy: -219.922 where: short stacking energy: -105.866 Base-Backbone interact. energy: -0.759 local terms energy: -120.158534 where: bonds (distance) C4'-P energy: -19.431 bonds (distance) P-C4' energy: -25.520 flat angles C4'-P-C4' energy: -24.379 flat angles P-C4'-P energy: -18.854 tors. eta vs tors. theta energy: -31.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 182 Temperature: 1.200000 Total energy: -239.598972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.598972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.604226 (E_RNA) where: Base-Base interactions energy: -138.958 where: short stacking energy: -79.396 Base-Backbone interact. energy: -0.914 local terms energy: -99.731769 where: bonds (distance) C4'-P energy: -17.248 bonds (distance) P-C4' energy: -23.272 flat angles C4'-P-C4' energy: -25.643 flat angles P-C4'-P energy: -15.024 tors. eta vs tors. theta energy: -18.544 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 182 Temperature: 1.250000 Total energy: -241.876610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.876610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.938557 (E_RNA) where: Base-Base interactions energy: -148.294 where: short stacking energy: -81.041 Base-Backbone interact. energy: -0.485 local terms energy: -93.159103 where: bonds (distance) C4'-P energy: -23.512 bonds (distance) P-C4' energy: -17.763 flat angles C4'-P-C4' energy: -17.458 flat angles P-C4'-P energy: -13.911 tors. eta vs tors. theta energy: -20.515 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 182 Temperature: 1.300000 Total energy: -238.513777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.513777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.521982 (E_RNA) where: Base-Base interactions energy: -149.904 where: short stacking energy: -81.304 Base-Backbone interact. energy: -0.094 local terms energy: -88.523954 where: bonds (distance) C4'-P energy: -17.342 bonds (distance) P-C4' energy: -14.517 flat angles C4'-P-C4' energy: -21.371 flat angles P-C4'-P energy: -13.671 tors. eta vs tors. theta energy: -21.623 Dist. restrs. and SS energy: 0.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 182 Temperature: 1.350000 Total energy: -160.147451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.147451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.147451 (E_RNA) where: Base-Base interactions energy: -83.842 where: short stacking energy: -56.959 Base-Backbone interact. energy: -0.972 local terms energy: -75.332917 where: bonds (distance) C4'-P energy: -23.381 bonds (distance) P-C4' energy: -19.634 flat angles C4'-P-C4' energy: -17.409 flat angles P-C4'-P energy: -13.482 tors. eta vs tors. theta energy: -1.427 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 183 Temperature: 0.900000 Total energy: -364.876378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.876378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.876378 (E_RNA) where: Base-Base interactions energy: -245.107 where: short stacking energy: -120.007 Base-Backbone interact. energy: -0.452 local terms energy: -119.317943 where: bonds (distance) C4'-P energy: -24.616 bonds (distance) P-C4' energy: -24.209 flat angles C4'-P-C4' energy: -25.118 flat angles P-C4'-P energy: -15.129 tors. eta vs tors. theta energy: -30.246 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 183 Temperature: 0.950000 Total energy: -380.304667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.304667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.341174 (E_RNA) where: Base-Base interactions energy: -253.173 where: short stacking energy: -124.114 Base-Backbone interact. energy: -0.631 local terms energy: -126.537300 where: bonds (distance) C4'-P energy: -20.801 bonds (distance) P-C4' energy: -27.484 flat angles C4'-P-C4' energy: -26.356 flat angles P-C4'-P energy: -18.963 tors. eta vs tors. theta energy: -32.934 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 183 Temperature: 1.000000 Total energy: -360.339125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.339125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.339125 (E_RNA) where: Base-Base interactions energy: -237.835 where: short stacking energy: -115.803 Base-Backbone interact. energy: -0.272 local terms energy: -122.232335 where: bonds (distance) C4'-P energy: -24.757 bonds (distance) P-C4' energy: -26.648 flat angles C4'-P-C4' energy: -16.543 flat angles P-C4'-P energy: -20.500 tors. eta vs tors. theta energy: -33.785 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 183 Temperature: 1.050000 Total energy: -363.558931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.558931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.558931 (E_RNA) where: Base-Base interactions energy: -247.314 where: short stacking energy: -122.839 Base-Backbone interact. energy: -0.092 local terms energy: -116.152620 where: bonds (distance) C4'-P energy: -18.395 bonds (distance) P-C4' energy: -18.877 flat angles C4'-P-C4' energy: -28.167 flat angles P-C4'-P energy: -13.998 tors. eta vs tors. theta energy: -36.716 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 183 Temperature: 1.100000 Total energy: -331.467934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.467934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.484552 (E_RNA) where: Base-Base interactions energy: -215.320 where: short stacking energy: -105.413 Base-Backbone interact. energy: -0.813 local terms energy: -115.350946 where: bonds (distance) C4'-P energy: -19.941 bonds (distance) P-C4' energy: -24.300 flat angles C4'-P-C4' energy: -22.989 flat angles P-C4'-P energy: -18.087 tors. eta vs tors. theta energy: -30.034 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 183 Temperature: 1.150000 Total energy: -304.746928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.746928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.848190 (E_RNA) where: Base-Base interactions energy: -200.019 where: short stacking energy: -99.415 Base-Backbone interact. energy: -0.398 local terms energy: -104.430896 where: bonds (distance) C4'-P energy: -21.689 bonds (distance) P-C4' energy: -22.876 flat angles C4'-P-C4' energy: -26.577 flat angles P-C4'-P energy: -5.594 tors. eta vs tors. theta energy: -27.695 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 183 Temperature: 1.200000 Total energy: -244.380322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.380322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.380322 (E_RNA) where: Base-Base interactions energy: -146.049 where: short stacking energy: -72.735 Base-Backbone interact. energy: -0.154 local terms energy: -98.176718 where: bonds (distance) C4'-P energy: -22.430 bonds (distance) P-C4' energy: -28.154 flat angles C4'-P-C4' energy: -28.162 flat angles P-C4'-P energy: -9.595 tors. eta vs tors. theta energy: -9.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 183 Temperature: 1.250000 Total energy: -249.322245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.322245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.672626 (E_RNA) where: Base-Base interactions energy: -154.467 where: short stacking energy: -89.025 Base-Backbone interact. energy: -0.218 local terms energy: -94.987332 where: bonds (distance) C4'-P energy: -26.102 bonds (distance) P-C4' energy: -21.573 flat angles C4'-P-C4' energy: -16.889 flat angles P-C4'-P energy: -13.361 tors. eta vs tors. theta energy: -17.062 Dist. restrs. and SS energy: 0.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 183 Temperature: 1.300000 Total energy: -193.134889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.134889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.218585 (E_RNA) where: Base-Base interactions energy: -114.905 where: short stacking energy: -59.668 Base-Backbone interact. energy: -0.242 local terms energy: -78.072168 where: bonds (distance) C4'-P energy: -16.880 bonds (distance) P-C4' energy: -19.937 flat angles C4'-P-C4' energy: -19.341 flat angles P-C4'-P energy: -15.012 tors. eta vs tors. theta energy: -6.902 Dist. restrs. and SS energy: 0.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 183 Temperature: 1.350000 Total energy: -170.996470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.996470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.338149 (E_RNA) where: Base-Base interactions energy: -107.608 where: short stacking energy: -48.207 Base-Backbone interact. energy: -0.994 local terms energy: -62.736792 where: bonds (distance) C4'-P energy: -14.641 bonds (distance) P-C4' energy: -17.367 flat angles C4'-P-C4' energy: -14.438 flat angles P-C4'-P energy: -11.891 tors. eta vs tors. theta energy: -4.399 Dist. restrs. and SS energy: 0.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 184 Temperature: 0.900000 Total energy: -380.695584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.695584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.695584 (E_RNA) where: Base-Base interactions energy: -248.076 where: short stacking energy: -125.321 Base-Backbone interact. energy: -0.087 local terms energy: -132.532665 where: bonds (distance) C4'-P energy: -22.821 bonds (distance) P-C4' energy: -27.717 flat angles C4'-P-C4' energy: -28.412 flat angles P-C4'-P energy: -17.238 tors. eta vs tors. theta energy: -36.345 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 184 Temperature: 0.950000 Total energy: -371.343913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.343913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.353244 (E_RNA) where: Base-Base interactions energy: -244.521 where: short stacking energy: -124.344 Base-Backbone interact. energy: -0.098 local terms energy: -126.734919 where: bonds (distance) C4'-P energy: -24.694 bonds (distance) P-C4' energy: -28.827 flat angles C4'-P-C4' energy: -24.685 flat angles P-C4'-P energy: -15.765 tors. eta vs tors. theta energy: -32.763 Dist. restrs. and SS energy: 0.009 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 184 Temperature: 1.000000 Total energy: -362.188270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.188270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.201405 (E_RNA) where: Base-Base interactions energy: -243.557 where: short stacking energy: -118.322 Base-Backbone interact. energy: -1.071 local terms energy: -117.574146 where: bonds (distance) C4'-P energy: -19.819 bonds (distance) P-C4' energy: -22.823 flat angles C4'-P-C4' energy: -24.131 flat angles P-C4'-P energy: -14.146 tors. eta vs tors. theta energy: -36.656 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 184 Temperature: 1.050000 Total energy: -374.282056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.282056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.282056 (E_RNA) where: Base-Base interactions energy: -248.649 where: short stacking energy: -117.906 Base-Backbone interact. energy: -0.318 local terms energy: -125.315894 where: bonds (distance) C4'-P energy: -26.226 bonds (distance) P-C4' energy: -22.837 flat angles C4'-P-C4' energy: -26.009 flat angles P-C4'-P energy: -14.196 tors. eta vs tors. theta energy: -36.048 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 184 Temperature: 1.100000 Total energy: -311.074324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.074324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.123182 (E_RNA) where: Base-Base interactions energy: -207.269 where: short stacking energy: -107.324 Base-Backbone interact. energy: -0.620 local terms energy: -103.234435 where: bonds (distance) C4'-P energy: -23.465 bonds (distance) P-C4' energy: -22.243 flat angles C4'-P-C4' energy: -25.158 flat angles P-C4'-P energy: -13.030 tors. eta vs tors. theta energy: -19.338 Dist. restrs. and SS energy: 0.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 184 Temperature: 1.150000 Total energy: -305.315300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.315300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.315300 (E_RNA) where: Base-Base interactions energy: -196.855 where: short stacking energy: -93.513 Base-Backbone interact. energy: -0.072 local terms energy: -108.387801 where: bonds (distance) C4'-P energy: -20.330 bonds (distance) P-C4' energy: -22.440 flat angles C4'-P-C4' energy: -22.057 flat angles P-C4'-P energy: -17.788 tors. eta vs tors. theta energy: -25.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 184 Temperature: 1.200000 Total energy: -213.463626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.463626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.463626 (E_RNA) where: Base-Base interactions energy: -125.833 where: short stacking energy: -55.054 Base-Backbone interact. energy: -0.312 local terms energy: -87.318445 where: bonds (distance) C4'-P energy: -19.426 bonds (distance) P-C4' energy: -23.133 flat angles C4'-P-C4' energy: -23.832 flat angles P-C4'-P energy: -15.881 tors. eta vs tors. theta energy: -5.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 184 Temperature: 1.250000 Total energy: -250.640954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.640954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.685962 (E_RNA) where: Base-Base interactions energy: -147.226 where: short stacking energy: -72.813 Base-Backbone interact. energy: -0.299 local terms energy: -103.161042 where: bonds (distance) C4'-P energy: -24.211 bonds (distance) P-C4' energy: -26.236 flat angles C4'-P-C4' energy: -22.961 flat angles P-C4'-P energy: -15.067 tors. eta vs tors. theta energy: -14.687 Dist. restrs. and SS energy: 0.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 184 Temperature: 1.300000 Total energy: -191.996188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.996188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.996188 (E_RNA) where: Base-Base interactions energy: -118.529 where: short stacking energy: -55.241 Base-Backbone interact. energy: 5.633 local terms energy: -79.100378 where: bonds (distance) C4'-P energy: -25.054 bonds (distance) P-C4' energy: -20.226 flat angles C4'-P-C4' energy: -19.153 flat angles P-C4'-P energy: -10.819 tors. eta vs tors. theta energy: -3.848 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 184 Temperature: 1.350000 Total energy: -152.623716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.623716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.813135 (E_RNA) where: Base-Base interactions energy: -71.266 where: short stacking energy: -49.814 Base-Backbone interact. energy: -0.548 local terms energy: -80.998557 where: bonds (distance) C4'-P energy: -21.687 bonds (distance) P-C4' energy: -24.262 flat angles C4'-P-C4' energy: -21.779 flat angles P-C4'-P energy: -9.344 tors. eta vs tors. theta energy: -3.926 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 185 Temperature: 0.900000 Total energy: -377.156454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.156454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.193453 (E_RNA) where: Base-Base interactions energy: -246.359 where: short stacking energy: -130.619 Base-Backbone interact. energy: -1.329 local terms energy: -129.505148 where: bonds (distance) C4'-P energy: -24.240 bonds (distance) P-C4' energy: -26.339 flat angles C4'-P-C4' energy: -25.678 flat angles P-C4'-P energy: -17.049 tors. eta vs tors. theta energy: -36.199 Dist. restrs. and SS energy: 0.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 185 Temperature: 0.950000 Total energy: -375.781756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.781756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.786862 (E_RNA) where: Base-Base interactions energy: -248.504 where: short stacking energy: -126.727 Base-Backbone interact. energy: -1.492 local terms energy: -125.790451 where: bonds (distance) C4'-P energy: -16.767 bonds (distance) P-C4' energy: -25.496 flat angles C4'-P-C4' energy: -26.892 flat angles P-C4'-P energy: -18.153 tors. eta vs tors. theta energy: -38.482 Dist. restrs. and SS energy: 0.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 185 Temperature: 1.000000 Total energy: -363.797275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.797275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.811497 (E_RNA) where: Base-Base interactions energy: -238.096 where: short stacking energy: -124.810 Base-Backbone interact. energy: -0.367 local terms energy: -125.348448 where: bonds (distance) C4'-P energy: -23.739 bonds (distance) P-C4' energy: -27.807 flat angles C4'-P-C4' energy: -22.773 flat angles P-C4'-P energy: -16.151 tors. eta vs tors. theta energy: -34.879 Dist. restrs. and SS energy: 0.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 185 Temperature: 1.050000 Total energy: -353.169064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.169064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.169064 (E_RNA) where: Base-Base interactions energy: -238.127 where: short stacking energy: -113.889 Base-Backbone interact. energy: -1.159 local terms energy: -113.883475 where: bonds (distance) C4'-P energy: -22.103 bonds (distance) P-C4' energy: -20.978 flat angles C4'-P-C4' energy: -19.083 flat angles P-C4'-P energy: -19.375 tors. eta vs tors. theta energy: -32.345 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 185 Temperature: 1.100000 Total energy: -337.104621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.104621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.125286 (E_RNA) where: Base-Base interactions energy: -217.294 where: short stacking energy: -105.578 Base-Backbone interact. energy: -0.795 local terms energy: -119.037101 where: bonds (distance) C4'-P energy: -20.678 bonds (distance) P-C4' energy: -22.253 flat angles C4'-P-C4' energy: -21.710 flat angles P-C4'-P energy: -20.798 tors. eta vs tors. theta energy: -33.598 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 185 Temperature: 1.150000 Total energy: -310.024401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.024401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.030575 (E_RNA) where: Base-Base interactions energy: -202.592 where: short stacking energy: -96.239 Base-Backbone interact. energy: -0.111 local terms energy: -107.327597 where: bonds (distance) C4'-P energy: -18.269 bonds (distance) P-C4' energy: -20.797 flat angles C4'-P-C4' energy: -23.506 flat angles P-C4'-P energy: -18.431 tors. eta vs tors. theta energy: -26.325 Dist. restrs. and SS energy: 0.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 185 Temperature: 1.200000 Total energy: -237.693753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.693753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.693753 (E_RNA) where: Base-Base interactions energy: -143.309 where: short stacking energy: -79.375 Base-Backbone interact. energy: -0.120 local terms energy: -94.265052 where: bonds (distance) C4'-P energy: -19.401 bonds (distance) P-C4' energy: -25.533 flat angles C4'-P-C4' energy: -20.980 flat angles P-C4'-P energy: -13.493 tors. eta vs tors. theta energy: -14.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 185 Temperature: 1.250000 Total energy: -253.808496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.808496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.808496 (E_RNA) where: Base-Base interactions energy: -159.136 where: short stacking energy: -72.692 Base-Backbone interact. energy: -0.327 local terms energy: -94.345739 where: bonds (distance) C4'-P energy: -19.076 bonds (distance) P-C4' energy: -20.457 flat angles C4'-P-C4' energy: -21.519 flat angles P-C4'-P energy: -15.158 tors. eta vs tors. theta energy: -18.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 185 Temperature: 1.300000 Total energy: -166.511784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.511784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.513965 (E_RNA) where: Base-Base interactions energy: -92.535 where: short stacking energy: -56.223 Base-Backbone interact. energy: 0.330 local terms energy: -74.308558 where: bonds (distance) C4'-P energy: -20.846 bonds (distance) P-C4' energy: -22.087 flat angles C4'-P-C4' energy: -12.466 flat angles P-C4'-P energy: -14.900 tors. eta vs tors. theta energy: -4.009 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 185 Temperature: 1.350000 Total energy: -154.192386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.192386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.203348 (E_RNA) where: Base-Base interactions energy: -85.139 where: short stacking energy: -46.520 Base-Backbone interact. energy: -0.090 local terms energy: -68.974495 where: bonds (distance) C4'-P energy: -13.417 bonds (distance) P-C4' energy: -20.190 flat angles C4'-P-C4' energy: -20.785 flat angles P-C4'-P energy: -12.104 tors. eta vs tors. theta energy: -2.478 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 186 Temperature: 0.900000 Total energy: -377.452253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.452253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.452253 (E_RNA) where: Base-Base interactions energy: -251.278 where: short stacking energy: -120.867 Base-Backbone interact. energy: -0.638 local terms energy: -125.536741 where: bonds (distance) C4'-P energy: -23.184 bonds (distance) P-C4' energy: -23.347 flat angles C4'-P-C4' energy: -28.795 flat angles P-C4'-P energy: -17.588 tors. eta vs tors. theta energy: -32.622 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 186 Temperature: 0.950000 Total energy: -376.110521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.110521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.123945 (E_RNA) where: Base-Base interactions energy: -247.594 where: short stacking energy: -120.797 Base-Backbone interact. energy: -0.434 local terms energy: -128.095543 where: bonds (distance) C4'-P energy: -18.667 bonds (distance) P-C4' energy: -24.042 flat angles C4'-P-C4' energy: -30.450 flat angles P-C4'-P energy: -19.922 tors. eta vs tors. theta energy: -35.015 Dist. restrs. and SS energy: 0.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 186 Temperature: 1.000000 Total energy: -361.695194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.695194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.695194 (E_RNA) where: Base-Base interactions energy: -233.227 where: short stacking energy: -117.052 Base-Backbone interact. energy: -0.457 local terms energy: -128.010876 where: bonds (distance) C4'-P energy: -25.787 bonds (distance) P-C4' energy: -23.976 flat angles C4'-P-C4' energy: -28.231 flat angles P-C4'-P energy: -16.526 tors. eta vs tors. theta energy: -33.491 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 186 Temperature: 1.050000 Total energy: -354.952197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.952197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.952197 (E_RNA) where: Base-Base interactions energy: -242.415 where: short stacking energy: -109.732 Base-Backbone interact. energy: -0.331 local terms energy: -112.206005 where: bonds (distance) C4'-P energy: -22.307 bonds (distance) P-C4' energy: -25.067 flat angles C4'-P-C4' energy: -19.448 flat angles P-C4'-P energy: -11.912 tors. eta vs tors. theta energy: -33.472 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 186 Temperature: 1.100000 Total energy: -298.043139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.043139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.075178 (E_RNA) where: Base-Base interactions energy: -183.968 where: short stacking energy: -96.245 Base-Backbone interact. energy: 0.779 local terms energy: -114.886592 where: bonds (distance) C4'-P energy: -21.465 bonds (distance) P-C4' energy: -24.217 flat angles C4'-P-C4' energy: -24.649 flat angles P-C4'-P energy: -16.259 tors. eta vs tors. theta energy: -28.297 Dist. restrs. and SS energy: 0.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 186 Temperature: 1.150000 Total energy: -272.719742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.719742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.720174 (E_RNA) where: Base-Base interactions energy: -165.900 where: short stacking energy: -84.739 Base-Backbone interact. energy: -0.123 local terms energy: -106.697628 where: bonds (distance) C4'-P energy: -21.214 bonds (distance) P-C4' energy: -18.885 flat angles C4'-P-C4' energy: -24.366 flat angles P-C4'-P energy: -14.176 tors. eta vs tors. theta energy: -28.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 186 Temperature: 1.200000 Total energy: -270.193788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.193788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.193788 (E_RNA) where: Base-Base interactions energy: -163.397 where: short stacking energy: -83.892 Base-Backbone interact. energy: -0.417 local terms energy: -106.380093 where: bonds (distance) C4'-P energy: -19.756 bonds (distance) P-C4' energy: -18.839 flat angles C4'-P-C4' energy: -26.725 flat angles P-C4'-P energy: -15.628 tors. eta vs tors. theta energy: -25.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 186 Temperature: 1.250000 Total energy: -249.285467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.285467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.318705 (E_RNA) where: Base-Base interactions energy: -156.897 where: short stacking energy: -75.553 Base-Backbone interact. energy: 0.045 local terms energy: -92.466882 where: bonds (distance) C4'-P energy: -16.933 bonds (distance) P-C4' energy: -22.245 flat angles C4'-P-C4' energy: -15.969 flat angles P-C4'-P energy: -17.539 tors. eta vs tors. theta energy: -19.781 Dist. restrs. and SS energy: 0.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 186 Temperature: 1.300000 Total energy: -179.522385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.522385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.522385 (E_RNA) where: Base-Base interactions energy: -100.807 where: short stacking energy: -73.578 Base-Backbone interact. energy: 0.032 local terms energy: -78.747270 where: bonds (distance) C4'-P energy: -16.449 bonds (distance) P-C4' energy: -13.134 flat angles C4'-P-C4' energy: -20.974 flat angles P-C4'-P energy: -13.943 tors. eta vs tors. theta energy: -14.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 186 Temperature: 1.350000 Total energy: -156.035820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.035820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.035820 (E_RNA) where: Base-Base interactions energy: -84.671 where: short stacking energy: -46.757 Base-Backbone interact. energy: -0.539 local terms energy: -70.825064 where: bonds (distance) C4'-P energy: -21.440 bonds (distance) P-C4' energy: -24.626 flat angles C4'-P-C4' energy: -17.140 flat angles P-C4'-P energy: -7.293 tors. eta vs tors. theta energy: -0.326 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 187 Temperature: 0.900000 Total energy: -385.330687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.330687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.348139 (E_RNA) where: Base-Base interactions energy: -246.156 where: short stacking energy: -123.991 Base-Backbone interact. energy: -0.069 local terms energy: -139.122408 where: bonds (distance) C4'-P energy: -26.825 bonds (distance) P-C4' energy: -28.921 flat angles C4'-P-C4' energy: -30.244 flat angles P-C4'-P energy: -16.779 tors. eta vs tors. theta energy: -36.354 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 187 Temperature: 0.950000 Total energy: -364.141709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.141709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.141709 (E_RNA) where: Base-Base interactions energy: -243.930 where: short stacking energy: -120.033 Base-Backbone interact. energy: -0.174 local terms energy: -120.037412 where: bonds (distance) C4'-P energy: -18.175 bonds (distance) P-C4' energy: -25.371 flat angles C4'-P-C4' energy: -26.267 flat angles P-C4'-P energy: -16.767 tors. eta vs tors. theta energy: -33.458 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 187 Temperature: 1.000000 Total energy: -356.944806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.944806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.944806 (E_RNA) where: Base-Base interactions energy: -249.559 where: short stacking energy: -126.758 Base-Backbone interact. energy: -0.703 local terms energy: -106.682679 where: bonds (distance) C4'-P energy: -22.721 bonds (distance) P-C4' energy: -14.379 flat angles C4'-P-C4' energy: -20.965 flat angles P-C4'-P energy: -13.986 tors. eta vs tors. theta energy: -34.632 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 187 Temperature: 1.050000 Total energy: -354.026296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.026296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.026296 (E_RNA) where: Base-Base interactions energy: -223.975 where: short stacking energy: -117.352 Base-Backbone interact. energy: -0.470 local terms energy: -129.581644 where: bonds (distance) C4'-P energy: -19.834 bonds (distance) P-C4' energy: -25.691 flat angles C4'-P-C4' energy: -24.368 flat angles P-C4'-P energy: -21.521 tors. eta vs tors. theta energy: -38.169 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 187 Temperature: 1.100000 Total energy: -318.438559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.438559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.653853 (E_RNA) where: Base-Base interactions energy: -203.358 where: short stacking energy: -106.654 Base-Backbone interact. energy: -0.599 local terms energy: -114.696972 where: bonds (distance) C4'-P energy: -20.178 bonds (distance) P-C4' energy: -22.585 flat angles C4'-P-C4' energy: -24.371 flat angles P-C4'-P energy: -16.817 tors. eta vs tors. theta energy: -30.748 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 187 Temperature: 1.150000 Total energy: -301.948245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.948245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.949920 (E_RNA) where: Base-Base interactions energy: -193.560 where: short stacking energy: -97.447 Base-Backbone interact. energy: -0.730 local terms energy: -107.659858 where: bonds (distance) C4'-P energy: -16.064 bonds (distance) P-C4' energy: -27.773 flat angles C4'-P-C4' energy: -23.475 flat angles P-C4'-P energy: -14.259 tors. eta vs tors. theta energy: -26.089 Dist. restrs. and SS energy: 0.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 187 Temperature: 1.200000 Total energy: -261.118840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.118840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.450305 (E_RNA) where: Base-Base interactions energy: -162.133 where: short stacking energy: -91.557 Base-Backbone interact. energy: -1.098 local terms energy: -98.220083 where: bonds (distance) C4'-P energy: -17.076 bonds (distance) P-C4' energy: -16.802 flat angles C4'-P-C4' energy: -25.472 flat angles P-C4'-P energy: -15.351 tors. eta vs tors. theta energy: -23.519 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 187 Temperature: 1.250000 Total energy: -242.112843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.112843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.434365 (E_RNA) where: Base-Base interactions energy: -143.079 where: short stacking energy: -83.962 Base-Backbone interact. energy: 1.812 local terms energy: -101.167318 where: bonds (distance) C4'-P energy: -21.105 bonds (distance) P-C4' energy: -21.923 flat angles C4'-P-C4' energy: -16.080 flat angles P-C4'-P energy: -18.145 tors. eta vs tors. theta energy: -23.914 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 187 Temperature: 1.300000 Total energy: -231.715394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.715394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.715394 (E_RNA) where: Base-Base interactions energy: -129.488 where: short stacking energy: -74.530 Base-Backbone interact. energy: -0.287 local terms energy: -101.940209 where: bonds (distance) C4'-P energy: -14.328 bonds (distance) P-C4' energy: -27.713 flat angles C4'-P-C4' energy: -26.582 flat angles P-C4'-P energy: -13.450 tors. eta vs tors. theta energy: -19.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 187 Temperature: 1.350000 Total energy: -172.268846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.268846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.279429 (E_RNA) where: Base-Base interactions energy: -100.098 where: short stacking energy: -52.222 Base-Backbone interact. energy: -0.117 local terms energy: -72.064740 where: bonds (distance) C4'-P energy: -16.035 bonds (distance) P-C4' energy: -17.870 flat angles C4'-P-C4' energy: -16.801 flat angles P-C4'-P energy: -14.681 tors. eta vs tors. theta energy: -6.678 Dist. restrs. and SS energy: 0.011 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 188 Temperature: 0.900000 Total energy: -380.821585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.821585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.842618 (E_RNA) where: Base-Base interactions energy: -253.242 where: short stacking energy: -121.443 Base-Backbone interact. energy: 1.576 local terms energy: -129.176523 where: bonds (distance) C4'-P energy: -26.162 bonds (distance) P-C4' energy: -22.099 flat angles C4'-P-C4' energy: -20.249 flat angles P-C4'-P energy: -23.594 tors. eta vs tors. theta energy: -37.073 Dist. restrs. and SS energy: 0.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 188 Temperature: 0.950000 Total energy: -368.506584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.506584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.523985 (E_RNA) where: Base-Base interactions energy: -248.995 where: short stacking energy: -126.370 Base-Backbone interact. energy: 0.033 local terms energy: -119.561952 where: bonds (distance) C4'-P energy: -23.922 bonds (distance) P-C4' energy: -19.224 flat angles C4'-P-C4' energy: -23.513 flat angles P-C4'-P energy: -16.711 tors. eta vs tors. theta energy: -36.192 Dist. restrs. and SS energy: 0.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 188 Temperature: 1.000000 Total energy: -364.220802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.220802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.220802 (E_RNA) where: Base-Base interactions energy: -242.186 where: short stacking energy: -120.409 Base-Backbone interact. energy: -0.806 local terms energy: -121.228812 where: bonds (distance) C4'-P energy: -17.653 bonds (distance) P-C4' energy: -27.113 flat angles C4'-P-C4' energy: -23.271 flat angles P-C4'-P energy: -13.145 tors. eta vs tors. theta energy: -40.048 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 188 Temperature: 1.050000 Total energy: -364.744085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.744085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.744085 (E_RNA) where: Base-Base interactions energy: -245.373 where: short stacking energy: -123.322 Base-Backbone interact. energy: -0.004 local terms energy: -119.367294 where: bonds (distance) C4'-P energy: -21.469 bonds (distance) P-C4' energy: -20.645 flat angles C4'-P-C4' energy: -24.458 flat angles P-C4'-P energy: -16.265 tors. eta vs tors. theta energy: -36.531 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 188 Temperature: 1.100000 Total energy: -326.652432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.652432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.913008 (E_RNA) where: Base-Base interactions energy: -211.175 where: short stacking energy: -114.029 Base-Backbone interact. energy: -0.305 local terms energy: -115.433094 where: bonds (distance) C4'-P energy: -22.104 bonds (distance) P-C4' energy: -20.650 flat angles C4'-P-C4' energy: -23.162 flat angles P-C4'-P energy: -16.641 tors. eta vs tors. theta energy: -32.875 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 188 Temperature: 1.150000 Total energy: -281.246306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.246306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.246306 (E_RNA) where: Base-Base interactions energy: -176.444 where: short stacking energy: -83.083 Base-Backbone interact. energy: -0.022 local terms energy: -104.779925 where: bonds (distance) C4'-P energy: -23.760 bonds (distance) P-C4' energy: -23.965 flat angles C4'-P-C4' energy: -16.340 flat angles P-C4'-P energy: -20.793 tors. eta vs tors. theta energy: -19.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 188 Temperature: 1.200000 Total energy: -281.448866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.448866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.448866 (E_RNA) where: Base-Base interactions energy: -178.601 where: short stacking energy: -80.209 Base-Backbone interact. energy: -0.203 local terms energy: -102.644187 where: bonds (distance) C4'-P energy: -20.187 bonds (distance) P-C4' energy: -23.998 flat angles C4'-P-C4' energy: -20.759 flat angles P-C4'-P energy: -16.381 tors. eta vs tors. theta energy: -21.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 188 Temperature: 1.250000 Total energy: -221.432005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.432005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.432005 (E_RNA) where: Base-Base interactions energy: -133.081 where: short stacking energy: -73.524 Base-Backbone interact. energy: -0.321 local terms energy: -88.030050 where: bonds (distance) C4'-P energy: -12.074 bonds (distance) P-C4' energy: -26.440 flat angles C4'-P-C4' energy: -19.712 flat angles P-C4'-P energy: -13.236 tors. eta vs tors. theta energy: -16.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 188 Temperature: 1.300000 Total energy: -171.033956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.033956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.389436 (E_RNA) where: Base-Base interactions energy: -87.602 where: short stacking energy: -43.973 Base-Backbone interact. energy: -0.665 local terms energy: -83.122073 where: bonds (distance) C4'-P energy: -22.042 bonds (distance) P-C4' energy: -19.976 flat angles C4'-P-C4' energy: -20.406 flat angles P-C4'-P energy: -14.248 tors. eta vs tors. theta energy: -6.450 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 188 Temperature: 1.350000 Total energy: -177.697153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.697153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.697153 (E_RNA) where: Base-Base interactions energy: -103.974 where: short stacking energy: -49.771 Base-Backbone interact. energy: -0.240 local terms energy: -73.483585 where: bonds (distance) C4'-P energy: -20.456 bonds (distance) P-C4' energy: -16.509 flat angles C4'-P-C4' energy: -21.201 flat angles P-C4'-P energy: -14.451 tors. eta vs tors. theta energy: -0.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)