SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/Apt_6_t-9e2689dc/inputs/seq.fa: 1 curr_seq: _GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGGCUAGCCCAGAGGGCACUCGCCCGCGGCGAGGUCGGGGGCGCCCCGCCCCACA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 56 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 285 n_atoms_counter: 285 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 56.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -227.964569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.964569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.964569 (E_RNA) where: Base-Base interactions energy: -9.679 where: short stacking energy: -9.679 Base-Backbone interact. energy: -0.000 local terms energy: -218.285771 where: bonds (distance) C4'-P energy: -54.408 bonds (distance) P-C4' energy: -50.995 flat angles C4'-P-C4' energy: -41.117 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -24.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -338.421618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.421618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.421618 (E_RNA) where: Base-Base interactions energy: -160.108 where: short stacking energy: -160.108 Base-Backbone interact. energy: -0.114 local terms energy: -178.199749 where: bonds (distance) C4'-P energy: -34.778 bonds (distance) P-C4' energy: -37.853 flat angles C4'-P-C4' energy: -37.481 flat angles P-C4'-P energy: -29.838 tors. eta vs tors. theta energy: -38.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -317.614273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.614273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.614273 (E_RNA) where: Base-Base interactions energy: -140.621 where: short stacking energy: -140.621 Base-Backbone interact. energy: -0.701 local terms energy: -176.292222 where: bonds (distance) C4'-P energy: -32.657 bonds (distance) P-C4' energy: -42.263 flat angles C4'-P-C4' energy: -45.833 flat angles P-C4'-P energy: -22.463 tors. eta vs tors. theta energy: -33.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -309.382648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.382648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.382648 (E_RNA) where: Base-Base interactions energy: -150.928 where: short stacking energy: -148.862 Base-Backbone interact. energy: -1.312 local terms energy: -157.142492 where: bonds (distance) C4'-P energy: -28.327 bonds (distance) P-C4' energy: -41.410 flat angles C4'-P-C4' energy: -31.454 flat angles P-C4'-P energy: -26.184 tors. eta vs tors. theta energy: -29.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -309.452025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.452025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.452025 (E_RNA) where: Base-Base interactions energy: -158.580 where: short stacking energy: -139.842 Base-Backbone interact. energy: -0.315 local terms energy: -150.557074 where: bonds (distance) C4'-P energy: -39.167 bonds (distance) P-C4' energy: -32.503 flat angles C4'-P-C4' energy: -34.706 flat angles P-C4'-P energy: -17.457 tors. eta vs tors. theta energy: -26.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -276.633979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.633979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.633979 (E_RNA) where: Base-Base interactions energy: -125.202 where: short stacking energy: -123.284 Base-Backbone interact. energy: -0.092 local terms energy: -151.340148 where: bonds (distance) C4'-P energy: -30.122 bonds (distance) P-C4' energy: -37.315 flat angles C4'-P-C4' energy: -35.885 flat angles P-C4'-P energy: -15.672 tors. eta vs tors. theta energy: -32.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -302.070293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.070293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.070293 (E_RNA) where: Base-Base interactions energy: -176.816 where: short stacking energy: -100.831 Base-Backbone interact. energy: -0.300 local terms energy: -124.954603 where: bonds (distance) C4'-P energy: -31.292 bonds (distance) P-C4' energy: -33.239 flat angles C4'-P-C4' energy: -22.626 flat angles P-C4'-P energy: -24.084 tors. eta vs tors. theta energy: -13.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -227.147873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.147873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.147873 (E_RNA) where: Base-Base interactions energy: -9.737 where: short stacking energy: -9.737 Base-Backbone interact. energy: -0.000 local terms energy: -217.411148 where: bonds (distance) C4'-P energy: -54.292 bonds (distance) P-C4' energy: -50.988 flat angles C4'-P-C4' energy: -40.532 flat angles P-C4'-P energy: -46.959 tors. eta vs tors. theta energy: -24.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -242.415864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.415864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.415864 (E_RNA) where: Base-Base interactions energy: -108.923 where: short stacking energy: -78.347 Base-Backbone interact. energy: -0.044 local terms energy: -133.448162 where: bonds (distance) C4'-P energy: -29.093 bonds (distance) P-C4' energy: -32.685 flat angles C4'-P-C4' energy: -36.203 flat angles P-C4'-P energy: -23.924 tors. eta vs tors. theta energy: -11.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -228.278423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.278423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.278423 (E_RNA) where: Base-Base interactions energy: -10.830 where: short stacking energy: -10.830 Base-Backbone interact. energy: -0.000 local terms energy: -217.448390 where: bonds (distance) C4'-P energy: -54.292 bonds (distance) P-C4' energy: -50.988 flat angles C4'-P-C4' energy: -40.532 flat angles P-C4'-P energy: -46.996 tors. eta vs tors. theta energy: -24.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -228.278097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.278097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.278097 (E_RNA) where: Base-Base interactions energy: -10.830 where: short stacking energy: -10.830 Base-Backbone interact. energy: -0.000 local terms energy: -217.448390 where: bonds (distance) C4'-P energy: -54.292 bonds (distance) P-C4' energy: -50.988 flat angles C4'-P-C4' energy: -40.532 flat angles P-C4'-P energy: -46.996 tors. eta vs tors. theta energy: -24.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -405.994763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.994763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.994763 (E_RNA) where: Base-Base interactions energy: -241.715 where: short stacking energy: -162.072 Base-Backbone interact. energy: -0.617 local terms energy: -163.663341 where: bonds (distance) C4'-P energy: -32.523 bonds (distance) P-C4' energy: -35.159 flat angles C4'-P-C4' energy: -35.724 flat angles P-C4'-P energy: -22.023 tors. eta vs tors. theta energy: -38.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -371.571894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.571894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.571894 (E_RNA) where: Base-Base interactions energy: -186.894 where: short stacking energy: -160.062 Base-Backbone interact. energy: -0.224 local terms energy: -184.453717 where: bonds (distance) C4'-P energy: -38.833 bonds (distance) P-C4' energy: -39.460 flat angles C4'-P-C4' energy: -37.644 flat angles P-C4'-P energy: -29.849 tors. eta vs tors. theta energy: -38.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -334.902045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.902045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.902045 (E_RNA) where: Base-Base interactions energy: -165.121 where: short stacking energy: -105.208 Base-Backbone interact. energy: -1.481 local terms energy: -168.300486 where: bonds (distance) C4'-P energy: -33.773 bonds (distance) P-C4' energy: -39.732 flat angles C4'-P-C4' energy: -41.087 flat angles P-C4'-P energy: -23.664 tors. eta vs tors. theta energy: -30.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -332.121839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.121839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.121839 (E_RNA) where: Base-Base interactions energy: -189.200 where: short stacking energy: -112.166 Base-Backbone interact. energy: -1.263 local terms energy: -141.658199 where: bonds (distance) C4'-P energy: -35.416 bonds (distance) P-C4' energy: -36.881 flat angles C4'-P-C4' energy: -28.590 flat angles P-C4'-P energy: -25.679 tors. eta vs tors. theta energy: -15.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -329.403120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.403120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.403120 (E_RNA) where: Base-Base interactions energy: -184.565 where: short stacking energy: -118.300 Base-Backbone interact. energy: -1.021 local terms energy: -143.816864 where: bonds (distance) C4'-P energy: -29.122 bonds (distance) P-C4' energy: -38.794 flat angles C4'-P-C4' energy: -33.131 flat angles P-C4'-P energy: -21.559 tors. eta vs tors. theta energy: -21.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -329.666762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.666762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.666762 (E_RNA) where: Base-Base interactions energy: -192.232 where: short stacking energy: -104.222 Base-Backbone interact. energy: -1.673 local terms energy: -135.761711 where: bonds (distance) C4'-P energy: -34.898 bonds (distance) P-C4' energy: -36.172 flat angles C4'-P-C4' energy: -24.796 flat angles P-C4'-P energy: -20.026 tors. eta vs tors. theta energy: -19.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -371.490019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.490019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.490019 (E_RNA) where: Base-Base interactions energy: -236.535 where: short stacking energy: -118.676 Base-Backbone interact. energy: -0.436 local terms energy: -134.519833 where: bonds (distance) C4'-P energy: -32.209 bonds (distance) P-C4' energy: -27.242 flat angles C4'-P-C4' energy: -38.072 flat angles P-C4'-P energy: -16.035 tors. eta vs tors. theta energy: -20.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -299.432932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.432932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.432932 (E_RNA) where: Base-Base interactions energy: -176.617 where: short stacking energy: -100.156 Base-Backbone interact. energy: -1.061 local terms energy: -121.754620 where: bonds (distance) C4'-P energy: -27.843 bonds (distance) P-C4' energy: -36.851 flat angles C4'-P-C4' energy: -24.981 flat angles P-C4'-P energy: -13.785 tors. eta vs tors. theta energy: -18.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -285.428186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.428186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.428186 (E_RNA) where: Base-Base interactions energy: -173.214 where: short stacking energy: -105.295 Base-Backbone interact. energy: 2.020 local terms energy: -114.233943 where: bonds (distance) C4'-P energy: -32.592 bonds (distance) P-C4' energy: -27.327 flat angles C4'-P-C4' energy: -30.075 flat angles P-C4'-P energy: -11.883 tors. eta vs tors. theta energy: -12.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -204.479378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -204.479378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -204.479378 (E_RNA) where: Base-Base interactions energy: -87.742 where: short stacking energy: -50.395 Base-Backbone interact. energy: 1.014 local terms energy: -117.751608 where: bonds (distance) C4'-P energy: -31.509 bonds (distance) P-C4' energy: -33.238 flat angles C4'-P-C4' energy: -30.878 flat angles P-C4'-P energy: -18.296 tors. eta vs tors. theta energy: -3.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -441.604158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.604158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.604158 (E_RNA) where: Base-Base interactions energy: -260.882 where: short stacking energy: -161.193 Base-Backbone interact. energy: -1.411 local terms energy: -179.312084 where: bonds (distance) C4'-P energy: -37.896 bonds (distance) P-C4' energy: -42.349 flat angles C4'-P-C4' energy: -36.930 flat angles P-C4'-P energy: -20.993 tors. eta vs tors. theta energy: -41.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -353.065396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.065396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.065396 (E_RNA) where: Base-Base interactions energy: -178.902 where: short stacking energy: -149.770 Base-Backbone interact. energy: -0.341 local terms energy: -173.821897 where: bonds (distance) C4'-P energy: -40.156 bonds (distance) P-C4' energy: -34.717 flat angles C4'-P-C4' energy: -37.519 flat angles P-C4'-P energy: -26.515 tors. eta vs tors. theta energy: -34.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -361.072300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.072300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.072300 (E_RNA) where: Base-Base interactions energy: -208.205 where: short stacking energy: -132.232 Base-Backbone interact. energy: 1.569 local terms energy: -154.435980 where: bonds (distance) C4'-P energy: -33.600 bonds (distance) P-C4' energy: -36.232 flat angles C4'-P-C4' energy: -38.351 flat angles P-C4'-P energy: -23.014 tors. eta vs tors. theta energy: -23.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -346.823185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.823185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.823185 (E_RNA) where: Base-Base interactions energy: -191.416 where: short stacking energy: -91.784 Base-Backbone interact. energy: -0.831 local terms energy: -154.576623 where: bonds (distance) C4'-P energy: -34.633 bonds (distance) P-C4' energy: -37.445 flat angles C4'-P-C4' energy: -37.400 flat angles P-C4'-P energy: -24.447 tors. eta vs tors. theta energy: -20.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -406.678099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.678099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.678099 (E_RNA) where: Base-Base interactions energy: -259.623 where: short stacking energy: -132.607 Base-Backbone interact. energy: -0.948 local terms energy: -146.107669 where: bonds (distance) C4'-P energy: -34.389 bonds (distance) P-C4' energy: -34.525 flat angles C4'-P-C4' energy: -28.717 flat angles P-C4'-P energy: -19.820 tors. eta vs tors. theta energy: -28.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -329.718157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.718157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.718157 (E_RNA) where: Base-Base interactions energy: -212.834 where: short stacking energy: -99.289 Base-Backbone interact. energy: -0.582 local terms energy: -116.302342 where: bonds (distance) C4'-P energy: -19.415 bonds (distance) P-C4' energy: -34.366 flat angles C4'-P-C4' energy: -26.464 flat angles P-C4'-P energy: -15.148 tors. eta vs tors. theta energy: -20.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -379.450530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.450530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.450530 (E_RNA) where: Base-Base interactions energy: -235.150 where: short stacking energy: -113.145 Base-Backbone interact. energy: -0.818 local terms energy: -143.482632 where: bonds (distance) C4'-P energy: -30.697 bonds (distance) P-C4' energy: -24.783 flat angles C4'-P-C4' energy: -36.933 flat angles P-C4'-P energy: -29.182 tors. eta vs tors. theta energy: -21.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -295.042006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.042006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.042006 (E_RNA) where: Base-Base interactions energy: -160.726 where: short stacking energy: -96.224 Base-Backbone interact. energy: 0.174 local terms energy: -134.490263 where: bonds (distance) C4'-P energy: -25.335 bonds (distance) P-C4' energy: -34.061 flat angles C4'-P-C4' energy: -32.169 flat angles P-C4'-P energy: -23.141 tors. eta vs tors. theta energy: -19.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -272.609562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.609562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.609562 (E_RNA) where: Base-Base interactions energy: -146.425 where: short stacking energy: -85.019 Base-Backbone interact. energy: 0.645 local terms energy: -126.829513 where: bonds (distance) C4'-P energy: -31.124 bonds (distance) P-C4' energy: -31.495 flat angles C4'-P-C4' energy: -27.023 flat angles P-C4'-P energy: -20.346 tors. eta vs tors. theta energy: -16.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -280.614887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.614887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.614887 (E_RNA) where: Base-Base interactions energy: -174.531 where: short stacking energy: -76.797 Base-Backbone interact. energy: -1.015 local terms energy: -105.069801 where: bonds (distance) C4'-P energy: -28.228 bonds (distance) P-C4' energy: -31.490 flat angles C4'-P-C4' energy: -22.294 flat angles P-C4'-P energy: -20.382 tors. eta vs tors. theta energy: -2.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -507.725497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.725497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.725497 (E_RNA) where: Base-Base interactions energy: -335.024 where: short stacking energy: -184.759 Base-Backbone interact. energy: -0.660 local terms energy: -172.041565 where: bonds (distance) C4'-P energy: -34.050 bonds (distance) P-C4' energy: -32.883 flat angles C4'-P-C4' energy: -39.813 flat angles P-C4'-P energy: -23.426 tors. eta vs tors. theta energy: -41.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -398.358433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.358433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.358433 (E_RNA) where: Base-Base interactions energy: -238.902 where: short stacking energy: -137.739 Base-Backbone interact. energy: -0.962 local terms energy: -158.494968 where: bonds (distance) C4'-P energy: -35.674 bonds (distance) P-C4' energy: -34.824 flat angles C4'-P-C4' energy: -37.254 flat angles P-C4'-P energy: -28.928 tors. eta vs tors. theta energy: -21.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -335.225505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.225505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.225505 (E_RNA) where: Base-Base interactions energy: -174.034 where: short stacking energy: -141.811 Base-Backbone interact. energy: -0.072 local terms energy: -161.119115 where: bonds (distance) C4'-P energy: -34.968 bonds (distance) P-C4' energy: -39.293 flat angles C4'-P-C4' energy: -33.636 flat angles P-C4'-P energy: -23.871 tors. eta vs tors. theta energy: -29.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -454.788885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.788885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.788885 (E_RNA) where: Base-Base interactions energy: -306.167 where: short stacking energy: -146.929 Base-Backbone interact. energy: 0.026 local terms energy: -148.648116 where: bonds (distance) C4'-P energy: -34.193 bonds (distance) P-C4' energy: -36.407 flat angles C4'-P-C4' energy: -28.497 flat angles P-C4'-P energy: -21.814 tors. eta vs tors. theta energy: -27.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -357.374646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.374646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.374646 (E_RNA) where: Base-Base interactions energy: -211.341 where: short stacking energy: -101.202 Base-Backbone interact. energy: -0.675 local terms energy: -145.358121 where: bonds (distance) C4'-P energy: -38.951 bonds (distance) P-C4' energy: -36.842 flat angles C4'-P-C4' energy: -33.251 flat angles P-C4'-P energy: -21.521 tors. eta vs tors. theta energy: -14.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -426.349762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.349762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.349762 (E_RNA) where: Base-Base interactions energy: -266.248 where: short stacking energy: -140.059 Base-Backbone interact. energy: -0.284 local terms energy: -159.817816 where: bonds (distance) C4'-P energy: -29.798 bonds (distance) P-C4' energy: -33.698 flat angles C4'-P-C4' energy: -39.296 flat angles P-C4'-P energy: -26.196 tors. eta vs tors. theta energy: -30.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -310.468397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.468397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.468397 (E_RNA) where: Base-Base interactions energy: -169.097 where: short stacking energy: -100.878 Base-Backbone interact. energy: -0.710 local terms energy: -140.661172 where: bonds (distance) C4'-P energy: -32.111 bonds (distance) P-C4' energy: -33.396 flat angles C4'-P-C4' energy: -32.517 flat angles P-C4'-P energy: -23.477 tors. eta vs tors. theta energy: -19.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -320.849907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.849907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.849907 (E_RNA) where: Base-Base interactions energy: -179.545 where: short stacking energy: -98.251 Base-Backbone interact. energy: -0.288 local terms energy: -141.016536 where: bonds (distance) C4'-P energy: -33.665 bonds (distance) P-C4' energy: -32.467 flat angles C4'-P-C4' energy: -39.596 flat angles P-C4'-P energy: -16.349 tors. eta vs tors. theta energy: -18.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -311.739879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.739879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.739879 (E_RNA) where: Base-Base interactions energy: -178.228 where: short stacking energy: -97.495 Base-Backbone interact. energy: -0.645 local terms energy: -132.866189 where: bonds (distance) C4'-P energy: -32.952 bonds (distance) P-C4' energy: -36.478 flat angles C4'-P-C4' energy: -29.083 flat angles P-C4'-P energy: -17.415 tors. eta vs tors. theta energy: -16.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -348.669785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.669785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.669785 (E_RNA) where: Base-Base interactions energy: -226.744 where: short stacking energy: -98.221 Base-Backbone interact. energy: -0.786 local terms energy: -121.139003 where: bonds (distance) C4'-P energy: -27.462 bonds (distance) P-C4' energy: -23.721 flat angles C4'-P-C4' energy: -29.185 flat angles P-C4'-P energy: -25.006 tors. eta vs tors. theta energy: -15.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -523.014505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.014505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.014505 (E_RNA) where: Base-Base interactions energy: -335.489 where: short stacking energy: -165.313 Base-Backbone interact. energy: 0.220 local terms energy: -187.745682 where: bonds (distance) C4'-P energy: -40.048 bonds (distance) P-C4' energy: -40.169 flat angles C4'-P-C4' energy: -41.414 flat angles P-C4'-P energy: -26.335 tors. eta vs tors. theta energy: -39.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -432.170795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.170795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.170795 (E_RNA) where: Base-Base interactions energy: -271.560 where: short stacking energy: -129.265 Base-Backbone interact. energy: -1.127 local terms energy: -159.483629 where: bonds (distance) C4'-P energy: -31.406 bonds (distance) P-C4' energy: -43.792 flat angles C4'-P-C4' energy: -35.191 flat angles P-C4'-P energy: -25.014 tors. eta vs tors. theta energy: -24.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -471.743503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.743503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.743503 (E_RNA) where: Base-Base interactions energy: -308.094 where: short stacking energy: -148.746 Base-Backbone interact. energy: -0.080 local terms energy: -163.570209 where: bonds (distance) C4'-P energy: -34.781 bonds (distance) P-C4' energy: -36.516 flat angles C4'-P-C4' energy: -39.217 flat angles P-C4'-P energy: -18.560 tors. eta vs tors. theta energy: -34.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -351.326011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.326011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.326011 (E_RNA) where: Base-Base interactions energy: -204.209 where: short stacking energy: -115.504 Base-Backbone interact. energy: -0.848 local terms energy: -146.268731 where: bonds (distance) C4'-P energy: -32.523 bonds (distance) P-C4' energy: -33.328 flat angles C4'-P-C4' energy: -35.942 flat angles P-C4'-P energy: -18.551 tors. eta vs tors. theta energy: -25.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -381.881146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.881146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.881146 (E_RNA) where: Base-Base interactions energy: -234.090 where: short stacking energy: -100.653 Base-Backbone interact. energy: -0.801 local terms energy: -146.990281 where: bonds (distance) C4'-P energy: -40.032 bonds (distance) P-C4' energy: -32.413 flat angles C4'-P-C4' energy: -31.437 flat angles P-C4'-P energy: -25.075 tors. eta vs tors. theta energy: -18.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -420.181223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.181223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.181223 (E_RNA) where: Base-Base interactions energy: -279.091 where: short stacking energy: -139.467 Base-Backbone interact. energy: 0.509 local terms energy: -141.599464 where: bonds (distance) C4'-P energy: -31.939 bonds (distance) P-C4' energy: -32.736 flat angles C4'-P-C4' energy: -29.329 flat angles P-C4'-P energy: -23.074 tors. eta vs tors. theta energy: -24.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -330.487945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.487945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.487945 (E_RNA) where: Base-Base interactions energy: -197.798 where: short stacking energy: -110.526 Base-Backbone interact. energy: -0.357 local terms energy: -132.332156 where: bonds (distance) C4'-P energy: -31.113 bonds (distance) P-C4' energy: -29.785 flat angles C4'-P-C4' energy: -30.067 flat angles P-C4'-P energy: -19.190 tors. eta vs tors. theta energy: -22.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -309.628109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.628109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.628109 (E_RNA) where: Base-Base interactions energy: -178.648 where: short stacking energy: -95.875 Base-Backbone interact. energy: -0.260 local terms energy: -130.720953 where: bonds (distance) C4'-P energy: -29.204 bonds (distance) P-C4' energy: -28.571 flat angles C4'-P-C4' energy: -41.421 flat angles P-C4'-P energy: -19.610 tors. eta vs tors. theta energy: -11.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -373.256122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.256122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.256122 (E_RNA) where: Base-Base interactions energy: -240.622 where: short stacking energy: -102.990 Base-Backbone interact. energy: 1.618 local terms energy: -134.252644 where: bonds (distance) C4'-P energy: -35.153 bonds (distance) P-C4' energy: -33.348 flat angles C4'-P-C4' energy: -30.335 flat angles P-C4'-P energy: -20.147 tors. eta vs tors. theta energy: -15.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -311.000083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.000083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.000083 (E_RNA) where: Base-Base interactions energy: -200.576 where: short stacking energy: -103.179 Base-Backbone interact. energy: 0.189 local terms energy: -110.613304 where: bonds (distance) C4'-P energy: -27.631 bonds (distance) P-C4' energy: -36.340 flat angles C4'-P-C4' energy: -25.883 flat angles P-C4'-P energy: -14.068 tors. eta vs tors. theta energy: -6.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -540.575313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.575313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.575313 (E_RNA) where: Base-Base interactions energy: -343.929 where: short stacking energy: -171.463 Base-Backbone interact. energy: -0.765 local terms energy: -195.881280 where: bonds (distance) C4'-P energy: -40.818 bonds (distance) P-C4' energy: -42.208 flat angles C4'-P-C4' energy: -39.808 flat angles P-C4'-P energy: -29.638 tors. eta vs tors. theta energy: -43.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -472.454537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.454537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.454537 (E_RNA) where: Base-Base interactions energy: -314.027 where: short stacking energy: -163.688 Base-Backbone interact. energy: -1.369 local terms energy: -157.058293 where: bonds (distance) C4'-P energy: -35.244 bonds (distance) P-C4' energy: -29.850 flat angles C4'-P-C4' energy: -33.766 flat angles P-C4'-P energy: -26.347 tors. eta vs tors. theta energy: -31.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -469.230767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.230767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.230767 (E_RNA) where: Base-Base interactions energy: -297.897 where: short stacking energy: -139.091 Base-Backbone interact. energy: -0.799 local terms energy: -170.534660 where: bonds (distance) C4'-P energy: -38.117 bonds (distance) P-C4' energy: -37.716 flat angles C4'-P-C4' energy: -41.529 flat angles P-C4'-P energy: -27.519 tors. eta vs tors. theta energy: -25.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -386.666203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.666203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.666203 (E_RNA) where: Base-Base interactions energy: -237.941 where: short stacking energy: -127.695 Base-Backbone interact. energy: -0.049 local terms energy: -148.676261 where: bonds (distance) C4'-P energy: -39.970 bonds (distance) P-C4' energy: -32.626 flat angles C4'-P-C4' energy: -37.638 flat angles P-C4'-P energy: -16.893 tors. eta vs tors. theta energy: -21.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -386.420557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.420557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.420557 (E_RNA) where: Base-Base interactions energy: -229.546 where: short stacking energy: -110.700 Base-Backbone interact. energy: -0.779 local terms energy: -156.095356 where: bonds (distance) C4'-P energy: -39.341 bonds (distance) P-C4' energy: -43.573 flat angles C4'-P-C4' energy: -34.914 flat angles P-C4'-P energy: -17.095 tors. eta vs tors. theta energy: -21.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -478.160072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.160072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.160072 (E_RNA) where: Base-Base interactions energy: -332.284 where: short stacking energy: -144.561 Base-Backbone interact. energy: 1.404 local terms energy: -147.280392 where: bonds (distance) C4'-P energy: -30.766 bonds (distance) P-C4' energy: -38.088 flat angles C4'-P-C4' energy: -31.135 flat angles P-C4'-P energy: -14.140 tors. eta vs tors. theta energy: -33.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -380.348733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.348733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.348733 (E_RNA) where: Base-Base interactions energy: -228.614 where: short stacking energy: -111.003 Base-Backbone interact. energy: -0.345 local terms energy: -151.388790 where: bonds (distance) C4'-P energy: -34.020 bonds (distance) P-C4' energy: -35.091 flat angles C4'-P-C4' energy: -35.197 flat angles P-C4'-P energy: -21.718 tors. eta vs tors. theta energy: -25.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -424.606222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.606222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.606222 (E_RNA) where: Base-Base interactions energy: -265.788 where: short stacking energy: -118.996 Base-Backbone interact. energy: 0.185 local terms energy: -159.002814 where: bonds (distance) C4'-P energy: -37.309 bonds (distance) P-C4' energy: -36.550 flat angles C4'-P-C4' energy: -34.998 flat angles P-C4'-P energy: -20.027 tors. eta vs tors. theta energy: -30.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -299.172032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.172032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.172032 (E_RNA) where: Base-Base interactions energy: -179.469 where: short stacking energy: -95.364 Base-Backbone interact. energy: -0.972 local terms energy: -118.731451 where: bonds (distance) C4'-P energy: -31.835 bonds (distance) P-C4' energy: -25.866 flat angles C4'-P-C4' energy: -35.256 flat angles P-C4'-P energy: -16.105 tors. eta vs tors. theta energy: -9.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -328.188584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.188584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.188584 (E_RNA) where: Base-Base interactions energy: -199.908 where: short stacking energy: -99.934 Base-Backbone interact. energy: -0.377 local terms energy: -127.902834 where: bonds (distance) C4'-P energy: -21.114 bonds (distance) P-C4' energy: -35.046 flat angles C4'-P-C4' energy: -40.165 flat angles P-C4'-P energy: -18.726 tors. eta vs tors. theta energy: -12.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -524.462276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.462276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.462276 (E_RNA) where: Base-Base interactions energy: -341.435 where: short stacking energy: -180.821 Base-Backbone interact. energy: -2.007 local terms energy: -181.020118 where: bonds (distance) C4'-P energy: -37.602 bonds (distance) P-C4' energy: -35.298 flat angles C4'-P-C4' energy: -42.590 flat angles P-C4'-P energy: -19.122 tors. eta vs tors. theta energy: -46.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -536.150250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.150250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.150250 (E_RNA) where: Base-Base interactions energy: -352.444 where: short stacking energy: -176.727 Base-Backbone interact. energy: -1.090 local terms energy: -182.616084 where: bonds (distance) C4'-P energy: -37.344 bonds (distance) P-C4' energy: -30.681 flat angles C4'-P-C4' energy: -44.481 flat angles P-C4'-P energy: -27.427 tors. eta vs tors. theta energy: -42.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -484.708858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.708858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.708858 (E_RNA) where: Base-Base interactions energy: -315.737 where: short stacking energy: -146.666 Base-Backbone interact. energy: 0.949 local terms energy: -169.921280 where: bonds (distance) C4'-P energy: -40.642 bonds (distance) P-C4' energy: -40.427 flat angles C4'-P-C4' energy: -37.863 flat angles P-C4'-P energy: -24.033 tors. eta vs tors. theta energy: -26.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -406.044620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.044620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.044620 (E_RNA) where: Base-Base interactions energy: -251.303 where: short stacking energy: -122.570 Base-Backbone interact. energy: -1.644 local terms energy: -153.097937 where: bonds (distance) C4'-P energy: -28.397 bonds (distance) P-C4' energy: -34.364 flat angles C4'-P-C4' energy: -39.414 flat angles P-C4'-P energy: -28.168 tors. eta vs tors. theta energy: -22.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -523.484731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.484731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.484731 (E_RNA) where: Base-Base interactions energy: -366.172 where: short stacking energy: -168.563 Base-Backbone interact. energy: -2.233 local terms energy: -155.079456 where: bonds (distance) C4'-P energy: -25.932 bonds (distance) P-C4' energy: -28.694 flat angles C4'-P-C4' energy: -39.618 flat angles P-C4'-P energy: -20.886 tors. eta vs tors. theta energy: -39.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -434.783777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.783777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.783777 (E_RNA) where: Base-Base interactions energy: -304.314 where: short stacking energy: -132.215 Base-Backbone interact. energy: -1.176 local terms energy: -129.294311 where: bonds (distance) C4'-P energy: -31.742 bonds (distance) P-C4' energy: -27.778 flat angles C4'-P-C4' energy: -32.608 flat angles P-C4'-P energy: -12.118 tors. eta vs tors. theta energy: -25.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -450.347347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.347347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.347347 (E_RNA) where: Base-Base interactions energy: -295.450 where: short stacking energy: -132.597 Base-Backbone interact. energy: -0.256 local terms energy: -154.642192 where: bonds (distance) C4'-P energy: -33.593 bonds (distance) P-C4' energy: -40.984 flat angles C4'-P-C4' energy: -33.199 flat angles P-C4'-P energy: -19.349 tors. eta vs tors. theta energy: -27.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -398.302950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.302950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.302950 (E_RNA) where: Base-Base interactions energy: -261.493 where: short stacking energy: -115.357 Base-Backbone interact. energy: 0.349 local terms energy: -137.159491 where: bonds (distance) C4'-P energy: -33.629 bonds (distance) P-C4' energy: -35.169 flat angles C4'-P-C4' energy: -27.821 flat angles P-C4'-P energy: -24.742 tors. eta vs tors. theta energy: -15.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -399.254851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.254851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.254851 (E_RNA) where: Base-Base interactions energy: -261.099 where: short stacking energy: -126.157 Base-Backbone interact. energy: -1.531 local terms energy: -136.624887 where: bonds (distance) C4'-P energy: -25.607 bonds (distance) P-C4' energy: -33.833 flat angles C4'-P-C4' energy: -26.771 flat angles P-C4'-P energy: -13.738 tors. eta vs tors. theta energy: -36.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -266.947378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.947378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.947378 (E_RNA) where: Base-Base interactions energy: -141.956 where: short stacking energy: -95.032 Base-Backbone interact. energy: 6.434 local terms energy: -131.424751 where: bonds (distance) C4'-P energy: -34.098 bonds (distance) P-C4' energy: -28.218 flat angles C4'-P-C4' energy: -30.310 flat angles P-C4'-P energy: -22.320 tors. eta vs tors. theta energy: -16.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -545.221247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.221247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.221247 (E_RNA) where: Base-Base interactions energy: -359.773 where: short stacking energy: -182.738 Base-Backbone interact. energy: -0.334 local terms energy: -185.115151 where: bonds (distance) C4'-P energy: -35.269 bonds (distance) P-C4' energy: -36.846 flat angles C4'-P-C4' energy: -39.854 flat angles P-C4'-P energy: -26.271 tors. eta vs tors. theta energy: -46.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -515.319524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.319524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.319524 (E_RNA) where: Base-Base interactions energy: -348.747 where: short stacking energy: -159.188 Base-Backbone interact. energy: -0.846 local terms energy: -165.726213 where: bonds (distance) C4'-P energy: -41.087 bonds (distance) P-C4' energy: -33.039 flat angles C4'-P-C4' energy: -36.520 flat angles P-C4'-P energy: -23.375 tors. eta vs tors. theta energy: -31.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -505.382997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.382997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.382997 (E_RNA) where: Base-Base interactions energy: -328.095 where: short stacking energy: -153.610 Base-Backbone interact. energy: -0.848 local terms energy: -176.440466 where: bonds (distance) C4'-P energy: -36.821 bonds (distance) P-C4' energy: -37.578 flat angles C4'-P-C4' energy: -38.943 flat angles P-C4'-P energy: -26.798 tors. eta vs tors. theta energy: -36.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -552.083236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.083236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.083236 (E_RNA) where: Base-Base interactions energy: -389.945 where: short stacking energy: -184.990 Base-Backbone interact. energy: 4.389 local terms energy: -166.527919 where: bonds (distance) C4'-P energy: -32.472 bonds (distance) P-C4' energy: -34.018 flat angles C4'-P-C4' energy: -36.284 flat angles P-C4'-P energy: -23.292 tors. eta vs tors. theta energy: -40.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -378.863080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.863080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.863080 (E_RNA) where: Base-Base interactions energy: -227.263 where: short stacking energy: -128.288 Base-Backbone interact. energy: -1.702 local terms energy: -149.897967 where: bonds (distance) C4'-P energy: -31.664 bonds (distance) P-C4' energy: -31.924 flat angles C4'-P-C4' energy: -33.933 flat angles P-C4'-P energy: -25.709 tors. eta vs tors. theta energy: -26.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -466.243500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.243500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.243500 (E_RNA) where: Base-Base interactions energy: -316.032 where: short stacking energy: -146.565 Base-Backbone interact. energy: -0.397 local terms energy: -149.814518 where: bonds (distance) C4'-P energy: -27.993 bonds (distance) P-C4' energy: -27.314 flat angles C4'-P-C4' energy: -34.696 flat angles P-C4'-P energy: -23.557 tors. eta vs tors. theta energy: -36.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -364.407970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.407970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.407970 (E_RNA) where: Base-Base interactions energy: -227.837 where: short stacking energy: -91.618 Base-Backbone interact. energy: -0.348 local terms energy: -136.222175 where: bonds (distance) C4'-P energy: -39.861 bonds (distance) P-C4' energy: -28.909 flat angles C4'-P-C4' energy: -28.166 flat angles P-C4'-P energy: -24.285 tors. eta vs tors. theta energy: -15.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -398.166256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.166256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.166256 (E_RNA) where: Base-Base interactions energy: -255.832 where: short stacking energy: -123.744 Base-Backbone interact. energy: -0.714 local terms energy: -141.620488 where: bonds (distance) C4'-P energy: -33.056 bonds (distance) P-C4' energy: -40.403 flat angles C4'-P-C4' energy: -26.204 flat angles P-C4'-P energy: -22.630 tors. eta vs tors. theta energy: -19.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -386.944530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.944530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.944530 (E_RNA) where: Base-Base interactions energy: -263.920 where: short stacking energy: -111.675 Base-Backbone interact. energy: -0.662 local terms energy: -122.361856 where: bonds (distance) C4'-P energy: -24.450 bonds (distance) P-C4' energy: -23.827 flat angles C4'-P-C4' energy: -36.281 flat angles P-C4'-P energy: -23.975 tors. eta vs tors. theta energy: -13.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -371.287193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.287193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.287193 (E_RNA) where: Base-Base interactions energy: -254.111 where: short stacking energy: -111.088 Base-Backbone interact. energy: -0.674 local terms energy: -116.502424 where: bonds (distance) C4'-P energy: -19.332 bonds (distance) P-C4' energy: -29.050 flat angles C4'-P-C4' energy: -26.417 flat angles P-C4'-P energy: -19.635 tors. eta vs tors. theta energy: -22.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -528.875075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.875075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.875075 (E_RNA) where: Base-Base interactions energy: -361.607 where: short stacking energy: -164.821 Base-Backbone interact. energy: 0.378 local terms energy: -167.646007 where: bonds (distance) C4'-P energy: -40.482 bonds (distance) P-C4' energy: -37.592 flat angles C4'-P-C4' energy: -36.896 flat angles P-C4'-P energy: -24.044 tors. eta vs tors. theta energy: -28.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -510.609696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.609696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.609696 (E_RNA) where: Base-Base interactions energy: -343.985 where: short stacking energy: -160.100 Base-Backbone interact. energy: -1.413 local terms energy: -165.212027 where: bonds (distance) C4'-P energy: -35.965 bonds (distance) P-C4' energy: -39.098 flat angles C4'-P-C4' energy: -39.609 flat angles P-C4'-P energy: -16.308 tors. eta vs tors. theta energy: -34.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -562.026202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.026202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.026202 (E_RNA) where: Base-Base interactions energy: -386.897 where: short stacking energy: -177.784 Base-Backbone interact. energy: 1.336 local terms energy: -176.465327 where: bonds (distance) C4'-P energy: -39.484 bonds (distance) P-C4' energy: -35.461 flat angles C4'-P-C4' energy: -33.210 flat angles P-C4'-P energy: -27.323 tors. eta vs tors. theta energy: -40.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -478.221062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.221062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.221062 (E_RNA) where: Base-Base interactions energy: -319.319 where: short stacking energy: -148.859 Base-Backbone interact. energy: -0.209 local terms energy: -158.693177 where: bonds (distance) C4'-P energy: -29.059 bonds (distance) P-C4' energy: -35.401 flat angles C4'-P-C4' energy: -36.552 flat angles P-C4'-P energy: -28.882 tors. eta vs tors. theta energy: -28.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -475.112629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.112629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.112629 (E_RNA) where: Base-Base interactions energy: -318.397 where: short stacking energy: -139.933 Base-Backbone interact. energy: -0.521 local terms energy: -156.194169 where: bonds (distance) C4'-P energy: -37.895 bonds (distance) P-C4' energy: -28.794 flat angles C4'-P-C4' energy: -35.629 flat angles P-C4'-P energy: -22.004 tors. eta vs tors. theta energy: -31.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -381.248663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.248663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.248663 (E_RNA) where: Base-Base interactions energy: -248.620 where: short stacking energy: -140.394 Base-Backbone interact. energy: 0.496 local terms energy: -133.124440 where: bonds (distance) C4'-P energy: -26.348 bonds (distance) P-C4' energy: -27.939 flat angles C4'-P-C4' energy: -27.344 flat angles P-C4'-P energy: -22.779 tors. eta vs tors. theta energy: -28.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -449.283211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.283211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.283211 (E_RNA) where: Base-Base interactions energy: -290.288 where: short stacking energy: -140.933 Base-Backbone interact. energy: -0.390 local terms energy: -158.605945 where: bonds (distance) C4'-P energy: -34.391 bonds (distance) P-C4' energy: -39.624 flat angles C4'-P-C4' energy: -34.702 flat angles P-C4'-P energy: -20.051 tors. eta vs tors. theta energy: -29.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -403.380714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.380714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.380714 (E_RNA) where: Base-Base interactions energy: -273.853 where: short stacking energy: -109.802 Base-Backbone interact. energy: -0.785 local terms energy: -128.743292 where: bonds (distance) C4'-P energy: -36.438 bonds (distance) P-C4' energy: -29.704 flat angles C4'-P-C4' energy: -28.370 flat angles P-C4'-P energy: -17.368 tors. eta vs tors. theta energy: -16.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -413.179418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.179418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.179418 (E_RNA) where: Base-Base interactions energy: -285.723 where: short stacking energy: -116.990 Base-Backbone interact. energy: 1.282 local terms energy: -128.738658 where: bonds (distance) C4'-P energy: -29.224 bonds (distance) P-C4' energy: -30.488 flat angles C4'-P-C4' energy: -23.822 flat angles P-C4'-P energy: -20.530 tors. eta vs tors. theta energy: -24.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -297.709968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.709968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -297.709968 (E_RNA) where: Base-Base interactions energy: -172.457 where: short stacking energy: -90.782 Base-Backbone interact. energy: 1.246 local terms energy: -126.498999 where: bonds (distance) C4'-P energy: -32.017 bonds (distance) P-C4' energy: -32.113 flat angles C4'-P-C4' energy: -32.974 flat angles P-C4'-P energy: -17.173 tors. eta vs tors. theta energy: -12.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -525.341184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.341184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.341184 (E_RNA) where: Base-Base interactions energy: -353.008 where: short stacking energy: -157.718 Base-Backbone interact. energy: -1.573 local terms energy: -170.759564 where: bonds (distance) C4'-P energy: -37.270 bonds (distance) P-C4' energy: -36.483 flat angles C4'-P-C4' energy: -40.625 flat angles P-C4'-P energy: -24.430 tors. eta vs tors. theta energy: -31.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -574.523182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.523182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.523182 (E_RNA) where: Base-Base interactions energy: -397.259 where: short stacking energy: -181.009 Base-Backbone interact. energy: -0.478 local terms energy: -176.786015 where: bonds (distance) C4'-P energy: -39.145 bonds (distance) P-C4' energy: -36.725 flat angles C4'-P-C4' energy: -40.085 flat angles P-C4'-P energy: -20.499 tors. eta vs tors. theta energy: -40.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -460.560000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.560000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.560000 (E_RNA) where: Base-Base interactions energy: -282.177 where: short stacking energy: -147.486 Base-Backbone interact. energy: -0.364 local terms energy: -178.019218 where: bonds (distance) C4'-P energy: -35.797 bonds (distance) P-C4' energy: -39.553 flat angles C4'-P-C4' energy: -41.464 flat angles P-C4'-P energy: -24.801 tors. eta vs tors. theta energy: -36.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -507.917239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.917239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.917239 (E_RNA) where: Base-Base interactions energy: -347.368 where: short stacking energy: -152.653 Base-Backbone interact. energy: -0.515 local terms energy: -160.034465 where: bonds (distance) C4'-P energy: -35.071 bonds (distance) P-C4' energy: -30.871 flat angles C4'-P-C4' energy: -38.967 flat angles P-C4'-P energy: -23.880 tors. eta vs tors. theta energy: -31.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -515.514409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.514409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.514409 (E_RNA) where: Base-Base interactions energy: -350.246 where: short stacking energy: -165.398 Base-Backbone interact. energy: -0.603 local terms energy: -164.665764 where: bonds (distance) C4'-P energy: -39.969 bonds (distance) P-C4' energy: -28.069 flat angles C4'-P-C4' energy: -27.506 flat angles P-C4'-P energy: -27.546 tors. eta vs tors. theta energy: -41.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -448.505359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.505359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.505359 (E_RNA) where: Base-Base interactions energy: -308.882 where: short stacking energy: -138.443 Base-Backbone interact. energy: 0.558 local terms energy: -140.181233 where: bonds (distance) C4'-P energy: -28.553 bonds (distance) P-C4' energy: -30.779 flat angles C4'-P-C4' energy: -31.747 flat angles P-C4'-P energy: -22.724 tors. eta vs tors. theta energy: -26.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -395.885164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.885164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.885164 (E_RNA) where: Base-Base interactions energy: -238.642 where: short stacking energy: -125.035 Base-Backbone interact. energy: -0.243 local terms energy: -157.000305 where: bonds (distance) C4'-P energy: -37.450 bonds (distance) P-C4' energy: -34.880 flat angles C4'-P-C4' energy: -33.055 flat angles P-C4'-P energy: -23.967 tors. eta vs tors. theta energy: -27.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -416.320322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.320322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.320322 (E_RNA) where: Base-Base interactions energy: -297.388 where: short stacking energy: -128.277 Base-Backbone interact. energy: 0.412 local terms energy: -119.343727 where: bonds (distance) C4'-P energy: -19.975 bonds (distance) P-C4' energy: -35.325 flat angles C4'-P-C4' energy: -28.803 flat angles P-C4'-P energy: -13.818 tors. eta vs tors. theta energy: -21.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -361.280429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.280429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.280429 (E_RNA) where: Base-Base interactions energy: -238.241 where: short stacking energy: -97.763 Base-Backbone interact. energy: -0.261 local terms energy: -122.778084 where: bonds (distance) C4'-P energy: -36.144 bonds (distance) P-C4' energy: -22.289 flat angles C4'-P-C4' energy: -29.916 flat angles P-C4'-P energy: -22.786 tors. eta vs tors. theta energy: -11.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -303.973108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.973108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.973108 (E_RNA) where: Base-Base interactions energy: -190.349 where: short stacking energy: -86.044 Base-Backbone interact. energy: 0.102 local terms energy: -113.726270 where: bonds (distance) C4'-P energy: -26.324 bonds (distance) P-C4' energy: -31.144 flat angles C4'-P-C4' energy: -22.847 flat angles P-C4'-P energy: -17.148 tors. eta vs tors. theta energy: -16.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -593.287077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.287077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.287077 (E_RNA) where: Base-Base interactions energy: -406.861 where: short stacking energy: -188.760 Base-Backbone interact. energy: -1.366 local terms energy: -185.060639 where: bonds (distance) C4'-P energy: -33.480 bonds (distance) P-C4' energy: -38.267 flat angles C4'-P-C4' energy: -42.096 flat angles P-C4'-P energy: -32.138 tors. eta vs tors. theta energy: -39.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -527.112215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.112215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.112215 (E_RNA) where: Base-Base interactions energy: -357.298 where: short stacking energy: -167.030 Base-Backbone interact. energy: -0.615 local terms energy: -169.198480 where: bonds (distance) C4'-P energy: -33.420 bonds (distance) P-C4' energy: -37.681 flat angles C4'-P-C4' energy: -34.529 flat angles P-C4'-P energy: -23.176 tors. eta vs tors. theta energy: -40.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -540.846185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.846185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.846185 (E_RNA) where: Base-Base interactions energy: -362.317 where: short stacking energy: -167.494 Base-Backbone interact. energy: -0.098 local terms energy: -178.430830 where: bonds (distance) C4'-P energy: -37.976 bonds (distance) P-C4' energy: -39.619 flat angles C4'-P-C4' energy: -38.372 flat angles P-C4'-P energy: -19.658 tors. eta vs tors. theta energy: -42.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -475.452497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.452497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.452497 (E_RNA) where: Base-Base interactions energy: -314.035 where: short stacking energy: -163.917 Base-Backbone interact. energy: 4.156 local terms energy: -165.573993 where: bonds (distance) C4'-P energy: -34.431 bonds (distance) P-C4' energy: -31.886 flat angles C4'-P-C4' energy: -34.233 flat angles P-C4'-P energy: -23.617 tors. eta vs tors. theta energy: -41.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -495.646776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.646776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.646776 (E_RNA) where: Base-Base interactions energy: -339.584 where: short stacking energy: -141.189 Base-Backbone interact. energy: -1.946 local terms energy: -154.117614 where: bonds (distance) C4'-P energy: -29.090 bonds (distance) P-C4' energy: -35.198 flat angles C4'-P-C4' energy: -35.461 flat angles P-C4'-P energy: -20.905 tors. eta vs tors. theta energy: -33.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -449.373774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.373774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.373774 (E_RNA) where: Base-Base interactions energy: -294.672 where: short stacking energy: -134.394 Base-Backbone interact. energy: 0.644 local terms energy: -155.345580 where: bonds (distance) C4'-P energy: -34.244 bonds (distance) P-C4' energy: -31.445 flat angles C4'-P-C4' energy: -38.760 flat angles P-C4'-P energy: -26.569 tors. eta vs tors. theta energy: -24.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -438.919489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.919489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.919489 (E_RNA) where: Base-Base interactions energy: -303.886 where: short stacking energy: -131.248 Base-Backbone interact. energy: -1.018 local terms energy: -134.016079 where: bonds (distance) C4'-P energy: -25.143 bonds (distance) P-C4' energy: -27.831 flat angles C4'-P-C4' energy: -32.163 flat angles P-C4'-P energy: -16.904 tors. eta vs tors. theta energy: -31.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -387.595457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.595457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.595457 (E_RNA) where: Base-Base interactions energy: -255.120 where: short stacking energy: -109.769 Base-Backbone interact. energy: -0.497 local terms energy: -131.978157 where: bonds (distance) C4'-P energy: -31.160 bonds (distance) P-C4' energy: -40.554 flat angles C4'-P-C4' energy: -28.037 flat angles P-C4'-P energy: -11.265 tors. eta vs tors. theta energy: -20.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -394.596966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.596966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.596966 (E_RNA) where: Base-Base interactions energy: -279.766 where: short stacking energy: -116.080 Base-Backbone interact. energy: 0.870 local terms energy: -115.701732 where: bonds (distance) C4'-P energy: -29.706 bonds (distance) P-C4' energy: -27.070 flat angles C4'-P-C4' energy: -32.000 flat angles P-C4'-P energy: -11.839 tors. eta vs tors. theta energy: -15.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -359.037903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.037903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.037903 (E_RNA) where: Base-Base interactions energy: -254.927 where: short stacking energy: -122.774 Base-Backbone interact. energy: 3.840 local terms energy: -107.951707 where: bonds (distance) C4'-P energy: -22.250 bonds (distance) P-C4' energy: -26.896 flat angles C4'-P-C4' energy: -22.986 flat angles P-C4'-P energy: -12.777 tors. eta vs tors. theta energy: -23.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -589.181881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.181881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.181881 (E_RNA) where: Base-Base interactions energy: -398.020 where: short stacking energy: -180.270 Base-Backbone interact. energy: 0.320 local terms energy: -191.481312 where: bonds (distance) C4'-P energy: -36.686 bonds (distance) P-C4' energy: -44.504 flat angles C4'-P-C4' energy: -40.856 flat angles P-C4'-P energy: -31.322 tors. eta vs tors. theta energy: -38.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -556.497448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.497448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.497448 (E_RNA) where: Base-Base interactions energy: -384.658 where: short stacking energy: -175.359 Base-Backbone interact. energy: -0.345 local terms energy: -171.494363 where: bonds (distance) C4'-P energy: -34.544 bonds (distance) P-C4' energy: -42.538 flat angles C4'-P-C4' energy: -33.191 flat angles P-C4'-P energy: -25.069 tors. eta vs tors. theta energy: -36.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -550.798470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.798470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.798470 (E_RNA) where: Base-Base interactions energy: -381.169 where: short stacking energy: -172.227 Base-Backbone interact. energy: -0.207 local terms energy: -169.422631 where: bonds (distance) C4'-P energy: -35.177 bonds (distance) P-C4' energy: -34.724 flat angles C4'-P-C4' energy: -37.359 flat angles P-C4'-P energy: -24.991 tors. eta vs tors. theta energy: -37.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -494.481776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.481776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.481776 (E_RNA) where: Base-Base interactions energy: -341.575 where: short stacking energy: -138.384 Base-Backbone interact. energy: -0.250 local terms energy: -152.657000 where: bonds (distance) C4'-P energy: -32.663 bonds (distance) P-C4' energy: -30.921 flat angles C4'-P-C4' energy: -40.296 flat angles P-C4'-P energy: -18.408 tors. eta vs tors. theta energy: -30.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -472.090246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.090246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.090246 (E_RNA) where: Base-Base interactions energy: -308.927 where: short stacking energy: -149.081 Base-Backbone interact. energy: -1.165 local terms energy: -161.998644 where: bonds (distance) C4'-P energy: -31.070 bonds (distance) P-C4' energy: -33.418 flat angles C4'-P-C4' energy: -39.200 flat angles P-C4'-P energy: -22.827 tors. eta vs tors. theta energy: -35.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -464.620101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.620101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.620101 (E_RNA) where: Base-Base interactions energy: -311.316 where: short stacking energy: -144.187 Base-Backbone interact. energy: 0.552 local terms energy: -153.856348 where: bonds (distance) C4'-P energy: -33.755 bonds (distance) P-C4' energy: -30.227 flat angles C4'-P-C4' energy: -35.856 flat angles P-C4'-P energy: -24.680 tors. eta vs tors. theta energy: -29.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -466.708687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.708687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.708687 (E_RNA) where: Base-Base interactions energy: -345.110 where: short stacking energy: -155.017 Base-Backbone interact. energy: -1.629 local terms energy: -119.969605 where: bonds (distance) C4'-P energy: -19.968 bonds (distance) P-C4' energy: -21.477 flat angles C4'-P-C4' energy: -32.682 flat angles P-C4'-P energy: -17.283 tors. eta vs tors. theta energy: -28.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -432.630004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.630004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.630004 (E_RNA) where: Base-Base interactions energy: -289.132 where: short stacking energy: -124.368 Base-Backbone interact. energy: -1.057 local terms energy: -142.440324 where: bonds (distance) C4'-P energy: -34.989 bonds (distance) P-C4' energy: -27.121 flat angles C4'-P-C4' energy: -34.341 flat angles P-C4'-P energy: -24.245 tors. eta vs tors. theta energy: -21.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -380.751928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.751928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.751928 (E_RNA) where: Base-Base interactions energy: -241.837 where: short stacking energy: -115.144 Base-Backbone interact. energy: 1.941 local terms energy: -140.855964 where: bonds (distance) C4'-P energy: -40.800 bonds (distance) P-C4' energy: -30.073 flat angles C4'-P-C4' energy: -26.970 flat angles P-C4'-P energy: -21.634 tors. eta vs tors. theta energy: -21.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -335.112683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.112683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.112683 (E_RNA) where: Base-Base interactions energy: -217.968 where: short stacking energy: -101.090 Base-Backbone interact. energy: 1.190 local terms energy: -118.335140 where: bonds (distance) C4'-P energy: -25.764 bonds (distance) P-C4' energy: -28.474 flat angles C4'-P-C4' energy: -29.510 flat angles P-C4'-P energy: -20.111 tors. eta vs tors. theta energy: -14.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -587.423642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.423642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.423642 (E_RNA) where: Base-Base interactions energy: -409.252 where: short stacking energy: -194.317 Base-Backbone interact. energy: -0.780 local terms energy: -177.391743 where: bonds (distance) C4'-P energy: -32.432 bonds (distance) P-C4' energy: -34.158 flat angles C4'-P-C4' energy: -39.613 flat angles P-C4'-P energy: -25.456 tors. eta vs tors. theta energy: -45.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -553.198072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.198072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.198072 (E_RNA) where: Base-Base interactions energy: -379.645 where: short stacking energy: -169.276 Base-Backbone interact. energy: 2.067 local terms energy: -175.619921 where: bonds (distance) C4'-P energy: -34.584 bonds (distance) P-C4' energy: -39.521 flat angles C4'-P-C4' energy: -35.510 flat angles P-C4'-P energy: -28.121 tors. eta vs tors. theta energy: -37.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -537.392368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.392368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.392368 (E_RNA) where: Base-Base interactions energy: -365.560 where: short stacking energy: -165.431 Base-Backbone interact. energy: -1.576 local terms energy: -170.256602 where: bonds (distance) C4'-P energy: -35.071 bonds (distance) P-C4' energy: -35.597 flat angles C4'-P-C4' energy: -35.066 flat angles P-C4'-P energy: -20.503 tors. eta vs tors. theta energy: -44.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -477.483570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.483570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.483570 (E_RNA) where: Base-Base interactions energy: -325.379 where: short stacking energy: -146.078 Base-Backbone interact. energy: -0.717 local terms energy: -151.387655 where: bonds (distance) C4'-P energy: -35.973 bonds (distance) P-C4' energy: -31.370 flat angles C4'-P-C4' energy: -30.717 flat angles P-C4'-P energy: -18.495 tors. eta vs tors. theta energy: -34.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -486.391706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.391706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.391706 (E_RNA) where: Base-Base interactions energy: -323.391 where: short stacking energy: -154.514 Base-Backbone interact. energy: -0.374 local terms energy: -162.627312 where: bonds (distance) C4'-P energy: -29.972 bonds (distance) P-C4' energy: -32.636 flat angles C4'-P-C4' energy: -39.867 flat angles P-C4'-P energy: -25.493 tors. eta vs tors. theta energy: -34.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -510.852949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.852949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.852949 (E_RNA) where: Base-Base interactions energy: -351.305 where: short stacking energy: -155.510 Base-Backbone interact. energy: 0.254 local terms energy: -159.802006 where: bonds (distance) C4'-P energy: -35.307 bonds (distance) P-C4' energy: -32.687 flat angles C4'-P-C4' energy: -35.815 flat angles P-C4'-P energy: -26.329 tors. eta vs tors. theta energy: -29.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -459.669662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.669662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.669662 (E_RNA) where: Base-Base interactions energy: -308.938 where: short stacking energy: -160.716 Base-Backbone interact. energy: 0.468 local terms energy: -151.198737 where: bonds (distance) C4'-P energy: -33.525 bonds (distance) P-C4' energy: -26.629 flat angles C4'-P-C4' energy: -34.803 flat angles P-C4'-P energy: -23.156 tors. eta vs tors. theta energy: -33.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -426.862674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.862674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.862674 (E_RNA) where: Base-Base interactions energy: -277.390 where: short stacking energy: -123.149 Base-Backbone interact. energy: -0.695 local terms energy: -148.776846 where: bonds (distance) C4'-P energy: -36.074 bonds (distance) P-C4' energy: -42.126 flat angles C4'-P-C4' energy: -25.052 flat angles P-C4'-P energy: -25.620 tors. eta vs tors. theta energy: -19.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -322.238216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.238216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.238216 (E_RNA) where: Base-Base interactions energy: -188.567 where: short stacking energy: -97.787 Base-Backbone interact. energy: -0.361 local terms energy: -133.310499 where: bonds (distance) C4'-P energy: -35.816 bonds (distance) P-C4' energy: -34.782 flat angles C4'-P-C4' energy: -35.540 flat angles P-C4'-P energy: -13.631 tors. eta vs tors. theta energy: -13.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -307.553525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.553525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.553525 (E_RNA) where: Base-Base interactions energy: -194.505 where: short stacking energy: -112.831 Base-Backbone interact. energy: 1.191 local terms energy: -114.239568 where: bonds (distance) C4'-P energy: -26.669 bonds (distance) P-C4' energy: -23.058 flat angles C4'-P-C4' energy: -31.430 flat angles P-C4'-P energy: -19.593 tors. eta vs tors. theta energy: -13.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -604.692599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.692599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.692599 (E_RNA) where: Base-Base interactions energy: -417.327 where: short stacking energy: -201.454 Base-Backbone interact. energy: -0.817 local terms energy: -186.549197 where: bonds (distance) C4'-P energy: -35.160 bonds (distance) P-C4' energy: -42.636 flat angles C4'-P-C4' energy: -42.093 flat angles P-C4'-P energy: -25.033 tors. eta vs tors. theta energy: -41.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -568.769520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.769520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.769520 (E_RNA) where: Base-Base interactions energy: -392.599 where: short stacking energy: -192.428 Base-Backbone interact. energy: 2.204 local terms energy: -178.374058 where: bonds (distance) C4'-P energy: -40.553 bonds (distance) P-C4' energy: -29.622 flat angles C4'-P-C4' energy: -40.694 flat angles P-C4'-P energy: -18.362 tors. eta vs tors. theta energy: -49.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -551.011194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.011194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.011194 (E_RNA) where: Base-Base interactions energy: -381.293 where: short stacking energy: -172.192 Base-Backbone interact. energy: -1.713 local terms energy: -168.005093 where: bonds (distance) C4'-P energy: -32.734 bonds (distance) P-C4' energy: -31.936 flat angles C4'-P-C4' energy: -35.036 flat angles P-C4'-P energy: -25.052 tors. eta vs tors. theta energy: -43.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -527.049825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.049825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.049825 (E_RNA) where: Base-Base interactions energy: -370.789 where: short stacking energy: -179.426 Base-Backbone interact. energy: 1.916 local terms energy: -158.176358 where: bonds (distance) C4'-P energy: -33.905 bonds (distance) P-C4' energy: -38.534 flat angles C4'-P-C4' energy: -37.461 flat angles P-C4'-P energy: -14.800 tors. eta vs tors. theta energy: -33.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -481.716988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.716988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.716988 (E_RNA) where: Base-Base interactions energy: -306.685 where: short stacking energy: -142.512 Base-Backbone interact. energy: -0.035 local terms energy: -174.996593 where: bonds (distance) C4'-P energy: -32.622 bonds (distance) P-C4' energy: -39.584 flat angles C4'-P-C4' energy: -41.018 flat angles P-C4'-P energy: -22.259 tors. eta vs tors. theta energy: -39.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -500.986612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.986612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.986612 (E_RNA) where: Base-Base interactions energy: -334.491 where: short stacking energy: -164.964 Base-Backbone interact. energy: -0.360 local terms energy: -166.136201 where: bonds (distance) C4'-P energy: -37.257 bonds (distance) P-C4' energy: -33.925 flat angles C4'-P-C4' energy: -37.454 flat angles P-C4'-P energy: -21.446 tors. eta vs tors. theta energy: -36.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -471.348872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.348872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.348872 (E_RNA) where: Base-Base interactions energy: -325.234 where: short stacking energy: -148.381 Base-Backbone interact. energy: -0.844 local terms energy: -145.271371 where: bonds (distance) C4'-P energy: -23.277 bonds (distance) P-C4' energy: -25.569 flat angles C4'-P-C4' energy: -36.745 flat angles P-C4'-P energy: -24.829 tors. eta vs tors. theta energy: -34.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -420.993272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.993272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.993272 (E_RNA) where: Base-Base interactions energy: -270.514 where: short stacking energy: -121.914 Base-Backbone interact. energy: -0.358 local terms energy: -150.121263 where: bonds (distance) C4'-P energy: -35.901 bonds (distance) P-C4' energy: -28.501 flat angles C4'-P-C4' energy: -31.666 flat angles P-C4'-P energy: -24.777 tors. eta vs tors. theta energy: -29.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -333.662248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.662248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.662248 (E_RNA) where: Base-Base interactions energy: -218.025 where: short stacking energy: -113.767 Base-Backbone interact. energy: 1.020 local terms energy: -116.657240 where: bonds (distance) C4'-P energy: -34.295 bonds (distance) P-C4' energy: -27.119 flat angles C4'-P-C4' energy: -25.901 flat angles P-C4'-P energy: -11.281 tors. eta vs tors. theta energy: -18.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -316.759957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.759957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.759957 (E_RNA) where: Base-Base interactions energy: -198.698 where: short stacking energy: -79.176 Base-Backbone interact. energy: -0.412 local terms energy: -117.649660 where: bonds (distance) C4'-P energy: -24.220 bonds (distance) P-C4' energy: -32.457 flat angles C4'-P-C4' energy: -34.574 flat angles P-C4'-P energy: -19.407 tors. eta vs tors. theta energy: -6.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -609.235581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.235581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.235581 (E_RNA) where: Base-Base interactions energy: -422.108 where: short stacking energy: -194.472 Base-Backbone interact. energy: 0.602 local terms energy: -187.729230 where: bonds (distance) C4'-P energy: -41.896 bonds (distance) P-C4' energy: -34.585 flat angles C4'-P-C4' energy: -40.132 flat angles P-C4'-P energy: -22.221 tors. eta vs tors. theta energy: -48.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -557.100416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.100416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.100416 (E_RNA) where: Base-Base interactions energy: -380.429 where: short stacking energy: -176.790 Base-Backbone interact. energy: -2.934 local terms energy: -173.737489 where: bonds (distance) C4'-P energy: -32.181 bonds (distance) P-C4' energy: -39.371 flat angles C4'-P-C4' energy: -37.089 flat angles P-C4'-P energy: -23.323 tors. eta vs tors. theta energy: -41.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -523.309258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.309258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.309258 (E_RNA) where: Base-Base interactions energy: -365.500 where: short stacking energy: -146.316 Base-Backbone interact. energy: 0.186 local terms energy: -157.994935 where: bonds (distance) C4'-P energy: -35.792 bonds (distance) P-C4' energy: -37.153 flat angles C4'-P-C4' energy: -37.880 flat angles P-C4'-P energy: -18.633 tors. eta vs tors. theta energy: -28.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -533.332162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.332162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.332162 (E_RNA) where: Base-Base interactions energy: -348.593 where: short stacking energy: -165.802 Base-Backbone interact. energy: -0.353 local terms energy: -184.386098 where: bonds (distance) C4'-P energy: -35.652 bonds (distance) P-C4' energy: -43.172 flat angles C4'-P-C4' energy: -40.931 flat angles P-C4'-P energy: -24.895 tors. eta vs tors. theta energy: -39.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -499.391785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.391785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.391785 (E_RNA) where: Base-Base interactions energy: -319.254 where: short stacking energy: -154.066 Base-Backbone interact. energy: -0.482 local terms energy: -179.656374 where: bonds (distance) C4'-P energy: -37.132 bonds (distance) P-C4' energy: -33.869 flat angles C4'-P-C4' energy: -39.925 flat angles P-C4'-P energy: -29.907 tors. eta vs tors. theta energy: -38.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -543.657904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.657904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.657904 (E_RNA) where: Base-Base interactions energy: -369.602 where: short stacking energy: -156.520 Base-Backbone interact. energy: -1.897 local terms energy: -172.159554 where: bonds (distance) C4'-P energy: -37.354 bonds (distance) P-C4' energy: -35.166 flat angles C4'-P-C4' energy: -35.892 flat angles P-C4'-P energy: -28.551 tors. eta vs tors. theta energy: -35.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -476.599780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.599780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.599780 (E_RNA) where: Base-Base interactions energy: -315.472 where: short stacking energy: -149.565 Base-Backbone interact. energy: -0.516 local terms energy: -160.611529 where: bonds (distance) C4'-P energy: -35.912 bonds (distance) P-C4' energy: -31.926 flat angles C4'-P-C4' energy: -32.834 flat angles P-C4'-P energy: -23.493 tors. eta vs tors. theta energy: -36.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -416.532271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.532271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.532271 (E_RNA) where: Base-Base interactions energy: -267.830 where: short stacking energy: -122.702 Base-Backbone interact. energy: -0.665 local terms energy: -148.037162 where: bonds (distance) C4'-P energy: -37.998 bonds (distance) P-C4' energy: -34.817 flat angles C4'-P-C4' energy: -31.845 flat angles P-C4'-P energy: -26.303 tors. eta vs tors. theta energy: -17.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -398.742300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.742300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.742300 (E_RNA) where: Base-Base interactions energy: -270.766 where: short stacking energy: -117.532 Base-Backbone interact. energy: 2.562 local terms energy: -130.538374 where: bonds (distance) C4'-P energy: -22.240 bonds (distance) P-C4' energy: -33.537 flat angles C4'-P-C4' energy: -31.402 flat angles P-C4'-P energy: -26.192 tors. eta vs tors. theta energy: -17.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -317.323271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.323271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.323271 (E_RNA) where: Base-Base interactions energy: -186.039 where: short stacking energy: -102.689 Base-Backbone interact. energy: -0.866 local terms energy: -130.417966 where: bonds (distance) C4'-P energy: -34.619 bonds (distance) P-C4' energy: -31.808 flat angles C4'-P-C4' energy: -30.061 flat angles P-C4'-P energy: -27.123 tors. eta vs tors. theta energy: -6.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -599.090278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.090278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.090278 (E_RNA) where: Base-Base interactions energy: -420.727 where: short stacking energy: -190.898 Base-Backbone interact. energy: -0.730 local terms energy: -177.632914 where: bonds (distance) C4'-P energy: -33.585 bonds (distance) P-C4' energy: -42.298 flat angles C4'-P-C4' energy: -36.649 flat angles P-C4'-P energy: -21.287 tors. eta vs tors. theta energy: -43.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -566.318373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.318373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.318373 (E_RNA) where: Base-Base interactions energy: -388.244 where: short stacking energy: -169.720 Base-Backbone interact. energy: -0.295 local terms energy: -177.779162 where: bonds (distance) C4'-P energy: -37.410 bonds (distance) P-C4' energy: -46.058 flat angles C4'-P-C4' energy: -38.188 flat angles P-C4'-P energy: -17.716 tors. eta vs tors. theta energy: -38.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -531.347622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.347622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.347622 (E_RNA) where: Base-Base interactions energy: -368.791 where: short stacking energy: -187.002 Base-Backbone interact. energy: -0.736 local terms energy: -161.821306 where: bonds (distance) C4'-P energy: -36.582 bonds (distance) P-C4' energy: -29.919 flat angles C4'-P-C4' energy: -33.435 flat angles P-C4'-P energy: -22.488 tors. eta vs tors. theta energy: -39.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -529.219906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.219906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.219906 (E_RNA) where: Base-Base interactions energy: -370.800 where: short stacking energy: -167.295 Base-Backbone interact. energy: 1.295 local terms energy: -159.714255 where: bonds (distance) C4'-P energy: -26.440 bonds (distance) P-C4' energy: -35.688 flat angles C4'-P-C4' energy: -34.357 flat angles P-C4'-P energy: -23.324 tors. eta vs tors. theta energy: -39.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -502.263823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.263823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.263823 (E_RNA) where: Base-Base interactions energy: -337.355 where: short stacking energy: -155.928 Base-Backbone interact. energy: -0.304 local terms energy: -164.604365 where: bonds (distance) C4'-P energy: -37.014 bonds (distance) P-C4' energy: -32.795 flat angles C4'-P-C4' energy: -37.283 flat angles P-C4'-P energy: -22.473 tors. eta vs tors. theta energy: -35.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -558.973260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.973260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.973260 (E_RNA) where: Base-Base interactions energy: -387.326 where: short stacking energy: -166.802 Base-Backbone interact. energy: -0.300 local terms energy: -171.347853 where: bonds (distance) C4'-P energy: -30.682 bonds (distance) P-C4' energy: -37.011 flat angles C4'-P-C4' energy: -38.187 flat angles P-C4'-P energy: -24.768 tors. eta vs tors. theta energy: -40.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -466.478794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.478794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.478794 (E_RNA) where: Base-Base interactions energy: -311.915 where: short stacking energy: -132.583 Base-Backbone interact. energy: -0.564 local terms energy: -153.999560 where: bonds (distance) C4'-P energy: -28.960 bonds (distance) P-C4' energy: -38.021 flat angles C4'-P-C4' energy: -33.682 flat angles P-C4'-P energy: -20.958 tors. eta vs tors. theta energy: -32.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -428.549935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.549935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.549935 (E_RNA) where: Base-Base interactions energy: -287.066 where: short stacking energy: -134.106 Base-Backbone interact. energy: -0.407 local terms energy: -141.077530 where: bonds (distance) C4'-P energy: -31.372 bonds (distance) P-C4' energy: -26.105 flat angles C4'-P-C4' energy: -27.290 flat angles P-C4'-P energy: -28.168 tors. eta vs tors. theta energy: -28.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -403.324705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.324705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.324705 (E_RNA) where: Base-Base interactions energy: -267.702 where: short stacking energy: -129.266 Base-Backbone interact. energy: 0.461 local terms energy: -136.083733 where: bonds (distance) C4'-P energy: -24.052 bonds (distance) P-C4' energy: -26.349 flat angles C4'-P-C4' energy: -35.497 flat angles P-C4'-P energy: -17.232 tors. eta vs tors. theta energy: -32.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -302.780232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.780232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.780232 (E_RNA) where: Base-Base interactions energy: -174.055 where: short stacking energy: -85.583 Base-Backbone interact. energy: -0.563 local terms energy: -128.162182 where: bonds (distance) C4'-P energy: -27.188 bonds (distance) P-C4' energy: -29.195 flat angles C4'-P-C4' energy: -29.342 flat angles P-C4'-P energy: -27.843 tors. eta vs tors. theta energy: -14.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -589.543053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.543053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.543053 (E_RNA) where: Base-Base interactions energy: -398.801 where: short stacking energy: -184.795 Base-Backbone interact. energy: 1.434 local terms energy: -192.176448 where: bonds (distance) C4'-P energy: -35.229 bonds (distance) P-C4' energy: -43.306 flat angles C4'-P-C4' energy: -40.997 flat angles P-C4'-P energy: -28.387 tors. eta vs tors. theta energy: -44.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -543.411316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.411316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.411316 (E_RNA) where: Base-Base interactions energy: -376.649 where: short stacking energy: -168.618 Base-Backbone interact. energy: -1.159 local terms energy: -165.603617 where: bonds (distance) C4'-P energy: -31.980 bonds (distance) P-C4' energy: -39.446 flat angles C4'-P-C4' energy: -37.480 flat angles P-C4'-P energy: -18.797 tors. eta vs tors. theta energy: -37.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -554.480679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.480679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.480679 (E_RNA) where: Base-Base interactions energy: -384.535 where: short stacking energy: -177.357 Base-Backbone interact. energy: -0.785 local terms energy: -169.160775 where: bonds (distance) C4'-P energy: -38.748 bonds (distance) P-C4' energy: -39.136 flat angles C4'-P-C4' energy: -37.115 flat angles P-C4'-P energy: -9.342 tors. eta vs tors. theta energy: -44.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -516.013012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.013012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.013012 (E_RNA) where: Base-Base interactions energy: -365.533 where: short stacking energy: -145.039 Base-Backbone interact. energy: -0.494 local terms energy: -149.986041 where: bonds (distance) C4'-P energy: -34.168 bonds (distance) P-C4' energy: -30.704 flat angles C4'-P-C4' energy: -36.949 flat angles P-C4'-P energy: -16.044 tors. eta vs tors. theta energy: -32.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -571.823566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.823566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.823566 (E_RNA) where: Base-Base interactions energy: -401.756 where: short stacking energy: -183.417 Base-Backbone interact. energy: -0.651 local terms energy: -169.416792 where: bonds (distance) C4'-P energy: -31.503 bonds (distance) P-C4' energy: -31.769 flat angles C4'-P-C4' energy: -35.534 flat angles P-C4'-P energy: -29.056 tors. eta vs tors. theta energy: -41.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -520.213139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.213139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.213139 (E_RNA) where: Base-Base interactions energy: -359.239 where: short stacking energy: -186.864 Base-Backbone interact. energy: -1.342 local terms energy: -159.632765 where: bonds (distance) C4'-P energy: -26.860 bonds (distance) P-C4' energy: -31.700 flat angles C4'-P-C4' energy: -29.289 flat angles P-C4'-P energy: -25.356 tors. eta vs tors. theta energy: -46.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -477.023448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.023448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.023448 (E_RNA) where: Base-Base interactions energy: -335.178 where: short stacking energy: -149.867 Base-Backbone interact. energy: -0.562 local terms energy: -141.283403 where: bonds (distance) C4'-P energy: -34.161 bonds (distance) P-C4' energy: -25.771 flat angles C4'-P-C4' energy: -33.574 flat angles P-C4'-P energy: -17.378 tors. eta vs tors. theta energy: -30.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -425.949471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.949471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.949471 (E_RNA) where: Base-Base interactions energy: -294.138 where: short stacking energy: -122.649 Base-Backbone interact. energy: 0.361 local terms energy: -132.172479 where: bonds (distance) C4'-P energy: -33.557 bonds (distance) P-C4' energy: -30.795 flat angles C4'-P-C4' energy: -30.774 flat angles P-C4'-P energy: -16.675 tors. eta vs tors. theta energy: -20.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -404.985110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.985110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.985110 (E_RNA) where: Base-Base interactions energy: -269.816 where: short stacking energy: -115.020 Base-Backbone interact. energy: -0.334 local terms energy: -134.835426 where: bonds (distance) C4'-P energy: -28.046 bonds (distance) P-C4' energy: -36.519 flat angles C4'-P-C4' energy: -28.969 flat angles P-C4'-P energy: -14.080 tors. eta vs tors. theta energy: -27.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -334.478790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.478790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.478790 (E_RNA) where: Base-Base interactions energy: -210.222 where: short stacking energy: -98.854 Base-Backbone interact. energy: -1.027 local terms energy: -123.229755 where: bonds (distance) C4'-P energy: -31.338 bonds (distance) P-C4' energy: -27.258 flat angles C4'-P-C4' energy: -32.042 flat angles P-C4'-P energy: -19.443 tors. eta vs tors. theta energy: -13.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -603.460549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.460549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.460549 (E_RNA) where: Base-Base interactions energy: -419.697 where: short stacking energy: -192.515 Base-Backbone interact. energy: -1.290 local terms energy: -182.473965 where: bonds (distance) C4'-P energy: -35.496 bonds (distance) P-C4' energy: -35.626 flat angles C4'-P-C4' energy: -44.301 flat angles P-C4'-P energy: -24.355 tors. eta vs tors. theta energy: -42.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -573.323430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.323430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.323430 (E_RNA) where: Base-Base interactions energy: -411.956 where: short stacking energy: -166.490 Base-Backbone interact. energy: 0.139 local terms energy: -161.505834 where: bonds (distance) C4'-P energy: -35.846 bonds (distance) P-C4' energy: -35.529 flat angles C4'-P-C4' energy: -41.002 flat angles P-C4'-P energy: -17.673 tors. eta vs tors. theta energy: -31.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -528.209938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.209938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.209938 (E_RNA) where: Base-Base interactions energy: -363.139 where: short stacking energy: -164.677 Base-Backbone interact. energy: -1.056 local terms energy: -164.015506 where: bonds (distance) C4'-P energy: -36.840 bonds (distance) P-C4' energy: -33.988 flat angles C4'-P-C4' energy: -33.101 flat angles P-C4'-P energy: -21.589 tors. eta vs tors. theta energy: -38.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -585.585441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.585441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.585441 (E_RNA) where: Base-Base interactions energy: -395.523 where: short stacking energy: -179.084 Base-Backbone interact. energy: -0.681 local terms energy: -189.381331 where: bonds (distance) C4'-P energy: -40.718 bonds (distance) P-C4' energy: -39.148 flat angles C4'-P-C4' energy: -41.606 flat angles P-C4'-P energy: -22.907 tors. eta vs tors. theta energy: -45.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -538.874846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.874846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.874846 (E_RNA) where: Base-Base interactions energy: -360.550 where: short stacking energy: -165.340 Base-Backbone interact. energy: 3.531 local terms energy: -181.855573 where: bonds (distance) C4'-P energy: -35.047 bonds (distance) P-C4' energy: -33.676 flat angles C4'-P-C4' energy: -44.268 flat angles P-C4'-P energy: -22.242 tors. eta vs tors. theta energy: -46.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -502.115526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.115526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.115526 (E_RNA) where: Base-Base interactions energy: -355.098 where: short stacking energy: -155.871 Base-Backbone interact. energy: -0.169 local terms energy: -146.848919 where: bonds (distance) C4'-P energy: -26.677 bonds (distance) P-C4' energy: -35.752 flat angles C4'-P-C4' energy: -33.610 flat angles P-C4'-P energy: -16.505 tors. eta vs tors. theta energy: -34.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -472.532242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.532242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.532242 (E_RNA) where: Base-Base interactions energy: -328.381 where: short stacking energy: -149.217 Base-Backbone interact. energy: 1.813 local terms energy: -145.964464 where: bonds (distance) C4'-P energy: -31.253 bonds (distance) P-C4' energy: -41.184 flat angles C4'-P-C4' energy: -27.575 flat angles P-C4'-P energy: -18.391 tors. eta vs tors. theta energy: -27.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -448.508183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.508183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.508183 (E_RNA) where: Base-Base interactions energy: -301.953 where: short stacking energy: -120.625 Base-Backbone interact. energy: -0.437 local terms energy: -146.117811 where: bonds (distance) C4'-P energy: -36.657 bonds (distance) P-C4' energy: -31.291 flat angles C4'-P-C4' energy: -34.118 flat angles P-C4'-P energy: -18.817 tors. eta vs tors. theta energy: -25.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -415.932330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.932330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.932330 (E_RNA) where: Base-Base interactions energy: -287.190 where: short stacking energy: -131.604 Base-Backbone interact. energy: 1.178 local terms energy: -129.920222 where: bonds (distance) C4'-P energy: -14.359 bonds (distance) P-C4' energy: -31.623 flat angles C4'-P-C4' energy: -37.526 flat angles P-C4'-P energy: -19.568 tors. eta vs tors. theta energy: -26.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -323.118787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.118787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.118787 (E_RNA) where: Base-Base interactions energy: -194.716 where: short stacking energy: -108.204 Base-Backbone interact. energy: 2.111 local terms energy: -130.513732 where: bonds (distance) C4'-P energy: -29.993 bonds (distance) P-C4' energy: -35.568 flat angles C4'-P-C4' energy: -27.946 flat angles P-C4'-P energy: -18.990 tors. eta vs tors. theta energy: -18.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -606.818509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.818509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.818509 (E_RNA) where: Base-Base interactions energy: -426.435 where: short stacking energy: -195.458 Base-Backbone interact. energy: -0.923 local terms energy: -179.460931 where: bonds (distance) C4'-P energy: -31.635 bonds (distance) P-C4' energy: -36.699 flat angles C4'-P-C4' energy: -42.386 flat angles P-C4'-P energy: -23.745 tors. eta vs tors. theta energy: -44.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -568.892128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.892128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.892128 (E_RNA) where: Base-Base interactions energy: -406.186 where: short stacking energy: -175.384 Base-Backbone interact. energy: -0.496 local terms energy: -162.210020 where: bonds (distance) C4'-P energy: -33.291 bonds (distance) P-C4' energy: -33.726 flat angles C4'-P-C4' energy: -37.454 flat angles P-C4'-P energy: -21.189 tors. eta vs tors. theta energy: -36.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -582.836423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.836423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.836423 (E_RNA) where: Base-Base interactions energy: -404.699 where: short stacking energy: -188.517 Base-Backbone interact. energy: 0.427 local terms energy: -178.564822 where: bonds (distance) C4'-P energy: -30.962 bonds (distance) P-C4' energy: -34.826 flat angles C4'-P-C4' energy: -36.530 flat angles P-C4'-P energy: -28.984 tors. eta vs tors. theta energy: -47.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -539.452815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.452815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.452815 (E_RNA) where: Base-Base interactions energy: -364.672 where: short stacking energy: -170.152 Base-Backbone interact. energy: 0.506 local terms energy: -175.286140 where: bonds (distance) C4'-P energy: -28.854 bonds (distance) P-C4' energy: -33.996 flat angles C4'-P-C4' energy: -40.734 flat angles P-C4'-P energy: -27.485 tors. eta vs tors. theta energy: -44.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -571.367091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.367091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.367091 (E_RNA) where: Base-Base interactions energy: -393.927 where: short stacking energy: -176.751 Base-Backbone interact. energy: -0.845 local terms energy: -176.594731 where: bonds (distance) C4'-P energy: -31.326 bonds (distance) P-C4' energy: -41.573 flat angles C4'-P-C4' energy: -41.528 flat angles P-C4'-P energy: -17.658 tors. eta vs tors. theta energy: -44.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -520.860848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.860848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.860848 (E_RNA) where: Base-Base interactions energy: -351.012 where: short stacking energy: -171.147 Base-Backbone interact. energy: 2.315 local terms energy: -172.163764 where: bonds (distance) C4'-P energy: -29.612 bonds (distance) P-C4' energy: -34.204 flat angles C4'-P-C4' energy: -41.773 flat angles P-C4'-P energy: -20.701 tors. eta vs tors. theta energy: -45.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -485.317019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.317019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.317019 (E_RNA) where: Base-Base interactions energy: -329.807 where: short stacking energy: -152.970 Base-Backbone interact. energy: -0.293 local terms energy: -155.217431 where: bonds (distance) C4'-P energy: -27.641 bonds (distance) P-C4' energy: -40.167 flat angles C4'-P-C4' energy: -28.978 flat angles P-C4'-P energy: -15.750 tors. eta vs tors. theta energy: -42.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -464.402362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.402362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.402362 (E_RNA) where: Base-Base interactions energy: -318.467 where: short stacking energy: -144.962 Base-Backbone interact. energy: -0.292 local terms energy: -145.642874 where: bonds (distance) C4'-P energy: -30.886 bonds (distance) P-C4' energy: -28.422 flat angles C4'-P-C4' energy: -27.371 flat angles P-C4'-P energy: -22.095 tors. eta vs tors. theta energy: -36.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -339.478983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.478983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.478983 (E_RNA) where: Base-Base interactions energy: -215.826 where: short stacking energy: -105.890 Base-Backbone interact. energy: 5.133 local terms energy: -128.785652 where: bonds (distance) C4'-P energy: -23.842 bonds (distance) P-C4' energy: -34.844 flat angles C4'-P-C4' energy: -32.539 flat angles P-C4'-P energy: -18.207 tors. eta vs tors. theta energy: -19.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -418.521999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.521999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.521999 (E_RNA) where: Base-Base interactions energy: -294.383 where: short stacking energy: -126.069 Base-Backbone interact. energy: -1.631 local terms energy: -122.507996 where: bonds (distance) C4'-P energy: -21.906 bonds (distance) P-C4' energy: -22.779 flat angles C4'-P-C4' energy: -36.240 flat angles P-C4'-P energy: -17.924 tors. eta vs tors. theta energy: -23.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -601.005130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.005130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.005130 (E_RNA) where: Base-Base interactions energy: -401.900 where: short stacking energy: -183.330 Base-Backbone interact. energy: -0.692 local terms energy: -198.412995 where: bonds (distance) C4'-P energy: -41.120 bonds (distance) P-C4' energy: -38.667 flat angles C4'-P-C4' energy: -45.150 flat angles P-C4'-P energy: -29.095 tors. eta vs tors. theta energy: -44.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -606.083758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.083758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.083758 (E_RNA) where: Base-Base interactions energy: -423.138 where: short stacking energy: -185.959 Base-Backbone interact. energy: -0.250 local terms energy: -182.695344 where: bonds (distance) C4'-P energy: -33.969 bonds (distance) P-C4' energy: -36.847 flat angles C4'-P-C4' energy: -38.659 flat angles P-C4'-P energy: -26.101 tors. eta vs tors. theta energy: -47.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -565.655434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.655434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.655434 (E_RNA) where: Base-Base interactions energy: -398.457 where: short stacking energy: -172.106 Base-Backbone interact. energy: -1.462 local terms energy: -165.736937 where: bonds (distance) C4'-P energy: -32.632 bonds (distance) P-C4' energy: -41.988 flat angles C4'-P-C4' energy: -31.655 flat angles P-C4'-P energy: -21.078 tors. eta vs tors. theta energy: -38.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -580.140288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.140288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.140288 (E_RNA) where: Base-Base interactions energy: -404.028 where: short stacking energy: -175.073 Base-Backbone interact. energy: -0.288 local terms energy: -175.824381 where: bonds (distance) C4'-P energy: -27.646 bonds (distance) P-C4' energy: -33.293 flat angles C4'-P-C4' energy: -46.225 flat angles P-C4'-P energy: -24.576 tors. eta vs tors. theta energy: -44.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -524.239806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.239806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.239806 (E_RNA) where: Base-Base interactions energy: -365.967 where: short stacking energy: -168.421 Base-Backbone interact. energy: -1.850 local terms energy: -156.422647 where: bonds (distance) C4'-P energy: -27.235 bonds (distance) P-C4' energy: -29.406 flat angles C4'-P-C4' energy: -35.398 flat angles P-C4'-P energy: -25.844 tors. eta vs tors. theta energy: -38.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -521.544963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.544963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.544963 (E_RNA) where: Base-Base interactions energy: -359.349 where: short stacking energy: -162.846 Base-Backbone interact. energy: 0.160 local terms energy: -162.355853 where: bonds (distance) C4'-P energy: -29.437 bonds (distance) P-C4' energy: -34.657 flat angles C4'-P-C4' energy: -35.618 flat angles P-C4'-P energy: -25.553 tors. eta vs tors. theta energy: -37.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -461.497448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.497448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.497448 (E_RNA) where: Base-Base interactions energy: -296.915 where: short stacking energy: -131.301 Base-Backbone interact. energy: 0.113 local terms energy: -164.694856 where: bonds (distance) C4'-P energy: -35.842 bonds (distance) P-C4' energy: -40.578 flat angles C4'-P-C4' energy: -36.380 flat angles P-C4'-P energy: -25.178 tors. eta vs tors. theta energy: -26.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -406.047663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.047663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.047663 (E_RNA) where: Base-Base interactions energy: -272.429 where: short stacking energy: -115.515 Base-Backbone interact. energy: 1.099 local terms energy: -134.717168 where: bonds (distance) C4'-P energy: -32.816 bonds (distance) P-C4' energy: -31.671 flat angles C4'-P-C4' energy: -38.461 flat angles P-C4'-P energy: -13.472 tors. eta vs tors. theta energy: -18.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -448.016510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.016510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.016510 (E_RNA) where: Base-Base interactions energy: -296.630 where: short stacking energy: -143.161 Base-Backbone interact. energy: -0.251 local terms energy: -151.135226 where: bonds (distance) C4'-P energy: -29.594 bonds (distance) P-C4' energy: -32.120 flat angles C4'-P-C4' energy: -33.748 flat angles P-C4'-P energy: -23.992 tors. eta vs tors. theta energy: -31.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -383.022049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.022049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.022049 (E_RNA) where: Base-Base interactions energy: -262.450 where: short stacking energy: -120.227 Base-Backbone interact. energy: -1.289 local terms energy: -119.282813 where: bonds (distance) C4'-P energy: -28.941 bonds (distance) P-C4' energy: -31.319 flat angles C4'-P-C4' energy: -24.656 flat angles P-C4'-P energy: -12.731 tors. eta vs tors. theta energy: -21.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -619.275870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.275870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.275870 (E_RNA) where: Base-Base interactions energy: -434.891 where: short stacking energy: -194.121 Base-Backbone interact. energy: -0.466 local terms energy: -183.919297 where: bonds (distance) C4'-P energy: -38.443 bonds (distance) P-C4' energy: -43.868 flat angles C4'-P-C4' energy: -38.314 flat angles P-C4'-P energy: -17.575 tors. eta vs tors. theta energy: -45.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -598.696063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.696063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.696063 (E_RNA) where: Base-Base interactions energy: -405.270 where: short stacking energy: -174.832 Base-Backbone interact. energy: -0.737 local terms energy: -192.689562 where: bonds (distance) C4'-P energy: -42.778 bonds (distance) P-C4' energy: -43.479 flat angles C4'-P-C4' energy: -37.732 flat angles P-C4'-P energy: -23.080 tors. eta vs tors. theta energy: -45.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -584.000694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.000694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.000694 (E_RNA) where: Base-Base interactions energy: -400.610 where: short stacking energy: -169.864 Base-Backbone interact. energy: -1.358 local terms energy: -182.032857 where: bonds (distance) C4'-P energy: -28.999 bonds (distance) P-C4' energy: -38.131 flat angles C4'-P-C4' energy: -44.670 flat angles P-C4'-P energy: -31.814 tors. eta vs tors. theta energy: -38.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -544.497794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.497794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.497794 (E_RNA) where: Base-Base interactions energy: -379.733 where: short stacking energy: -163.566 Base-Backbone interact. energy: 1.157 local terms energy: -165.922441 where: bonds (distance) C4'-P energy: -32.546 bonds (distance) P-C4' energy: -34.500 flat angles C4'-P-C4' energy: -37.012 flat angles P-C4'-P energy: -22.536 tors. eta vs tors. theta energy: -39.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -548.483025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.483025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.483025 (E_RNA) where: Base-Base interactions energy: -384.160 where: short stacking energy: -157.362 Base-Backbone interact. energy: -1.140 local terms energy: -163.183116 where: bonds (distance) C4'-P energy: -37.112 bonds (distance) P-C4' energy: -29.542 flat angles C4'-P-C4' energy: -38.443 flat angles P-C4'-P energy: -19.798 tors. eta vs tors. theta energy: -38.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -493.832156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.832156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.832156 (E_RNA) where: Base-Base interactions energy: -343.058 where: short stacking energy: -162.146 Base-Backbone interact. energy: 3.267 local terms energy: -154.041317 where: bonds (distance) C4'-P energy: -37.819 bonds (distance) P-C4' energy: -30.960 flat angles C4'-P-C4' energy: -31.946 flat angles P-C4'-P energy: -22.724 tors. eta vs tors. theta energy: -30.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -446.739871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.739871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.739871 (E_RNA) where: Base-Base interactions energy: -301.342 where: short stacking energy: -131.432 Base-Backbone interact. energy: 0.360 local terms energy: -145.757816 where: bonds (distance) C4'-P energy: -30.313 bonds (distance) P-C4' energy: -36.758 flat angles C4'-P-C4' energy: -35.782 flat angles P-C4'-P energy: -16.118 tors. eta vs tors. theta energy: -26.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -428.198329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.198329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.198329 (E_RNA) where: Base-Base interactions energy: -277.932 where: short stacking energy: -137.975 Base-Backbone interact. energy: -0.864 local terms energy: -149.402762 where: bonds (distance) C4'-P energy: -31.652 bonds (distance) P-C4' energy: -33.656 flat angles C4'-P-C4' energy: -32.769 flat angles P-C4'-P energy: -25.162 tors. eta vs tors. theta energy: -26.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -472.449580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.449580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.449580 (E_RNA) where: Base-Base interactions energy: -341.539 where: short stacking energy: -131.871 Base-Backbone interact. energy: -1.104 local terms energy: -129.806678 where: bonds (distance) C4'-P energy: -30.040 bonds (distance) P-C4' energy: -25.247 flat angles C4'-P-C4' energy: -29.863 flat angles P-C4'-P energy: -21.680 tors. eta vs tors. theta energy: -22.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -357.781709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.781709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.781709 (E_RNA) where: Base-Base interactions energy: -233.204 where: short stacking energy: -101.378 Base-Backbone interact. energy: -1.757 local terms energy: -122.821025 where: bonds (distance) C4'-P energy: -23.572 bonds (distance) P-C4' energy: -32.173 flat angles C4'-P-C4' energy: -31.230 flat angles P-C4'-P energy: -20.870 tors. eta vs tors. theta energy: -14.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -630.078683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.078683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.078683 (E_RNA) where: Base-Base interactions energy: -437.013 where: short stacking energy: -199.700 Base-Backbone interact. energy: -0.289 local terms energy: -192.777485 where: bonds (distance) C4'-P energy: -39.824 bonds (distance) P-C4' energy: -37.459 flat angles C4'-P-C4' energy: -41.017 flat angles P-C4'-P energy: -27.397 tors. eta vs tors. theta energy: -47.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -579.650106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.650106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.650106 (E_RNA) where: Base-Base interactions energy: -393.626 where: short stacking energy: -176.597 Base-Backbone interact. energy: -0.996 local terms energy: -185.028237 where: bonds (distance) C4'-P energy: -35.664 bonds (distance) P-C4' energy: -43.426 flat angles C4'-P-C4' energy: -36.483 flat angles P-C4'-P energy: -29.630 tors. eta vs tors. theta energy: -39.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -575.670695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.670695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.670695 (E_RNA) where: Base-Base interactions energy: -398.743 where: short stacking energy: -183.087 Base-Backbone interact. energy: -1.004 local terms energy: -175.923372 where: bonds (distance) C4'-P energy: -35.783 bonds (distance) P-C4' energy: -35.815 flat angles C4'-P-C4' energy: -36.636 flat angles P-C4'-P energy: -20.586 tors. eta vs tors. theta energy: -47.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -561.686717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.686717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.686717 (E_RNA) where: Base-Base interactions energy: -394.462 where: short stacking energy: -179.333 Base-Backbone interact. energy: -0.068 local terms energy: -167.156508 where: bonds (distance) C4'-P energy: -35.920 bonds (distance) P-C4' energy: -33.979 flat angles C4'-P-C4' energy: -29.513 flat angles P-C4'-P energy: -27.685 tors. eta vs tors. theta energy: -40.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -531.194954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.194954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.194954 (E_RNA) where: Base-Base interactions energy: -364.211 where: short stacking energy: -154.198 Base-Backbone interact. energy: -0.203 local terms energy: -166.780827 where: bonds (distance) C4'-P energy: -37.947 bonds (distance) P-C4' energy: -28.263 flat angles C4'-P-C4' energy: -34.565 flat angles P-C4'-P energy: -26.725 tors. eta vs tors. theta energy: -39.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -515.959682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.959682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.959682 (E_RNA) where: Base-Base interactions energy: -355.235 where: short stacking energy: -151.824 Base-Backbone interact. energy: 1.138 local terms energy: -161.863141 where: bonds (distance) C4'-P energy: -29.246 bonds (distance) P-C4' energy: -39.019 flat angles C4'-P-C4' energy: -37.937 flat angles P-C4'-P energy: -23.547 tors. eta vs tors. theta energy: -32.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -454.754506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.754506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.754506 (E_RNA) where: Base-Base interactions energy: -304.343 where: short stacking energy: -133.477 Base-Backbone interact. energy: 0.626 local terms energy: -151.038297 where: bonds (distance) C4'-P energy: -28.310 bonds (distance) P-C4' energy: -39.809 flat angles C4'-P-C4' energy: -34.101 flat angles P-C4'-P energy: -22.204 tors. eta vs tors. theta energy: -26.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -513.358242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.358242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.358242 (E_RNA) where: Base-Base interactions energy: -364.868 where: short stacking energy: -162.917 Base-Backbone interact. energy: -0.426 local terms energy: -148.063479 where: bonds (distance) C4'-P energy: -26.719 bonds (distance) P-C4' energy: -30.971 flat angles C4'-P-C4' energy: -33.032 flat angles P-C4'-P energy: -25.389 tors. eta vs tors. theta energy: -31.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -404.680577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.680577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.680577 (E_RNA) where: Base-Base interactions energy: -268.834 where: short stacking energy: -116.413 Base-Backbone interact. energy: -0.236 local terms energy: -135.610081 where: bonds (distance) C4'-P energy: -28.338 bonds (distance) P-C4' energy: -31.217 flat angles C4'-P-C4' energy: -36.227 flat angles P-C4'-P energy: -18.263 tors. eta vs tors. theta energy: -21.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -388.182362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.182362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.182362 (E_RNA) where: Base-Base interactions energy: -240.802 where: short stacking energy: -105.704 Base-Backbone interact. energy: 0.561 local terms energy: -147.941248 where: bonds (distance) C4'-P energy: -39.222 bonds (distance) P-C4' energy: -39.379 flat angles C4'-P-C4' energy: -32.762 flat angles P-C4'-P energy: -18.923 tors. eta vs tors. theta energy: -17.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -632.032261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.032261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.032261 (E_RNA) where: Base-Base interactions energy: -430.420 where: short stacking energy: -197.306 Base-Backbone interact. energy: -0.184 local terms energy: -201.427529 where: bonds (distance) C4'-P energy: -36.571 bonds (distance) P-C4' energy: -39.537 flat angles C4'-P-C4' energy: -42.496 flat angles P-C4'-P energy: -35.427 tors. eta vs tors. theta energy: -47.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -597.779792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.779792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.779792 (E_RNA) where: Base-Base interactions energy: -425.089 where: short stacking energy: -177.926 Base-Backbone interact. energy: -1.055 local terms energy: -171.635612 where: bonds (distance) C4'-P energy: -29.048 bonds (distance) P-C4' energy: -34.154 flat angles C4'-P-C4' energy: -39.431 flat angles P-C4'-P energy: -20.844 tors. eta vs tors. theta energy: -48.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -588.808448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.808448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.808448 (E_RNA) where: Base-Base interactions energy: -408.998 where: short stacking energy: -175.641 Base-Backbone interact. energy: -0.197 local terms energy: -179.613613 where: bonds (distance) C4'-P energy: -33.507 bonds (distance) P-C4' energy: -39.200 flat angles C4'-P-C4' energy: -36.012 flat angles P-C4'-P energy: -24.790 tors. eta vs tors. theta energy: -46.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -568.162336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.162336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.162336 (E_RNA) where: Base-Base interactions energy: -387.054 where: short stacking energy: -181.359 Base-Backbone interact. energy: -0.653 local terms energy: -180.455630 where: bonds (distance) C4'-P energy: -30.898 bonds (distance) P-C4' energy: -37.037 flat angles C4'-P-C4' energy: -38.472 flat angles P-C4'-P energy: -28.832 tors. eta vs tors. theta energy: -45.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -560.542573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.542573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.542573 (E_RNA) where: Base-Base interactions energy: -390.120 where: short stacking energy: -168.782 Base-Backbone interact. energy: 0.735 local terms energy: -171.157865 where: bonds (distance) C4'-P energy: -38.267 bonds (distance) P-C4' energy: -35.142 flat angles C4'-P-C4' energy: -37.768 flat angles P-C4'-P energy: -27.271 tors. eta vs tors. theta energy: -32.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -523.454608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.454608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.454608 (E_RNA) where: Base-Base interactions energy: -360.122 where: short stacking energy: -150.820 Base-Backbone interact. energy: 0.404 local terms energy: -163.736899 where: bonds (distance) C4'-P energy: -38.564 bonds (distance) P-C4' energy: -36.483 flat angles C4'-P-C4' energy: -38.710 flat angles P-C4'-P energy: -21.737 tors. eta vs tors. theta energy: -28.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -564.942795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.942795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.942795 (E_RNA) where: Base-Base interactions energy: -416.157 where: short stacking energy: -169.121 Base-Backbone interact. energy: -0.103 local terms energy: -148.683100 where: bonds (distance) C4'-P energy: -32.476 bonds (distance) P-C4' energy: -30.114 flat angles C4'-P-C4' energy: -32.022 flat angles P-C4'-P energy: -18.480 tors. eta vs tors. theta energy: -35.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -431.538567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.538567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.538567 (E_RNA) where: Base-Base interactions energy: -299.376 where: short stacking energy: -137.846 Base-Backbone interact. energy: -0.802 local terms energy: -131.360288 where: bonds (distance) C4'-P energy: -29.915 bonds (distance) P-C4' energy: -33.750 flat angles C4'-P-C4' energy: -27.704 flat angles P-C4'-P energy: -14.852 tors. eta vs tors. theta energy: -25.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -406.084191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.084191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.084191 (E_RNA) where: Base-Base interactions energy: -264.810 where: short stacking energy: -130.860 Base-Backbone interact. energy: -0.271 local terms energy: -141.002457 where: bonds (distance) C4'-P energy: -28.742 bonds (distance) P-C4' energy: -34.576 flat angles C4'-P-C4' energy: -33.792 flat angles P-C4'-P energy: -18.885 tors. eta vs tors. theta energy: -25.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -362.911490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.911490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.911490 (E_RNA) where: Base-Base interactions energy: -228.527 where: short stacking energy: -109.975 Base-Backbone interact. energy: 0.884 local terms energy: -135.268673 where: bonds (distance) C4'-P energy: -30.535 bonds (distance) P-C4' energy: -30.078 flat angles C4'-P-C4' energy: -34.054 flat angles P-C4'-P energy: -24.916 tors. eta vs tors. theta energy: -15.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -629.041088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.041088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.041088 (E_RNA) where: Base-Base interactions energy: -429.099 where: short stacking energy: -200.753 Base-Backbone interact. energy: -1.309 local terms energy: -198.632960 where: bonds (distance) C4'-P energy: -39.873 bonds (distance) P-C4' energy: -38.521 flat angles C4'-P-C4' energy: -42.111 flat angles P-C4'-P energy: -30.038 tors. eta vs tors. theta energy: -48.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -608.692031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.692031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.692031 (E_RNA) where: Base-Base interactions energy: -417.449 where: short stacking energy: -188.581 Base-Backbone interact. energy: -0.289 local terms energy: -190.953746 where: bonds (distance) C4'-P energy: -38.704 bonds (distance) P-C4' energy: -37.915 flat angles C4'-P-C4' energy: -39.977 flat angles P-C4'-P energy: -27.135 tors. eta vs tors. theta energy: -47.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -617.017483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.017483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.017483 (E_RNA) where: Base-Base interactions energy: -443.480 where: short stacking energy: -192.837 Base-Backbone interact. energy: -0.470 local terms energy: -173.067423 where: bonds (distance) C4'-P energy: -38.446 bonds (distance) P-C4' energy: -29.924 flat angles C4'-P-C4' energy: -33.645 flat angles P-C4'-P energy: -23.769 tors. eta vs tors. theta energy: -47.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -537.801316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.801316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.801316 (E_RNA) where: Base-Base interactions energy: -361.748 where: short stacking energy: -175.259 Base-Backbone interact. energy: -1.309 local terms energy: -174.744188 where: bonds (distance) C4'-P energy: -32.944 bonds (distance) P-C4' energy: -37.173 flat angles C4'-P-C4' energy: -41.338 flat angles P-C4'-P energy: -22.529 tors. eta vs tors. theta energy: -40.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -596.364398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.364398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.364398 (E_RNA) where: Base-Base interactions energy: -435.826 where: short stacking energy: -175.945 Base-Backbone interact. energy: 1.326 local terms energy: -161.865094 where: bonds (distance) C4'-P energy: -28.037 bonds (distance) P-C4' energy: -29.900 flat angles C4'-P-C4' energy: -38.823 flat angles P-C4'-P energy: -24.320 tors. eta vs tors. theta energy: -40.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -570.117804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.117804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.117804 (E_RNA) where: Base-Base interactions energy: -385.725 where: short stacking energy: -176.263 Base-Backbone interact. energy: -1.145 local terms energy: -183.247659 where: bonds (distance) C4'-P energy: -35.351 bonds (distance) P-C4' energy: -34.368 flat angles C4'-P-C4' energy: -41.689 flat angles P-C4'-P energy: -25.607 tors. eta vs tors. theta energy: -46.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -507.070291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.070291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.070291 (E_RNA) where: Base-Base interactions energy: -360.660 where: short stacking energy: -142.991 Base-Backbone interact. energy: -0.471 local terms energy: -145.939273 where: bonds (distance) C4'-P energy: -30.119 bonds (distance) P-C4' energy: -26.834 flat angles C4'-P-C4' energy: -30.424 flat angles P-C4'-P energy: -25.615 tors. eta vs tors. theta energy: -32.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -417.769962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.769962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.769962 (E_RNA) where: Base-Base interactions energy: -288.972 where: short stacking energy: -125.690 Base-Backbone interact. energy: 2.179 local terms energy: -130.976327 where: bonds (distance) C4'-P energy: -20.446 bonds (distance) P-C4' energy: -33.804 flat angles C4'-P-C4' energy: -36.576 flat angles P-C4'-P energy: -19.723 tors. eta vs tors. theta energy: -20.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -429.323103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.323103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.323103 (E_RNA) where: Base-Base interactions energy: -281.348 where: short stacking energy: -131.803 Base-Backbone interact. energy: 0.038 local terms energy: -148.013224 where: bonds (distance) C4'-P energy: -32.347 bonds (distance) P-C4' energy: -33.940 flat angles C4'-P-C4' energy: -34.625 flat angles P-C4'-P energy: -23.898 tors. eta vs tors. theta energy: -23.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -366.776103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.776103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.776103 (E_RNA) where: Base-Base interactions energy: -236.741 where: short stacking energy: -105.984 Base-Backbone interact. energy: -0.180 local terms energy: -129.854711 where: bonds (distance) C4'-P energy: -30.221 bonds (distance) P-C4' energy: -30.594 flat angles C4'-P-C4' energy: -30.350 flat angles P-C4'-P energy: -21.969 tors. eta vs tors. theta energy: -16.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -619.901176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.901176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.901176 (E_RNA) where: Base-Base interactions energy: -430.675 where: short stacking energy: -203.410 Base-Backbone interact. energy: -0.386 local terms energy: -188.840545 where: bonds (distance) C4'-P energy: -37.781 bonds (distance) P-C4' energy: -35.390 flat angles C4'-P-C4' energy: -38.142 flat angles P-C4'-P energy: -28.683 tors. eta vs tors. theta energy: -48.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -628.132462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.132462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.132462 (E_RNA) where: Base-Base interactions energy: -442.521 where: short stacking energy: -176.689 Base-Backbone interact. energy: -0.628 local terms energy: -184.983162 where: bonds (distance) C4'-P energy: -34.640 bonds (distance) P-C4' energy: -37.094 flat angles C4'-P-C4' energy: -39.959 flat angles P-C4'-P energy: -28.411 tors. eta vs tors. theta energy: -44.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -622.430242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.430242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.430242 (E_RNA) where: Base-Base interactions energy: -447.711 where: short stacking energy: -184.311 Base-Backbone interact. energy: -0.124 local terms energy: -174.595180 where: bonds (distance) C4'-P energy: -35.985 bonds (distance) P-C4' energy: -32.868 flat angles C4'-P-C4' energy: -39.997 flat angles P-C4'-P energy: -16.310 tors. eta vs tors. theta energy: -49.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -549.190269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.190269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.190269 (E_RNA) where: Base-Base interactions energy: -383.804 where: short stacking energy: -177.664 Base-Backbone interact. energy: -1.060 local terms energy: -164.325721 where: bonds (distance) C4'-P energy: -30.116 bonds (distance) P-C4' energy: -39.993 flat angles C4'-P-C4' energy: -39.974 flat angles P-C4'-P energy: -19.150 tors. eta vs tors. theta energy: -35.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -621.325446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.325446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.325446 (E_RNA) where: Base-Base interactions energy: -436.421 where: short stacking energy: -182.096 Base-Backbone interact. energy: 1.791 local terms energy: -186.694877 where: bonds (distance) C4'-P energy: -29.796 bonds (distance) P-C4' energy: -39.377 flat angles C4'-P-C4' energy: -41.992 flat angles P-C4'-P energy: -30.546 tors. eta vs tors. theta energy: -44.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -617.067705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.067705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.067705 (E_RNA) where: Base-Base interactions energy: -433.374 where: short stacking energy: -183.123 Base-Backbone interact. energy: 2.641 local terms energy: -186.335296 where: bonds (distance) C4'-P energy: -36.490 bonds (distance) P-C4' energy: -32.646 flat angles C4'-P-C4' energy: -41.031 flat angles P-C4'-P energy: -28.235 tors. eta vs tors. theta energy: -47.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -485.093401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.093401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.093401 (E_RNA) where: Base-Base interactions energy: -327.579 where: short stacking energy: -129.909 Base-Backbone interact. energy: -0.771 local terms energy: -156.744190 where: bonds (distance) C4'-P energy: -39.353 bonds (distance) P-C4' energy: -37.857 flat angles C4'-P-C4' energy: -28.659 flat angles P-C4'-P energy: -21.420 tors. eta vs tors. theta energy: -29.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -407.880355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.880355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.880355 (E_RNA) where: Base-Base interactions energy: -276.842 where: short stacking energy: -140.257 Base-Backbone interact. energy: -0.689 local terms energy: -130.349727 where: bonds (distance) C4'-P energy: -35.983 bonds (distance) P-C4' energy: -20.390 flat angles C4'-P-C4' energy: -32.937 flat angles P-C4'-P energy: -12.952 tors. eta vs tors. theta energy: -28.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -378.071452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.071452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.071452 (E_RNA) where: Base-Base interactions energy: -236.243 where: short stacking energy: -113.795 Base-Backbone interact. energy: -1.227 local terms energy: -140.600984 where: bonds (distance) C4'-P energy: -28.275 bonds (distance) P-C4' energy: -33.172 flat angles C4'-P-C4' energy: -37.677 flat angles P-C4'-P energy: -24.548 tors. eta vs tors. theta energy: -16.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -395.339181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.339181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.339181 (E_RNA) where: Base-Base interactions energy: -270.555 where: short stacking energy: -130.230 Base-Backbone interact. energy: 0.083 local terms energy: -124.867485 where: bonds (distance) C4'-P energy: -33.637 bonds (distance) P-C4' energy: -24.573 flat angles C4'-P-C4' energy: -28.304 flat angles P-C4'-P energy: -20.756 tors. eta vs tors. theta energy: -17.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -625.485257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.485257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.485257 (E_RNA) where: Base-Base interactions energy: -435.931 where: short stacking energy: -191.704 Base-Backbone interact. energy: -1.006 local terms energy: -188.548462 where: bonds (distance) C4'-P energy: -36.747 bonds (distance) P-C4' energy: -37.198 flat angles C4'-P-C4' energy: -43.406 flat angles P-C4'-P energy: -26.412 tors. eta vs tors. theta energy: -44.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -648.627327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.627327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.627327 (E_RNA) where: Base-Base interactions energy: -455.800 where: short stacking energy: -199.855 Base-Backbone interact. energy: -0.648 local terms energy: -192.179304 where: bonds (distance) C4'-P energy: -36.986 bonds (distance) P-C4' energy: -35.410 flat angles C4'-P-C4' energy: -40.215 flat angles P-C4'-P energy: -28.127 tors. eta vs tors. theta energy: -51.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -593.392527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.392527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.392527 (E_RNA) where: Base-Base interactions energy: -408.448 where: short stacking energy: -175.821 Base-Backbone interact. energy: -0.597 local terms energy: -184.346837 where: bonds (distance) C4'-P energy: -31.951 bonds (distance) P-C4' energy: -39.502 flat angles C4'-P-C4' energy: -41.482 flat angles P-C4'-P energy: -29.530 tors. eta vs tors. theta energy: -41.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -639.918613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.918613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.918613 (E_RNA) where: Base-Base interactions energy: -454.560 where: short stacking energy: -184.377 Base-Backbone interact. energy: 2.022 local terms energy: -187.380772 where: bonds (distance) C4'-P energy: -37.404 bonds (distance) P-C4' energy: -37.373 flat angles C4'-P-C4' energy: -39.716 flat angles P-C4'-P energy: -27.699 tors. eta vs tors. theta energy: -45.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -498.329643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.329643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.329643 (E_RNA) where: Base-Base interactions energy: -344.108 where: short stacking energy: -151.126 Base-Backbone interact. energy: 1.190 local terms energy: -155.411487 where: bonds (distance) C4'-P energy: -33.170 bonds (distance) P-C4' energy: -37.007 flat angles C4'-P-C4' energy: -39.985 flat angles P-C4'-P energy: -14.702 tors. eta vs tors. theta energy: -30.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -599.565805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.565805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.565805 (E_RNA) where: Base-Base interactions energy: -439.712 where: short stacking energy: -190.001 Base-Backbone interact. energy: -0.275 local terms energy: -159.578105 where: bonds (distance) C4'-P energy: -28.113 bonds (distance) P-C4' energy: -29.578 flat angles C4'-P-C4' energy: -35.097 flat angles P-C4'-P energy: -21.217 tors. eta vs tors. theta energy: -45.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -497.840843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.840843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.840843 (E_RNA) where: Base-Base interactions energy: -328.354 where: short stacking energy: -143.798 Base-Backbone interact. energy: -0.414 local terms energy: -169.072956 where: bonds (distance) C4'-P energy: -33.463 bonds (distance) P-C4' energy: -30.638 flat angles C4'-P-C4' energy: -37.385 flat angles P-C4'-P energy: -25.158 tors. eta vs tors. theta energy: -42.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -429.130438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.130438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.130438 (E_RNA) where: Base-Base interactions energy: -295.361 where: short stacking energy: -124.134 Base-Backbone interact. energy: 0.459 local terms energy: -134.228016 where: bonds (distance) C4'-P energy: -22.504 bonds (distance) P-C4' energy: -24.754 flat angles C4'-P-C4' energy: -41.631 flat angles P-C4'-P energy: -21.475 tors. eta vs tors. theta energy: -23.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -390.536036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.536036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.536036 (E_RNA) where: Base-Base interactions energy: -253.900 where: short stacking energy: -133.539 Base-Backbone interact. energy: -0.316 local terms energy: -136.320303 where: bonds (distance) C4'-P energy: -26.407 bonds (distance) P-C4' energy: -36.137 flat angles C4'-P-C4' energy: -31.364 flat angles P-C4'-P energy: -17.611 tors. eta vs tors. theta energy: -24.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -421.048470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.048470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.048470 (E_RNA) where: Base-Base interactions energy: -302.642 where: short stacking energy: -122.973 Base-Backbone interact. energy: 1.712 local terms energy: -120.118853 where: bonds (distance) C4'-P energy: -19.332 bonds (distance) P-C4' energy: -36.775 flat angles C4'-P-C4' energy: -24.638 flat angles P-C4'-P energy: -16.066 tors. eta vs tors. theta energy: -23.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -656.760157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.760157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.760157 (E_RNA) where: Base-Base interactions energy: -457.978 where: short stacking energy: -197.228 Base-Backbone interact. energy: -0.846 local terms energy: -197.935452 where: bonds (distance) C4'-P energy: -32.962 bonds (distance) P-C4' energy: -40.049 flat angles C4'-P-C4' energy: -41.355 flat angles P-C4'-P energy: -32.968 tors. eta vs tors. theta energy: -50.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -613.669265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.669265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.669265 (E_RNA) where: Base-Base interactions energy: -438.779 where: short stacking energy: -186.060 Base-Backbone interact. energy: -1.068 local terms energy: -173.822524 where: bonds (distance) C4'-P energy: -27.596 bonds (distance) P-C4' energy: -39.413 flat angles C4'-P-C4' energy: -37.291 flat angles P-C4'-P energy: -23.637 tors. eta vs tors. theta energy: -45.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -630.852841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.852841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.852841 (E_RNA) where: Base-Base interactions energy: -438.644 where: short stacking energy: -174.649 Base-Backbone interact. energy: 0.344 local terms energy: -192.552616 where: bonds (distance) C4'-P energy: -40.739 bonds (distance) P-C4' energy: -34.185 flat angles C4'-P-C4' energy: -46.923 flat angles P-C4'-P energy: -30.395 tors. eta vs tors. theta energy: -40.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -587.364262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.364262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.364262 (E_RNA) where: Base-Base interactions energy: -413.699 where: short stacking energy: -190.346 Base-Backbone interact. energy: 0.338 local terms energy: -174.002962 where: bonds (distance) C4'-P energy: -26.645 bonds (distance) P-C4' energy: -39.882 flat angles C4'-P-C4' energy: -41.485 flat angles P-C4'-P energy: -17.125 tors. eta vs tors. theta energy: -48.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -611.547864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.547864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.547864 (E_RNA) where: Base-Base interactions energy: -430.062 where: short stacking energy: -192.752 Base-Backbone interact. energy: -0.257 local terms energy: -181.229542 where: bonds (distance) C4'-P energy: -33.858 bonds (distance) P-C4' energy: -29.360 flat angles C4'-P-C4' energy: -44.157 flat angles P-C4'-P energy: -26.010 tors. eta vs tors. theta energy: -47.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -485.014787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.014787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.014787 (E_RNA) where: Base-Base interactions energy: -327.384 where: short stacking energy: -142.503 Base-Backbone interact. energy: 0.157 local terms energy: -157.787795 where: bonds (distance) C4'-P energy: -37.750 bonds (distance) P-C4' energy: -32.357 flat angles C4'-P-C4' energy: -36.038 flat angles P-C4'-P energy: -17.537 tors. eta vs tors. theta energy: -34.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -499.336864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.336864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.336864 (E_RNA) where: Base-Base interactions energy: -359.044 where: short stacking energy: -151.105 Base-Backbone interact. energy: -0.169 local terms energy: -140.123676 where: bonds (distance) C4'-P energy: -30.581 bonds (distance) P-C4' energy: -37.165 flat angles C4'-P-C4' energy: -34.008 flat angles P-C4'-P energy: -12.247 tors. eta vs tors. theta energy: -26.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -431.233217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.233217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.233217 (E_RNA) where: Base-Base interactions energy: -283.691 where: short stacking energy: -124.966 Base-Backbone interact. energy: -1.167 local terms energy: -146.375950 where: bonds (distance) C4'-P energy: -33.904 bonds (distance) P-C4' energy: -32.179 flat angles C4'-P-C4' energy: -34.163 flat angles P-C4'-P energy: -28.063 tors. eta vs tors. theta energy: -18.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -413.504300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.504300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.504300 (E_RNA) where: Base-Base interactions energy: -275.626 where: short stacking energy: -133.785 Base-Backbone interact. energy: -1.425 local terms energy: -136.453329 where: bonds (distance) C4'-P energy: -31.023 bonds (distance) P-C4' energy: -30.807 flat angles C4'-P-C4' energy: -30.370 flat angles P-C4'-P energy: -16.286 tors. eta vs tors. theta energy: -27.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -408.056939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.056939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.056939 (E_RNA) where: Base-Base interactions energy: -266.574 where: short stacking energy: -121.110 Base-Backbone interact. energy: -0.492 local terms energy: -140.990993 where: bonds (distance) C4'-P energy: -34.115 bonds (distance) P-C4' energy: -30.762 flat angles C4'-P-C4' energy: -33.437 flat angles P-C4'-P energy: -20.365 tors. eta vs tors. theta energy: -22.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -651.059188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.059188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.059188 (E_RNA) where: Base-Base interactions energy: -464.308 where: short stacking energy: -197.958 Base-Backbone interact. energy: -1.605 local terms energy: -185.145783 where: bonds (distance) C4'-P energy: -34.580 bonds (distance) P-C4' energy: -33.184 flat angles C4'-P-C4' energy: -42.968 flat angles P-C4'-P energy: -28.788 tors. eta vs tors. theta energy: -45.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -659.928650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.928650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.928650 (E_RNA) where: Base-Base interactions energy: -469.655 where: short stacking energy: -192.459 Base-Backbone interact. energy: 1.760 local terms energy: -192.033129 where: bonds (distance) C4'-P energy: -35.110 bonds (distance) P-C4' energy: -34.746 flat angles C4'-P-C4' energy: -43.627 flat angles P-C4'-P energy: -26.795 tors. eta vs tors. theta energy: -51.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -618.548178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.548178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.548178 (E_RNA) where: Base-Base interactions energy: -425.496 where: short stacking energy: -201.927 Base-Backbone interact. energy: -0.959 local terms energy: -192.092601 where: bonds (distance) C4'-P energy: -38.749 bonds (distance) P-C4' energy: -31.771 flat angles C4'-P-C4' energy: -38.227 flat angles P-C4'-P energy: -27.528 tors. eta vs tors. theta energy: -55.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -629.801599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.801599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.801599 (E_RNA) where: Base-Base interactions energy: -434.664 where: short stacking energy: -189.569 Base-Backbone interact. energy: -0.762 local terms energy: -194.375927 where: bonds (distance) C4'-P energy: -39.888 bonds (distance) P-C4' energy: -37.232 flat angles C4'-P-C4' energy: -40.618 flat angles P-C4'-P energy: -21.036 tors. eta vs tors. theta energy: -55.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -559.243630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.243630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.243630 (E_RNA) where: Base-Base interactions energy: -392.508 where: short stacking energy: -174.390 Base-Backbone interact. energy: -0.433 local terms energy: -166.302931 where: bonds (distance) C4'-P energy: -33.339 bonds (distance) P-C4' energy: -36.256 flat angles C4'-P-C4' energy: -34.374 flat angles P-C4'-P energy: -19.491 tors. eta vs tors. theta energy: -42.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -513.265712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.265712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.265712 (E_RNA) where: Base-Base interactions energy: -350.647 where: short stacking energy: -154.942 Base-Backbone interact. energy: 0.005 local terms energy: -162.623198 where: bonds (distance) C4'-P energy: -34.376 bonds (distance) P-C4' energy: -30.879 flat angles C4'-P-C4' energy: -36.825 flat angles P-C4'-P energy: -23.893 tors. eta vs tors. theta energy: -36.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -494.931275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.931275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.931275 (E_RNA) where: Base-Base interactions energy: -345.496 where: short stacking energy: -159.105 Base-Backbone interact. energy: -0.646 local terms energy: -148.789322 where: bonds (distance) C4'-P energy: -28.343 bonds (distance) P-C4' energy: -24.842 flat angles C4'-P-C4' energy: -32.564 flat angles P-C4'-P energy: -20.828 tors. eta vs tors. theta energy: -42.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -451.600232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.600232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.600232 (E_RNA) where: Base-Base interactions energy: -308.959 where: short stacking energy: -123.630 Base-Backbone interact. energy: 0.472 local terms energy: -143.113274 where: bonds (distance) C4'-P energy: -35.098 bonds (distance) P-C4' energy: -24.885 flat angles C4'-P-C4' energy: -39.354 flat angles P-C4'-P energy: -23.225 tors. eta vs tors. theta energy: -20.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -412.499322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.499322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.499322 (E_RNA) where: Base-Base interactions energy: -272.598 where: short stacking energy: -129.409 Base-Backbone interact. energy: 1.331 local terms energy: -141.232026 where: bonds (distance) C4'-P energy: -27.305 bonds (distance) P-C4' energy: -29.612 flat angles C4'-P-C4' energy: -37.577 flat angles P-C4'-P energy: -19.701 tors. eta vs tors. theta energy: -27.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -367.263583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.263583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.263583 (E_RNA) where: Base-Base interactions energy: -238.629 where: short stacking energy: -102.800 Base-Backbone interact. energy: -0.314 local terms energy: -128.320442 where: bonds (distance) C4'-P energy: -31.468 bonds (distance) P-C4' energy: -27.513 flat angles C4'-P-C4' energy: -31.083 flat angles P-C4'-P energy: -17.309 tors. eta vs tors. theta energy: -20.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -668.211696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.211696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.211696 (E_RNA) where: Base-Base interactions energy: -480.258 where: short stacking energy: -194.310 Base-Backbone interact. energy: 1.787 local terms energy: -189.740670 where: bonds (distance) C4'-P energy: -34.525 bonds (distance) P-C4' energy: -36.414 flat angles C4'-P-C4' energy: -43.600 flat angles P-C4'-P energy: -29.247 tors. eta vs tors. theta energy: -45.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -649.516705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.516705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.516705 (E_RNA) where: Base-Base interactions energy: -452.209 where: short stacking energy: -192.261 Base-Backbone interact. energy: -1.046 local terms energy: -196.261110 where: bonds (distance) C4'-P energy: -41.287 bonds (distance) P-C4' energy: -37.748 flat angles C4'-P-C4' energy: -44.912 flat angles P-C4'-P energy: -24.236 tors. eta vs tors. theta energy: -48.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -641.137749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.137749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.137749 (E_RNA) where: Base-Base interactions energy: -442.218 where: short stacking energy: -191.655 Base-Backbone interact. energy: -0.144 local terms energy: -198.775151 where: bonds (distance) C4'-P energy: -36.712 bonds (distance) P-C4' energy: -38.980 flat angles C4'-P-C4' energy: -42.165 flat angles P-C4'-P energy: -27.029 tors. eta vs tors. theta energy: -53.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -614.328511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.328511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.328511 (E_RNA) where: Base-Base interactions energy: -428.867 where: short stacking energy: -201.890 Base-Backbone interact. energy: -0.054 local terms energy: -185.407314 where: bonds (distance) C4'-P energy: -39.135 bonds (distance) P-C4' energy: -31.014 flat angles C4'-P-C4' energy: -34.635 flat angles P-C4'-P energy: -28.944 tors. eta vs tors. theta energy: -51.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -564.053898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.053898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.053898 (E_RNA) where: Base-Base interactions energy: -410.168 where: short stacking energy: -173.800 Base-Backbone interact. energy: -1.335 local terms energy: -152.550764 where: bonds (distance) C4'-P energy: -30.263 bonds (distance) P-C4' energy: -35.816 flat angles C4'-P-C4' energy: -28.172 flat angles P-C4'-P energy: -21.192 tors. eta vs tors. theta energy: -37.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -516.550604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.550604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.550604 (E_RNA) where: Base-Base interactions energy: -350.270 where: short stacking energy: -153.681 Base-Backbone interact. energy: -0.107 local terms energy: -166.173447 where: bonds (distance) C4'-P energy: -32.135 bonds (distance) P-C4' energy: -36.660 flat angles C4'-P-C4' energy: -39.661 flat angles P-C4'-P energy: -21.604 tors. eta vs tors. theta energy: -36.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -468.566146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.566146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.566146 (E_RNA) where: Base-Base interactions energy: -322.567 where: short stacking energy: -144.812 Base-Backbone interact. energy: -0.678 local terms energy: -145.321056 where: bonds (distance) C4'-P energy: -30.716 bonds (distance) P-C4' energy: -32.141 flat angles C4'-P-C4' energy: -36.224 flat angles P-C4'-P energy: -13.265 tors. eta vs tors. theta energy: -32.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -447.275823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.275823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.275823 (E_RNA) where: Base-Base interactions energy: -285.221 where: short stacking energy: -129.117 Base-Backbone interact. energy: -0.063 local terms energy: -161.991990 where: bonds (distance) C4'-P energy: -36.705 bonds (distance) P-C4' energy: -32.392 flat angles C4'-P-C4' energy: -39.291 flat angles P-C4'-P energy: -25.338 tors. eta vs tors. theta energy: -28.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -410.578473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.578473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.578473 (E_RNA) where: Base-Base interactions energy: -280.993 where: short stacking energy: -134.123 Base-Backbone interact. energy: 1.035 local terms energy: -130.620891 where: bonds (distance) C4'-P energy: -29.106 bonds (distance) P-C4' energy: -26.450 flat angles C4'-P-C4' energy: -30.089 flat angles P-C4'-P energy: -15.717 tors. eta vs tors. theta energy: -29.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -440.511821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.511821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.511821 (E_RNA) where: Base-Base interactions energy: -299.423 where: short stacking energy: -128.431 Base-Backbone interact. energy: -0.960 local terms energy: -140.128291 where: bonds (distance) C4'-P energy: -39.548 bonds (distance) P-C4' energy: -38.466 flat angles C4'-P-C4' energy: -32.230 flat angles P-C4'-P energy: -10.380 tors. eta vs tors. theta energy: -19.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -674.318904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.318904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.318904 (E_RNA) where: Base-Base interactions energy: -479.232 where: short stacking energy: -195.244 Base-Backbone interact. energy: -0.852 local terms energy: -194.234674 where: bonds (distance) C4'-P energy: -36.733 bonds (distance) P-C4' energy: -42.030 flat angles C4'-P-C4' energy: -38.278 flat angles P-C4'-P energy: -26.339 tors. eta vs tors. theta energy: -50.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -669.206556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.206556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.206556 (E_RNA) where: Base-Base interactions energy: -466.405 where: short stacking energy: -207.738 Base-Backbone interact. energy: -0.126 local terms energy: -202.675026 where: bonds (distance) C4'-P energy: -34.785 bonds (distance) P-C4' energy: -39.786 flat angles C4'-P-C4' energy: -45.129 flat angles P-C4'-P energy: -23.282 tors. eta vs tors. theta energy: -59.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -628.588705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.588705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.588705 (E_RNA) where: Base-Base interactions energy: -444.686 where: short stacking energy: -189.670 Base-Backbone interact. energy: -0.563 local terms energy: -183.340418 where: bonds (distance) C4'-P energy: -42.362 bonds (distance) P-C4' energy: -35.206 flat angles C4'-P-C4' energy: -40.532 flat angles P-C4'-P energy: -16.134 tors. eta vs tors. theta energy: -49.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -623.826000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.826000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.826000 (E_RNA) where: Base-Base interactions energy: -432.236 where: short stacking energy: -199.527 Base-Backbone interact. energy: 0.328 local terms energy: -191.918003 where: bonds (distance) C4'-P energy: -31.747 bonds (distance) P-C4' energy: -36.300 flat angles C4'-P-C4' energy: -37.827 flat angles P-C4'-P energy: -32.150 tors. eta vs tors. theta energy: -53.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -552.397179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.397179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.397179 (E_RNA) where: Base-Base interactions energy: -394.127 where: short stacking energy: -168.065 Base-Backbone interact. energy: -0.182 local terms energy: -158.088103 where: bonds (distance) C4'-P energy: -34.096 bonds (distance) P-C4' energy: -34.092 flat angles C4'-P-C4' energy: -34.966 flat angles P-C4'-P energy: -19.239 tors. eta vs tors. theta energy: -35.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -514.315570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.315570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.315570 (E_RNA) where: Base-Base interactions energy: -354.801 where: short stacking energy: -152.206 Base-Backbone interact. energy: 0.207 local terms energy: -159.721950 where: bonds (distance) C4'-P energy: -36.114 bonds (distance) P-C4' energy: -32.071 flat angles C4'-P-C4' energy: -35.329 flat angles P-C4'-P energy: -21.767 tors. eta vs tors. theta energy: -34.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -488.836371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.836371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.836371 (E_RNA) where: Base-Base interactions energy: -353.059 where: short stacking energy: -155.104 Base-Backbone interact. energy: -0.733 local terms energy: -135.044410 where: bonds (distance) C4'-P energy: -28.084 bonds (distance) P-C4' energy: -27.262 flat angles C4'-P-C4' energy: -34.734 flat angles P-C4'-P energy: -13.806 tors. eta vs tors. theta energy: -31.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -440.057787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.057787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.057787 (E_RNA) where: Base-Base interactions energy: -292.179 where: short stacking energy: -127.172 Base-Backbone interact. energy: -0.297 local terms energy: -147.581595 where: bonds (distance) C4'-P energy: -28.767 bonds (distance) P-C4' energy: -36.145 flat angles C4'-P-C4' energy: -32.918 flat angles P-C4'-P energy: -26.761 tors. eta vs tors. theta energy: -22.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -438.353187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.353187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.353187 (E_RNA) where: Base-Base interactions energy: -299.706 where: short stacking energy: -131.345 Base-Backbone interact. energy: -2.005 local terms energy: -136.642189 where: bonds (distance) C4'-P energy: -29.424 bonds (distance) P-C4' energy: -28.333 flat angles C4'-P-C4' energy: -28.181 flat angles P-C4'-P energy: -16.111 tors. eta vs tors. theta energy: -34.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -410.708625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.708625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.708625 (E_RNA) where: Base-Base interactions energy: -268.625 where: short stacking energy: -110.364 Base-Backbone interact. energy: -0.257 local terms energy: -141.827223 where: bonds (distance) C4'-P energy: -29.142 bonds (distance) P-C4' energy: -41.205 flat angles C4'-P-C4' energy: -31.353 flat angles P-C4'-P energy: -22.046 tors. eta vs tors. theta energy: -18.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -696.353425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.353425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.353425 (E_RNA) where: Base-Base interactions energy: -491.009 where: short stacking energy: -215.116 Base-Backbone interact. energy: -0.022 local terms energy: -205.322723 where: bonds (distance) C4'-P energy: -35.823 bonds (distance) P-C4' energy: -37.953 flat angles C4'-P-C4' energy: -44.156 flat angles P-C4'-P energy: -29.602 tors. eta vs tors. theta energy: -57.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -651.169777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.169777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.169777 (E_RNA) where: Base-Base interactions energy: -481.388 where: short stacking energy: -186.458 Base-Backbone interact. energy: 0.007 local terms energy: -169.788629 where: bonds (distance) C4'-P energy: -30.292 bonds (distance) P-C4' energy: -35.981 flat angles C4'-P-C4' energy: -38.601 flat angles P-C4'-P energy: -17.853 tors. eta vs tors. theta energy: -47.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -624.443631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.443631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.443631 (E_RNA) where: Base-Base interactions energy: -428.442 where: short stacking energy: -189.657 Base-Backbone interact. energy: -0.039 local terms energy: -195.962742 where: bonds (distance) C4'-P energy: -31.874 bonds (distance) P-C4' energy: -43.757 flat angles C4'-P-C4' energy: -41.558 flat angles P-C4'-P energy: -27.720 tors. eta vs tors. theta energy: -51.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -595.989090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.989090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.989090 (E_RNA) where: Base-Base interactions energy: -418.933 where: short stacking energy: -183.151 Base-Backbone interact. energy: -0.589 local terms energy: -176.467396 where: bonds (distance) C4'-P energy: -33.775 bonds (distance) P-C4' energy: -37.784 flat angles C4'-P-C4' energy: -37.243 flat angles P-C4'-P energy: -20.829 tors. eta vs tors. theta energy: -46.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -589.477540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.477540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.477540 (E_RNA) where: Base-Base interactions energy: -418.724 where: short stacking energy: -180.580 Base-Backbone interact. energy: -1.219 local terms energy: -169.534825 where: bonds (distance) C4'-P energy: -33.125 bonds (distance) P-C4' energy: -33.467 flat angles C4'-P-C4' energy: -33.992 flat angles P-C4'-P energy: -24.465 tors. eta vs tors. theta energy: -44.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -512.747828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.747828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.747828 (E_RNA) where: Base-Base interactions energy: -362.572 where: short stacking energy: -162.395 Base-Backbone interact. energy: -0.832 local terms energy: -149.343893 where: bonds (distance) C4'-P energy: -30.728 bonds (distance) P-C4' energy: -29.065 flat angles C4'-P-C4' energy: -37.009 flat angles P-C4'-P energy: -19.890 tors. eta vs tors. theta energy: -32.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -519.874736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.874736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.874736 (E_RNA) where: Base-Base interactions energy: -368.994 where: short stacking energy: -154.419 Base-Backbone interact. energy: 0.641 local terms energy: -151.521490 where: bonds (distance) C4'-P energy: -30.248 bonds (distance) P-C4' energy: -31.264 flat angles C4'-P-C4' energy: -31.879 flat angles P-C4'-P energy: -18.402 tors. eta vs tors. theta energy: -39.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -440.042796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.042796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.042796 (E_RNA) where: Base-Base interactions energy: -319.242 where: short stacking energy: -144.393 Base-Backbone interact. energy: 4.769 local terms energy: -125.569677 where: bonds (distance) C4'-P energy: -27.442 bonds (distance) P-C4' energy: -30.678 flat angles C4'-P-C4' energy: -25.500 flat angles P-C4'-P energy: -17.306 tors. eta vs tors. theta energy: -24.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -440.212535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.212535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.212535 (E_RNA) where: Base-Base interactions energy: -315.179 where: short stacking energy: -135.393 Base-Backbone interact. energy: 2.946 local terms energy: -127.979704 where: bonds (distance) C4'-P energy: -26.043 bonds (distance) P-C4' energy: -37.516 flat angles C4'-P-C4' energy: -26.808 flat angles P-C4'-P energy: -16.775 tors. eta vs tors. theta energy: -20.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -413.409642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.409642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.409642 (E_RNA) where: Base-Base interactions energy: -286.559 where: short stacking energy: -120.505 Base-Backbone interact. energy: 0.533 local terms energy: -127.383240 where: bonds (distance) C4'-P energy: -20.369 bonds (distance) P-C4' energy: -31.498 flat angles C4'-P-C4' energy: -31.948 flat angles P-C4'-P energy: -15.829 tors. eta vs tors. theta energy: -27.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -692.860678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.860678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.860678 (E_RNA) where: Base-Base interactions energy: -482.591 where: short stacking energy: -214.765 Base-Backbone interact. energy: 0.132 local terms energy: -210.401254 where: bonds (distance) C4'-P energy: -37.141 bonds (distance) P-C4' energy: -43.087 flat angles C4'-P-C4' energy: -41.196 flat angles P-C4'-P energy: -29.265 tors. eta vs tors. theta energy: -59.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -642.409337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.409337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.409337 (E_RNA) where: Base-Base interactions energy: -460.030 where: short stacking energy: -194.065 Base-Backbone interact. energy: 2.089 local terms energy: -184.467862 where: bonds (distance) C4'-P energy: -33.850 bonds (distance) P-C4' energy: -34.229 flat angles C4'-P-C4' energy: -39.153 flat angles P-C4'-P energy: -28.327 tors. eta vs tors. theta energy: -48.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -626.422531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.422531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.422531 (E_RNA) where: Base-Base interactions energy: -435.873 where: short stacking energy: -188.950 Base-Backbone interact. energy: 0.812 local terms energy: -191.360916 where: bonds (distance) C4'-P energy: -35.745 bonds (distance) P-C4' energy: -41.214 flat angles C4'-P-C4' energy: -37.814 flat angles P-C4'-P energy: -30.534 tors. eta vs tors. theta energy: -46.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -604.838534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.838534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.838534 (E_RNA) where: Base-Base interactions energy: -420.888 where: short stacking energy: -177.742 Base-Backbone interact. energy: -0.088 local terms energy: -183.862187 where: bonds (distance) C4'-P energy: -35.600 bonds (distance) P-C4' energy: -34.269 flat angles C4'-P-C4' energy: -39.688 flat angles P-C4'-P energy: -23.873 tors. eta vs tors. theta energy: -50.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -580.777098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.777098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.777098 (E_RNA) where: Base-Base interactions energy: -398.850 where: short stacking energy: -174.786 Base-Backbone interact. energy: -0.525 local terms energy: -181.401479 where: bonds (distance) C4'-P energy: -32.628 bonds (distance) P-C4' energy: -36.998 flat angles C4'-P-C4' energy: -37.444 flat angles P-C4'-P energy: -24.000 tors. eta vs tors. theta energy: -50.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -560.333292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.333292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.333292 (E_RNA) where: Base-Base interactions energy: -384.276 where: short stacking energy: -154.462 Base-Backbone interact. energy: 0.103 local terms energy: -176.160179 where: bonds (distance) C4'-P energy: -35.453 bonds (distance) P-C4' energy: -37.667 flat angles C4'-P-C4' energy: -38.042 flat angles P-C4'-P energy: -26.877 tors. eta vs tors. theta energy: -38.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -511.129766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.129766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.129766 (E_RNA) where: Base-Base interactions energy: -343.122 where: short stacking energy: -144.645 Base-Backbone interact. energy: -0.822 local terms energy: -167.186396 where: bonds (distance) C4'-P energy: -36.503 bonds (distance) P-C4' energy: -37.743 flat angles C4'-P-C4' energy: -32.177 flat angles P-C4'-P energy: -19.206 tors. eta vs tors. theta energy: -41.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -483.857710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.857710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.857710 (E_RNA) where: Base-Base interactions energy: -343.942 where: short stacking energy: -150.126 Base-Backbone interact. energy: -0.505 local terms energy: -139.410673 where: bonds (distance) C4'-P energy: -28.356 bonds (distance) P-C4' energy: -29.571 flat angles C4'-P-C4' energy: -32.102 flat angles P-C4'-P energy: -24.079 tors. eta vs tors. theta energy: -25.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -399.710592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.710592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.710592 (E_RNA) where: Base-Base interactions energy: -262.432 where: short stacking energy: -120.586 Base-Backbone interact. energy: -0.803 local terms energy: -136.475010 where: bonds (distance) C4'-P energy: -24.088 bonds (distance) P-C4' energy: -33.445 flat angles C4'-P-C4' energy: -28.267 flat angles P-C4'-P energy: -28.391 tors. eta vs tors. theta energy: -22.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -480.814070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.814070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.814070 (E_RNA) where: Base-Base interactions energy: -339.259 where: short stacking energy: -134.825 Base-Backbone interact. energy: 1.179 local terms energy: -142.734263 where: bonds (distance) C4'-P energy: -23.155 bonds (distance) P-C4' energy: -36.084 flat angles C4'-P-C4' energy: -37.772 flat angles P-C4'-P energy: -23.530 tors. eta vs tors. theta energy: -22.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -684.123679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.123679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.123679 (E_RNA) where: Base-Base interactions energy: -485.784 where: short stacking energy: -219.421 Base-Backbone interact. energy: -0.264 local terms energy: -198.075494 where: bonds (distance) C4'-P energy: -36.251 bonds (distance) P-C4' energy: -33.617 flat angles C4'-P-C4' energy: -37.511 flat angles P-C4'-P energy: -33.841 tors. eta vs tors. theta energy: -56.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -656.899532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.899532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.899532 (E_RNA) where: Base-Base interactions energy: -478.206 where: short stacking energy: -195.396 Base-Backbone interact. energy: 0.230 local terms energy: -178.924408 where: bonds (distance) C4'-P energy: -32.013 bonds (distance) P-C4' energy: -28.466 flat angles C4'-P-C4' energy: -41.258 flat angles P-C4'-P energy: -27.758 tors. eta vs tors. theta energy: -49.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -628.670287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.670287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.670287 (E_RNA) where: Base-Base interactions energy: -429.000 where: short stacking energy: -186.763 Base-Backbone interact. energy: 0.889 local terms energy: -200.558556 where: bonds (distance) C4'-P energy: -43.227 bonds (distance) P-C4' energy: -39.454 flat angles C4'-P-C4' energy: -41.475 flat angles P-C4'-P energy: -28.919 tors. eta vs tors. theta energy: -47.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -607.860337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.860337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.860337 (E_RNA) where: Base-Base interactions energy: -425.686 where: short stacking energy: -183.509 Base-Backbone interact. energy: -0.030 local terms energy: -182.144786 where: bonds (distance) C4'-P energy: -29.845 bonds (distance) P-C4' energy: -34.231 flat angles C4'-P-C4' energy: -43.221 flat angles P-C4'-P energy: -27.864 tors. eta vs tors. theta energy: -46.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -592.780251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.780251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.780251 (E_RNA) where: Base-Base interactions energy: -411.957 where: short stacking energy: -186.284 Base-Backbone interact. energy: -0.260 local terms energy: -180.563361 where: bonds (distance) C4'-P energy: -33.041 bonds (distance) P-C4' energy: -33.686 flat angles C4'-P-C4' energy: -40.912 flat angles P-C4'-P energy: -25.038 tors. eta vs tors. theta energy: -47.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -550.027470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.027470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.027470 (E_RNA) where: Base-Base interactions energy: -380.286 where: short stacking energy: -168.661 Base-Backbone interact. energy: -2.046 local terms energy: -167.695932 where: bonds (distance) C4'-P energy: -30.062 bonds (distance) P-C4' energy: -32.585 flat angles C4'-P-C4' energy: -38.739 flat angles P-C4'-P energy: -24.780 tors. eta vs tors. theta energy: -41.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -532.020243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.020243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.020243 (E_RNA) where: Base-Base interactions energy: -377.120 where: short stacking energy: -174.729 Base-Backbone interact. energy: -0.346 local terms energy: -154.554054 where: bonds (distance) C4'-P energy: -25.108 bonds (distance) P-C4' energy: -34.723 flat angles C4'-P-C4' energy: -34.736 flat angles P-C4'-P energy: -20.739 tors. eta vs tors. theta energy: -39.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -464.658054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.658054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.658054 (E_RNA) where: Base-Base interactions energy: -308.217 where: short stacking energy: -131.165 Base-Backbone interact. energy: 0.562 local terms energy: -157.003348 where: bonds (distance) C4'-P energy: -23.706 bonds (distance) P-C4' energy: -33.896 flat angles C4'-P-C4' energy: -40.020 flat angles P-C4'-P energy: -25.886 tors. eta vs tors. theta energy: -33.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -503.280340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.280340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.280340 (E_RNA) where: Base-Base interactions energy: -362.371 where: short stacking energy: -151.185 Base-Backbone interact. energy: 0.383 local terms energy: -141.292607 where: bonds (distance) C4'-P energy: -29.909 bonds (distance) P-C4' energy: -26.654 flat angles C4'-P-C4' energy: -38.218 flat angles P-C4'-P energy: -21.197 tors. eta vs tors. theta energy: -25.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -376.757216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.757216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.757216 (E_RNA) where: Base-Base interactions energy: -241.921 where: short stacking energy: -100.459 Base-Backbone interact. energy: -1.282 local terms energy: -133.553925 where: bonds (distance) C4'-P energy: -35.261 bonds (distance) P-C4' energy: -24.794 flat angles C4'-P-C4' energy: -36.116 flat angles P-C4'-P energy: -19.508 tors. eta vs tors. theta energy: -17.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -684.953004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.953004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.953004 (E_RNA) where: Base-Base interactions energy: -483.279 where: short stacking energy: -219.024 Base-Backbone interact. energy: 0.066 local terms energy: -201.740230 where: bonds (distance) C4'-P energy: -40.278 bonds (distance) P-C4' energy: -33.298 flat angles C4'-P-C4' energy: -41.968 flat angles P-C4'-P energy: -27.806 tors. eta vs tors. theta energy: -58.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -662.414567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.414567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.414567 (E_RNA) where: Base-Base interactions energy: -464.904 where: short stacking energy: -192.873 Base-Backbone interact. energy: 1.857 local terms energy: -199.367858 where: bonds (distance) C4'-P energy: -42.277 bonds (distance) P-C4' energy: -42.809 flat angles C4'-P-C4' energy: -35.658 flat angles P-C4'-P energy: -30.037 tors. eta vs tors. theta energy: -48.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -628.961666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.961666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.961666 (E_RNA) where: Base-Base interactions energy: -435.384 where: short stacking energy: -180.219 Base-Backbone interact. energy: -0.443 local terms energy: -193.134074 where: bonds (distance) C4'-P energy: -40.544 bonds (distance) P-C4' energy: -29.600 flat angles C4'-P-C4' energy: -41.228 flat angles P-C4'-P energy: -33.341 tors. eta vs tors. theta energy: -48.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -622.053698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.053698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.053698 (E_RNA) where: Base-Base interactions energy: -441.913 where: short stacking energy: -190.854 Base-Backbone interact. energy: -0.355 local terms energy: -179.785093 where: bonds (distance) C4'-P energy: -29.377 bonds (distance) P-C4' energy: -35.451 flat angles C4'-P-C4' energy: -40.500 flat angles P-C4'-P energy: -24.290 tors. eta vs tors. theta energy: -50.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -589.777021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.777021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.777021 (E_RNA) where: Base-Base interactions energy: -396.949 where: short stacking energy: -190.625 Base-Backbone interact. energy: -0.359 local terms energy: -192.468980 where: bonds (distance) C4'-P energy: -39.743 bonds (distance) P-C4' energy: -36.518 flat angles C4'-P-C4' energy: -36.436 flat angles P-C4'-P energy: -29.570 tors. eta vs tors. theta energy: -50.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -536.422980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.422980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.422980 (E_RNA) where: Base-Base interactions energy: -381.816 where: short stacking energy: -148.493 Base-Backbone interact. energy: 1.270 local terms energy: -155.876245 where: bonds (distance) C4'-P energy: -35.317 bonds (distance) P-C4' energy: -36.194 flat angles C4'-P-C4' energy: -33.943 flat angles P-C4'-P energy: -15.310 tors. eta vs tors. theta energy: -35.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -519.845007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.845007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.845007 (E_RNA) where: Base-Base interactions energy: -372.558 where: short stacking energy: -163.624 Base-Backbone interact. energy: -0.620 local terms energy: -146.666941 where: bonds (distance) C4'-P energy: -22.085 bonds (distance) P-C4' energy: -27.362 flat angles C4'-P-C4' energy: -34.719 flat angles P-C4'-P energy: -18.391 tors. eta vs tors. theta energy: -44.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -540.139815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.139815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.139815 (E_RNA) where: Base-Base interactions energy: -399.246 where: short stacking energy: -164.396 Base-Backbone interact. energy: -0.686 local terms energy: -140.207677 where: bonds (distance) C4'-P energy: -24.954 bonds (distance) P-C4' energy: -28.524 flat angles C4'-P-C4' energy: -37.164 flat angles P-C4'-P energy: -14.126 tors. eta vs tors. theta energy: -35.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -485.446907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.446907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.446907 (E_RNA) where: Base-Base interactions energy: -347.799 where: short stacking energy: -145.244 Base-Backbone interact. energy: 2.072 local terms energy: -139.719034 where: bonds (distance) C4'-P energy: -32.770 bonds (distance) P-C4' energy: -23.546 flat angles C4'-P-C4' energy: -35.672 flat angles P-C4'-P energy: -18.818 tors. eta vs tors. theta energy: -28.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -370.417053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.417053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.417053 (E_RNA) where: Base-Base interactions energy: -243.906 where: short stacking energy: -106.415 Base-Backbone interact. energy: -0.986 local terms energy: -125.524912 where: bonds (distance) C4'-P energy: -28.478 bonds (distance) P-C4' energy: -34.196 flat angles C4'-P-C4' energy: -28.446 flat angles P-C4'-P energy: -18.918 tors. eta vs tors. theta energy: -15.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -693.269998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.269998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.269998 (E_RNA) where: Base-Base interactions energy: -485.747 where: short stacking energy: -220.597 Base-Backbone interact. energy: -0.274 local terms energy: -207.248967 where: bonds (distance) C4'-P energy: -34.650 bonds (distance) P-C4' energy: -43.036 flat angles C4'-P-C4' energy: -44.459 flat angles P-C4'-P energy: -25.440 tors. eta vs tors. theta energy: -59.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -656.431194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.431194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.431194 (E_RNA) where: Base-Base interactions energy: -460.992 where: short stacking energy: -192.431 Base-Backbone interact. energy: 0.651 local terms energy: -196.090464 where: bonds (distance) C4'-P energy: -36.922 bonds (distance) P-C4' energy: -35.150 flat angles C4'-P-C4' energy: -42.869 flat angles P-C4'-P energy: -28.512 tors. eta vs tors. theta energy: -52.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -644.187692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.187692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.187692 (E_RNA) where: Base-Base interactions energy: -460.281 where: short stacking energy: -199.474 Base-Backbone interact. energy: 0.064 local terms energy: -183.970786 where: bonds (distance) C4'-P energy: -29.440 bonds (distance) P-C4' energy: -36.395 flat angles C4'-P-C4' energy: -34.667 flat angles P-C4'-P energy: -24.110 tors. eta vs tors. theta energy: -59.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -611.796993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.796993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.796993 (E_RNA) where: Base-Base interactions energy: -430.882 where: short stacking energy: -187.783 Base-Backbone interact. energy: -0.587 local terms energy: -180.328433 where: bonds (distance) C4'-P energy: -31.957 bonds (distance) P-C4' energy: -36.942 flat angles C4'-P-C4' energy: -39.217 flat angles P-C4'-P energy: -25.326 tors. eta vs tors. theta energy: -46.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -579.738805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.738805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.738805 (E_RNA) where: Base-Base interactions energy: -400.298 where: short stacking energy: -173.171 Base-Backbone interact. energy: -1.467 local terms energy: -177.973973 where: bonds (distance) C4'-P energy: -33.819 bonds (distance) P-C4' energy: -35.321 flat angles C4'-P-C4' energy: -31.668 flat angles P-C4'-P energy: -27.560 tors. eta vs tors. theta energy: -49.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -572.646091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.646091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.646091 (E_RNA) where: Base-Base interactions energy: -404.845 where: short stacking energy: -174.227 Base-Backbone interact. energy: 0.307 local terms energy: -168.108817 where: bonds (distance) C4'-P energy: -27.359 bonds (distance) P-C4' energy: -39.446 flat angles C4'-P-C4' energy: -40.907 flat angles P-C4'-P energy: -16.361 tors. eta vs tors. theta energy: -44.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -514.927524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.927524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.927524 (E_RNA) where: Base-Base interactions energy: -351.031 where: short stacking energy: -153.879 Base-Backbone interact. energy: 1.291 local terms energy: -165.187373 where: bonds (distance) C4'-P energy: -36.249 bonds (distance) P-C4' energy: -35.941 flat angles C4'-P-C4' energy: -34.919 flat angles P-C4'-P energy: -23.567 tors. eta vs tors. theta energy: -34.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -517.123811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.123811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.123811 (E_RNA) where: Base-Base interactions energy: -360.361 where: short stacking energy: -140.877 Base-Backbone interact. energy: -1.968 local terms energy: -154.795511 where: bonds (distance) C4'-P energy: -37.476 bonds (distance) P-C4' energy: -26.808 flat angles C4'-P-C4' energy: -36.834 flat angles P-C4'-P energy: -27.514 tors. eta vs tors. theta energy: -26.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -497.248060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.248060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.248060 (E_RNA) where: Base-Base interactions energy: -359.632 where: short stacking energy: -159.843 Base-Backbone interact. energy: -0.031 local terms energy: -137.584843 where: bonds (distance) C4'-P energy: -14.420 bonds (distance) P-C4' energy: -32.275 flat angles C4'-P-C4' energy: -36.647 flat angles P-C4'-P energy: -22.709 tors. eta vs tors. theta energy: -31.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -312.829044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.829044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.829044 (E_RNA) where: Base-Base interactions energy: -196.697 where: short stacking energy: -91.570 Base-Backbone interact. energy: -1.402 local terms energy: -114.730340 where: bonds (distance) C4'-P energy: -20.674 bonds (distance) P-C4' energy: -42.043 flat angles C4'-P-C4' energy: -26.123 flat angles P-C4'-P energy: -15.915 tors. eta vs tors. theta energy: -9.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -693.329289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.329289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.329289 (E_RNA) where: Base-Base interactions energy: -492.886 where: short stacking energy: -223.627 Base-Backbone interact. energy: 0.700 local terms energy: -201.142989 where: bonds (distance) C4'-P energy: -32.591 bonds (distance) P-C4' energy: -32.072 flat angles C4'-P-C4' energy: -41.100 flat angles P-C4'-P energy: -33.160 tors. eta vs tors. theta energy: -62.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -659.494138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.494138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.494138 (E_RNA) where: Base-Base interactions energy: -468.495 where: short stacking energy: -198.270 Base-Backbone interact. energy: 2.169 local terms energy: -193.167969 where: bonds (distance) C4'-P energy: -33.622 bonds (distance) P-C4' energy: -39.905 flat angles C4'-P-C4' energy: -39.059 flat angles P-C4'-P energy: -28.019 tors. eta vs tors. theta energy: -52.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -640.903003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.903003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.903003 (E_RNA) where: Base-Base interactions energy: -457.351 where: short stacking energy: -202.120 Base-Backbone interact. energy: -0.206 local terms energy: -183.345729 where: bonds (distance) C4'-P energy: -34.123 bonds (distance) P-C4' energy: -36.445 flat angles C4'-P-C4' energy: -36.844 flat angles P-C4'-P energy: -23.769 tors. eta vs tors. theta energy: -52.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -614.950087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.950087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.950087 (E_RNA) where: Base-Base interactions energy: -440.337 where: short stacking energy: -184.591 Base-Backbone interact. energy: -1.553 local terms energy: -173.059838 where: bonds (distance) C4'-P energy: -36.019 bonds (distance) P-C4' energy: -33.741 flat angles C4'-P-C4' energy: -31.096 flat angles P-C4'-P energy: -24.081 tors. eta vs tors. theta energy: -48.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -573.412055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.412055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.412055 (E_RNA) where: Base-Base interactions energy: -399.971 where: short stacking energy: -166.328 Base-Backbone interact. energy: -0.919 local terms energy: -172.521875 where: bonds (distance) C4'-P energy: -31.148 bonds (distance) P-C4' energy: -32.610 flat angles C4'-P-C4' energy: -39.070 flat angles P-C4'-P energy: -21.047 tors. eta vs tors. theta energy: -48.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -579.758805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.758805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.758805 (E_RNA) where: Base-Base interactions energy: -418.892 where: short stacking energy: -177.407 Base-Backbone interact. energy: 0.982 local terms energy: -161.848898 where: bonds (distance) C4'-P energy: -34.780 bonds (distance) P-C4' energy: -31.225 flat angles C4'-P-C4' energy: -37.746 flat angles P-C4'-P energy: -19.579 tors. eta vs tors. theta energy: -38.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -492.609930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.609930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.609930 (E_RNA) where: Base-Base interactions energy: -330.523 where: short stacking energy: -156.662 Base-Backbone interact. energy: -0.270 local terms energy: -161.817749 where: bonds (distance) C4'-P energy: -28.470 bonds (distance) P-C4' energy: -32.411 flat angles C4'-P-C4' energy: -39.193 flat angles P-C4'-P energy: -24.601 tors. eta vs tors. theta energy: -37.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -532.418119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.418119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.418119 (E_RNA) where: Base-Base interactions energy: -361.840 where: short stacking energy: -151.679 Base-Backbone interact. energy: -0.025 local terms energy: -170.552902 where: bonds (distance) C4'-P energy: -41.886 bonds (distance) P-C4' energy: -32.412 flat angles C4'-P-C4' energy: -34.513 flat angles P-C4'-P energy: -20.986 tors. eta vs tors. theta energy: -40.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -501.680797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.680797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.680797 (E_RNA) where: Base-Base interactions energy: -350.995 where: short stacking energy: -149.545 Base-Backbone interact. energy: -0.384 local terms energy: -150.302452 where: bonds (distance) C4'-P energy: -32.672 bonds (distance) P-C4' energy: -38.557 flat angles C4'-P-C4' energy: -33.425 flat angles P-C4'-P energy: -17.615 tors. eta vs tors. theta energy: -28.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -356.906373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.906373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.906373 (E_RNA) where: Base-Base interactions energy: -233.268 where: short stacking energy: -112.219 Base-Backbone interact. energy: -1.641 local terms energy: -121.997005 where: bonds (distance) C4'-P energy: -22.086 bonds (distance) P-C4' energy: -28.161 flat angles C4'-P-C4' energy: -34.358 flat angles P-C4'-P energy: -19.553 tors. eta vs tors. theta energy: -17.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -688.676423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.676423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.676423 (E_RNA) where: Base-Base interactions energy: -472.575 where: short stacking energy: -210.833 Base-Backbone interact. energy: -0.197 local terms energy: -215.904785 where: bonds (distance) C4'-P energy: -39.323 bonds (distance) P-C4' energy: -42.786 flat angles C4'-P-C4' energy: -42.941 flat angles P-C4'-P energy: -30.474 tors. eta vs tors. theta energy: -60.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -651.207843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.207843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.207843 (E_RNA) where: Base-Base interactions energy: -467.740 where: short stacking energy: -194.642 Base-Backbone interact. energy: -1.724 local terms energy: -181.743310 where: bonds (distance) C4'-P energy: -32.127 bonds (distance) P-C4' energy: -34.744 flat angles C4'-P-C4' energy: -42.877 flat angles P-C4'-P energy: -22.310 tors. eta vs tors. theta energy: -49.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -648.886324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.886324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.886324 (E_RNA) where: Base-Base interactions energy: -472.417 where: short stacking energy: -207.824 Base-Backbone interact. energy: -0.058 local terms energy: -176.411910 where: bonds (distance) C4'-P energy: -26.291 bonds (distance) P-C4' energy: -39.353 flat angles C4'-P-C4' energy: -33.155 flat angles P-C4'-P energy: -23.121 tors. eta vs tors. theta energy: -54.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -600.332972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.332972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.332972 (E_RNA) where: Base-Base interactions energy: -422.227 where: short stacking energy: -183.513 Base-Backbone interact. energy: -0.594 local terms energy: -177.512268 where: bonds (distance) C4'-P energy: -30.157 bonds (distance) P-C4' energy: -34.041 flat angles C4'-P-C4' energy: -38.573 flat angles P-C4'-P energy: -29.500 tors. eta vs tors. theta energy: -45.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -587.179035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.179035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.179035 (E_RNA) where: Base-Base interactions energy: -408.988 where: short stacking energy: -176.321 Base-Backbone interact. energy: -0.363 local terms energy: -177.827849 where: bonds (distance) C4'-P energy: -30.633 bonds (distance) P-C4' energy: -39.198 flat angles C4'-P-C4' energy: -38.990 flat angles P-C4'-P energy: -24.397 tors. eta vs tors. theta energy: -44.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -549.975440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.975440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.975440 (E_RNA) where: Base-Base interactions energy: -393.182 where: short stacking energy: -162.511 Base-Backbone interact. energy: 0.942 local terms energy: -157.735949 where: bonds (distance) C4'-P energy: -30.372 bonds (distance) P-C4' energy: -31.278 flat angles C4'-P-C4' energy: -33.894 flat angles P-C4'-P energy: -25.547 tors. eta vs tors. theta energy: -36.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -534.009335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.009335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.009335 (E_RNA) where: Base-Base interactions energy: -377.972 where: short stacking energy: -163.780 Base-Backbone interact. energy: 1.120 local terms energy: -157.158061 where: bonds (distance) C4'-P energy: -31.302 bonds (distance) P-C4' energy: -36.050 flat angles C4'-P-C4' energy: -31.639 flat angles P-C4'-P energy: -17.948 tors. eta vs tors. theta energy: -40.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -495.813025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.813025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.813025 (E_RNA) where: Base-Base interactions energy: -338.848 where: short stacking energy: -126.239 Base-Backbone interact. energy: -0.313 local terms energy: -156.652203 where: bonds (distance) C4'-P energy: -37.403 bonds (distance) P-C4' energy: -37.900 flat angles C4'-P-C4' energy: -26.749 flat angles P-C4'-P energy: -23.643 tors. eta vs tors. theta energy: -30.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -498.483678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.483678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.483678 (E_RNA) where: Base-Base interactions energy: -353.951 where: short stacking energy: -151.111 Base-Backbone interact. energy: -0.688 local terms energy: -143.844859 where: bonds (distance) C4'-P energy: -29.905 bonds (distance) P-C4' energy: -30.224 flat angles C4'-P-C4' energy: -29.880 flat angles P-C4'-P energy: -21.768 tors. eta vs tors. theta energy: -32.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -358.288156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.288156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.288156 (E_RNA) where: Base-Base interactions energy: -234.512 where: short stacking energy: -104.256 Base-Backbone interact. energy: -0.272 local terms energy: -123.504017 where: bonds (distance) C4'-P energy: -25.089 bonds (distance) P-C4' energy: -29.069 flat angles C4'-P-C4' energy: -37.150 flat angles P-C4'-P energy: -18.224 tors. eta vs tors. theta energy: -13.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -693.857839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.857839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.857839 (E_RNA) where: Base-Base interactions energy: -478.254 where: short stacking energy: -224.600 Base-Backbone interact. energy: -0.582 local terms energy: -215.022205 where: bonds (distance) C4'-P energy: -39.043 bonds (distance) P-C4' energy: -44.119 flat angles C4'-P-C4' energy: -41.725 flat angles P-C4'-P energy: -30.414 tors. eta vs tors. theta energy: -59.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -656.178057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.178057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.178057 (E_RNA) where: Base-Base interactions energy: -459.079 where: short stacking energy: -199.406 Base-Backbone interact. energy: -0.392 local terms energy: -196.707222 where: bonds (distance) C4'-P energy: -41.487 bonds (distance) P-C4' energy: -32.483 flat angles C4'-P-C4' energy: -40.283 flat angles P-C4'-P energy: -26.252 tors. eta vs tors. theta energy: -56.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -659.841738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.841738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.841738 (E_RNA) where: Base-Base interactions energy: -475.791 where: short stacking energy: -203.112 Base-Backbone interact. energy: 1.244 local terms energy: -185.294510 where: bonds (distance) C4'-P energy: -36.167 bonds (distance) P-C4' energy: -33.540 flat angles C4'-P-C4' energy: -40.628 flat angles P-C4'-P energy: -26.478 tors. eta vs tors. theta energy: -48.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -593.933671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.933671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.933671 (E_RNA) where: Base-Base interactions energy: -417.476 where: short stacking energy: -173.266 Base-Backbone interact. energy: -1.367 local terms energy: -175.091043 where: bonds (distance) C4'-P energy: -35.748 bonds (distance) P-C4' energy: -38.038 flat angles C4'-P-C4' energy: -39.929 flat angles P-C4'-P energy: -21.771 tors. eta vs tors. theta energy: -39.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -603.096775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.096775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.096775 (E_RNA) where: Base-Base interactions energy: -414.518 where: short stacking energy: -183.599 Base-Backbone interact. energy: -0.317 local terms energy: -188.262128 where: bonds (distance) C4'-P energy: -34.592 bonds (distance) P-C4' energy: -37.793 flat angles C4'-P-C4' energy: -43.894 flat angles P-C4'-P energy: -19.838 tors. eta vs tors. theta energy: -52.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -542.092037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.092037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.092037 (E_RNA) where: Base-Base interactions energy: -380.967 where: short stacking energy: -173.022 Base-Backbone interact. energy: 2.228 local terms energy: -163.352783 where: bonds (distance) C4'-P energy: -25.326 bonds (distance) P-C4' energy: -35.625 flat angles C4'-P-C4' energy: -37.138 flat angles P-C4'-P energy: -23.248 tors. eta vs tors. theta energy: -42.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -598.028354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.028354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.028354 (E_RNA) where: Base-Base interactions energy: -411.241 where: short stacking energy: -174.077 Base-Backbone interact. energy: -0.738 local terms energy: -186.049749 where: bonds (distance) C4'-P energy: -38.824 bonds (distance) P-C4' energy: -37.824 flat angles C4'-P-C4' energy: -39.136 flat angles P-C4'-P energy: -21.615 tors. eta vs tors. theta energy: -48.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -509.761700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.761700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.761700 (E_RNA) where: Base-Base interactions energy: -366.608 where: short stacking energy: -149.919 Base-Backbone interact. energy: 0.019 local terms energy: -143.173205 where: bonds (distance) C4'-P energy: -33.621 bonds (distance) P-C4' energy: -30.618 flat angles C4'-P-C4' energy: -32.710 flat angles P-C4'-P energy: -15.083 tors. eta vs tors. theta energy: -31.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -467.188642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.188642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.188642 (E_RNA) where: Base-Base interactions energy: -324.752 where: short stacking energy: -128.013 Base-Backbone interact. energy: -0.754 local terms energy: -141.682155 where: bonds (distance) C4'-P energy: -36.665 bonds (distance) P-C4' energy: -29.662 flat angles C4'-P-C4' energy: -28.217 flat angles P-C4'-P energy: -21.137 tors. eta vs tors. theta energy: -26.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -366.710039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.710039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.710039 (E_RNA) where: Base-Base interactions energy: -241.636 where: short stacking energy: -118.016 Base-Backbone interact. energy: -0.350 local terms energy: -124.723730 where: bonds (distance) C4'-P energy: -34.271 bonds (distance) P-C4' energy: -32.194 flat angles C4'-P-C4' energy: -23.252 flat angles P-C4'-P energy: -19.398 tors. eta vs tors. theta energy: -15.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -706.959999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.959999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.959999 (E_RNA) where: Base-Base interactions energy: -496.253 where: short stacking energy: -218.970 Base-Backbone interact. energy: -0.065 local terms energy: -210.642525 where: bonds (distance) C4'-P energy: -33.774 bonds (distance) P-C4' energy: -36.933 flat angles C4'-P-C4' energy: -40.997 flat angles P-C4'-P energy: -34.135 tors. eta vs tors. theta energy: -64.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -666.852587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.852587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.852587 (E_RNA) where: Base-Base interactions energy: -468.971 where: short stacking energy: -213.121 Base-Backbone interact. energy: -0.745 local terms energy: -197.136752 where: bonds (distance) C4'-P energy: -28.758 bonds (distance) P-C4' energy: -38.898 flat angles C4'-P-C4' energy: -45.506 flat angles P-C4'-P energy: -26.875 tors. eta vs tors. theta energy: -57.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -664.579486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.579486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.579486 (E_RNA) where: Base-Base interactions energy: -479.126 where: short stacking energy: -202.694 Base-Backbone interact. energy: 2.653 local terms energy: -188.106230 where: bonds (distance) C4'-P energy: -40.521 bonds (distance) P-C4' energy: -37.873 flat angles C4'-P-C4' energy: -39.961 flat angles P-C4'-P energy: -21.913 tors. eta vs tors. theta energy: -47.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -598.991820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.991820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.991820 (E_RNA) where: Base-Base interactions energy: -416.890 where: short stacking energy: -189.813 Base-Backbone interact. energy: -0.882 local terms energy: -181.219311 where: bonds (distance) C4'-P energy: -28.750 bonds (distance) P-C4' energy: -35.135 flat angles C4'-P-C4' energy: -38.384 flat angles P-C4'-P energy: -27.595 tors. eta vs tors. theta energy: -51.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -608.208273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.208273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.208273 (E_RNA) where: Base-Base interactions energy: -430.863 where: short stacking energy: -186.823 Base-Backbone interact. energy: 0.043 local terms energy: -177.387959 where: bonds (distance) C4'-P energy: -26.591 bonds (distance) P-C4' energy: -34.612 flat angles C4'-P-C4' energy: -40.990 flat angles P-C4'-P energy: -21.433 tors. eta vs tors. theta energy: -53.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -551.149468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.149468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.149468 (E_RNA) where: Base-Base interactions energy: -376.791 where: short stacking energy: -157.980 Base-Backbone interact. energy: 1.215 local terms energy: -175.573441 where: bonds (distance) C4'-P energy: -31.655 bonds (distance) P-C4' energy: -39.510 flat angles C4'-P-C4' energy: -40.756 flat angles P-C4'-P energy: -27.124 tors. eta vs tors. theta energy: -36.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -555.904265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.904265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.904265 (E_RNA) where: Base-Base interactions energy: -401.076 where: short stacking energy: -152.030 Base-Backbone interact. energy: -0.881 local terms energy: -153.947968 where: bonds (distance) C4'-P energy: -23.394 bonds (distance) P-C4' energy: -38.654 flat angles C4'-P-C4' energy: -36.575 flat angles P-C4'-P energy: -23.752 tors. eta vs tors. theta energy: -31.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -509.836879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.836879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.836879 (E_RNA) where: Base-Base interactions energy: -357.392 where: short stacking energy: -149.561 Base-Backbone interact. energy: 0.340 local terms energy: -152.785297 where: bonds (distance) C4'-P energy: -23.238 bonds (distance) P-C4' energy: -29.354 flat angles C4'-P-C4' energy: -38.303 flat angles P-C4'-P energy: -24.047 tors. eta vs tors. theta energy: -37.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -451.277196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.277196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.277196 (E_RNA) where: Base-Base interactions energy: -310.891 where: short stacking energy: -112.909 Base-Backbone interact. energy: -0.687 local terms energy: -139.700118 where: bonds (distance) C4'-P energy: -24.706 bonds (distance) P-C4' energy: -32.907 flat angles C4'-P-C4' energy: -32.681 flat angles P-C4'-P energy: -22.271 tors. eta vs tors. theta energy: -27.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -353.193228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.193228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.193228 (E_RNA) where: Base-Base interactions energy: -233.789 where: short stacking energy: -114.305 Base-Backbone interact. energy: -0.280 local terms energy: -119.124210 where: bonds (distance) C4'-P energy: -25.599 bonds (distance) P-C4' energy: -29.858 flat angles C4'-P-C4' energy: -29.071 flat angles P-C4'-P energy: -18.959 tors. eta vs tors. theta energy: -15.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -703.194052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.194052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.194052 (E_RNA) where: Base-Base interactions energy: -495.998 where: short stacking energy: -223.972 Base-Backbone interact. energy: -0.574 local terms energy: -206.621429 where: bonds (distance) C4'-P energy: -33.502 bonds (distance) P-C4' energy: -42.079 flat angles C4'-P-C4' energy: -40.597 flat angles P-C4'-P energy: -29.083 tors. eta vs tors. theta energy: -61.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -662.920720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.920720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.920720 (E_RNA) where: Base-Base interactions energy: -466.361 where: short stacking energy: -203.371 Base-Backbone interact. energy: -0.256 local terms energy: -196.303385 where: bonds (distance) C4'-P energy: -36.777 bonds (distance) P-C4' energy: -38.592 flat angles C4'-P-C4' energy: -38.458 flat angles P-C4'-P energy: -25.850 tors. eta vs tors. theta energy: -56.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -668.409419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.409419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.409419 (E_RNA) where: Base-Base interactions energy: -477.020 where: short stacking energy: -190.866 Base-Backbone interact. energy: 1.511 local terms energy: -192.901203 where: bonds (distance) C4'-P energy: -38.401 bonds (distance) P-C4' energy: -37.467 flat angles C4'-P-C4' energy: -38.014 flat angles P-C4'-P energy: -31.013 tors. eta vs tors. theta energy: -48.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -594.694701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.694701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.694701 (E_RNA) where: Base-Base interactions energy: -410.740 where: short stacking energy: -180.160 Base-Backbone interact. energy: -1.692 local terms energy: -182.262381 where: bonds (distance) C4'-P energy: -32.302 bonds (distance) P-C4' energy: -36.361 flat angles C4'-P-C4' energy: -41.900 flat angles P-C4'-P energy: -26.244 tors. eta vs tors. theta energy: -45.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -603.180296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.180296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.180296 (E_RNA) where: Base-Base interactions energy: -413.532 where: short stacking energy: -175.508 Base-Backbone interact. energy: -0.035 local terms energy: -189.613895 where: bonds (distance) C4'-P energy: -28.280 bonds (distance) P-C4' energy: -39.611 flat angles C4'-P-C4' energy: -41.838 flat angles P-C4'-P energy: -25.724 tors. eta vs tors. theta energy: -54.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -568.499867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.499867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.499867 (E_RNA) where: Base-Base interactions energy: -411.136 where: short stacking energy: -171.379 Base-Backbone interact. energy: 0.711 local terms energy: -158.074235 where: bonds (distance) C4'-P energy: -35.263 bonds (distance) P-C4' energy: -26.970 flat angles C4'-P-C4' energy: -35.751 flat angles P-C4'-P energy: -20.010 tors. eta vs tors. theta energy: -40.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -541.672983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.672983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.672983 (E_RNA) where: Base-Base interactions energy: -383.229 where: short stacking energy: -166.561 Base-Backbone interact. energy: -0.038 local terms energy: -158.406305 where: bonds (distance) C4'-P energy: -37.358 bonds (distance) P-C4' energy: -27.200 flat angles C4'-P-C4' energy: -37.006 flat angles P-C4'-P energy: -24.844 tors. eta vs tors. theta energy: -31.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -509.992137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.992137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.992137 (E_RNA) where: Base-Base interactions energy: -351.829 where: short stacking energy: -158.701 Base-Backbone interact. energy: -0.439 local terms energy: -157.724055 where: bonds (distance) C4'-P energy: -28.118 bonds (distance) P-C4' energy: -30.633 flat angles C4'-P-C4' energy: -34.363 flat angles P-C4'-P energy: -24.732 tors. eta vs tors. theta energy: -39.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -543.536250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.536250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.536250 (E_RNA) where: Base-Base interactions energy: -383.279 where: short stacking energy: -172.195 Base-Backbone interact. energy: -0.363 local terms energy: -159.894023 where: bonds (distance) C4'-P energy: -33.871 bonds (distance) P-C4' energy: -35.874 flat angles C4'-P-C4' energy: -30.066 flat angles P-C4'-P energy: -24.673 tors. eta vs tors. theta energy: -35.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -343.318925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.318925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.318925 (E_RNA) where: Base-Base interactions energy: -219.252 where: short stacking energy: -96.580 Base-Backbone interact. energy: -1.027 local terms energy: -123.039741 where: bonds (distance) C4'-P energy: -32.393 bonds (distance) P-C4' energy: -26.020 flat angles C4'-P-C4' energy: -36.634 flat angles P-C4'-P energy: -21.817 tors. eta vs tors. theta energy: -6.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -699.342846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.342846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.342846 (E_RNA) where: Base-Base interactions energy: -491.435 where: short stacking energy: -210.608 Base-Backbone interact. energy: -0.446 local terms energy: -207.461690 where: bonds (distance) C4'-P energy: -40.248 bonds (distance) P-C4' energy: -33.749 flat angles C4'-P-C4' energy: -43.255 flat angles P-C4'-P energy: -33.722 tors. eta vs tors. theta energy: -56.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -672.910643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.910643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.910643 (E_RNA) where: Base-Base interactions energy: -476.240 where: short stacking energy: -211.930 Base-Backbone interact. energy: -0.145 local terms energy: -196.525457 where: bonds (distance) C4'-P energy: -32.773 bonds (distance) P-C4' energy: -38.771 flat angles C4'-P-C4' energy: -39.564 flat angles P-C4'-P energy: -30.431 tors. eta vs tors. theta energy: -54.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -647.347036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.347036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.347036 (E_RNA) where: Base-Base interactions energy: -473.631 where: short stacking energy: -187.997 Base-Backbone interact. energy: 5.704 local terms energy: -179.420030 where: bonds (distance) C4'-P energy: -34.600 bonds (distance) P-C4' energy: -35.524 flat angles C4'-P-C4' energy: -38.366 flat angles P-C4'-P energy: -22.913 tors. eta vs tors. theta energy: -48.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -606.348791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.348791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.348791 (E_RNA) where: Base-Base interactions energy: -416.571 where: short stacking energy: -180.576 Base-Backbone interact. energy: -0.407 local terms energy: -189.370613 where: bonds (distance) C4'-P energy: -33.862 bonds (distance) P-C4' energy: -35.903 flat angles C4'-P-C4' energy: -42.254 flat angles P-C4'-P energy: -27.468 tors. eta vs tors. theta energy: -49.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -582.196123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.196123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.196123 (E_RNA) where: Base-Base interactions energy: -402.410 where: short stacking energy: -177.046 Base-Backbone interact. energy: -0.692 local terms energy: -179.094276 where: bonds (distance) C4'-P energy: -39.349 bonds (distance) P-C4' energy: -33.853 flat angles C4'-P-C4' energy: -41.985 flat angles P-C4'-P energy: -23.949 tors. eta vs tors. theta energy: -39.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -603.097808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.097808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.097808 (E_RNA) where: Base-Base interactions energy: -430.844 where: short stacking energy: -191.125 Base-Backbone interact. energy: -0.640 local terms energy: -171.614165 where: bonds (distance) C4'-P energy: -37.366 bonds (distance) P-C4' energy: -28.056 flat angles C4'-P-C4' energy: -35.628 flat angles P-C4'-P energy: -23.541 tors. eta vs tors. theta energy: -47.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -515.820596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.820596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.820596 (E_RNA) where: Base-Base interactions energy: -372.669 where: short stacking energy: -157.097 Base-Backbone interact. energy: -0.173 local terms energy: -142.978284 where: bonds (distance) C4'-P energy: -30.545 bonds (distance) P-C4' energy: -28.981 flat angles C4'-P-C4' energy: -34.300 flat angles P-C4'-P energy: -14.703 tors. eta vs tors. theta energy: -34.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -527.128262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.128262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.128262 (E_RNA) where: Base-Base interactions energy: -366.628 where: short stacking energy: -150.604 Base-Backbone interact. energy: -0.308 local terms energy: -160.191835 where: bonds (distance) C4'-P energy: -32.563 bonds (distance) P-C4' energy: -33.789 flat angles C4'-P-C4' energy: -36.275 flat angles P-C4'-P energy: -28.375 tors. eta vs tors. theta energy: -29.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -498.978800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.978800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.978800 (E_RNA) where: Base-Base interactions energy: -343.288 where: short stacking energy: -142.358 Base-Backbone interact. energy: -1.127 local terms energy: -154.564459 where: bonds (distance) C4'-P energy: -35.167 bonds (distance) P-C4' energy: -30.914 flat angles C4'-P-C4' energy: -39.896 flat angles P-C4'-P energy: -19.282 tors. eta vs tors. theta energy: -29.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -380.522926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.522926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.522926 (E_RNA) where: Base-Base interactions energy: -242.638 where: short stacking energy: -109.105 Base-Backbone interact. energy: -1.221 local terms energy: -136.664589 where: bonds (distance) C4'-P energy: -27.269 bonds (distance) P-C4' energy: -33.474 flat angles C4'-P-C4' energy: -28.170 flat angles P-C4'-P energy: -27.915 tors. eta vs tors. theta energy: -19.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -683.665910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.665910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.665910 (E_RNA) where: Base-Base interactions energy: -473.027 where: short stacking energy: -210.424 Base-Backbone interact. energy: -1.011 local terms energy: -209.627845 where: bonds (distance) C4'-P energy: -39.332 bonds (distance) P-C4' energy: -33.141 flat angles C4'-P-C4' energy: -44.256 flat angles P-C4'-P energy: -29.858 tors. eta vs tors. theta energy: -63.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -678.948544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.948544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.948544 (E_RNA) where: Base-Base interactions energy: -487.300 where: short stacking energy: -216.122 Base-Backbone interact. energy: -0.887 local terms energy: -190.760828 where: bonds (distance) C4'-P energy: -32.523 bonds (distance) P-C4' energy: -39.239 flat angles C4'-P-C4' energy: -37.266 flat angles P-C4'-P energy: -26.041 tors. eta vs tors. theta energy: -55.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -651.251525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.251525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.251525 (E_RNA) where: Base-Base interactions energy: -456.998 where: short stacking energy: -186.076 Base-Backbone interact. energy: -0.526 local terms energy: -193.726802 where: bonds (distance) C4'-P energy: -37.565 bonds (distance) P-C4' energy: -38.676 flat angles C4'-P-C4' energy: -40.260 flat angles P-C4'-P energy: -23.063 tors. eta vs tors. theta energy: -54.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -604.697756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.697756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.697756 (E_RNA) where: Base-Base interactions energy: -413.169 where: short stacking energy: -176.925 Base-Backbone interact. energy: -0.491 local terms energy: -191.038418 where: bonds (distance) C4'-P energy: -40.260 bonds (distance) P-C4' energy: -42.127 flat angles C4'-P-C4' energy: -38.176 flat angles P-C4'-P energy: -26.912 tors. eta vs tors. theta energy: -43.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -584.000262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.000262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.000262 (E_RNA) where: Base-Base interactions energy: -421.150 where: short stacking energy: -188.871 Base-Backbone interact. energy: 1.328 local terms energy: -164.178438 where: bonds (distance) C4'-P energy: -36.945 bonds (distance) P-C4' energy: -27.030 flat angles C4'-P-C4' energy: -34.855 flat angles P-C4'-P energy: -24.756 tors. eta vs tors. theta energy: -40.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -584.058103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.058103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.058103 (E_RNA) where: Base-Base interactions energy: -414.472 where: short stacking energy: -186.845 Base-Backbone interact. energy: 0.533 local terms energy: -170.119411 where: bonds (distance) C4'-P energy: -29.033 bonds (distance) P-C4' energy: -29.728 flat angles C4'-P-C4' energy: -40.445 flat angles P-C4'-P energy: -25.975 tors. eta vs tors. theta energy: -44.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -519.170006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.170006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.170006 (E_RNA) where: Base-Base interactions energy: -362.001 where: short stacking energy: -160.987 Base-Backbone interact. energy: 0.554 local terms energy: -157.723713 where: bonds (distance) C4'-P energy: -33.756 bonds (distance) P-C4' energy: -36.619 flat angles C4'-P-C4' energy: -29.856 flat angles P-C4'-P energy: -20.992 tors. eta vs tors. theta energy: -36.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -526.631867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.631867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.631867 (E_RNA) where: Base-Base interactions energy: -377.047 where: short stacking energy: -153.969 Base-Backbone interact. energy: -0.408 local terms energy: -149.176599 where: bonds (distance) C4'-P energy: -20.643 bonds (distance) P-C4' energy: -30.253 flat angles C4'-P-C4' energy: -38.989 flat angles P-C4'-P energy: -27.986 tors. eta vs tors. theta energy: -31.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -497.492267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.492267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.492267 (E_RNA) where: Base-Base interactions energy: -353.397 where: short stacking energy: -146.476 Base-Backbone interact. energy: 0.296 local terms energy: -144.391101 where: bonds (distance) C4'-P energy: -30.132 bonds (distance) P-C4' energy: -27.071 flat angles C4'-P-C4' energy: -33.083 flat angles P-C4'-P energy: -22.978 tors. eta vs tors. theta energy: -31.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -336.864238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.864238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.864238 (E_RNA) where: Base-Base interactions energy: -226.135 where: short stacking energy: -103.229 Base-Backbone interact. energy: 0.381 local terms energy: -111.110704 where: bonds (distance) C4'-P energy: -31.765 bonds (distance) P-C4' energy: -21.150 flat angles C4'-P-C4' energy: -28.700 flat angles P-C4'-P energy: -15.673 tors. eta vs tors. theta energy: -13.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -696.169017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.169017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.169017 (E_RNA) where: Base-Base interactions energy: -490.696 where: short stacking energy: -219.530 Base-Backbone interact. energy: -0.147 local terms energy: -205.325342 where: bonds (distance) C4'-P energy: -33.942 bonds (distance) P-C4' energy: -42.526 flat angles C4'-P-C4' energy: -39.723 flat angles P-C4'-P energy: -30.052 tors. eta vs tors. theta energy: -59.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -672.438741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.438741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.438741 (E_RNA) where: Base-Base interactions energy: -471.660 where: short stacking energy: -210.519 Base-Backbone interact. energy: -2.042 local terms energy: -198.737362 where: bonds (distance) C4'-P energy: -37.455 bonds (distance) P-C4' energy: -37.051 flat angles C4'-P-C4' energy: -40.249 flat angles P-C4'-P energy: -29.524 tors. eta vs tors. theta energy: -54.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -656.640055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.640055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.640055 (E_RNA) where: Base-Base interactions energy: -468.177 where: short stacking energy: -194.472 Base-Backbone interact. energy: 1.887 local terms energy: -190.349841 where: bonds (distance) C4'-P energy: -35.082 bonds (distance) P-C4' energy: -38.598 flat angles C4'-P-C4' energy: -38.229 flat angles P-C4'-P energy: -27.825 tors. eta vs tors. theta energy: -50.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -600.803174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.803174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.803174 (E_RNA) where: Base-Base interactions energy: -418.028 where: short stacking energy: -170.392 Base-Backbone interact. energy: -0.756 local terms energy: -182.018948 where: bonds (distance) C4'-P energy: -39.303 bonds (distance) P-C4' energy: -35.068 flat angles C4'-P-C4' energy: -44.309 flat angles P-C4'-P energy: -28.556 tors. eta vs tors. theta energy: -34.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -606.180931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.180931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.180931 (E_RNA) where: Base-Base interactions energy: -429.764 where: short stacking energy: -194.487 Base-Backbone interact. energy: -0.188 local terms energy: -176.229370 where: bonds (distance) C4'-P energy: -29.722 bonds (distance) P-C4' energy: -39.081 flat angles C4'-P-C4' energy: -33.013 flat angles P-C4'-P energy: -24.973 tors. eta vs tors. theta energy: -49.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -568.542167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.542167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.542167 (E_RNA) where: Base-Base interactions energy: -410.417 where: short stacking energy: -157.734 Base-Backbone interact. energy: -2.242 local terms energy: -155.883877 where: bonds (distance) C4'-P energy: -29.273 bonds (distance) P-C4' energy: -35.208 flat angles C4'-P-C4' energy: -32.281 flat angles P-C4'-P energy: -17.222 tors. eta vs tors. theta energy: -41.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -529.711139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.711139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.711139 (E_RNA) where: Base-Base interactions energy: -358.766 where: short stacking energy: -163.801 Base-Backbone interact. energy: -0.478 local terms energy: -170.467497 where: bonds (distance) C4'-P energy: -34.033 bonds (distance) P-C4' energy: -31.613 flat angles C4'-P-C4' energy: -38.269 flat angles P-C4'-P energy: -26.210 tors. eta vs tors. theta energy: -40.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -494.149361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.149361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.149361 (E_RNA) where: Base-Base interactions energy: -341.875 where: short stacking energy: -154.204 Base-Backbone interact. energy: 2.581 local terms energy: -154.854891 where: bonds (distance) C4'-P energy: -24.378 bonds (distance) P-C4' energy: -36.616 flat angles C4'-P-C4' energy: -34.531 flat angles P-C4'-P energy: -24.408 tors. eta vs tors. theta energy: -34.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -479.219401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.219401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.219401 (E_RNA) where: Base-Base interactions energy: -339.456 where: short stacking energy: -128.217 Base-Backbone interact. energy: -0.958 local terms energy: -138.805325 where: bonds (distance) C4'-P energy: -33.289 bonds (distance) P-C4' energy: -33.216 flat angles C4'-P-C4' energy: -32.966 flat angles P-C4'-P energy: -20.518 tors. eta vs tors. theta energy: -18.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -349.419824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.419824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.419824 (E_RNA) where: Base-Base interactions energy: -224.619 where: short stacking energy: -108.524 Base-Backbone interact. energy: -0.178 local terms energy: -124.622734 where: bonds (distance) C4'-P energy: -28.871 bonds (distance) P-C4' energy: -26.931 flat angles C4'-P-C4' energy: -31.637 flat angles P-C4'-P energy: -17.882 tors. eta vs tors. theta energy: -19.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -693.510043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.510043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.510043 (E_RNA) where: Base-Base interactions energy: -482.745 where: short stacking energy: -216.895 Base-Backbone interact. energy: -0.687 local terms energy: -210.077451 where: bonds (distance) C4'-P energy: -36.535 bonds (distance) P-C4' energy: -36.094 flat angles C4'-P-C4' energy: -43.570 flat angles P-C4'-P energy: -31.991 tors. eta vs tors. theta energy: -61.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -665.498650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.498650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.498650 (E_RNA) where: Base-Base interactions energy: -471.633 where: short stacking energy: -187.220 Base-Backbone interact. energy: 1.099 local terms energy: -194.964000 where: bonds (distance) C4'-P energy: -37.582 bonds (distance) P-C4' energy: -37.103 flat angles C4'-P-C4' energy: -38.810 flat angles P-C4'-P energy: -31.328 tors. eta vs tors. theta energy: -50.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -655.075886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.075886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.075886 (E_RNA) where: Base-Base interactions energy: -458.570 where: short stacking energy: -203.317 Base-Backbone interact. energy: -0.174 local terms energy: -196.331040 where: bonds (distance) C4'-P energy: -34.997 bonds (distance) P-C4' energy: -35.510 flat angles C4'-P-C4' energy: -39.473 flat angles P-C4'-P energy: -28.233 tors. eta vs tors. theta energy: -58.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -614.867214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.867214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.867214 (E_RNA) where: Base-Base interactions energy: -441.523 where: short stacking energy: -191.379 Base-Backbone interact. energy: -1.222 local terms energy: -172.122865 where: bonds (distance) C4'-P energy: -36.794 bonds (distance) P-C4' energy: -31.822 flat angles C4'-P-C4' energy: -34.475 flat angles P-C4'-P energy: -19.838 tors. eta vs tors. theta energy: -49.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -585.971344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.971344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.971344 (E_RNA) where: Base-Base interactions energy: -420.648 where: short stacking energy: -184.293 Base-Backbone interact. energy: -2.291 local terms energy: -163.032763 where: bonds (distance) C4'-P energy: -27.572 bonds (distance) P-C4' energy: -34.144 flat angles C4'-P-C4' energy: -34.881 flat angles P-C4'-P energy: -21.236 tors. eta vs tors. theta energy: -45.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -585.582705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.582705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.582705 (E_RNA) where: Base-Base interactions energy: -413.783 where: short stacking energy: -183.665 Base-Backbone interact. energy: -0.559 local terms energy: -171.241108 where: bonds (distance) C4'-P energy: -30.117 bonds (distance) P-C4' energy: -35.436 flat angles C4'-P-C4' energy: -34.234 flat angles P-C4'-P energy: -27.618 tors. eta vs tors. theta energy: -43.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -543.301161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.301161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.301161 (E_RNA) where: Base-Base interactions energy: -390.632 where: short stacking energy: -163.598 Base-Backbone interact. energy: -1.109 local terms energy: -151.560623 where: bonds (distance) C4'-P energy: -29.455 bonds (distance) P-C4' energy: -31.517 flat angles C4'-P-C4' energy: -28.677 flat angles P-C4'-P energy: -23.652 tors. eta vs tors. theta energy: -38.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -481.727480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.727480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.727480 (E_RNA) where: Base-Base interactions energy: -331.480 where: short stacking energy: -140.609 Base-Backbone interact. energy: -0.684 local terms energy: -149.563227 where: bonds (distance) C4'-P energy: -33.921 bonds (distance) P-C4' energy: -37.399 flat angles C4'-P-C4' energy: -30.636 flat angles P-C4'-P energy: -11.344 tors. eta vs tors. theta energy: -36.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -466.781949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.781949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.781949 (E_RNA) where: Base-Base interactions energy: -317.439 where: short stacking energy: -135.823 Base-Backbone interact. energy: 0.565 local terms energy: -149.908140 where: bonds (distance) C4'-P energy: -30.733 bonds (distance) P-C4' energy: -32.367 flat angles C4'-P-C4' energy: -34.970 flat angles P-C4'-P energy: -26.521 tors. eta vs tors. theta energy: -25.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -320.244771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.244771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.244771 (E_RNA) where: Base-Base interactions energy: -204.965 where: short stacking energy: -81.006 Base-Backbone interact. energy: -1.276 local terms energy: -114.003522 where: bonds (distance) C4'-P energy: -19.135 bonds (distance) P-C4' energy: -33.685 flat angles C4'-P-C4' energy: -31.001 flat angles P-C4'-P energy: -21.997 tors. eta vs tors. theta energy: -8.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -685.862742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.862742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.862742 (E_RNA) where: Base-Base interactions energy: -485.184 where: short stacking energy: -218.457 Base-Backbone interact. energy: -0.117 local terms energy: -200.562299 where: bonds (distance) C4'-P energy: -32.044 bonds (distance) P-C4' energy: -32.239 flat angles C4'-P-C4' energy: -45.136 flat angles P-C4'-P energy: -33.033 tors. eta vs tors. theta energy: -58.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -668.994606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.994606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.994606 (E_RNA) where: Base-Base interactions energy: -467.547 where: short stacking energy: -195.686 Base-Backbone interact. energy: 2.463 local terms energy: -203.910543 where: bonds (distance) C4'-P energy: -39.246 bonds (distance) P-C4' energy: -43.005 flat angles C4'-P-C4' energy: -37.754 flat angles P-C4'-P energy: -32.502 tors. eta vs tors. theta energy: -51.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -652.819305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.819305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.819305 (E_RNA) where: Base-Base interactions energy: -464.788 where: short stacking energy: -201.028 Base-Backbone interact. energy: -0.674 local terms energy: -187.357339 where: bonds (distance) C4'-P energy: -33.418 bonds (distance) P-C4' energy: -34.171 flat angles C4'-P-C4' energy: -42.445 flat angles P-C4'-P energy: -22.891 tors. eta vs tors. theta energy: -54.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -600.646745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.646745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.646745 (E_RNA) where: Base-Base interactions energy: -426.064 where: short stacking energy: -179.124 Base-Backbone interact. energy: -0.553 local terms energy: -174.029302 where: bonds (distance) C4'-P energy: -27.508 bonds (distance) P-C4' energy: -38.333 flat angles C4'-P-C4' energy: -35.158 flat angles P-C4'-P energy: -25.733 tors. eta vs tors. theta energy: -47.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -574.918216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.918216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.918216 (E_RNA) where: Base-Base interactions energy: -403.744 where: short stacking energy: -173.372 Base-Backbone interact. energy: 0.609 local terms energy: -171.783656 where: bonds (distance) C4'-P energy: -38.641 bonds (distance) P-C4' energy: -38.775 flat angles C4'-P-C4' energy: -39.111 flat angles P-C4'-P energy: -14.036 tors. eta vs tors. theta energy: -41.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -554.201991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.201991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.201991 (E_RNA) where: Base-Base interactions energy: -401.938 where: short stacking energy: -179.143 Base-Backbone interact. energy: 1.769 local terms energy: -154.033103 where: bonds (distance) C4'-P energy: -32.887 bonds (distance) P-C4' energy: -31.165 flat angles C4'-P-C4' energy: -29.311 flat angles P-C4'-P energy: -21.589 tors. eta vs tors. theta energy: -39.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -516.619323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.619323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.619323 (E_RNA) where: Base-Base interactions energy: -350.286 where: short stacking energy: -168.125 Base-Backbone interact. energy: -0.421 local terms energy: -165.912073 where: bonds (distance) C4'-P energy: -34.505 bonds (distance) P-C4' energy: -33.512 flat angles C4'-P-C4' energy: -35.408 flat angles P-C4'-P energy: -20.132 tors. eta vs tors. theta energy: -42.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -488.420311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.420311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.420311 (E_RNA) where: Base-Base interactions energy: -347.065 where: short stacking energy: -146.923 Base-Backbone interact. energy: -0.799 local terms energy: -140.555633 where: bonds (distance) C4'-P energy: -28.069 bonds (distance) P-C4' energy: -30.470 flat angles C4'-P-C4' energy: -37.405 flat angles P-C4'-P energy: -15.818 tors. eta vs tors. theta energy: -28.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -454.118275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.118275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.118275 (E_RNA) where: Base-Base interactions energy: -320.394 where: short stacking energy: -139.406 Base-Backbone interact. energy: -0.172 local terms energy: -133.551821 where: bonds (distance) C4'-P energy: -18.255 bonds (distance) P-C4' energy: -30.810 flat angles C4'-P-C4' energy: -28.170 flat angles P-C4'-P energy: -21.713 tors. eta vs tors. theta energy: -34.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -327.968057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.968057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.968057 (E_RNA) where: Base-Base interactions energy: -207.034 where: short stacking energy: -107.180 Base-Backbone interact. energy: -0.033 local terms energy: -120.900886 where: bonds (distance) C4'-P energy: -31.111 bonds (distance) P-C4' energy: -39.304 flat angles C4'-P-C4' energy: -21.754 flat angles P-C4'-P energy: -16.946 tors. eta vs tors. theta energy: -11.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -699.011249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.011249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.011249 (E_RNA) where: Base-Base interactions energy: -483.135 where: short stacking energy: -217.103 Base-Backbone interact. energy: -1.930 local terms energy: -213.945612 where: bonds (distance) C4'-P energy: -36.853 bonds (distance) P-C4' energy: -42.614 flat angles C4'-P-C4' energy: -43.038 flat angles P-C4'-P energy: -30.843 tors. eta vs tors. theta energy: -60.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -673.973213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.973213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.973213 (E_RNA) where: Base-Base interactions energy: -495.087 where: short stacking energy: -217.843 Base-Backbone interact. energy: -0.216 local terms energy: -178.670246 where: bonds (distance) C4'-P energy: -29.565 bonds (distance) P-C4' energy: -29.298 flat angles C4'-P-C4' energy: -36.998 flat angles P-C4'-P energy: -25.802 tors. eta vs tors. theta energy: -57.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -643.290716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.290716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.290716 (E_RNA) where: Base-Base interactions energy: -463.354 where: short stacking energy: -199.934 Base-Backbone interact. energy: 0.002 local terms energy: -179.938889 where: bonds (distance) C4'-P energy: -39.737 bonds (distance) P-C4' energy: -33.150 flat angles C4'-P-C4' energy: -33.671 flat angles P-C4'-P energy: -24.622 tors. eta vs tors. theta energy: -48.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -615.145122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.145122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.145122 (E_RNA) where: Base-Base interactions energy: -428.188 where: short stacking energy: -200.190 Base-Backbone interact. energy: -0.127 local terms energy: -186.830623 where: bonds (distance) C4'-P energy: -36.655 bonds (distance) P-C4' energy: -31.625 flat angles C4'-P-C4' energy: -45.033 flat angles P-C4'-P energy: -23.509 tors. eta vs tors. theta energy: -50.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -572.084577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.084577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.084577 (E_RNA) where: Base-Base interactions energy: -407.234 where: short stacking energy: -181.899 Base-Backbone interact. energy: -0.456 local terms energy: -164.394625 where: bonds (distance) C4'-P energy: -30.289 bonds (distance) P-C4' energy: -31.654 flat angles C4'-P-C4' energy: -37.479 flat angles P-C4'-P energy: -18.990 tors. eta vs tors. theta energy: -45.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -574.622416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.622416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.622416 (E_RNA) where: Base-Base interactions energy: -399.567 where: short stacking energy: -162.297 Base-Backbone interact. energy: -3.253 local terms energy: -171.802673 where: bonds (distance) C4'-P energy: -41.435 bonds (distance) P-C4' energy: -29.025 flat angles C4'-P-C4' energy: -37.966 flat angles P-C4'-P energy: -18.754 tors. eta vs tors. theta energy: -44.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -514.517621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.517621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.517621 (E_RNA) where: Base-Base interactions energy: -370.435 where: short stacking energy: -161.671 Base-Backbone interact. energy: -0.465 local terms energy: -143.618007 where: bonds (distance) C4'-P energy: -29.015 bonds (distance) P-C4' energy: -21.386 flat angles C4'-P-C4' energy: -38.417 flat angles P-C4'-P energy: -13.315 tors. eta vs tors. theta energy: -41.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -473.264403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.264403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.264403 (E_RNA) where: Base-Base interactions energy: -339.883 where: short stacking energy: -151.150 Base-Backbone interact. energy: -0.570 local terms energy: -132.811828 where: bonds (distance) C4'-P energy: -25.904 bonds (distance) P-C4' energy: -33.288 flat angles C4'-P-C4' energy: -20.031 flat angles P-C4'-P energy: -21.397 tors. eta vs tors. theta energy: -32.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -491.484012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.484012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.484012 (E_RNA) where: Base-Base interactions energy: -348.220 where: short stacking energy: -148.432 Base-Backbone interact. energy: -0.751 local terms energy: -142.513029 where: bonds (distance) C4'-P energy: -25.131 bonds (distance) P-C4' energy: -38.828 flat angles C4'-P-C4' energy: -31.202 flat angles P-C4'-P energy: -17.877 tors. eta vs tors. theta energy: -29.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -395.959557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.959557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.959557 (E_RNA) where: Base-Base interactions energy: -267.574 where: short stacking energy: -102.655 Base-Backbone interact. energy: -0.783 local terms energy: -127.602078 where: bonds (distance) C4'-P energy: -31.191 bonds (distance) P-C4' energy: -27.307 flat angles C4'-P-C4' energy: -33.141 flat angles P-C4'-P energy: -14.871 tors. eta vs tors. theta energy: -21.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -685.296661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.296661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.296661 (E_RNA) where: Base-Base interactions energy: -488.508 where: short stacking energy: -211.156 Base-Backbone interact. energy: -0.261 local terms energy: -196.527722 where: bonds (distance) C4'-P energy: -32.190 bonds (distance) P-C4' energy: -35.211 flat angles C4'-P-C4' energy: -41.797 flat angles P-C4'-P energy: -28.236 tors. eta vs tors. theta energy: -59.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -685.476326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.476326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.476326 (E_RNA) where: Base-Base interactions energy: -489.097 where: short stacking energy: -222.438 Base-Backbone interact. energy: -0.391 local terms energy: -195.989055 where: bonds (distance) C4'-P energy: -32.939 bonds (distance) P-C4' energy: -39.944 flat angles C4'-P-C4' energy: -37.974 flat angles P-C4'-P energy: -25.008 tors. eta vs tors. theta energy: -60.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -633.770156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.770156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.770156 (E_RNA) where: Base-Base interactions energy: -457.586 where: short stacking energy: -193.323 Base-Backbone interact. energy: 0.524 local terms energy: -176.707664 where: bonds (distance) C4'-P energy: -36.517 bonds (distance) P-C4' energy: -37.108 flat angles C4'-P-C4' energy: -38.704 flat angles P-C4'-P energy: -16.805 tors. eta vs tors. theta energy: -47.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -600.968318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.968318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.968318 (E_RNA) where: Base-Base interactions energy: -417.243 where: short stacking energy: -178.825 Base-Backbone interact. energy: -0.439 local terms energy: -183.286858 where: bonds (distance) C4'-P energy: -35.042 bonds (distance) P-C4' energy: -35.751 flat angles C4'-P-C4' energy: -37.626 flat angles P-C4'-P energy: -19.957 tors. eta vs tors. theta energy: -54.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -591.558166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.558166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.558166 (E_RNA) where: Base-Base interactions energy: -424.241 where: short stacking energy: -188.639 Base-Backbone interact. energy: 0.314 local terms energy: -167.631457 where: bonds (distance) C4'-P energy: -24.397 bonds (distance) P-C4' energy: -36.727 flat angles C4'-P-C4' energy: -33.679 flat angles P-C4'-P energy: -29.669 tors. eta vs tors. theta energy: -43.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -566.940626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.940626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.940626 (E_RNA) where: Base-Base interactions energy: -389.498 where: short stacking energy: -170.274 Base-Backbone interact. energy: -1.878 local terms energy: -175.564668 where: bonds (distance) C4'-P energy: -36.667 bonds (distance) P-C4' energy: -38.105 flat angles C4'-P-C4' energy: -33.368 flat angles P-C4'-P energy: -30.640 tors. eta vs tors. theta energy: -36.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -531.171508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.171508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.171508 (E_RNA) where: Base-Base interactions energy: -362.792 where: short stacking energy: -158.912 Base-Backbone interact. energy: -0.427 local terms energy: -167.952218 where: bonds (distance) C4'-P energy: -34.647 bonds (distance) P-C4' energy: -35.647 flat angles C4'-P-C4' energy: -33.179 flat angles P-C4'-P energy: -25.407 tors. eta vs tors. theta energy: -39.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -469.331161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.331161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.331161 (E_RNA) where: Base-Base interactions energy: -318.075 where: short stacking energy: -141.949 Base-Backbone interact. energy: -0.264 local terms energy: -150.992394 where: bonds (distance) C4'-P energy: -26.022 bonds (distance) P-C4' energy: -37.600 flat angles C4'-P-C4' energy: -34.447 flat angles P-C4'-P energy: -19.243 tors. eta vs tors. theta energy: -33.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -455.492612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.492612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.492612 (E_RNA) where: Base-Base interactions energy: -323.366 where: short stacking energy: -139.133 Base-Backbone interact. energy: 0.315 local terms energy: -132.441392 where: bonds (distance) C4'-P energy: -31.938 bonds (distance) P-C4' energy: -26.608 flat angles C4'-P-C4' energy: -30.766 flat angles P-C4'-P energy: -18.878 tors. eta vs tors. theta energy: -24.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -451.438192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.438192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.438192 (E_RNA) where: Base-Base interactions energy: -327.333 where: short stacking energy: -125.485 Base-Backbone interact. energy: -0.863 local terms energy: -123.241834 where: bonds (distance) C4'-P energy: -25.464 bonds (distance) P-C4' energy: -29.921 flat angles C4'-P-C4' energy: -30.069 flat angles P-C4'-P energy: -18.443 tors. eta vs tors. theta energy: -19.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -689.235833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.235833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.235833 (E_RNA) where: Base-Base interactions energy: -484.939 where: short stacking energy: -216.724 Base-Backbone interact. energy: 1.465 local terms energy: -205.761052 where: bonds (distance) C4'-P energy: -31.911 bonds (distance) P-C4' energy: -38.962 flat angles C4'-P-C4' energy: -47.133 flat angles P-C4'-P energy: -28.851 tors. eta vs tors. theta energy: -58.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -671.126569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.126569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.126569 (E_RNA) where: Base-Base interactions energy: -481.746 where: short stacking energy: -208.353 Base-Backbone interact. energy: -0.557 local terms energy: -188.822941 where: bonds (distance) C4'-P energy: -33.261 bonds (distance) P-C4' energy: -35.073 flat angles C4'-P-C4' energy: -38.024 flat angles P-C4'-P energy: -25.297 tors. eta vs tors. theta energy: -57.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -642.363728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.363728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.363728 (E_RNA) where: Base-Base interactions energy: -466.825 where: short stacking energy: -193.471 Base-Backbone interact. energy: -0.206 local terms energy: -175.333427 where: bonds (distance) C4'-P energy: -35.287 bonds (distance) P-C4' energy: -34.075 flat angles C4'-P-C4' energy: -38.540 flat angles P-C4'-P energy: -23.408 tors. eta vs tors. theta energy: -44.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -611.823592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.823592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.823592 (E_RNA) where: Base-Base interactions energy: -439.409 where: short stacking energy: -191.172 Base-Backbone interact. energy: -0.273 local terms energy: -172.141484 where: bonds (distance) C4'-P energy: -28.616 bonds (distance) P-C4' energy: -37.037 flat angles C4'-P-C4' energy: -32.021 flat angles P-C4'-P energy: -27.884 tors. eta vs tors. theta energy: -46.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -566.885109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.885109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.885109 (E_RNA) where: Base-Base interactions energy: -411.939 where: short stacking energy: -176.680 Base-Backbone interact. energy: -0.300 local terms energy: -154.646463 where: bonds (distance) C4'-P energy: -34.065 bonds (distance) P-C4' energy: -28.633 flat angles C4'-P-C4' energy: -30.431 flat angles P-C4'-P energy: -21.112 tors. eta vs tors. theta energy: -40.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -562.640911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.640911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.640911 (E_RNA) where: Base-Base interactions energy: -387.135 where: short stacking energy: -179.216 Base-Backbone interact. energy: -1.923 local terms energy: -173.583292 where: bonds (distance) C4'-P energy: -31.980 bonds (distance) P-C4' energy: -36.695 flat angles C4'-P-C4' energy: -34.621 flat angles P-C4'-P energy: -25.470 tors. eta vs tors. theta energy: -44.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -531.687809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.687809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.687809 (E_RNA) where: Base-Base interactions energy: -368.111 where: short stacking energy: -163.128 Base-Backbone interact. energy: -0.191 local terms energy: -163.386381 where: bonds (distance) C4'-P energy: -29.059 bonds (distance) P-C4' energy: -34.215 flat angles C4'-P-C4' energy: -39.341 flat angles P-C4'-P energy: -25.226 tors. eta vs tors. theta energy: -35.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -486.385850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.385850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.385850 (E_RNA) where: Base-Base interactions energy: -334.201 where: short stacking energy: -145.449 Base-Backbone interact. energy: -0.365 local terms energy: -151.820791 where: bonds (distance) C4'-P energy: -35.201 bonds (distance) P-C4' energy: -24.427 flat angles C4'-P-C4' energy: -29.506 flat angles P-C4'-P energy: -25.886 tors. eta vs tors. theta energy: -36.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -424.239740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.239740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.239740 (E_RNA) where: Base-Base interactions energy: -296.259 where: short stacking energy: -126.096 Base-Backbone interact. energy: -0.367 local terms energy: -127.613798 where: bonds (distance) C4'-P energy: -26.883 bonds (distance) P-C4' energy: -30.252 flat angles C4'-P-C4' energy: -28.112 flat angles P-C4'-P energy: -20.065 tors. eta vs tors. theta energy: -22.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -455.329107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.329107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.329107 (E_RNA) where: Base-Base interactions energy: -327.151 where: short stacking energy: -131.069 Base-Backbone interact. energy: -1.062 local terms energy: -127.115813 where: bonds (distance) C4'-P energy: -33.534 bonds (distance) P-C4' energy: -21.972 flat angles C4'-P-C4' energy: -30.005 flat angles P-C4'-P energy: -13.099 tors. eta vs tors. theta energy: -28.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -683.750462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.750462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.750462 (E_RNA) where: Base-Base interactions energy: -472.933 where: short stacking energy: -209.741 Base-Backbone interact. energy: 1.625 local terms energy: -212.442037 where: bonds (distance) C4'-P energy: -37.698 bonds (distance) P-C4' energy: -40.221 flat angles C4'-P-C4' energy: -44.971 flat angles P-C4'-P energy: -31.050 tors. eta vs tors. theta energy: -58.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -665.775066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.775066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.775066 (E_RNA) where: Base-Base interactions energy: -460.273 where: short stacking energy: -208.019 Base-Backbone interact. energy: -0.855 local terms energy: -204.647397 where: bonds (distance) C4'-P energy: -36.948 bonds (distance) P-C4' energy: -38.435 flat angles C4'-P-C4' energy: -37.830 flat angles P-C4'-P energy: -34.383 tors. eta vs tors. theta energy: -57.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -616.177201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.177201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.177201 (E_RNA) where: Base-Base interactions energy: -428.267 where: short stacking energy: -190.874 Base-Backbone interact. energy: -0.418 local terms energy: -187.491706 where: bonds (distance) C4'-P energy: -29.101 bonds (distance) P-C4' energy: -40.543 flat angles C4'-P-C4' energy: -46.890 flat angles P-C4'-P energy: -22.475 tors. eta vs tors. theta energy: -48.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -639.343941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.343941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.343941 (E_RNA) where: Base-Base interactions energy: -459.584 where: short stacking energy: -182.568 Base-Backbone interact. energy: -0.320 local terms energy: -179.439889 where: bonds (distance) C4'-P energy: -34.776 bonds (distance) P-C4' energy: -37.831 flat angles C4'-P-C4' energy: -41.365 flat angles P-C4'-P energy: -20.535 tors. eta vs tors. theta energy: -44.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -572.759251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.759251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.759251 (E_RNA) where: Base-Base interactions energy: -406.525 where: short stacking energy: -180.925 Base-Backbone interact. energy: -0.413 local terms energy: -165.820793 where: bonds (distance) C4'-P energy: -33.633 bonds (distance) P-C4' energy: -31.760 flat angles C4'-P-C4' energy: -36.091 flat angles P-C4'-P energy: -16.757 tors. eta vs tors. theta energy: -47.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -556.307153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.307153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.307153 (E_RNA) where: Base-Base interactions energy: -394.803 where: short stacking energy: -172.447 Base-Backbone interact. energy: -1.055 local terms energy: -160.449725 where: bonds (distance) C4'-P energy: -20.600 bonds (distance) P-C4' energy: -39.068 flat angles C4'-P-C4' energy: -33.777 flat angles P-C4'-P energy: -24.157 tors. eta vs tors. theta energy: -42.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -530.227791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.227791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.227791 (E_RNA) where: Base-Base interactions energy: -386.449 where: short stacking energy: -166.301 Base-Backbone interact. energy: 2.772 local terms energy: -146.550843 where: bonds (distance) C4'-P energy: -18.833 bonds (distance) P-C4' energy: -32.651 flat angles C4'-P-C4' energy: -33.982 flat angles P-C4'-P energy: -20.639 tors. eta vs tors. theta energy: -40.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -468.606584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.606584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.606584 (E_RNA) where: Base-Base interactions energy: -320.038 where: short stacking energy: -131.928 Base-Backbone interact. energy: -0.721 local terms energy: -147.847220 where: bonds (distance) C4'-P energy: -35.897 bonds (distance) P-C4' energy: -30.563 flat angles C4'-P-C4' energy: -32.472 flat angles P-C4'-P energy: -20.328 tors. eta vs tors. theta energy: -28.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -495.071607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.071607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.071607 (E_RNA) where: Base-Base interactions energy: -366.714 where: short stacking energy: -139.846 Base-Backbone interact. energy: 0.713 local terms energy: -129.069918 where: bonds (distance) C4'-P energy: -30.064 bonds (distance) P-C4' energy: -27.489 flat angles C4'-P-C4' energy: -30.679 flat angles P-C4'-P energy: -16.463 tors. eta vs tors. theta energy: -24.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -361.737507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.737507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.737507 (E_RNA) where: Base-Base interactions energy: -226.499 where: short stacking energy: -103.864 Base-Backbone interact. energy: 1.034 local terms energy: -136.272435 where: bonds (distance) C4'-P energy: -38.049 bonds (distance) P-C4' energy: -39.973 flat angles C4'-P-C4' energy: -37.595 flat angles P-C4'-P energy: -20.330 tors. eta vs tors. theta energy: -0.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -690.968809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.968809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.968809 (E_RNA) where: Base-Base interactions energy: -485.499 where: short stacking energy: -217.135 Base-Backbone interact. energy: -0.250 local terms energy: -205.219468 where: bonds (distance) C4'-P energy: -35.441 bonds (distance) P-C4' energy: -39.669 flat angles C4'-P-C4' energy: -44.218 flat angles P-C4'-P energy: -28.616 tors. eta vs tors. theta energy: -57.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -676.841113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.841113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.841113 (E_RNA) where: Base-Base interactions energy: -475.967 where: short stacking energy: -213.558 Base-Backbone interact. energy: -0.722 local terms energy: -200.151280 where: bonds (distance) C4'-P energy: -32.046 bonds (distance) P-C4' energy: -39.436 flat angles C4'-P-C4' energy: -44.248 flat angles P-C4'-P energy: -27.271 tors. eta vs tors. theta energy: -57.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -615.722177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.722177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.722177 (E_RNA) where: Base-Base interactions energy: -421.519 where: short stacking energy: -188.772 Base-Backbone interact. energy: -0.124 local terms energy: -194.079133 where: bonds (distance) C4'-P energy: -36.104 bonds (distance) P-C4' energy: -40.959 flat angles C4'-P-C4' energy: -40.508 flat angles P-C4'-P energy: -29.233 tors. eta vs tors. theta energy: -47.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -604.431605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.431605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.431605 (E_RNA) where: Base-Base interactions energy: -435.661 where: short stacking energy: -183.652 Base-Backbone interact. energy: -0.590 local terms energy: -168.180414 where: bonds (distance) C4'-P energy: -33.791 bonds (distance) P-C4' energy: -27.846 flat angles C4'-P-C4' energy: -37.923 flat angles P-C4'-P energy: -18.663 tors. eta vs tors. theta energy: -49.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -630.394877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.394877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.394877 (E_RNA) where: Base-Base interactions energy: -450.109 where: short stacking energy: -187.560 Base-Backbone interact. energy: 1.159 local terms energy: -181.445056 where: bonds (distance) C4'-P energy: -38.776 bonds (distance) P-C4' energy: -38.914 flat angles C4'-P-C4' energy: -35.393 flat angles P-C4'-P energy: -22.334 tors. eta vs tors. theta energy: -46.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -562.111340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.111340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.111340 (E_RNA) where: Base-Base interactions energy: -391.941 where: short stacking energy: -182.313 Base-Backbone interact. energy: -0.318 local terms energy: -169.851910 where: bonds (distance) C4'-P energy: -29.033 bonds (distance) P-C4' energy: -37.236 flat angles C4'-P-C4' energy: -33.243 flat angles P-C4'-P energy: -23.239 tors. eta vs tors. theta energy: -47.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -528.353171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.353171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.353171 (E_RNA) where: Base-Base interactions energy: -363.619 where: short stacking energy: -147.301 Base-Backbone interact. energy: -1.519 local terms energy: -163.215055 where: bonds (distance) C4'-P energy: -33.691 bonds (distance) P-C4' energy: -40.060 flat angles C4'-P-C4' energy: -41.445 flat angles P-C4'-P energy: -18.803 tors. eta vs tors. theta energy: -29.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -508.455327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.455327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.455327 (E_RNA) where: Base-Base interactions energy: -367.208 where: short stacking energy: -149.488 Base-Backbone interact. energy: 0.744 local terms energy: -141.991331 where: bonds (distance) C4'-P energy: -27.871 bonds (distance) P-C4' energy: -28.095 flat angles C4'-P-C4' energy: -34.774 flat angles P-C4'-P energy: -19.420 tors. eta vs tors. theta energy: -31.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -454.750492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.750492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.750492 (E_RNA) where: Base-Base interactions energy: -313.951 where: short stacking energy: -148.510 Base-Backbone interact. energy: -0.471 local terms energy: -140.328427 where: bonds (distance) C4'-P energy: -33.249 bonds (distance) P-C4' energy: -29.259 flat angles C4'-P-C4' energy: -32.285 flat angles P-C4'-P energy: -13.537 tors. eta vs tors. theta energy: -31.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -374.743076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.743076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.743076 (E_RNA) where: Base-Base interactions energy: -255.037 where: short stacking energy: -99.092 Base-Backbone interact. energy: -0.359 local terms energy: -119.346962 where: bonds (distance) C4'-P energy: -31.923 bonds (distance) P-C4' energy: -27.159 flat angles C4'-P-C4' energy: -35.335 flat angles P-C4'-P energy: -14.250 tors. eta vs tors. theta energy: -10.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -693.585904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.585904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.585904 (E_RNA) where: Base-Base interactions energy: -490.767 where: short stacking energy: -219.896 Base-Backbone interact. energy: -0.022 local terms energy: -202.796986 where: bonds (distance) C4'-P energy: -35.558 bonds (distance) P-C4' energy: -33.004 flat angles C4'-P-C4' energy: -42.144 flat angles P-C4'-P energy: -30.660 tors. eta vs tors. theta energy: -61.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -680.802486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.802486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.802486 (E_RNA) where: Base-Base interactions energy: -475.840 where: short stacking energy: -218.284 Base-Backbone interact. energy: 0.351 local terms energy: -205.313700 where: bonds (distance) C4'-P energy: -36.774 bonds (distance) P-C4' energy: -30.860 flat angles C4'-P-C4' energy: -45.266 flat angles P-C4'-P energy: -33.585 tors. eta vs tors. theta energy: -58.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -632.904204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.904204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.904204 (E_RNA) where: Base-Base interactions energy: -446.401 where: short stacking energy: -198.793 Base-Backbone interact. energy: -0.113 local terms energy: -186.389783 where: bonds (distance) C4'-P energy: -37.420 bonds (distance) P-C4' energy: -38.219 flat angles C4'-P-C4' energy: -36.148 flat angles P-C4'-P energy: -24.297 tors. eta vs tors. theta energy: -50.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -586.010962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.010962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.010962 (E_RNA) where: Base-Base interactions energy: -404.948 where: short stacking energy: -189.948 Base-Backbone interact. energy: -0.591 local terms energy: -180.472399 where: bonds (distance) C4'-P energy: -31.746 bonds (distance) P-C4' energy: -36.483 flat angles C4'-P-C4' energy: -38.390 flat angles P-C4'-P energy: -22.129 tors. eta vs tors. theta energy: -51.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -613.656550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.656550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.656550 (E_RNA) where: Base-Base interactions energy: -430.627 where: short stacking energy: -180.732 Base-Backbone interact. energy: -0.784 local terms energy: -182.245993 where: bonds (distance) C4'-P energy: -33.992 bonds (distance) P-C4' energy: -38.097 flat angles C4'-P-C4' energy: -39.193 flat angles P-C4'-P energy: -28.549 tors. eta vs tors. theta energy: -42.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -571.479917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.479917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.479917 (E_RNA) where: Base-Base interactions energy: -386.317 where: short stacking energy: -192.125 Base-Backbone interact. energy: -0.109 local terms energy: -185.054727 where: bonds (distance) C4'-P energy: -40.219 bonds (distance) P-C4' energy: -37.438 flat angles C4'-P-C4' energy: -37.990 flat angles P-C4'-P energy: -17.800 tors. eta vs tors. theta energy: -51.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -526.993669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.993669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.993669 (E_RNA) where: Base-Base interactions energy: -370.294 where: short stacking energy: -154.552 Base-Backbone interact. energy: -0.028 local terms energy: -156.670769 where: bonds (distance) C4'-P energy: -35.591 bonds (distance) P-C4' energy: -33.925 flat angles C4'-P-C4' energy: -28.280 flat angles P-C4'-P energy: -21.250 tors. eta vs tors. theta energy: -37.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -516.565335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.565335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.565335 (E_RNA) where: Base-Base interactions energy: -358.733 where: short stacking energy: -145.215 Base-Backbone interact. energy: 0.809 local terms energy: -158.640911 where: bonds (distance) C4'-P energy: -36.823 bonds (distance) P-C4' energy: -30.551 flat angles C4'-P-C4' energy: -34.471 flat angles P-C4'-P energy: -21.519 tors. eta vs tors. theta energy: -35.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -408.618751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.618751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.618751 (E_RNA) where: Base-Base interactions energy: -262.511 where: short stacking energy: -117.912 Base-Backbone interact. energy: -0.704 local terms energy: -145.403455 where: bonds (distance) C4'-P energy: -35.316 bonds (distance) P-C4' energy: -38.815 flat angles C4'-P-C4' energy: -32.800 flat angles P-C4'-P energy: -15.715 tors. eta vs tors. theta energy: -22.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -429.676871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.676871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.676871 (E_RNA) where: Base-Base interactions energy: -293.687 where: short stacking energy: -129.940 Base-Backbone interact. energy: -0.091 local terms energy: -135.899640 where: bonds (distance) C4'-P energy: -34.559 bonds (distance) P-C4' energy: -29.018 flat angles C4'-P-C4' energy: -34.489 flat angles P-C4'-P energy: -18.827 tors. eta vs tors. theta energy: -19.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -690.995326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.995326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.995326 (E_RNA) where: Base-Base interactions energy: -493.080 where: short stacking energy: -230.659 Base-Backbone interact. energy: 0.505 local terms energy: -198.420725 where: bonds (distance) C4'-P energy: -43.001 bonds (distance) P-C4' energy: -33.784 flat angles C4'-P-C4' energy: -41.052 flat angles P-C4'-P energy: -19.735 tors. eta vs tors. theta energy: -60.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -697.606427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.606427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.606427 (E_RNA) where: Base-Base interactions energy: -479.312 where: short stacking energy: -222.868 Base-Backbone interact. energy: -0.213 local terms energy: -218.082122 where: bonds (distance) C4'-P energy: -36.332 bonds (distance) P-C4' energy: -42.983 flat angles C4'-P-C4' energy: -45.758 flat angles P-C4'-P energy: -31.482 tors. eta vs tors. theta energy: -61.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -635.427553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.427553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.427553 (E_RNA) where: Base-Base interactions energy: -446.236 where: short stacking energy: -191.745 Base-Backbone interact. energy: -0.261 local terms energy: -188.931196 where: bonds (distance) C4'-P energy: -32.315 bonds (distance) P-C4' energy: -37.275 flat angles C4'-P-C4' energy: -40.277 flat angles P-C4'-P energy: -28.078 tors. eta vs tors. theta energy: -50.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -626.204635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.204635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.204635 (E_RNA) where: Base-Base interactions energy: -448.204 where: short stacking energy: -183.848 Base-Backbone interact. energy: -0.726 local terms energy: -177.275006 where: bonds (distance) C4'-P energy: -32.281 bonds (distance) P-C4' energy: -29.017 flat angles C4'-P-C4' energy: -42.553 flat angles P-C4'-P energy: -24.175 tors. eta vs tors. theta energy: -49.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -582.908885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.908885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.908885 (E_RNA) where: Base-Base interactions energy: -399.170 where: short stacking energy: -183.811 Base-Backbone interact. energy: -0.871 local terms energy: -182.867855 where: bonds (distance) C4'-P energy: -33.624 bonds (distance) P-C4' energy: -36.636 flat angles C4'-P-C4' energy: -38.531 flat angles P-C4'-P energy: -26.267 tors. eta vs tors. theta energy: -47.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -554.858323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.858323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.858323 (E_RNA) where: Base-Base interactions energy: -384.850 where: short stacking energy: -175.824 Base-Backbone interact. energy: -0.517 local terms energy: -169.491958 where: bonds (distance) C4'-P energy: -29.035 bonds (distance) P-C4' energy: -27.359 flat angles C4'-P-C4' energy: -38.025 flat angles P-C4'-P energy: -28.042 tors. eta vs tors. theta energy: -47.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -534.671282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.671282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.671282 (E_RNA) where: Base-Base interactions energy: -384.515 where: short stacking energy: -164.386 Base-Backbone interact. energy: -0.627 local terms energy: -149.529090 where: bonds (distance) C4'-P energy: -28.913 bonds (distance) P-C4' energy: -34.180 flat angles C4'-P-C4' energy: -28.731 flat angles P-C4'-P energy: -19.913 tors. eta vs tors. theta energy: -37.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -541.750840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.750840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.750840 (E_RNA) where: Base-Base interactions energy: -392.637 where: short stacking energy: -155.146 Base-Backbone interact. energy: -1.016 local terms energy: -148.097951 where: bonds (distance) C4'-P energy: -18.504 bonds (distance) P-C4' energy: -36.509 flat angles C4'-P-C4' energy: -37.042 flat angles P-C4'-P energy: -18.072 tors. eta vs tors. theta energy: -37.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -420.625563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.625563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.625563 (E_RNA) where: Base-Base interactions energy: -286.539 where: short stacking energy: -131.943 Base-Backbone interact. energy: 1.301 local terms energy: -135.387303 where: bonds (distance) C4'-P energy: -21.178 bonds (distance) P-C4' energy: -33.260 flat angles C4'-P-C4' energy: -40.146 flat angles P-C4'-P energy: -24.007 tors. eta vs tors. theta energy: -16.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -423.618427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.618427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.618427 (E_RNA) where: Base-Base interactions energy: -284.082 where: short stacking energy: -125.855 Base-Backbone interact. energy: 5.514 local terms energy: -145.050976 where: bonds (distance) C4'-P energy: -34.447 bonds (distance) P-C4' energy: -32.151 flat angles C4'-P-C4' energy: -27.211 flat angles P-C4'-P energy: -22.305 tors. eta vs tors. theta energy: -28.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -677.004082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.004082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.004082 (E_RNA) where: Base-Base interactions energy: -481.528 where: short stacking energy: -213.538 Base-Backbone interact. energy: -0.007 local terms energy: -195.468792 where: bonds (distance) C4'-P energy: -38.194 bonds (distance) P-C4' energy: -35.736 flat angles C4'-P-C4' energy: -39.697 flat angles P-C4'-P energy: -23.965 tors. eta vs tors. theta energy: -57.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -680.287181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.287181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.287181 (E_RNA) where: Base-Base interactions energy: -468.954 where: short stacking energy: -213.947 Base-Backbone interact. energy: -0.607 local terms energy: -210.726762 where: bonds (distance) C4'-P energy: -37.345 bonds (distance) P-C4' energy: -41.255 flat angles C4'-P-C4' energy: -39.358 flat angles P-C4'-P energy: -29.219 tors. eta vs tors. theta energy: -63.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -616.160497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.160497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.160497 (E_RNA) where: Base-Base interactions energy: -443.493 where: short stacking energy: -184.596 Base-Backbone interact. energy: -0.551 local terms energy: -172.116658 where: bonds (distance) C4'-P energy: -38.335 bonds (distance) P-C4' energy: -25.020 flat angles C4'-P-C4' energy: -44.050 flat angles P-C4'-P energy: -20.180 tors. eta vs tors. theta energy: -44.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -613.196977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.196977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.196977 (E_RNA) where: Base-Base interactions energy: -441.370 where: short stacking energy: -191.373 Base-Backbone interact. energy: -1.480 local terms energy: -170.347037 where: bonds (distance) C4'-P energy: -32.563 bonds (distance) P-C4' energy: -27.358 flat angles C4'-P-C4' energy: -38.985 flat angles P-C4'-P energy: -27.662 tors. eta vs tors. theta energy: -43.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -594.375151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.375151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.375151 (E_RNA) where: Base-Base interactions energy: -410.232 where: short stacking energy: -176.454 Base-Backbone interact. energy: 1.028 local terms energy: -185.171185 where: bonds (distance) C4'-P energy: -38.970 bonds (distance) P-C4' energy: -35.701 flat angles C4'-P-C4' energy: -37.409 flat angles P-C4'-P energy: -27.406 tors. eta vs tors. theta energy: -45.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -553.011694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.011694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.011694 (E_RNA) where: Base-Base interactions energy: -395.470 where: short stacking energy: -169.217 Base-Backbone interact. energy: -0.495 local terms energy: -157.046018 where: bonds (distance) C4'-P energy: -26.335 bonds (distance) P-C4' energy: -33.427 flat angles C4'-P-C4' energy: -25.854 flat angles P-C4'-P energy: -27.875 tors. eta vs tors. theta energy: -43.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -545.518945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.518945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.518945 (E_RNA) where: Base-Base interactions energy: -384.523 where: short stacking energy: -160.958 Base-Backbone interact. energy: 0.308 local terms energy: -161.303953 where: bonds (distance) C4'-P energy: -34.181 bonds (distance) P-C4' energy: -35.654 flat angles C4'-P-C4' energy: -36.898 flat angles P-C4'-P energy: -19.580 tors. eta vs tors. theta energy: -34.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -537.881009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.881009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.881009 (E_RNA) where: Base-Base interactions energy: -372.533 where: short stacking energy: -151.103 Base-Backbone interact. energy: -1.557 local terms energy: -163.790965 where: bonds (distance) C4'-P energy: -33.332 bonds (distance) P-C4' energy: -35.707 flat angles C4'-P-C4' energy: -39.486 flat angles P-C4'-P energy: -20.383 tors. eta vs tors. theta energy: -34.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -446.890759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.890759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.890759 (E_RNA) where: Base-Base interactions energy: -300.137 where: short stacking energy: -121.178 Base-Backbone interact. energy: -0.650 local terms energy: -146.104360 where: bonds (distance) C4'-P energy: -36.832 bonds (distance) P-C4' energy: -32.703 flat angles C4'-P-C4' energy: -33.952 flat angles P-C4'-P energy: -22.425 tors. eta vs tors. theta energy: -20.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -395.338515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.338515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.338515 (E_RNA) where: Base-Base interactions energy: -278.080 where: short stacking energy: -117.461 Base-Backbone interact. energy: -0.773 local terms energy: -116.485580 where: bonds (distance) C4'-P energy: -25.542 bonds (distance) P-C4' energy: -23.950 flat angles C4'-P-C4' energy: -32.135 flat angles P-C4'-P energy: -12.327 tors. eta vs tors. theta energy: -22.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -685.027515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.027515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.027515 (E_RNA) where: Base-Base interactions energy: -488.423 where: short stacking energy: -216.825 Base-Backbone interact. energy: -0.546 local terms energy: -196.059018 where: bonds (distance) C4'-P energy: -34.346 bonds (distance) P-C4' energy: -34.057 flat angles C4'-P-C4' energy: -40.365 flat angles P-C4'-P energy: -26.550 tors. eta vs tors. theta energy: -60.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -689.336550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.336550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.336550 (E_RNA) where: Base-Base interactions energy: -491.061 where: short stacking energy: -217.146 Base-Backbone interact. energy: 0.267 local terms energy: -198.542368 where: bonds (distance) C4'-P energy: -33.831 bonds (distance) P-C4' energy: -36.960 flat angles C4'-P-C4' energy: -37.951 flat angles P-C4'-P energy: -27.806 tors. eta vs tors. theta energy: -61.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -645.162082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.162082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.162082 (E_RNA) where: Base-Base interactions energy: -466.039 where: short stacking energy: -183.961 Base-Backbone interact. energy: -0.171 local terms energy: -178.951868 where: bonds (distance) C4'-P energy: -36.257 bonds (distance) P-C4' energy: -34.943 flat angles C4'-P-C4' energy: -40.195 flat angles P-C4'-P energy: -19.434 tors. eta vs tors. theta energy: -48.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -598.427903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.427903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.427903 (E_RNA) where: Base-Base interactions energy: -421.278 where: short stacking energy: -182.179 Base-Backbone interact. energy: -0.728 local terms energy: -176.421748 where: bonds (distance) C4'-P energy: -39.877 bonds (distance) P-C4' energy: -31.074 flat angles C4'-P-C4' energy: -37.585 flat angles P-C4'-P energy: -23.721 tors. eta vs tors. theta energy: -44.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -583.799253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.799253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.799253 (E_RNA) where: Base-Base interactions energy: -405.803 where: short stacking energy: -177.106 Base-Backbone interact. energy: -1.723 local terms energy: -176.273353 where: bonds (distance) C4'-P energy: -32.523 bonds (distance) P-C4' energy: -40.756 flat angles C4'-P-C4' energy: -38.204 flat angles P-C4'-P energy: -19.723 tors. eta vs tors. theta energy: -45.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -546.324592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.324592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.324592 (E_RNA) where: Base-Base interactions energy: -382.293 where: short stacking energy: -167.964 Base-Backbone interact. energy: -0.295 local terms energy: -163.737302 where: bonds (distance) C4'-P energy: -25.024 bonds (distance) P-C4' energy: -35.150 flat angles C4'-P-C4' energy: -34.025 flat angles P-C4'-P energy: -28.275 tors. eta vs tors. theta energy: -41.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -515.276158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.276158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.276158 (E_RNA) where: Base-Base interactions energy: -366.090 where: short stacking energy: -144.897 Base-Backbone interact. energy: 0.394 local terms energy: -149.580577 where: bonds (distance) C4'-P energy: -27.105 bonds (distance) P-C4' energy: -30.668 flat angles C4'-P-C4' energy: -33.311 flat angles P-C4'-P energy: -24.428 tors. eta vs tors. theta energy: -34.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -469.868350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.868350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.868350 (E_RNA) where: Base-Base interactions energy: -334.629 where: short stacking energy: -135.588 Base-Backbone interact. energy: 1.977 local terms energy: -137.216168 where: bonds (distance) C4'-P energy: -30.001 bonds (distance) P-C4' energy: -34.510 flat angles C4'-P-C4' energy: -33.160 flat angles P-C4'-P energy: -16.779 tors. eta vs tors. theta energy: -22.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -516.501466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.501466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.501466 (E_RNA) where: Base-Base interactions energy: -373.348 where: short stacking energy: -150.959 Base-Backbone interact. energy: -1.301 local terms energy: -141.852261 where: bonds (distance) C4'-P energy: -23.451 bonds (distance) P-C4' energy: -22.388 flat angles C4'-P-C4' energy: -41.700 flat angles P-C4'-P energy: -24.451 tors. eta vs tors. theta energy: -29.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -372.879613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.879613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.879613 (E_RNA) where: Base-Base interactions energy: -259.605 where: short stacking energy: -105.872 Base-Backbone interact. energy: -1.827 local terms energy: -111.447210 where: bonds (distance) C4'-P energy: -33.257 bonds (distance) P-C4' energy: -27.580 flat angles C4'-P-C4' energy: -37.016 flat angles P-C4'-P energy: -4.892 tors. eta vs tors. theta energy: -8.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -696.913683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.913683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.913683 (E_RNA) where: Base-Base interactions energy: -493.077 where: short stacking energy: -226.807 Base-Backbone interact. energy: -0.404 local terms energy: -203.433071 where: bonds (distance) C4'-P energy: -30.774 bonds (distance) P-C4' energy: -40.364 flat angles C4'-P-C4' energy: -37.290 flat angles P-C4'-P energy: -31.790 tors. eta vs tors. theta energy: -63.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -683.439471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.439471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.439471 (E_RNA) where: Base-Base interactions energy: -483.480 where: short stacking energy: -210.831 Base-Backbone interact. energy: -0.500 local terms energy: -199.459154 where: bonds (distance) C4'-P energy: -35.417 bonds (distance) P-C4' energy: -37.423 flat angles C4'-P-C4' energy: -39.234 flat angles P-C4'-P energy: -26.296 tors. eta vs tors. theta energy: -61.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -638.422599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.422599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.422599 (E_RNA) where: Base-Base interactions energy: -467.985 where: short stacking energy: -182.726 Base-Backbone interact. energy: -0.427 local terms energy: -170.010891 where: bonds (distance) C4'-P energy: -33.882 bonds (distance) P-C4' energy: -34.965 flat angles C4'-P-C4' energy: -37.596 flat angles P-C4'-P energy: -23.775 tors. eta vs tors. theta energy: -39.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -602.105410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.105410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.105410 (E_RNA) where: Base-Base interactions energy: -423.653 where: short stacking energy: -180.557 Base-Backbone interact. energy: -0.740 local terms energy: -177.712577 where: bonds (distance) C4'-P energy: -30.330 bonds (distance) P-C4' energy: -36.975 flat angles C4'-P-C4' energy: -39.689 flat angles P-C4'-P energy: -28.240 tors. eta vs tors. theta energy: -42.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -586.034575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.034575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.034575 (E_RNA) where: Base-Base interactions energy: -403.074 where: short stacking energy: -173.987 Base-Backbone interact. energy: -0.489 local terms energy: -182.471558 where: bonds (distance) C4'-P energy: -38.406 bonds (distance) P-C4' energy: -30.608 flat angles C4'-P-C4' energy: -36.443 flat angles P-C4'-P energy: -26.452 tors. eta vs tors. theta energy: -50.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -552.250825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.250825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.250825 (E_RNA) where: Base-Base interactions energy: -377.910 where: short stacking energy: -168.488 Base-Backbone interact. energy: -0.318 local terms energy: -174.023347 where: bonds (distance) C4'-P energy: -32.428 bonds (distance) P-C4' energy: -34.418 flat angles C4'-P-C4' energy: -34.807 flat angles P-C4'-P energy: -29.004 tors. eta vs tors. theta energy: -43.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -540.597916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.597916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.597916 (E_RNA) where: Base-Base interactions energy: -373.067 where: short stacking energy: -161.747 Base-Backbone interact. energy: -0.122 local terms energy: -167.409016 where: bonds (distance) C4'-P energy: -31.255 bonds (distance) P-C4' energy: -36.028 flat angles C4'-P-C4' energy: -34.012 flat angles P-C4'-P energy: -26.327 tors. eta vs tors. theta energy: -39.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -510.334246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.334246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.334246 (E_RNA) where: Base-Base interactions energy: -377.169 where: short stacking energy: -163.119 Base-Backbone interact. energy: 3.511 local terms energy: -136.675441 where: bonds (distance) C4'-P energy: -26.415 bonds (distance) P-C4' energy: -31.842 flat angles C4'-P-C4' energy: -27.018 flat angles P-C4'-P energy: -22.523 tors. eta vs tors. theta energy: -28.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -542.781937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.781937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.781937 (E_RNA) where: Base-Base interactions energy: -376.266 where: short stacking energy: -155.327 Base-Backbone interact. energy: -1.240 local terms energy: -165.276162 where: bonds (distance) C4'-P energy: -32.350 bonds (distance) P-C4' energy: -34.163 flat angles C4'-P-C4' energy: -33.967 flat angles P-C4'-P energy: -20.515 tors. eta vs tors. theta energy: -44.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -365.159141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.159141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.159141 (E_RNA) where: Base-Base interactions energy: -247.703 where: short stacking energy: -112.588 Base-Backbone interact. energy: -0.328 local terms energy: -117.128482 where: bonds (distance) C4'-P energy: -16.366 bonds (distance) P-C4' energy: -31.811 flat angles C4'-P-C4' energy: -31.367 flat angles P-C4'-P energy: -23.004 tors. eta vs tors. theta energy: -14.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -695.239732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.239732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.239732 (E_RNA) where: Base-Base interactions energy: -480.164 where: short stacking energy: -218.059 Base-Backbone interact. energy: -0.086 local terms energy: -214.989888 where: bonds (distance) C4'-P energy: -38.493 bonds (distance) P-C4' energy: -39.413 flat angles C4'-P-C4' energy: -45.817 flat angles P-C4'-P energy: -30.212 tors. eta vs tors. theta energy: -61.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -673.983071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.983071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.983071 (E_RNA) where: Base-Base interactions energy: -485.706 where: short stacking energy: -209.854 Base-Backbone interact. energy: -0.271 local terms energy: -188.005435 where: bonds (distance) C4'-P energy: -35.880 bonds (distance) P-C4' energy: -23.887 flat angles C4'-P-C4' energy: -41.119 flat angles P-C4'-P energy: -28.422 tors. eta vs tors. theta energy: -58.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -637.860045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.860045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.860045 (E_RNA) where: Base-Base interactions energy: -454.558 where: short stacking energy: -181.418 Base-Backbone interact. energy: -0.710 local terms energy: -182.592633 where: bonds (distance) C4'-P energy: -38.490 bonds (distance) P-C4' energy: -36.070 flat angles C4'-P-C4' energy: -35.331 flat angles P-C4'-P energy: -24.490 tors. eta vs tors. theta energy: -48.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -614.880338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.880338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.880338 (E_RNA) where: Base-Base interactions energy: -431.841 where: short stacking energy: -187.964 Base-Backbone interact. energy: -1.129 local terms energy: -181.910166 where: bonds (distance) C4'-P energy: -37.759 bonds (distance) P-C4' energy: -36.956 flat angles C4'-P-C4' energy: -38.251 flat angles P-C4'-P energy: -25.787 tors. eta vs tors. theta energy: -43.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -569.503024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.503024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.503024 (E_RNA) where: Base-Base interactions energy: -409.584 where: short stacking energy: -164.647 Base-Backbone interact. energy: -1.214 local terms energy: -158.705012 where: bonds (distance) C4'-P energy: -31.256 bonds (distance) P-C4' energy: -31.804 flat angles C4'-P-C4' energy: -36.273 flat angles P-C4'-P energy: -24.447 tors. eta vs tors. theta energy: -34.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -547.093041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.093041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.093041 (E_RNA) where: Base-Base interactions energy: -367.882 where: short stacking energy: -169.839 Base-Backbone interact. energy: 0.019 local terms energy: -179.229881 where: bonds (distance) C4'-P energy: -38.363 bonds (distance) P-C4' energy: -33.091 flat angles C4'-P-C4' energy: -40.088 flat angles P-C4'-P energy: -26.102 tors. eta vs tors. theta energy: -41.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -531.986473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.986473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.986473 (E_RNA) where: Base-Base interactions energy: -361.176 where: short stacking energy: -154.740 Base-Backbone interact. energy: -0.041 local terms energy: -170.769993 where: bonds (distance) C4'-P energy: -37.039 bonds (distance) P-C4' energy: -32.866 flat angles C4'-P-C4' energy: -41.029 flat angles P-C4'-P energy: -24.505 tors. eta vs tors. theta energy: -35.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -545.793520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.793520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.793520 (E_RNA) where: Base-Base interactions energy: -396.258 where: short stacking energy: -140.385 Base-Backbone interact. energy: -1.546 local terms energy: -147.989402 where: bonds (distance) C4'-P energy: -31.167 bonds (distance) P-C4' energy: -32.663 flat angles C4'-P-C4' energy: -36.132 flat angles P-C4'-P energy: -17.017 tors. eta vs tors. theta energy: -31.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -517.366672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.366672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.366672 (E_RNA) where: Base-Base interactions energy: -362.757 where: short stacking energy: -146.051 Base-Backbone interact. energy: -0.284 local terms energy: -154.325794 where: bonds (distance) C4'-P energy: -33.231 bonds (distance) P-C4' energy: -29.810 flat angles C4'-P-C4' energy: -39.543 flat angles P-C4'-P energy: -15.878 tors. eta vs tors. theta energy: -35.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -386.186018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.186018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.186018 (E_RNA) where: Base-Base interactions energy: -262.374 where: short stacking energy: -120.385 Base-Backbone interact. energy: 0.733 local terms energy: -124.545403 where: bonds (distance) C4'-P energy: -25.325 bonds (distance) P-C4' energy: -36.359 flat angles C4'-P-C4' energy: -30.394 flat angles P-C4'-P energy: -21.967 tors. eta vs tors. theta energy: -10.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -693.682687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.682687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.682687 (E_RNA) where: Base-Base interactions energy: -482.787 where: short stacking energy: -210.826 Base-Backbone interact. energy: -0.050 local terms energy: -210.846039 where: bonds (distance) C4'-P energy: -43.742 bonds (distance) P-C4' energy: -43.140 flat angles C4'-P-C4' energy: -43.668 flat angles P-C4'-P energy: -20.172 tors. eta vs tors. theta energy: -60.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -699.300459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.300459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.300459 (E_RNA) where: Base-Base interactions energy: -494.501 where: short stacking energy: -229.288 Base-Backbone interact. energy: -0.098 local terms energy: -204.702104 where: bonds (distance) C4'-P energy: -40.282 bonds (distance) P-C4' energy: -35.486 flat angles C4'-P-C4' energy: -38.643 flat angles P-C4'-P energy: -27.093 tors. eta vs tors. theta energy: -63.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -651.665389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.665389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.665389 (E_RNA) where: Base-Base interactions energy: -466.537 where: short stacking energy: -193.091 Base-Backbone interact. energy: 0.584 local terms energy: -185.712933 where: bonds (distance) C4'-P energy: -29.228 bonds (distance) P-C4' energy: -38.163 flat angles C4'-P-C4' energy: -44.149 flat angles P-C4'-P energy: -23.656 tors. eta vs tors. theta energy: -50.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -609.313396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.313396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.313396 (E_RNA) where: Base-Base interactions energy: -423.661 where: short stacking energy: -179.268 Base-Backbone interact. energy: -0.611 local terms energy: -185.041354 where: bonds (distance) C4'-P energy: -33.668 bonds (distance) P-C4' energy: -37.330 flat angles C4'-P-C4' energy: -39.296 flat angles P-C4'-P energy: -27.991 tors. eta vs tors. theta energy: -46.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -564.774423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.774423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.774423 (E_RNA) where: Base-Base interactions energy: -393.259 where: short stacking energy: -175.141 Base-Backbone interact. energy: -1.311 local terms energy: -170.204419 where: bonds (distance) C4'-P energy: -28.586 bonds (distance) P-C4' energy: -38.048 flat angles C4'-P-C4' energy: -34.589 flat angles P-C4'-P energy: -23.763 tors. eta vs tors. theta energy: -45.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -551.672385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.672385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.672385 (E_RNA) where: Base-Base interactions energy: -388.042 where: short stacking energy: -173.737 Base-Backbone interact. energy: -0.464 local terms energy: -163.166831 where: bonds (distance) C4'-P energy: -28.650 bonds (distance) P-C4' energy: -33.554 flat angles C4'-P-C4' energy: -39.057 flat angles P-C4'-P energy: -16.596 tors. eta vs tors. theta energy: -45.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -562.534346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.534346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.534346 (E_RNA) where: Base-Base interactions energy: -385.111 where: short stacking energy: -156.400 Base-Backbone interact. energy: -2.713 local terms energy: -174.710805 where: bonds (distance) C4'-P energy: -39.372 bonds (distance) P-C4' energy: -32.502 flat angles C4'-P-C4' energy: -38.245 flat angles P-C4'-P energy: -25.001 tors. eta vs tors. theta energy: -39.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -507.548493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.548493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.548493 (E_RNA) where: Base-Base interactions energy: -368.183 where: short stacking energy: -147.129 Base-Backbone interact. energy: 0.291 local terms energy: -139.657000 where: bonds (distance) C4'-P energy: -22.755 bonds (distance) P-C4' energy: -31.502 flat angles C4'-P-C4' energy: -34.283 flat angles P-C4'-P energy: -15.028 tors. eta vs tors. theta energy: -36.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -515.373932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.373932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.373932 (E_RNA) where: Base-Base interactions energy: -366.459 where: short stacking energy: -151.568 Base-Backbone interact. energy: -0.234 local terms energy: -148.680034 where: bonds (distance) C4'-P energy: -32.733 bonds (distance) P-C4' energy: -33.571 flat angles C4'-P-C4' energy: -33.091 flat angles P-C4'-P energy: -23.396 tors. eta vs tors. theta energy: -25.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -394.321748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.321748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.321748 (E_RNA) where: Base-Base interactions energy: -286.551 where: short stacking energy: -118.571 Base-Backbone interact. energy: 2.981 local terms energy: -110.751111 where: bonds (distance) C4'-P energy: -20.391 bonds (distance) P-C4' energy: -29.136 flat angles C4'-P-C4' energy: -27.349 flat angles P-C4'-P energy: -17.558 tors. eta vs tors. theta energy: -16.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -687.992783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.992783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.992783 (E_RNA) where: Base-Base interactions energy: -491.553 where: short stacking energy: -218.102 Base-Backbone interact. energy: 0.332 local terms energy: -196.771710 where: bonds (distance) C4'-P energy: -32.930 bonds (distance) P-C4' energy: -31.703 flat angles C4'-P-C4' energy: -40.357 flat angles P-C4'-P energy: -29.570 tors. eta vs tors. theta energy: -62.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -674.803701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.803701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.803701 (E_RNA) where: Base-Base interactions energy: -468.315 where: short stacking energy: -211.742 Base-Backbone interact. energy: -0.316 local terms energy: -206.172597 where: bonds (distance) C4'-P energy: -35.486 bonds (distance) P-C4' energy: -35.702 flat angles C4'-P-C4' energy: -43.972 flat angles P-C4'-P energy: -30.956 tors. eta vs tors. theta energy: -60.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -641.894151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.894151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.894151 (E_RNA) where: Base-Base interactions energy: -461.391 where: short stacking energy: -194.548 Base-Backbone interact. energy: 0.353 local terms energy: -180.856072 where: bonds (distance) C4'-P energy: -32.986 bonds (distance) P-C4' energy: -34.610 flat angles C4'-P-C4' energy: -38.401 flat angles P-C4'-P energy: -21.449 tors. eta vs tors. theta energy: -53.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -610.719922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.719922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.719922 (E_RNA) where: Base-Base interactions energy: -426.261 where: short stacking energy: -181.087 Base-Backbone interact. energy: -1.156 local terms energy: -183.302346 where: bonds (distance) C4'-P energy: -32.381 bonds (distance) P-C4' energy: -36.220 flat angles C4'-P-C4' energy: -38.017 flat angles P-C4'-P energy: -30.465 tors. eta vs tors. theta energy: -46.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -558.062320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.062320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.062320 (E_RNA) where: Base-Base interactions energy: -387.317 where: short stacking energy: -183.730 Base-Backbone interact. energy: -0.333 local terms energy: -170.412173 where: bonds (distance) C4'-P energy: -31.171 bonds (distance) P-C4' energy: -28.548 flat angles C4'-P-C4' energy: -35.555 flat angles P-C4'-P energy: -27.722 tors. eta vs tors. theta energy: -47.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -555.647628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.647628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.647628 (E_RNA) where: Base-Base interactions energy: -393.696 where: short stacking energy: -169.397 Base-Backbone interact. energy: -3.296 local terms energy: -158.655404 where: bonds (distance) C4'-P energy: -35.528 bonds (distance) P-C4' energy: -37.565 flat angles C4'-P-C4' energy: -35.549 flat angles P-C4'-P energy: -17.094 tors. eta vs tors. theta energy: -32.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -547.015757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.015757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.015757 (E_RNA) where: Base-Base interactions energy: -389.725 where: short stacking energy: -160.930 Base-Backbone interact. energy: -0.414 local terms energy: -156.877167 where: bonds (distance) C4'-P energy: -23.812 bonds (distance) P-C4' energy: -33.230 flat angles C4'-P-C4' energy: -37.830 flat angles P-C4'-P energy: -25.765 tors. eta vs tors. theta energy: -36.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -545.121171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.121171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.121171 (E_RNA) where: Base-Base interactions energy: -388.349 where: short stacking energy: -155.705 Base-Backbone interact. energy: -1.286 local terms energy: -155.485894 where: bonds (distance) C4'-P energy: -35.440 bonds (distance) P-C4' energy: -30.233 flat angles C4'-P-C4' energy: -30.523 flat angles P-C4'-P energy: -25.563 tors. eta vs tors. theta energy: -33.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -506.755111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.755111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.755111 (E_RNA) where: Base-Base interactions energy: -366.769 where: short stacking energy: -153.396 Base-Backbone interact. energy: -0.448 local terms energy: -139.538334 where: bonds (distance) C4'-P energy: -26.010 bonds (distance) P-C4' energy: -31.020 flat angles C4'-P-C4' energy: -32.789 flat angles P-C4'-P energy: -10.649 tors. eta vs tors. theta energy: -39.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -409.526840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.526840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.526840 (E_RNA) where: Base-Base interactions energy: -289.185 where: short stacking energy: -121.394 Base-Backbone interact. energy: -1.240 local terms energy: -119.102161 where: bonds (distance) C4'-P energy: -18.779 bonds (distance) P-C4' energy: -27.296 flat angles C4'-P-C4' energy: -36.559 flat angles P-C4'-P energy: -18.253 tors. eta vs tors. theta energy: -18.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -678.214795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.214795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.214795 (E_RNA) where: Base-Base interactions energy: -482.507 where: short stacking energy: -209.989 Base-Backbone interact. energy: -0.253 local terms energy: -195.454863 where: bonds (distance) C4'-P energy: -37.081 bonds (distance) P-C4' energy: -32.539 flat angles C4'-P-C4' energy: -40.721 flat angles P-C4'-P energy: -26.578 tors. eta vs tors. theta energy: -58.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -683.218085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.218085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.218085 (E_RNA) where: Base-Base interactions energy: -493.839 where: short stacking energy: -216.784 Base-Backbone interact. energy: 0.556 local terms energy: -189.934611 where: bonds (distance) C4'-P energy: -37.155 bonds (distance) P-C4' energy: -33.116 flat angles C4'-P-C4' energy: -41.908 flat angles P-C4'-P energy: -21.342 tors. eta vs tors. theta energy: -56.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -645.523932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.523932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.523932 (E_RNA) where: Base-Base interactions energy: -454.311 where: short stacking energy: -192.272 Base-Backbone interact. energy: -0.184 local terms energy: -191.028781 where: bonds (distance) C4'-P energy: -41.770 bonds (distance) P-C4' energy: -38.112 flat angles C4'-P-C4' energy: -35.669 flat angles P-C4'-P energy: -23.403 tors. eta vs tors. theta energy: -52.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -601.619111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.619111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.619111 (E_RNA) where: Base-Base interactions energy: -438.252 where: short stacking energy: -167.427 Base-Backbone interact. energy: -0.767 local terms energy: -162.600232 where: bonds (distance) C4'-P energy: -33.085 bonds (distance) P-C4' energy: -40.112 flat angles C4'-P-C4' energy: -25.978 flat angles P-C4'-P energy: -23.926 tors. eta vs tors. theta energy: -39.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -554.455912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.455912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.455912 (E_RNA) where: Base-Base interactions energy: -375.109 where: short stacking energy: -165.077 Base-Backbone interact. energy: -0.207 local terms energy: -179.139777 where: bonds (distance) C4'-P energy: -29.916 bonds (distance) P-C4' energy: -39.346 flat angles C4'-P-C4' energy: -41.334 flat angles P-C4'-P energy: -22.566 tors. eta vs tors. theta energy: -45.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -582.690977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.690977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.690977 (E_RNA) where: Base-Base interactions energy: -412.016 where: short stacking energy: -172.394 Base-Backbone interact. energy: -0.548 local terms energy: -170.126934 where: bonds (distance) C4'-P energy: -33.738 bonds (distance) P-C4' energy: -33.023 flat angles C4'-P-C4' energy: -40.010 flat angles P-C4'-P energy: -20.441 tors. eta vs tors. theta energy: -42.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -527.546538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.546538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.546538 (E_RNA) where: Base-Base interactions energy: -368.458 where: short stacking energy: -153.805 Base-Backbone interact. energy: -0.588 local terms energy: -158.499902 where: bonds (distance) C4'-P energy: -36.607 bonds (distance) P-C4' energy: -39.236 flat angles C4'-P-C4' energy: -38.140 flat angles P-C4'-P energy: -14.579 tors. eta vs tors. theta energy: -29.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -510.777815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.777815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.777815 (E_RNA) where: Base-Base interactions energy: -361.419 where: short stacking energy: -147.874 Base-Backbone interact. energy: -1.527 local terms energy: -147.831068 where: bonds (distance) C4'-P energy: -35.315 bonds (distance) P-C4' energy: -30.495 flat angles C4'-P-C4' energy: -32.580 flat angles P-C4'-P energy: -21.533 tors. eta vs tors. theta energy: -27.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -499.632641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.632641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.632641 (E_RNA) where: Base-Base interactions energy: -349.519 where: short stacking energy: -147.693 Base-Backbone interact. energy: 0.899 local terms energy: -151.012835 where: bonds (distance) C4'-P energy: -27.850 bonds (distance) P-C4' energy: -33.239 flat angles C4'-P-C4' energy: -37.362 flat angles P-C4'-P energy: -22.495 tors. eta vs tors. theta energy: -30.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -427.250318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.250318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.250318 (E_RNA) where: Base-Base interactions energy: -310.608 where: short stacking energy: -126.432 Base-Backbone interact. energy: 2.512 local terms energy: -119.153913 where: bonds (distance) C4'-P energy: -24.137 bonds (distance) P-C4' energy: -22.599 flat angles C4'-P-C4' energy: -33.418 flat angles P-C4'-P energy: -18.274 tors. eta vs tors. theta energy: -20.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -668.302178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.302178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.302178 (E_RNA) where: Base-Base interactions energy: -476.098 where: short stacking energy: -207.393 Base-Backbone interact. energy: -0.902 local terms energy: -191.302420 where: bonds (distance) C4'-P energy: -31.939 bonds (distance) P-C4' energy: -38.717 flat angles C4'-P-C4' energy: -42.988 flat angles P-C4'-P energy: -23.919 tors. eta vs tors. theta energy: -53.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -687.289834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.289834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.289834 (E_RNA) where: Base-Base interactions energy: -486.688 where: short stacking energy: -217.495 Base-Backbone interact. energy: -0.750 local terms energy: -199.852068 where: bonds (distance) C4'-P energy: -38.274 bonds (distance) P-C4' energy: -32.199 flat angles C4'-P-C4' energy: -39.370 flat angles P-C4'-P energy: -28.759 tors. eta vs tors. theta energy: -61.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -658.133862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.133862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.133862 (E_RNA) where: Base-Base interactions energy: -462.988 where: short stacking energy: -182.900 Base-Backbone interact. energy: 2.095 local terms energy: -197.239972 where: bonds (distance) C4'-P energy: -38.566 bonds (distance) P-C4' energy: -40.770 flat angles C4'-P-C4' energy: -42.336 flat angles P-C4'-P energy: -29.686 tors. eta vs tors. theta energy: -45.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -589.619242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.619242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.619242 (E_RNA) where: Base-Base interactions energy: -393.121 where: short stacking energy: -179.460 Base-Backbone interact. energy: -1.316 local terms energy: -195.181442 where: bonds (distance) C4'-P energy: -42.148 bonds (distance) P-C4' energy: -36.999 flat angles C4'-P-C4' energy: -43.189 flat angles P-C4'-P energy: -26.298 tors. eta vs tors. theta energy: -46.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -554.653651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.653651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.653651 (E_RNA) where: Base-Base interactions energy: -390.653 where: short stacking energy: -171.226 Base-Backbone interact. energy: -0.491 local terms energy: -163.509713 where: bonds (distance) C4'-P energy: -29.391 bonds (distance) P-C4' energy: -35.477 flat angles C4'-P-C4' energy: -36.217 flat angles P-C4'-P energy: -21.791 tors. eta vs tors. theta energy: -40.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -550.206998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.206998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.206998 (E_RNA) where: Base-Base interactions energy: -386.088 where: short stacking energy: -155.092 Base-Backbone interact. energy: 0.672 local terms energy: -164.790910 where: bonds (distance) C4'-P energy: -34.638 bonds (distance) P-C4' energy: -40.538 flat angles C4'-P-C4' energy: -37.682 flat angles P-C4'-P energy: -22.041 tors. eta vs tors. theta energy: -29.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -535.673191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.673191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.673191 (E_RNA) where: Base-Base interactions energy: -379.298 where: short stacking energy: -160.946 Base-Backbone interact. energy: -0.776 local terms energy: -155.599167 where: bonds (distance) C4'-P energy: -23.391 bonds (distance) P-C4' energy: -40.430 flat angles C4'-P-C4' energy: -29.953 flat angles P-C4'-P energy: -26.047 tors. eta vs tors. theta energy: -35.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -544.096419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.096419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.096419 (E_RNA) where: Base-Base interactions energy: -384.990 where: short stacking energy: -164.337 Base-Backbone interact. energy: 0.577 local terms energy: -159.683033 where: bonds (distance) C4'-P energy: -32.635 bonds (distance) P-C4' energy: -32.016 flat angles C4'-P-C4' energy: -35.390 flat angles P-C4'-P energy: -17.582 tors. eta vs tors. theta energy: -42.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -505.836966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.836966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.836966 (E_RNA) where: Base-Base interactions energy: -363.730 where: short stacking energy: -151.581 Base-Backbone interact. energy: -0.740 local terms energy: -141.366866 where: bonds (distance) C4'-P energy: -26.486 bonds (distance) P-C4' energy: -29.841 flat angles C4'-P-C4' energy: -33.547 flat angles P-C4'-P energy: -22.597 tors. eta vs tors. theta energy: -28.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -412.836903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.836903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.836903 (E_RNA) where: Base-Base interactions energy: -289.199 where: short stacking energy: -119.669 Base-Backbone interact. energy: 1.228 local terms energy: -124.865840 where: bonds (distance) C4'-P energy: -22.014 bonds (distance) P-C4' energy: -36.850 flat angles C4'-P-C4' energy: -31.482 flat angles P-C4'-P energy: -18.853 tors. eta vs tors. theta energy: -15.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -699.911106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.911106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.911106 (E_RNA) where: Base-Base interactions energy: -506.139 where: short stacking energy: -218.441 Base-Backbone interact. energy: 2.060 local terms energy: -195.832051 where: bonds (distance) C4'-P energy: -30.007 bonds (distance) P-C4' energy: -41.077 flat angles C4'-P-C4' energy: -38.854 flat angles P-C4'-P energy: -25.056 tors. eta vs tors. theta energy: -60.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -671.175360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.175360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.175360 (E_RNA) where: Base-Base interactions energy: -472.134 where: short stacking energy: -210.181 Base-Backbone interact. energy: -2.599 local terms energy: -196.442899 where: bonds (distance) C4'-P energy: -36.498 bonds (distance) P-C4' energy: -30.939 flat angles C4'-P-C4' energy: -41.745 flat angles P-C4'-P energy: -31.243 tors. eta vs tors. theta energy: -56.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -655.047780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.047780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.047780 (E_RNA) where: Base-Base interactions energy: -467.853 where: short stacking energy: -192.918 Base-Backbone interact. energy: -1.246 local terms energy: -185.948989 where: bonds (distance) C4'-P energy: -35.324 bonds (distance) P-C4' energy: -38.096 flat angles C4'-P-C4' energy: -40.074 flat angles P-C4'-P energy: -25.078 tors. eta vs tors. theta energy: -47.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -590.960976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.960976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.960976 (E_RNA) where: Base-Base interactions energy: -412.034 where: short stacking energy: -191.304 Base-Backbone interact. energy: -0.583 local terms energy: -178.343911 where: bonds (distance) C4'-P energy: -34.475 bonds (distance) P-C4' energy: -36.636 flat angles C4'-P-C4' energy: -35.801 flat angles P-C4'-P energy: -25.772 tors. eta vs tors. theta energy: -45.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -592.167073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.167073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.167073 (E_RNA) where: Base-Base interactions energy: -418.840 where: short stacking energy: -189.360 Base-Backbone interact. energy: -0.190 local terms energy: -173.137179 where: bonds (distance) C4'-P energy: -31.275 bonds (distance) P-C4' energy: -35.912 flat angles C4'-P-C4' energy: -35.840 flat angles P-C4'-P energy: -25.489 tors. eta vs tors. theta energy: -44.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -566.349406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.349406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.349406 (E_RNA) where: Base-Base interactions energy: -407.226 where: short stacking energy: -166.505 Base-Backbone interact. energy: -0.904 local terms energy: -158.219113 where: bonds (distance) C4'-P energy: -34.042 bonds (distance) P-C4' energy: -38.573 flat angles C4'-P-C4' energy: -36.389 flat angles P-C4'-P energy: -16.346 tors. eta vs tors. theta energy: -32.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -524.701079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.701079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.701079 (E_RNA) where: Base-Base interactions energy: -364.966 where: short stacking energy: -146.865 Base-Backbone interact. energy: 1.457 local terms energy: -161.191457 where: bonds (distance) C4'-P energy: -24.122 bonds (distance) P-C4' energy: -35.769 flat angles C4'-P-C4' energy: -37.350 flat angles P-C4'-P energy: -22.519 tors. eta vs tors. theta energy: -41.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -524.826119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.826119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.826119 (E_RNA) where: Base-Base interactions energy: -368.855 where: short stacking energy: -145.333 Base-Backbone interact. energy: 0.564 local terms energy: -156.535374 where: bonds (distance) C4'-P energy: -30.828 bonds (distance) P-C4' energy: -35.691 flat angles C4'-P-C4' energy: -34.769 flat angles P-C4'-P energy: -21.153 tors. eta vs tors. theta energy: -34.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -527.190459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.190459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.190459 (E_RNA) where: Base-Base interactions energy: -380.225 where: short stacking energy: -157.759 Base-Backbone interact. energy: -0.902 local terms energy: -146.063732 where: bonds (distance) C4'-P energy: -26.317 bonds (distance) P-C4' energy: -38.192 flat angles C4'-P-C4' energy: -26.309 flat angles P-C4'-P energy: -18.842 tors. eta vs tors. theta energy: -36.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -425.551545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.551545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.551545 (E_RNA) where: Base-Base interactions energy: -295.535 where: short stacking energy: -110.912 Base-Backbone interact. energy: -1.065 local terms energy: -128.951334 where: bonds (distance) C4'-P energy: -28.093 bonds (distance) P-C4' energy: -29.100 flat angles C4'-P-C4' energy: -34.453 flat angles P-C4'-P energy: -21.717 tors. eta vs tors. theta energy: -15.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -681.628297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.628297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.628297 (E_RNA) where: Base-Base interactions energy: -481.597 where: short stacking energy: -213.167 Base-Backbone interact. energy: -0.284 local terms energy: -199.746979 where: bonds (distance) C4'-P energy: -32.176 bonds (distance) P-C4' energy: -36.026 flat angles C4'-P-C4' energy: -41.491 flat angles P-C4'-P energy: -32.131 tors. eta vs tors. theta energy: -57.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -675.676659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.676659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.676659 (E_RNA) where: Base-Base interactions energy: -475.051 where: short stacking energy: -204.012 Base-Backbone interact. energy: -0.278 local terms energy: -200.347203 where: bonds (distance) C4'-P energy: -40.716 bonds (distance) P-C4' energy: -35.160 flat angles C4'-P-C4' energy: -42.251 flat angles P-C4'-P energy: -28.061 tors. eta vs tors. theta energy: -54.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -657.723253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.723253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.723253 (E_RNA) where: Base-Base interactions energy: -456.862 where: short stacking energy: -210.575 Base-Backbone interact. energy: 0.858 local terms energy: -201.719019 where: bonds (distance) C4'-P energy: -35.365 bonds (distance) P-C4' energy: -34.925 flat angles C4'-P-C4' energy: -42.923 flat angles P-C4'-P energy: -33.332 tors. eta vs tors. theta energy: -55.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -596.359885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.359885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.359885 (E_RNA) where: Base-Base interactions energy: -415.523 where: short stacking energy: -200.287 Base-Backbone interact. energy: -0.294 local terms energy: -180.542280 where: bonds (distance) C4'-P energy: -27.497 bonds (distance) P-C4' energy: -33.902 flat angles C4'-P-C4' energy: -39.580 flat angles P-C4'-P energy: -25.710 tors. eta vs tors. theta energy: -53.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -577.116486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.116486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.116486 (E_RNA) where: Base-Base interactions energy: -418.439 where: short stacking energy: -187.005 Base-Backbone interact. energy: 0.332 local terms energy: -159.009166 where: bonds (distance) C4'-P energy: -34.137 bonds (distance) P-C4' energy: -30.577 flat angles C4'-P-C4' energy: -29.780 flat angles P-C4'-P energy: -22.438 tors. eta vs tors. theta energy: -42.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -575.240344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.240344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.240344 (E_RNA) where: Base-Base interactions energy: -399.236 where: short stacking energy: -174.131 Base-Backbone interact. energy: -0.841 local terms energy: -175.163688 where: bonds (distance) C4'-P energy: -30.074 bonds (distance) P-C4' energy: -44.070 flat angles C4'-P-C4' energy: -37.329 flat angles P-C4'-P energy: -24.992 tors. eta vs tors. theta energy: -38.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -541.987012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.987012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.987012 (E_RNA) where: Base-Base interactions energy: -380.832 where: short stacking energy: -166.442 Base-Backbone interact. energy: 1.733 local terms energy: -162.887572 where: bonds (distance) C4'-P energy: -31.469 bonds (distance) P-C4' energy: -36.687 flat angles C4'-P-C4' energy: -35.771 flat angles P-C4'-P energy: -25.632 tors. eta vs tors. theta energy: -33.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -523.130453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.130453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.130453 (E_RNA) where: Base-Base interactions energy: -377.460 where: short stacking energy: -148.140 Base-Backbone interact. energy: 1.343 local terms energy: -147.013745 where: bonds (distance) C4'-P energy: -32.605 bonds (distance) P-C4' energy: -15.436 flat angles C4'-P-C4' energy: -39.763 flat angles P-C4'-P energy: -27.342 tors. eta vs tors. theta energy: -31.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -516.836746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.836746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.836746 (E_RNA) where: Base-Base interactions energy: -368.875 where: short stacking energy: -153.421 Base-Backbone interact. energy: -0.311 local terms energy: -147.651511 where: bonds (distance) C4'-P energy: -34.646 bonds (distance) P-C4' energy: -24.228 flat angles C4'-P-C4' energy: -34.613 flat angles P-C4'-P energy: -14.280 tors. eta vs tors. theta energy: -39.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -379.221337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.221337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.221337 (E_RNA) where: Base-Base interactions energy: -255.794 where: short stacking energy: -103.210 Base-Backbone interact. energy: -1.693 local terms energy: -121.733799 where: bonds (distance) C4'-P energy: -33.659 bonds (distance) P-C4' energy: -31.974 flat angles C4'-P-C4' energy: -27.477 flat angles P-C4'-P energy: -14.142 tors. eta vs tors. theta energy: -14.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -677.098446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.098446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.098446 (E_RNA) where: Base-Base interactions energy: -482.597 where: short stacking energy: -196.862 Base-Backbone interact. energy: -0.419 local terms energy: -194.083145 where: bonds (distance) C4'-P energy: -29.727 bonds (distance) P-C4' energy: -39.262 flat angles C4'-P-C4' energy: -35.972 flat angles P-C4'-P energy: -32.728 tors. eta vs tors. theta energy: -56.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -675.940582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.940582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.940582 (E_RNA) where: Base-Base interactions energy: -485.775 where: short stacking energy: -204.564 Base-Backbone interact. energy: -0.877 local terms energy: -189.287835 where: bonds (distance) C4'-P energy: -37.250 bonds (distance) P-C4' energy: -33.458 flat angles C4'-P-C4' energy: -36.153 flat angles P-C4'-P energy: -26.345 tors. eta vs tors. theta energy: -56.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -621.223342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.223342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.223342 (E_RNA) where: Base-Base interactions energy: -441.774 where: short stacking energy: -187.576 Base-Backbone interact. energy: -1.194 local terms energy: -178.254834 where: bonds (distance) C4'-P energy: -28.998 bonds (distance) P-C4' energy: -35.192 flat angles C4'-P-C4' energy: -40.333 flat angles P-C4'-P energy: -27.541 tors. eta vs tors. theta energy: -46.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -575.567000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.567000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.567000 (E_RNA) where: Base-Base interactions energy: -395.657 where: short stacking energy: -160.015 Base-Backbone interact. energy: -0.192 local terms energy: -179.717563 where: bonds (distance) C4'-P energy: -42.971 bonds (distance) P-C4' energy: -35.158 flat angles C4'-P-C4' energy: -41.657 flat angles P-C4'-P energy: -20.252 tors. eta vs tors. theta energy: -39.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -591.620961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.620961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.620961 (E_RNA) where: Base-Base interactions energy: -408.301 where: short stacking energy: -187.468 Base-Backbone interact. energy: -1.705 local terms energy: -181.614460 where: bonds (distance) C4'-P energy: -32.037 bonds (distance) P-C4' energy: -34.438 flat angles C4'-P-C4' energy: -40.936 flat angles P-C4'-P energy: -25.942 tors. eta vs tors. theta energy: -48.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -569.409245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.409245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.409245 (E_RNA) where: Base-Base interactions energy: -393.796 where: short stacking energy: -180.631 Base-Backbone interact. energy: -0.789 local terms energy: -174.824281 where: bonds (distance) C4'-P energy: -34.671 bonds (distance) P-C4' energy: -30.574 flat angles C4'-P-C4' energy: -41.490 flat angles P-C4'-P energy: -21.341 tors. eta vs tors. theta energy: -46.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -538.549731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.549731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.549731 (E_RNA) where: Base-Base interactions energy: -373.144 where: short stacking energy: -164.735 Base-Backbone interact. energy: -1.694 local terms energy: -163.711801 where: bonds (distance) C4'-P energy: -26.829 bonds (distance) P-C4' energy: -38.367 flat angles C4'-P-C4' energy: -37.937 flat angles P-C4'-P energy: -17.792 tors. eta vs tors. theta energy: -42.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -535.295653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.295653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.295653 (E_RNA) where: Base-Base interactions energy: -370.560 where: short stacking energy: -160.589 Base-Backbone interact. energy: -1.574 local terms energy: -163.161454 where: bonds (distance) C4'-P energy: -28.222 bonds (distance) P-C4' energy: -30.614 flat angles C4'-P-C4' energy: -40.486 flat angles P-C4'-P energy: -22.122 tors. eta vs tors. theta energy: -41.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -535.254779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.254779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.254779 (E_RNA) where: Base-Base interactions energy: -397.135 where: short stacking energy: -159.536 Base-Backbone interact. energy: -0.258 local terms energy: -137.862243 where: bonds (distance) C4'-P energy: -24.739 bonds (distance) P-C4' energy: -30.252 flat angles C4'-P-C4' energy: -34.353 flat angles P-C4'-P energy: -8.800 tors. eta vs tors. theta energy: -39.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -396.475360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.475360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.475360 (E_RNA) where: Base-Base interactions energy: -268.898 where: short stacking energy: -121.984 Base-Backbone interact. energy: -1.029 local terms energy: -126.548370 where: bonds (distance) C4'-P energy: -29.231 bonds (distance) P-C4' energy: -29.569 flat angles C4'-P-C4' energy: -35.095 flat angles P-C4'-P energy: -20.866 tors. eta vs tors. theta energy: -11.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -666.037009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.037009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.037009 (E_RNA) where: Base-Base interactions energy: -467.115 where: short stacking energy: -195.667 Base-Backbone interact. energy: -0.894 local terms energy: -198.028516 where: bonds (distance) C4'-P energy: -37.777 bonds (distance) P-C4' energy: -36.618 flat angles C4'-P-C4' energy: -41.288 flat angles P-C4'-P energy: -27.394 tors. eta vs tors. theta energy: -54.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -672.126245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.126245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.126245 (E_RNA) where: Base-Base interactions energy: -477.915 where: short stacking energy: -211.621 Base-Backbone interact. energy: -0.973 local terms energy: -193.239132 where: bonds (distance) C4'-P energy: -30.062 bonds (distance) P-C4' energy: -33.561 flat angles C4'-P-C4' energy: -43.379 flat angles P-C4'-P energy: -27.222 tors. eta vs tors. theta energy: -59.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -635.381386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.381386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.381386 (E_RNA) where: Base-Base interactions energy: -450.964 where: short stacking energy: -197.983 Base-Backbone interact. energy: -0.124 local terms energy: -184.293486 where: bonds (distance) C4'-P energy: -38.799 bonds (distance) P-C4' energy: -36.712 flat angles C4'-P-C4' energy: -40.937 flat angles P-C4'-P energy: -23.005 tors. eta vs tors. theta energy: -44.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -600.601557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.601557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.601557 (E_RNA) where: Base-Base interactions energy: -425.022 where: short stacking energy: -178.310 Base-Backbone interact. energy: 0.996 local terms energy: -176.575633 where: bonds (distance) C4'-P energy: -33.711 bonds (distance) P-C4' energy: -33.291 flat angles C4'-P-C4' energy: -39.256 flat angles P-C4'-P energy: -23.036 tors. eta vs tors. theta energy: -47.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -585.659174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.659174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.659174 (E_RNA) where: Base-Base interactions energy: -421.444 where: short stacking energy: -177.376 Base-Backbone interact. energy: -1.650 local terms energy: -162.564786 where: bonds (distance) C4'-P energy: -30.518 bonds (distance) P-C4' energy: -34.992 flat angles C4'-P-C4' energy: -32.467 flat angles P-C4'-P energy: -26.805 tors. eta vs tors. theta energy: -37.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -579.647337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.647337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.647337 (E_RNA) where: Base-Base interactions energy: -419.033 where: short stacking energy: -184.048 Base-Backbone interact. energy: -0.524 local terms energy: -160.089953 where: bonds (distance) C4'-P energy: -25.669 bonds (distance) P-C4' energy: -30.543 flat angles C4'-P-C4' energy: -39.759 flat angles P-C4'-P energy: -19.237 tors. eta vs tors. theta energy: -44.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -563.780040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.780040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.780040 (E_RNA) where: Base-Base interactions energy: -406.144 where: short stacking energy: -163.877 Base-Backbone interact. energy: -0.587 local terms energy: -157.048322 where: bonds (distance) C4'-P energy: -31.509 bonds (distance) P-C4' energy: -31.803 flat angles C4'-P-C4' energy: -34.878 flat angles P-C4'-P energy: -18.942 tors. eta vs tors. theta energy: -39.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -525.407041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.407041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.407041 (E_RNA) where: Base-Base interactions energy: -372.325 where: short stacking energy: -154.091 Base-Backbone interact. energy: -0.208 local terms energy: -152.874208 where: bonds (distance) C4'-P energy: -33.335 bonds (distance) P-C4' energy: -37.752 flat angles C4'-P-C4' energy: -33.475 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -31.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -509.029610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.029610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.029610 (E_RNA) where: Base-Base interactions energy: -364.802 where: short stacking energy: -143.679 Base-Backbone interact. energy: -1.754 local terms energy: -142.473785 where: bonds (distance) C4'-P energy: -20.967 bonds (distance) P-C4' energy: -30.839 flat angles C4'-P-C4' energy: -32.615 flat angles P-C4'-P energy: -25.260 tors. eta vs tors. theta energy: -32.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -398.527617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.527617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.527617 (E_RNA) where: Base-Base interactions energy: -266.764 where: short stacking energy: -106.551 Base-Backbone interact. energy: -0.541 local terms energy: -131.221840 where: bonds (distance) C4'-P energy: -32.616 bonds (distance) P-C4' energy: -33.666 flat angles C4'-P-C4' energy: -35.282 flat angles P-C4'-P energy: -15.551 tors. eta vs tors. theta energy: -14.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -685.822736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.822736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.822736 (E_RNA) where: Base-Base interactions energy: -486.247 where: short stacking energy: -195.363 Base-Backbone interact. energy: -1.309 local terms energy: -198.266507 where: bonds (distance) C4'-P energy: -39.457 bonds (distance) P-C4' energy: -40.562 flat angles C4'-P-C4' energy: -42.890 flat angles P-C4'-P energy: -27.654 tors. eta vs tors. theta energy: -47.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -665.982846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.982846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.982846 (E_RNA) where: Base-Base interactions energy: -469.159 where: short stacking energy: -196.249 Base-Backbone interact. energy: -1.441 local terms energy: -195.382963 where: bonds (distance) C4'-P energy: -37.076 bonds (distance) P-C4' energy: -34.094 flat angles C4'-P-C4' energy: -42.729 flat angles P-C4'-P energy: -27.038 tors. eta vs tors. theta energy: -54.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -649.530545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.530545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.530545 (E_RNA) where: Base-Base interactions energy: -467.401 where: short stacking energy: -194.389 Base-Backbone interact. energy: 0.837 local terms energy: -182.966313 where: bonds (distance) C4'-P energy: -31.338 bonds (distance) P-C4' energy: -33.576 flat angles C4'-P-C4' energy: -41.546 flat angles P-C4'-P energy: -27.096 tors. eta vs tors. theta energy: -49.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -595.212557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.212557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.212557 (E_RNA) where: Base-Base interactions energy: -413.145 where: short stacking energy: -180.705 Base-Backbone interact. energy: -0.065 local terms energy: -182.002158 where: bonds (distance) C4'-P energy: -30.253 bonds (distance) P-C4' energy: -41.609 flat angles C4'-P-C4' energy: -39.056 flat angles P-C4'-P energy: -25.056 tors. eta vs tors. theta energy: -46.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -589.056671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.056671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.056671 (E_RNA) where: Base-Base interactions energy: -420.526 where: short stacking energy: -160.516 Base-Backbone interact. energy: -0.771 local terms energy: -167.760056 where: bonds (distance) C4'-P energy: -31.055 bonds (distance) P-C4' energy: -34.937 flat angles C4'-P-C4' energy: -38.316 flat angles P-C4'-P energy: -27.582 tors. eta vs tors. theta energy: -35.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -561.393427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.393427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.393427 (E_RNA) where: Base-Base interactions energy: -388.896 where: short stacking energy: -167.631 Base-Backbone interact. energy: -1.163 local terms energy: -171.335141 where: bonds (distance) C4'-P energy: -36.677 bonds (distance) P-C4' energy: -31.286 flat angles C4'-P-C4' energy: -38.857 flat angles P-C4'-P energy: -21.374 tors. eta vs tors. theta energy: -43.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -546.261809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.261809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.261809 (E_RNA) where: Base-Base interactions energy: -388.375 where: short stacking energy: -168.601 Base-Backbone interact. energy: -0.306 local terms energy: -157.580891 where: bonds (distance) C4'-P energy: -35.113 bonds (distance) P-C4' energy: -28.502 flat angles C4'-P-C4' energy: -35.210 flat angles P-C4'-P energy: -22.994 tors. eta vs tors. theta energy: -35.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -525.191315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.191315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.191315 (E_RNA) where: Base-Base interactions energy: -374.951 where: short stacking energy: -166.548 Base-Backbone interact. energy: -1.107 local terms energy: -149.133232 where: bonds (distance) C4'-P energy: -34.370 bonds (distance) P-C4' energy: -24.855 flat angles C4'-P-C4' energy: -40.896 flat angles P-C4'-P energy: -13.201 tors. eta vs tors. theta energy: -35.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -447.084626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.084626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.084626 (E_RNA) where: Base-Base interactions energy: -320.466 where: short stacking energy: -134.554 Base-Backbone interact. energy: -0.036 local terms energy: -126.582441 where: bonds (distance) C4'-P energy: -31.532 bonds (distance) P-C4' energy: -28.897 flat angles C4'-P-C4' energy: -33.258 flat angles P-C4'-P energy: -9.594 tors. eta vs tors. theta energy: -23.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -362.794882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.794882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.794882 (E_RNA) where: Base-Base interactions energy: -246.398 where: short stacking energy: -103.220 Base-Backbone interact. energy: 0.247 local terms energy: -116.643744 where: bonds (distance) C4'-P energy: -31.697 bonds (distance) P-C4' energy: -33.693 flat angles C4'-P-C4' energy: -24.128 flat angles P-C4'-P energy: -11.886 tors. eta vs tors. theta energy: -15.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -677.574581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.574581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.574581 (E_RNA) where: Base-Base interactions energy: -479.968 where: short stacking energy: -202.979 Base-Backbone interact. energy: -0.007 local terms energy: -197.599232 where: bonds (distance) C4'-P energy: -38.195 bonds (distance) P-C4' energy: -37.272 flat angles C4'-P-C4' energy: -46.409 flat angles P-C4'-P energy: -20.606 tors. eta vs tors. theta energy: -55.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -666.189258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.189258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.189258 (E_RNA) where: Base-Base interactions energy: -473.747 where: short stacking energy: -196.161 Base-Backbone interact. energy: 0.043 local terms energy: -192.485076 where: bonds (distance) C4'-P energy: -35.176 bonds (distance) P-C4' energy: -34.971 flat angles C4'-P-C4' energy: -42.994 flat angles P-C4'-P energy: -28.276 tors. eta vs tors. theta energy: -51.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -653.953021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.953021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.953021 (E_RNA) where: Base-Base interactions energy: -463.377 where: short stacking energy: -199.812 Base-Backbone interact. energy: -1.391 local terms energy: -189.185025 where: bonds (distance) C4'-P energy: -35.901 bonds (distance) P-C4' energy: -33.964 flat angles C4'-P-C4' energy: -38.742 flat angles P-C4'-P energy: -27.093 tors. eta vs tors. theta energy: -53.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -588.237359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.237359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.237359 (E_RNA) where: Base-Base interactions energy: -420.087 where: short stacking energy: -185.560 Base-Backbone interact. energy: 0.296 local terms energy: -168.445447 where: bonds (distance) C4'-P energy: -37.756 bonds (distance) P-C4' energy: -31.112 flat angles C4'-P-C4' energy: -35.783 flat angles P-C4'-P energy: -24.975 tors. eta vs tors. theta energy: -38.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -572.513341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.513341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.513341 (E_RNA) where: Base-Base interactions energy: -400.652 where: short stacking energy: -177.872 Base-Backbone interact. energy: -1.437 local terms energy: -170.424252 where: bonds (distance) C4'-P energy: -26.091 bonds (distance) P-C4' energy: -28.006 flat angles C4'-P-C4' energy: -42.743 flat angles P-C4'-P energy: -23.937 tors. eta vs tors. theta energy: -49.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -597.292826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.292826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.292826 (E_RNA) where: Base-Base interactions energy: -421.265 where: short stacking energy: -169.291 Base-Backbone interact. energy: -2.257 local terms energy: -173.770130 where: bonds (distance) C4'-P energy: -34.144 bonds (distance) P-C4' energy: -35.338 flat angles C4'-P-C4' energy: -37.825 flat angles P-C4'-P energy: -29.403 tors. eta vs tors. theta energy: -37.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -538.581775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.581775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.581775 (E_RNA) where: Base-Base interactions energy: -379.864 where: short stacking energy: -155.302 Base-Backbone interact. energy: 1.317 local terms energy: -160.034580 where: bonds (distance) C4'-P energy: -32.952 bonds (distance) P-C4' energy: -28.171 flat angles C4'-P-C4' energy: -40.997 flat angles P-C4'-P energy: -21.017 tors. eta vs tors. theta energy: -36.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -528.593265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.593265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.593265 (E_RNA) where: Base-Base interactions energy: -378.827 where: short stacking energy: -150.627 Base-Backbone interact. energy: 1.923 local terms energy: -151.688815 where: bonds (distance) C4'-P energy: -17.715 bonds (distance) P-C4' energy: -35.609 flat angles C4'-P-C4' energy: -34.771 flat angles P-C4'-P energy: -22.514 tors. eta vs tors. theta energy: -41.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -505.389752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.389752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.389752 (E_RNA) where: Base-Base interactions energy: -363.412 where: short stacking energy: -147.753 Base-Backbone interact. energy: 0.828 local terms energy: -142.806254 where: bonds (distance) C4'-P energy: -30.770 bonds (distance) P-C4' energy: -31.720 flat angles C4'-P-C4' energy: -33.488 flat angles P-C4'-P energy: -12.611 tors. eta vs tors. theta energy: -34.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -383.628801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.628801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.628801 (E_RNA) where: Base-Base interactions energy: -264.821 where: short stacking energy: -115.491 Base-Backbone interact. energy: 0.017 local terms energy: -118.825066 where: bonds (distance) C4'-P energy: -21.079 bonds (distance) P-C4' energy: -28.580 flat angles C4'-P-C4' energy: -38.766 flat angles P-C4'-P energy: -16.679 tors. eta vs tors. theta energy: -13.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -688.630796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.630796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.630796 (E_RNA) where: Base-Base interactions energy: -481.912 where: short stacking energy: -223.386 Base-Backbone interact. energy: -0.881 local terms energy: -205.838114 where: bonds (distance) C4'-P energy: -38.858 bonds (distance) P-C4' energy: -37.612 flat angles C4'-P-C4' energy: -43.577 flat angles P-C4'-P energy: -28.778 tors. eta vs tors. theta energy: -57.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -674.652188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.652188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.652188 (E_RNA) where: Base-Base interactions energy: -481.804 where: short stacking energy: -198.253 Base-Backbone interact. energy: 0.980 local terms energy: -193.827627 where: bonds (distance) C4'-P energy: -41.311 bonds (distance) P-C4' energy: -34.599 flat angles C4'-P-C4' energy: -41.753 flat angles P-C4'-P energy: -26.634 tors. eta vs tors. theta energy: -49.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -669.928062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.928062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.928062 (E_RNA) where: Base-Base interactions energy: -474.775 where: short stacking energy: -213.305 Base-Backbone interact. energy: -0.953 local terms energy: -194.199956 where: bonds (distance) C4'-P energy: -33.843 bonds (distance) P-C4' energy: -38.779 flat angles C4'-P-C4' energy: -41.754 flat angles P-C4'-P energy: -25.833 tors. eta vs tors. theta energy: -53.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -605.859923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.859923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.859923 (E_RNA) where: Base-Base interactions energy: -415.153 where: short stacking energy: -181.377 Base-Backbone interact. energy: -0.925 local terms energy: -189.782147 where: bonds (distance) C4'-P energy: -37.352 bonds (distance) P-C4' energy: -37.607 flat angles C4'-P-C4' energy: -41.499 flat angles P-C4'-P energy: -23.730 tors. eta vs tors. theta energy: -49.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -571.918988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.918988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.918988 (E_RNA) where: Base-Base interactions energy: -395.248 where: short stacking energy: -173.506 Base-Backbone interact. energy: -0.077 local terms energy: -176.594000 where: bonds (distance) C4'-P energy: -34.338 bonds (distance) P-C4' energy: -37.397 flat angles C4'-P-C4' energy: -37.678 flat angles P-C4'-P energy: -20.670 tors. eta vs tors. theta energy: -46.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -559.827785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.827785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.827785 (E_RNA) where: Base-Base interactions energy: -384.924 where: short stacking energy: -171.039 Base-Backbone interact. energy: -0.271 local terms energy: -174.632964 where: bonds (distance) C4'-P energy: -36.339 bonds (distance) P-C4' energy: -34.372 flat angles C4'-P-C4' energy: -44.913 flat angles P-C4'-P energy: -16.976 tors. eta vs tors. theta energy: -42.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -555.843755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.843755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.843755 (E_RNA) where: Base-Base interactions energy: -403.001 where: short stacking energy: -162.226 Base-Backbone interact. energy: 1.325 local terms energy: -154.167727 where: bonds (distance) C4'-P energy: -26.677 bonds (distance) P-C4' energy: -42.557 flat angles C4'-P-C4' energy: -32.324 flat angles P-C4'-P energy: -16.754 tors. eta vs tors. theta energy: -35.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -549.553340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.553340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.553340 (E_RNA) where: Base-Base interactions energy: -374.679 where: short stacking energy: -166.742 Base-Backbone interact. energy: -1.354 local terms energy: -173.520456 where: bonds (distance) C4'-P energy: -34.082 bonds (distance) P-C4' energy: -36.815 flat angles C4'-P-C4' energy: -36.868 flat angles P-C4'-P energy: -15.647 tors. eta vs tors. theta energy: -50.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -476.234235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.234235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.234235 (E_RNA) where: Base-Base interactions energy: -332.127 where: short stacking energy: -125.166 Base-Backbone interact. energy: 1.352 local terms energy: -145.459682 where: bonds (distance) C4'-P energy: -35.011 bonds (distance) P-C4' energy: -29.480 flat angles C4'-P-C4' energy: -35.959 flat angles P-C4'-P energy: -18.223 tors. eta vs tors. theta energy: -26.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -390.416473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.416473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.416473 (E_RNA) where: Base-Base interactions energy: -260.723 where: short stacking energy: -110.313 Base-Backbone interact. energy: -0.032 local terms energy: -129.660820 where: bonds (distance) C4'-P energy: -30.036 bonds (distance) P-C4' energy: -38.378 flat angles C4'-P-C4' energy: -28.093 flat angles P-C4'-P energy: -19.166 tors. eta vs tors. theta energy: -13.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -692.379329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.379329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.379329 (E_RNA) where: Base-Base interactions energy: -482.413 where: short stacking energy: -211.310 Base-Backbone interact. energy: -0.074 local terms energy: -209.892319 where: bonds (distance) C4'-P energy: -36.922 bonds (distance) P-C4' energy: -40.386 flat angles C4'-P-C4' energy: -44.630 flat angles P-C4'-P energy: -31.256 tors. eta vs tors. theta energy: -56.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -682.863780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.863780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.863780 (E_RNA) where: Base-Base interactions energy: -492.657 where: short stacking energy: -214.261 Base-Backbone interact. energy: 0.251 local terms energy: -190.458327 where: bonds (distance) C4'-P energy: -36.780 bonds (distance) P-C4' energy: -41.641 flat angles C4'-P-C4' energy: -38.582 flat angles P-C4'-P energy: -21.138 tors. eta vs tors. theta energy: -52.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -649.106065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.106065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.106065 (E_RNA) where: Base-Base interactions energy: -465.726 where: short stacking energy: -181.189 Base-Backbone interact. energy: -0.256 local terms energy: -183.124201 where: bonds (distance) C4'-P energy: -32.474 bonds (distance) P-C4' energy: -37.045 flat angles C4'-P-C4' energy: -43.246 flat angles P-C4'-P energy: -20.801 tors. eta vs tors. theta energy: -49.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -604.525211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.525211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.525211 (E_RNA) where: Base-Base interactions energy: -427.982 where: short stacking energy: -190.594 Base-Backbone interact. energy: -0.458 local terms energy: -176.084914 where: bonds (distance) C4'-P energy: -26.213 bonds (distance) P-C4' energy: -35.101 flat angles C4'-P-C4' energy: -39.266 flat angles P-C4'-P energy: -24.462 tors. eta vs tors. theta energy: -51.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -578.961596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.961596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.961596 (E_RNA) where: Base-Base interactions energy: -391.060 where: short stacking energy: -171.678 Base-Backbone interact. energy: -1.419 local terms energy: -186.482375 where: bonds (distance) C4'-P energy: -31.248 bonds (distance) P-C4' energy: -40.497 flat angles C4'-P-C4' energy: -39.404 flat angles P-C4'-P energy: -30.444 tors. eta vs tors. theta energy: -44.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -552.550248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.550248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.550248 (E_RNA) where: Base-Base interactions energy: -404.555 where: short stacking energy: -162.668 Base-Backbone interact. energy: 0.391 local terms energy: -148.385713 where: bonds (distance) C4'-P energy: -27.349 bonds (distance) P-C4' energy: -34.853 flat angles C4'-P-C4' energy: -32.335 flat angles P-C4'-P energy: -18.110 tors. eta vs tors. theta energy: -35.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -552.336688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.336688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.336688 (E_RNA) where: Base-Base interactions energy: -385.274 where: short stacking energy: -177.224 Base-Backbone interact. energy: -0.014 local terms energy: -167.049041 where: bonds (distance) C4'-P energy: -24.305 bonds (distance) P-C4' energy: -39.508 flat angles C4'-P-C4' energy: -35.494 flat angles P-C4'-P energy: -25.169 tors. eta vs tors. theta energy: -42.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -543.742777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.742777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.742777 (E_RNA) where: Base-Base interactions energy: -366.592 where: short stacking energy: -152.019 Base-Backbone interact. energy: -3.306 local terms energy: -173.845218 where: bonds (distance) C4'-P energy: -33.881 bonds (distance) P-C4' energy: -39.861 flat angles C4'-P-C4' energy: -39.135 flat angles P-C4'-P energy: -24.949 tors. eta vs tors. theta energy: -36.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -513.441747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.441747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.441747 (E_RNA) where: Base-Base interactions energy: -369.025 where: short stacking energy: -147.054 Base-Backbone interact. energy: -0.245 local terms energy: -144.171343 where: bonds (distance) C4'-P energy: -29.644 bonds (distance) P-C4' energy: -26.426 flat angles C4'-P-C4' energy: -38.297 flat angles P-C4'-P energy: -18.202 tors. eta vs tors. theta energy: -31.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -393.347019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.347019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.347019 (E_RNA) where: Base-Base interactions energy: -271.506 where: short stacking energy: -105.176 Base-Backbone interact. energy: 0.058 local terms energy: -121.898920 where: bonds (distance) C4'-P energy: -26.645 bonds (distance) P-C4' energy: -34.846 flat angles C4'-P-C4' energy: -28.444 flat angles P-C4'-P energy: -22.875 tors. eta vs tors. theta energy: -9.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -698.212555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.212555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.212555 (E_RNA) where: Base-Base interactions energy: -486.255 where: short stacking energy: -224.572 Base-Backbone interact. energy: -0.688 local terms energy: -211.269266 where: bonds (distance) C4'-P energy: -39.904 bonds (distance) P-C4' energy: -38.605 flat angles C4'-P-C4' energy: -44.137 flat angles P-C4'-P energy: -30.564 tors. eta vs tors. theta energy: -58.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -664.723554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.723554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.723554 (E_RNA) where: Base-Base interactions energy: -470.525 where: short stacking energy: -201.590 Base-Backbone interact. energy: -0.133 local terms energy: -194.065856 where: bonds (distance) C4'-P energy: -37.801 bonds (distance) P-C4' energy: -38.340 flat angles C4'-P-C4' energy: -38.823 flat angles P-C4'-P energy: -24.003 tors. eta vs tors. theta energy: -55.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -635.609982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.609982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.609982 (E_RNA) where: Base-Base interactions energy: -455.461 where: short stacking energy: -184.371 Base-Backbone interact. energy: -0.110 local terms energy: -180.038861 where: bonds (distance) C4'-P energy: -31.930 bonds (distance) P-C4' energy: -34.532 flat angles C4'-P-C4' energy: -37.494 flat angles P-C4'-P energy: -24.384 tors. eta vs tors. theta energy: -51.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -577.439830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.439830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.439830 (E_RNA) where: Base-Base interactions energy: -413.379 where: short stacking energy: -191.577 Base-Backbone interact. energy: -0.781 local terms energy: -163.280061 where: bonds (distance) C4'-P energy: -36.189 bonds (distance) P-C4' energy: -33.025 flat angles C4'-P-C4' energy: -33.867 flat angles P-C4'-P energy: -19.070 tors. eta vs tors. theta energy: -41.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -601.511231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.511231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.511231 (E_RNA) where: Base-Base interactions energy: -432.400 where: short stacking energy: -181.483 Base-Backbone interact. energy: -1.183 local terms energy: -167.928163 where: bonds (distance) C4'-P energy: -35.717 bonds (distance) P-C4' energy: -30.882 flat angles C4'-P-C4' energy: -39.874 flat angles P-C4'-P energy: -13.039 tors. eta vs tors. theta energy: -48.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -583.839546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.839546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.839546 (E_RNA) where: Base-Base interactions energy: -411.668 where: short stacking energy: -173.739 Base-Backbone interact. energy: -0.297 local terms energy: -171.875268 where: bonds (distance) C4'-P energy: -27.642 bonds (distance) P-C4' energy: -40.448 flat angles C4'-P-C4' energy: -38.816 flat angles P-C4'-P energy: -24.454 tors. eta vs tors. theta energy: -40.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -561.558473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.558473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.558473 (E_RNA) where: Base-Base interactions energy: -393.519 where: short stacking energy: -185.966 Base-Backbone interact. energy: -1.599 local terms energy: -166.440460 where: bonds (distance) C4'-P energy: -26.911 bonds (distance) P-C4' energy: -33.505 flat angles C4'-P-C4' energy: -38.781 flat angles P-C4'-P energy: -19.957 tors. eta vs tors. theta energy: -47.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -537.277285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.277285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.277285 (E_RNA) where: Base-Base interactions energy: -376.277 where: short stacking energy: -177.015 Base-Backbone interact. energy: -0.065 local terms energy: -160.935538 where: bonds (distance) C4'-P energy: -28.912 bonds (distance) P-C4' energy: -29.960 flat angles C4'-P-C4' energy: -32.713 flat angles P-C4'-P energy: -22.161 tors. eta vs tors. theta energy: -47.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -472.458662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.458662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.458662 (E_RNA) where: Base-Base interactions energy: -331.445 where: short stacking energy: -134.812 Base-Backbone interact. energy: -0.375 local terms energy: -140.639292 where: bonds (distance) C4'-P energy: -30.422 bonds (distance) P-C4' energy: -20.005 flat angles C4'-P-C4' energy: -38.028 flat angles P-C4'-P energy: -27.078 tors. eta vs tors. theta energy: -25.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -382.100802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.100802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.100802 (E_RNA) where: Base-Base interactions energy: -242.769 where: short stacking energy: -119.894 Base-Backbone interact. energy: -0.621 local terms energy: -138.710945 where: bonds (distance) C4'-P energy: -30.853 bonds (distance) P-C4' energy: -33.497 flat angles C4'-P-C4' energy: -26.148 flat angles P-C4'-P energy: -26.322 tors. eta vs tors. theta energy: -21.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -688.854466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.854466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.854466 (E_RNA) where: Base-Base interactions energy: -488.126 where: short stacking energy: -213.689 Base-Backbone interact. energy: -0.356 local terms energy: -200.372696 where: bonds (distance) C4'-P energy: -39.110 bonds (distance) P-C4' energy: -36.969 flat angles C4'-P-C4' energy: -40.168 flat angles P-C4'-P energy: -24.131 tors. eta vs tors. theta energy: -59.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -664.413434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.413434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.413434 (E_RNA) where: Base-Base interactions energy: -477.609 where: short stacking energy: -209.537 Base-Backbone interact. energy: -1.314 local terms energy: -185.489997 where: bonds (distance) C4'-P energy: -26.610 bonds (distance) P-C4' energy: -37.399 flat angles C4'-P-C4' energy: -39.546 flat angles P-C4'-P energy: -28.632 tors. eta vs tors. theta energy: -53.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -661.594464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.594464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.594464 (E_RNA) where: Base-Base interactions energy: -477.012 where: short stacking energy: -199.087 Base-Backbone interact. energy: 0.092 local terms energy: -184.674927 where: bonds (distance) C4'-P energy: -37.769 bonds (distance) P-C4' energy: -30.026 flat angles C4'-P-C4' energy: -37.678 flat angles P-C4'-P energy: -25.786 tors. eta vs tors. theta energy: -53.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -604.053649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.053649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.053649 (E_RNA) where: Base-Base interactions energy: -436.346 where: short stacking energy: -180.882 Base-Backbone interact. energy: 0.312 local terms energy: -168.019310 where: bonds (distance) C4'-P energy: -27.504 bonds (distance) P-C4' energy: -33.332 flat angles C4'-P-C4' energy: -34.478 flat angles P-C4'-P energy: -21.188 tors. eta vs tors. theta energy: -51.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -580.543919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.543919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.543919 (E_RNA) where: Base-Base interactions energy: -412.922 where: short stacking energy: -177.060 Base-Backbone interact. energy: 0.754 local terms energy: -168.375857 where: bonds (distance) C4'-P energy: -31.828 bonds (distance) P-C4' energy: -29.232 flat angles C4'-P-C4' energy: -42.541 flat angles P-C4'-P energy: -24.243 tors. eta vs tors. theta energy: -40.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -557.739210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.739210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.739210 (E_RNA) where: Base-Base interactions energy: -394.701 where: short stacking energy: -164.195 Base-Backbone interact. energy: -1.376 local terms energy: -161.662689 where: bonds (distance) C4'-P energy: -29.297 bonds (distance) P-C4' energy: -31.512 flat angles C4'-P-C4' energy: -38.143 flat angles P-C4'-P energy: -24.373 tors. eta vs tors. theta energy: -38.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -567.796197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.796197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.796197 (E_RNA) where: Base-Base interactions energy: -420.324 where: short stacking energy: -177.296 Base-Backbone interact. energy: -1.244 local terms energy: -146.228070 where: bonds (distance) C4'-P energy: -26.652 bonds (distance) P-C4' energy: -34.846 flat angles C4'-P-C4' energy: -34.223 flat angles P-C4'-P energy: -14.638 tors. eta vs tors. theta energy: -35.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -523.890123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.890123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.890123 (E_RNA) where: Base-Base interactions energy: -359.048 where: short stacking energy: -149.310 Base-Backbone interact. energy: -0.822 local terms energy: -164.019694 where: bonds (distance) C4'-P energy: -34.874 bonds (distance) P-C4' energy: -30.196 flat angles C4'-P-C4' energy: -32.642 flat angles P-C4'-P energy: -30.621 tors. eta vs tors. theta energy: -35.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -504.343131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.343131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.343131 (E_RNA) where: Base-Base interactions energy: -377.724 where: short stacking energy: -150.115 Base-Backbone interact. energy: 0.088 local terms energy: -126.707129 where: bonds (distance) C4'-P energy: -23.972 bonds (distance) P-C4' energy: -34.709 flat angles C4'-P-C4' energy: -23.760 flat angles P-C4'-P energy: -11.324 tors. eta vs tors. theta energy: -32.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -382.280524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.280524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.280524 (E_RNA) where: Base-Base interactions energy: -260.258 where: short stacking energy: -110.801 Base-Backbone interact. energy: -0.149 local terms energy: -121.873516 where: bonds (distance) C4'-P energy: -21.518 bonds (distance) P-C4' energy: -32.636 flat angles C4'-P-C4' energy: -33.202 flat angles P-C4'-P energy: -21.405 tors. eta vs tors. theta energy: -13.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -677.346398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.346398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.346398 (E_RNA) where: Base-Base interactions energy: -477.230 where: short stacking energy: -207.559 Base-Backbone interact. energy: -0.335 local terms energy: -199.781876 where: bonds (distance) C4'-P energy: -36.509 bonds (distance) P-C4' energy: -37.635 flat angles C4'-P-C4' energy: -41.636 flat angles P-C4'-P energy: -26.920 tors. eta vs tors. theta energy: -57.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -687.525285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.525285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.525285 (E_RNA) where: Base-Base interactions energy: -495.250 where: short stacking energy: -221.618 Base-Backbone interact. energy: -0.988 local terms energy: -191.287874 where: bonds (distance) C4'-P energy: -34.759 bonds (distance) P-C4' energy: -28.874 flat angles C4'-P-C4' energy: -40.121 flat angles P-C4'-P energy: -30.832 tors. eta vs tors. theta energy: -56.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -642.929618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.929618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.929618 (E_RNA) where: Base-Base interactions energy: -458.310 where: short stacking energy: -182.943 Base-Backbone interact. energy: -0.334 local terms energy: -184.285248 where: bonds (distance) C4'-P energy: -36.522 bonds (distance) P-C4' energy: -37.092 flat angles C4'-P-C4' energy: -41.162 flat angles P-C4'-P energy: -27.775 tors. eta vs tors. theta energy: -41.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -629.425191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.425191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.425191 (E_RNA) where: Base-Base interactions energy: -435.294 where: short stacking energy: -176.867 Base-Backbone interact. energy: -0.281 local terms energy: -193.849444 where: bonds (distance) C4'-P energy: -40.641 bonds (distance) P-C4' energy: -42.769 flat angles C4'-P-C4' energy: -39.259 flat angles P-C4'-P energy: -22.583 tors. eta vs tors. theta energy: -48.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -583.611222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.611222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.611222 (E_RNA) where: Base-Base interactions energy: -408.704 where: short stacking energy: -185.877 Base-Backbone interact. energy: 0.666 local terms energy: -175.573145 where: bonds (distance) C4'-P energy: -34.203 bonds (distance) P-C4' energy: -38.978 flat angles C4'-P-C4' energy: -38.146 flat angles P-C4'-P energy: -18.235 tors. eta vs tors. theta energy: -46.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -568.294095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.294095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.294095 (E_RNA) where: Base-Base interactions energy: -396.218 where: short stacking energy: -176.151 Base-Backbone interact. energy: -0.872 local terms energy: -171.203767 where: bonds (distance) C4'-P energy: -23.873 bonds (distance) P-C4' energy: -36.436 flat angles C4'-P-C4' energy: -39.022 flat angles P-C4'-P energy: -26.446 tors. eta vs tors. theta energy: -45.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -551.672288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.672288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.672288 (E_RNA) where: Base-Base interactions energy: -373.388 where: short stacking energy: -172.962 Base-Backbone interact. energy: -1.059 local terms energy: -177.225658 where: bonds (distance) C4'-P energy: -25.984 bonds (distance) P-C4' energy: -37.752 flat angles C4'-P-C4' energy: -39.713 flat angles P-C4'-P energy: -30.131 tors. eta vs tors. theta energy: -43.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -551.592058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.592058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.592058 (E_RNA) where: Base-Base interactions energy: -392.402 where: short stacking energy: -163.084 Base-Backbone interact. energy: -0.607 local terms energy: -158.582275 where: bonds (distance) C4'-P energy: -29.574 bonds (distance) P-C4' energy: -34.513 flat angles C4'-P-C4' energy: -32.082 flat angles P-C4'-P energy: -19.466 tors. eta vs tors. theta energy: -42.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -512.052381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.052381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.052381 (E_RNA) where: Base-Base interactions energy: -373.805 where: short stacking energy: -158.787 Base-Backbone interact. energy: -1.031 local terms energy: -137.216427 where: bonds (distance) C4'-P energy: -32.418 bonds (distance) P-C4' energy: -20.199 flat angles C4'-P-C4' energy: -28.738 flat angles P-C4'-P energy: -19.336 tors. eta vs tors. theta energy: -36.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -404.923082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.923082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.923082 (E_RNA) where: Base-Base interactions energy: -287.905 where: short stacking energy: -123.161 Base-Backbone interact. energy: 0.298 local terms energy: -117.316483 where: bonds (distance) C4'-P energy: -15.644 bonds (distance) P-C4' energy: -25.462 flat angles C4'-P-C4' energy: -35.858 flat angles P-C4'-P energy: -23.948 tors. eta vs tors. theta energy: -16.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -686.533483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.533483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.533483 (E_RNA) where: Base-Base interactions energy: -488.426 where: short stacking energy: -212.185 Base-Backbone interact. energy: 0.505 local terms energy: -198.613028 where: bonds (distance) C4'-P energy: -37.987 bonds (distance) P-C4' energy: -37.034 flat angles C4'-P-C4' energy: -39.679 flat angles P-C4'-P energy: -29.971 tors. eta vs tors. theta energy: -53.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -671.591727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.591727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.591727 (E_RNA) where: Base-Base interactions energy: -466.437 where: short stacking energy: -208.426 Base-Backbone interact. energy: -0.354 local terms energy: -204.801023 where: bonds (distance) C4'-P energy: -33.385 bonds (distance) P-C4' energy: -40.174 flat angles C4'-P-C4' energy: -41.403 flat angles P-C4'-P energy: -29.713 tors. eta vs tors. theta energy: -60.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -651.628450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.628450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.628450 (E_RNA) where: Base-Base interactions energy: -452.444 where: short stacking energy: -184.294 Base-Backbone interact. energy: -0.503 local terms energy: -198.681974 where: bonds (distance) C4'-P energy: -38.008 bonds (distance) P-C4' energy: -40.197 flat angles C4'-P-C4' energy: -42.868 flat angles P-C4'-P energy: -28.264 tors. eta vs tors. theta energy: -49.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -625.113436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.113436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.113436 (E_RNA) where: Base-Base interactions energy: -457.801 where: short stacking energy: -181.626 Base-Backbone interact. energy: -0.871 local terms energy: -166.442013 where: bonds (distance) C4'-P energy: -29.628 bonds (distance) P-C4' energy: -33.425 flat angles C4'-P-C4' energy: -33.547 flat angles P-C4'-P energy: -22.132 tors. eta vs tors. theta energy: -47.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -590.061890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.061890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.061890 (E_RNA) where: Base-Base interactions energy: -430.053 where: short stacking energy: -192.016 Base-Backbone interact. energy: 0.416 local terms energy: -160.424891 where: bonds (distance) C4'-P energy: -31.708 bonds (distance) P-C4' energy: -28.440 flat angles C4'-P-C4' energy: -33.094 flat angles P-C4'-P energy: -18.683 tors. eta vs tors. theta energy: -48.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -554.321545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.321545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.321545 (E_RNA) where: Base-Base interactions energy: -389.477 where: short stacking energy: -173.190 Base-Backbone interact. energy: -0.214 local terms energy: -164.630067 where: bonds (distance) C4'-P energy: -25.740 bonds (distance) P-C4' energy: -36.763 flat angles C4'-P-C4' energy: -32.611 flat angles P-C4'-P energy: -24.430 tors. eta vs tors. theta energy: -45.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -534.635548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.635548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.635548 (E_RNA) where: Base-Base interactions energy: -382.941 where: short stacking energy: -158.806 Base-Backbone interact. energy: -0.546 local terms energy: -151.148927 where: bonds (distance) C4'-P energy: -28.050 bonds (distance) P-C4' energy: -28.671 flat angles C4'-P-C4' energy: -33.612 flat angles P-C4'-P energy: -21.258 tors. eta vs tors. theta energy: -39.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -546.320207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.320207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.320207 (E_RNA) where: Base-Base interactions energy: -399.674 where: short stacking energy: -156.620 Base-Backbone interact. energy: 2.670 local terms energy: -149.315826 where: bonds (distance) C4'-P energy: -25.647 bonds (distance) P-C4' energy: -37.399 flat angles C4'-P-C4' energy: -32.190 flat angles P-C4'-P energy: -16.501 tors. eta vs tors. theta energy: -37.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -562.088790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.088790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.088790 (E_RNA) where: Base-Base interactions energy: -393.096 where: short stacking energy: -166.065 Base-Backbone interact. energy: 2.380 local terms energy: -171.373208 where: bonds (distance) C4'-P energy: -28.382 bonds (distance) P-C4' energy: -29.456 flat angles C4'-P-C4' energy: -41.147 flat angles P-C4'-P energy: -27.209 tors. eta vs tors. theta energy: -45.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -415.490147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.490147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.490147 (E_RNA) where: Base-Base interactions energy: -275.613 where: short stacking energy: -121.476 Base-Backbone interact. energy: -0.879 local terms energy: -138.998448 where: bonds (distance) C4'-P energy: -34.487 bonds (distance) P-C4' energy: -41.607 flat angles C4'-P-C4' energy: -24.496 flat angles P-C4'-P energy: -15.705 tors. eta vs tors. theta energy: -22.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -695.313662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.313662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.313662 (E_RNA) where: Base-Base interactions energy: -480.271 where: short stacking energy: -220.860 Base-Backbone interact. energy: -0.251 local terms energy: -214.791778 where: bonds (distance) C4'-P energy: -41.062 bonds (distance) P-C4' energy: -40.626 flat angles C4'-P-C4' energy: -45.726 flat angles P-C4'-P energy: -30.084 tors. eta vs tors. theta energy: -57.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -692.659043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.659043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.659043 (E_RNA) where: Base-Base interactions energy: -488.852 where: short stacking energy: -210.648 Base-Backbone interact. energy: -0.298 local terms energy: -203.508677 where: bonds (distance) C4'-P energy: -33.287 bonds (distance) P-C4' energy: -43.472 flat angles C4'-P-C4' energy: -38.525 flat angles P-C4'-P energy: -28.714 tors. eta vs tors. theta energy: -59.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -641.995119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.995119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.995119 (E_RNA) where: Base-Base interactions energy: -467.880 where: short stacking energy: -190.870 Base-Backbone interact. energy: -1.469 local terms energy: -172.646450 where: bonds (distance) C4'-P energy: -30.354 bonds (distance) P-C4' energy: -29.843 flat angles C4'-P-C4' energy: -42.224 flat angles P-C4'-P energy: -24.672 tors. eta vs tors. theta energy: -45.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -621.600311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.600311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.600311 (E_RNA) where: Base-Base interactions energy: -454.341 where: short stacking energy: -177.170 Base-Backbone interact. energy: 0.107 local terms energy: -167.366476 where: bonds (distance) C4'-P energy: -35.403 bonds (distance) P-C4' energy: -35.787 flat angles C4'-P-C4' energy: -33.844 flat angles P-C4'-P energy: -18.440 tors. eta vs tors. theta energy: -43.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -606.594323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.594323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.594323 (E_RNA) where: Base-Base interactions energy: -438.994 where: short stacking energy: -201.164 Base-Backbone interact. energy: -0.870 local terms energy: -166.730575 where: bonds (distance) C4'-P energy: -31.849 bonds (distance) P-C4' energy: -29.656 flat angles C4'-P-C4' energy: -35.567 flat angles P-C4'-P energy: -23.465 tors. eta vs tors. theta energy: -46.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -538.597901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.597901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.597901 (E_RNA) where: Base-Base interactions energy: -385.667 where: short stacking energy: -159.392 Base-Backbone interact. energy: -0.552 local terms energy: -152.379480 where: bonds (distance) C4'-P energy: -35.344 bonds (distance) P-C4' energy: -26.430 flat angles C4'-P-C4' energy: -37.376 flat angles P-C4'-P energy: -21.805 tors. eta vs tors. theta energy: -31.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -572.889822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.889822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.889822 (E_RNA) where: Base-Base interactions energy: -413.311 where: short stacking energy: -165.420 Base-Backbone interact. energy: -1.249 local terms energy: -158.329996 where: bonds (distance) C4'-P energy: -35.430 bonds (distance) P-C4' energy: -33.535 flat angles C4'-P-C4' energy: -26.063 flat angles P-C4'-P energy: -20.903 tors. eta vs tors. theta energy: -42.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -513.454311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.454311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.454311 (E_RNA) where: Base-Base interactions energy: -360.650 where: short stacking energy: -153.904 Base-Backbone interact. energy: -0.376 local terms energy: -152.428314 where: bonds (distance) C4'-P energy: -28.514 bonds (distance) P-C4' energy: -32.038 flat angles C4'-P-C4' energy: -33.940 flat angles P-C4'-P energy: -26.519 tors. eta vs tors. theta energy: -31.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -547.766510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.766510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.766510 (E_RNA) where: Base-Base interactions energy: -373.665 where: short stacking energy: -176.390 Base-Backbone interact. energy: 0.693 local terms energy: -174.794751 where: bonds (distance) C4'-P energy: -32.160 bonds (distance) P-C4' energy: -32.853 flat angles C4'-P-C4' energy: -38.656 flat angles P-C4'-P energy: -19.262 tors. eta vs tors. theta energy: -51.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -416.519064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.519064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.519064 (E_RNA) where: Base-Base interactions energy: -309.630 where: short stacking energy: -120.307 Base-Backbone interact. energy: -0.163 local terms energy: -106.726907 where: bonds (distance) C4'-P energy: -27.197 bonds (distance) P-C4' energy: -32.714 flat angles C4'-P-C4' energy: -26.703 flat angles P-C4'-P energy: -12.398 tors. eta vs tors. theta energy: -7.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -684.495830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.495830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.495830 (E_RNA) where: Base-Base interactions energy: -478.578 where: short stacking energy: -206.583 Base-Backbone interact. energy: -0.284 local terms energy: -205.633880 where: bonds (distance) C4'-P energy: -41.810 bonds (distance) P-C4' energy: -30.385 flat angles C4'-P-C4' energy: -46.091 flat angles P-C4'-P energy: -31.110 tors. eta vs tors. theta energy: -56.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -685.375368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.375368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.375368 (E_RNA) where: Base-Base interactions energy: -473.655 where: short stacking energy: -209.666 Base-Backbone interact. energy: -0.348 local terms energy: -211.372597 where: bonds (distance) C4'-P energy: -40.163 bonds (distance) P-C4' energy: -40.006 flat angles C4'-P-C4' energy: -43.763 flat angles P-C4'-P energy: -30.206 tors. eta vs tors. theta energy: -57.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -647.501941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.501941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.501941 (E_RNA) where: Base-Base interactions energy: -466.601 where: short stacking energy: -189.756 Base-Backbone interact. energy: 0.890 local terms energy: -181.790055 where: bonds (distance) C4'-P energy: -36.612 bonds (distance) P-C4' energy: -36.662 flat angles C4'-P-C4' energy: -37.838 flat angles P-C4'-P energy: -25.745 tors. eta vs tors. theta energy: -44.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -621.104400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.104400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.104400 (E_RNA) where: Base-Base interactions energy: -440.535 where: short stacking energy: -164.086 Base-Backbone interact. energy: -0.496 local terms energy: -180.073317 where: bonds (distance) C4'-P energy: -37.217 bonds (distance) P-C4' energy: -33.810 flat angles C4'-P-C4' energy: -41.147 flat angles P-C4'-P energy: -23.604 tors. eta vs tors. theta energy: -44.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -578.016285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.016285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.016285 (E_RNA) where: Base-Base interactions energy: -411.289 where: short stacking energy: -170.177 Base-Backbone interact. energy: -0.666 local terms energy: -166.061801 where: bonds (distance) C4'-P energy: -37.706 bonds (distance) P-C4' energy: -39.595 flat angles C4'-P-C4' energy: -38.910 flat angles P-C4'-P energy: -9.137 tors. eta vs tors. theta energy: -40.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -554.801980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.801980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.801980 (E_RNA) where: Base-Base interactions energy: -384.189 where: short stacking energy: -154.997 Base-Backbone interact. energy: -0.355 local terms energy: -170.257743 where: bonds (distance) C4'-P energy: -34.539 bonds (distance) P-C4' energy: -37.221 flat angles C4'-P-C4' energy: -34.105 flat angles P-C4'-P energy: -23.752 tors. eta vs tors. theta energy: -40.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -553.454143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.454143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.454143 (E_RNA) where: Base-Base interactions energy: -368.449 where: short stacking energy: -173.001 Base-Backbone interact. energy: 0.405 local terms energy: -185.410996 where: bonds (distance) C4'-P energy: -31.736 bonds (distance) P-C4' energy: -34.116 flat angles C4'-P-C4' energy: -40.535 flat angles P-C4'-P energy: -25.881 tors. eta vs tors. theta energy: -53.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -561.809610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.809610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.809610 (E_RNA) where: Base-Base interactions energy: -402.783 where: short stacking energy: -178.432 Base-Backbone interact. energy: -0.064 local terms energy: -158.962521 where: bonds (distance) C4'-P energy: -30.691 bonds (distance) P-C4' energy: -31.657 flat angles C4'-P-C4' energy: -29.609 flat angles P-C4'-P energy: -26.574 tors. eta vs tors. theta energy: -40.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -514.474164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.474164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.474164 (E_RNA) where: Base-Base interactions energy: -361.502 where: short stacking energy: -168.740 Base-Backbone interact. energy: -1.132 local terms energy: -151.840390 where: bonds (distance) C4'-P energy: -30.471 bonds (distance) P-C4' energy: -29.582 flat angles C4'-P-C4' energy: -34.533 flat angles P-C4'-P energy: -16.918 tors. eta vs tors. theta energy: -40.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -405.330850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.330850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.330850 (E_RNA) where: Base-Base interactions energy: -277.419 where: short stacking energy: -127.874 Base-Backbone interact. energy: -0.958 local terms energy: -126.953179 where: bonds (distance) C4'-P energy: -29.378 bonds (distance) P-C4' energy: -33.349 flat angles C4'-P-C4' energy: -32.504 flat angles P-C4'-P energy: -15.792 tors. eta vs tors. theta energy: -15.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -696.447401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.447401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.447401 (E_RNA) where: Base-Base interactions energy: -500.958 where: short stacking energy: -221.193 Base-Backbone interact. energy: -0.462 local terms energy: -195.027045 where: bonds (distance) C4'-P energy: -29.661 bonds (distance) P-C4' energy: -34.950 flat angles C4'-P-C4' energy: -37.348 flat angles P-C4'-P energy: -31.076 tors. eta vs tors. theta energy: -61.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -674.634378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.634378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.634378 (E_RNA) where: Base-Base interactions energy: -474.088 where: short stacking energy: -202.280 Base-Backbone interact. energy: -0.716 local terms energy: -199.830148 where: bonds (distance) C4'-P energy: -35.115 bonds (distance) P-C4' energy: -39.625 flat angles C4'-P-C4' energy: -43.842 flat angles P-C4'-P energy: -27.752 tors. eta vs tors. theta energy: -53.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -653.156454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.156454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.156454 (E_RNA) where: Base-Base interactions energy: -460.329 where: short stacking energy: -197.248 Base-Backbone interact. energy: -0.894 local terms energy: -191.933198 where: bonds (distance) C4'-P energy: -34.003 bonds (distance) P-C4' energy: -36.553 flat angles C4'-P-C4' energy: -44.637 flat angles P-C4'-P energy: -22.839 tors. eta vs tors. theta energy: -53.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -624.864377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.864377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.864377 (E_RNA) where: Base-Base interactions energy: -462.624 where: short stacking energy: -180.398 Base-Backbone interact. energy: -0.834 local terms energy: -161.406818 where: bonds (distance) C4'-P energy: -33.467 bonds (distance) P-C4' energy: -32.214 flat angles C4'-P-C4' energy: -35.187 flat angles P-C4'-P energy: -22.629 tors. eta vs tors. theta energy: -37.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -569.320628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.320628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.320628 (E_RNA) where: Base-Base interactions energy: -390.240 where: short stacking energy: -175.783 Base-Backbone interact. energy: 0.422 local terms energy: -179.502807 where: bonds (distance) C4'-P energy: -38.732 bonds (distance) P-C4' energy: -34.129 flat angles C4'-P-C4' energy: -34.804 flat angles P-C4'-P energy: -26.040 tors. eta vs tors. theta energy: -45.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -543.553500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.553500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.553500 (E_RNA) where: Base-Base interactions energy: -384.182 where: short stacking energy: -160.650 Base-Backbone interact. energy: -0.202 local terms energy: -159.169090 where: bonds (distance) C4'-P energy: -26.531 bonds (distance) P-C4' energy: -34.526 flat angles C4'-P-C4' energy: -37.241 flat angles P-C4'-P energy: -24.060 tors. eta vs tors. theta energy: -36.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -569.891584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.891584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.891584 (E_RNA) where: Base-Base interactions energy: -400.456 where: short stacking energy: -170.205 Base-Backbone interact. energy: -0.275 local terms energy: -169.160719 where: bonds (distance) C4'-P energy: -31.782 bonds (distance) P-C4' energy: -33.288 flat angles C4'-P-C4' energy: -35.528 flat angles P-C4'-P energy: -27.293 tors. eta vs tors. theta energy: -41.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -535.406400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.406400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.406400 (E_RNA) where: Base-Base interactions energy: -378.222 where: short stacking energy: -169.304 Base-Backbone interact. energy: -0.359 local terms energy: -156.825924 where: bonds (distance) C4'-P energy: -25.658 bonds (distance) P-C4' energy: -32.780 flat angles C4'-P-C4' energy: -36.093 flat angles P-C4'-P energy: -15.036 tors. eta vs tors. theta energy: -47.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -505.078816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.078816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.078816 (E_RNA) where: Base-Base interactions energy: -344.123 where: short stacking energy: -138.715 Base-Backbone interact. energy: 0.172 local terms energy: -161.127991 where: bonds (distance) C4'-P energy: -30.638 bonds (distance) P-C4' energy: -38.315 flat angles C4'-P-C4' energy: -32.631 flat angles P-C4'-P energy: -26.750 tors. eta vs tors. theta energy: -32.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -346.586809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.586809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.586809 (E_RNA) where: Base-Base interactions energy: -231.447 where: short stacking energy: -103.777 Base-Backbone interact. energy: 5.778 local terms energy: -120.917296 where: bonds (distance) C4'-P energy: -26.181 bonds (distance) P-C4' energy: -32.153 flat angles C4'-P-C4' energy: -28.704 flat angles P-C4'-P energy: -16.308 tors. eta vs tors. theta energy: -17.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -697.020678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.020678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.020678 (E_RNA) where: Base-Base interactions energy: -493.330 where: short stacking energy: -211.384 Base-Backbone interact. energy: 0.595 local terms energy: -204.285345 where: bonds (distance) C4'-P energy: -32.611 bonds (distance) P-C4' energy: -38.673 flat angles C4'-P-C4' energy: -44.689 flat angles P-C4'-P energy: -26.529 tors. eta vs tors. theta energy: -61.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -661.418296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.418296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.418296 (E_RNA) where: Base-Base interactions energy: -456.917 where: short stacking energy: -212.803 Base-Backbone interact. energy: -0.902 local terms energy: -203.599882 where: bonds (distance) C4'-P energy: -36.993 bonds (distance) P-C4' energy: -34.571 flat angles C4'-P-C4' energy: -45.973 flat angles P-C4'-P energy: -25.289 tors. eta vs tors. theta energy: -60.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -645.313957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.313957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.313957 (E_RNA) where: Base-Base interactions energy: -463.581 where: short stacking energy: -194.162 Base-Backbone interact. energy: -1.000 local terms energy: -180.732279 where: bonds (distance) C4'-P energy: -35.593 bonds (distance) P-C4' energy: -42.983 flat angles C4'-P-C4' energy: -32.278 flat angles P-C4'-P energy: -23.257 tors. eta vs tors. theta energy: -46.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -618.051164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.051164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.051164 (E_RNA) where: Base-Base interactions energy: -448.754 where: short stacking energy: -179.221 Base-Backbone interact. energy: 1.085 local terms energy: -170.382311 where: bonds (distance) C4'-P energy: -33.375 bonds (distance) P-C4' energy: -37.173 flat angles C4'-P-C4' energy: -36.959 flat angles P-C4'-P energy: -23.321 tors. eta vs tors. theta energy: -39.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -563.405374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.405374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.405374 (E_RNA) where: Base-Base interactions energy: -394.225 where: short stacking energy: -173.080 Base-Backbone interact. energy: 1.083 local terms energy: -170.263833 where: bonds (distance) C4'-P energy: -33.590 bonds (distance) P-C4' energy: -32.056 flat angles C4'-P-C4' energy: -34.890 flat angles P-C4'-P energy: -23.101 tors. eta vs tors. theta energy: -46.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -582.190488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.190488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.190488 (E_RNA) where: Base-Base interactions energy: -408.989 where: short stacking energy: -171.677 Base-Backbone interact. energy: 1.104 local terms energy: -174.305596 where: bonds (distance) C4'-P energy: -39.617 bonds (distance) P-C4' energy: -37.101 flat angles C4'-P-C4' energy: -35.647 flat angles P-C4'-P energy: -18.659 tors. eta vs tors. theta energy: -43.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -558.800332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.800332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.800332 (E_RNA) where: Base-Base interactions energy: -387.289 where: short stacking energy: -151.064 Base-Backbone interact. energy: -0.254 local terms energy: -171.257517 where: bonds (distance) C4'-P energy: -37.177 bonds (distance) P-C4' energy: -32.795 flat angles C4'-P-C4' energy: -34.217 flat angles P-C4'-P energy: -24.262 tors. eta vs tors. theta energy: -42.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -537.161486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.161486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.161486 (E_RNA) where: Base-Base interactions energy: -388.973 where: short stacking energy: -162.202 Base-Backbone interact. energy: -0.288 local terms energy: -147.900245 where: bonds (distance) C4'-P energy: -23.864 bonds (distance) P-C4' energy: -21.833 flat angles C4'-P-C4' energy: -37.489 flat angles P-C4'-P energy: -20.664 tors. eta vs tors. theta energy: -44.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -448.472678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.472678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.472678 (E_RNA) where: Base-Base interactions energy: -322.237 where: short stacking energy: -130.011 Base-Backbone interact. energy: -0.844 local terms energy: -125.391427 where: bonds (distance) C4'-P energy: -27.946 bonds (distance) P-C4' energy: -23.287 flat angles C4'-P-C4' energy: -32.763 flat angles P-C4'-P energy: -22.131 tors. eta vs tors. theta energy: -19.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -305.457597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.457597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.457597 (E_RNA) where: Base-Base interactions energy: -181.939 where: short stacking energy: -87.753 Base-Backbone interact. energy: 0.020 local terms energy: -123.538669 where: bonds (distance) C4'-P energy: -36.217 bonds (distance) P-C4' energy: -38.149 flat angles C4'-P-C4' energy: -29.222 flat angles P-C4'-P energy: -17.519 tors. eta vs tors. theta energy: -2.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -687.960234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.960234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.960234 (E_RNA) where: Base-Base interactions energy: -482.620 where: short stacking energy: -208.008 Base-Backbone interact. energy: -0.177 local terms energy: -205.163217 where: bonds (distance) C4'-P energy: -38.877 bonds (distance) P-C4' energy: -40.543 flat angles C4'-P-C4' energy: -36.949 flat angles P-C4'-P energy: -29.507 tors. eta vs tors. theta energy: -59.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -687.553938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.553938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.553938 (E_RNA) where: Base-Base interactions energy: -483.699 where: short stacking energy: -221.521 Base-Backbone interact. energy: 0.888 local terms energy: -204.742522 where: bonds (distance) C4'-P energy: -34.187 bonds (distance) P-C4' energy: -38.901 flat angles C4'-P-C4' energy: -45.184 flat angles P-C4'-P energy: -27.156 tors. eta vs tors. theta energy: -59.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -619.792496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.792496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.792496 (E_RNA) where: Base-Base interactions energy: -439.975 where: short stacking energy: -175.534 Base-Backbone interact. energy: -1.241 local terms energy: -178.577079 where: bonds (distance) C4'-P energy: -34.475 bonds (distance) P-C4' energy: -41.452 flat angles C4'-P-C4' energy: -38.079 flat angles P-C4'-P energy: -19.751 tors. eta vs tors. theta energy: -44.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -609.971746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.971746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.971746 (E_RNA) where: Base-Base interactions energy: -423.423 where: short stacking energy: -184.868 Base-Backbone interact. energy: -0.432 local terms energy: -186.117556 where: bonds (distance) C4'-P energy: -33.347 bonds (distance) P-C4' energy: -33.822 flat angles C4'-P-C4' energy: -40.927 flat angles P-C4'-P energy: -30.616 tors. eta vs tors. theta energy: -47.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -583.070982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.070982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.070982 (E_RNA) where: Base-Base interactions energy: -412.629 where: short stacking energy: -173.397 Base-Backbone interact. energy: -0.387 local terms energy: -170.055164 where: bonds (distance) C4'-P energy: -38.198 bonds (distance) P-C4' energy: -30.570 flat angles C4'-P-C4' energy: -29.252 flat angles P-C4'-P energy: -25.956 tors. eta vs tors. theta energy: -46.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -585.973154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.973154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.973154 (E_RNA) where: Base-Base interactions energy: -421.892 where: short stacking energy: -184.490 Base-Backbone interact. energy: -0.093 local terms energy: -163.988239 where: bonds (distance) C4'-P energy: -32.553 bonds (distance) P-C4' energy: -32.095 flat angles C4'-P-C4' energy: -38.514 flat angles P-C4'-P energy: -20.541 tors. eta vs tors. theta energy: -40.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -567.212406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.212406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.212406 (E_RNA) where: Base-Base interactions energy: -405.086 where: short stacking energy: -156.842 Base-Backbone interact. energy: -0.176 local terms energy: -161.950791 where: bonds (distance) C4'-P energy: -25.337 bonds (distance) P-C4' energy: -34.794 flat angles C4'-P-C4' energy: -38.031 flat angles P-C4'-P energy: -24.583 tors. eta vs tors. theta energy: -39.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -519.792942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.792942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.792942 (E_RNA) where: Base-Base interactions energy: -369.391 where: short stacking energy: -152.533 Base-Backbone interact. energy: -0.555 local terms energy: -149.846409 where: bonds (distance) C4'-P energy: -31.541 bonds (distance) P-C4' energy: -31.935 flat angles C4'-P-C4' energy: -27.258 flat angles P-C4'-P energy: -21.554 tors. eta vs tors. theta energy: -37.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -474.429387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.429387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.429387 (E_RNA) where: Base-Base interactions energy: -315.833 where: short stacking energy: -130.580 Base-Backbone interact. energy: 0.226 local terms energy: -158.822385 where: bonds (distance) C4'-P energy: -29.932 bonds (distance) P-C4' energy: -32.276 flat angles C4'-P-C4' energy: -34.547 flat angles P-C4'-P energy: -28.137 tors. eta vs tors. theta energy: -33.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -285.856063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.856063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.856063 (E_RNA) where: Base-Base interactions energy: -167.372 where: short stacking energy: -96.211 Base-Backbone interact. energy: -0.725 local terms energy: -117.758802 where: bonds (distance) C4'-P energy: -23.083 bonds (distance) P-C4' energy: -29.190 flat angles C4'-P-C4' energy: -28.112 flat angles P-C4'-P energy: -25.089 tors. eta vs tors. theta energy: -12.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -693.090185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.090185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.090185 (E_RNA) where: Base-Base interactions energy: -487.469 where: short stacking energy: -204.909 Base-Backbone interact. energy: 0.271 local terms energy: -205.892184 where: bonds (distance) C4'-P energy: -35.717 bonds (distance) P-C4' energy: -39.955 flat angles C4'-P-C4' energy: -41.442 flat angles P-C4'-P energy: -27.815 tors. eta vs tors. theta energy: -60.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -679.357402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.357402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.357402 (E_RNA) where: Base-Base interactions energy: -483.593 where: short stacking energy: -210.964 Base-Backbone interact. energy: -0.005 local terms energy: -195.760089 where: bonds (distance) C4'-P energy: -35.671 bonds (distance) P-C4' energy: -38.494 flat angles C4'-P-C4' energy: -39.155 flat angles P-C4'-P energy: -23.774 tors. eta vs tors. theta energy: -58.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -635.323586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.323586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.323586 (E_RNA) where: Base-Base interactions energy: -459.448 where: short stacking energy: -179.820 Base-Backbone interact. energy: -1.171 local terms energy: -174.704167 where: bonds (distance) C4'-P energy: -32.239 bonds (distance) P-C4' energy: -36.306 flat angles C4'-P-C4' energy: -39.746 flat angles P-C4'-P energy: -21.278 tors. eta vs tors. theta energy: -45.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -627.639734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.639734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.639734 (E_RNA) where: Base-Base interactions energy: -437.436 where: short stacking energy: -184.487 Base-Backbone interact. energy: 0.387 local terms energy: -190.590468 where: bonds (distance) C4'-P energy: -33.362 bonds (distance) P-C4' energy: -38.795 flat angles C4'-P-C4' energy: -38.261 flat angles P-C4'-P energy: -29.006 tors. eta vs tors. theta energy: -51.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -598.283460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.283460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.283460 (E_RNA) where: Base-Base interactions energy: -423.629 where: short stacking energy: -178.154 Base-Backbone interact. energy: -0.952 local terms energy: -173.703176 where: bonds (distance) C4'-P energy: -30.198 bonds (distance) P-C4' energy: -37.294 flat angles C4'-P-C4' energy: -39.760 flat angles P-C4'-P energy: -26.794 tors. eta vs tors. theta energy: -39.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -574.502095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.502095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.502095 (E_RNA) where: Base-Base interactions energy: -402.132 where: short stacking energy: -182.860 Base-Backbone interact. energy: -0.353 local terms energy: -172.016861 where: bonds (distance) C4'-P energy: -31.574 bonds (distance) P-C4' energy: -37.472 flat angles C4'-P-C4' energy: -41.617 flat angles P-C4'-P energy: -23.824 tors. eta vs tors. theta energy: -37.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -541.892670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.892670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.892670 (E_RNA) where: Base-Base interactions energy: -396.640 where: short stacking energy: -162.753 Base-Backbone interact. energy: -0.660 local terms energy: -144.592671 where: bonds (distance) C4'-P energy: -27.101 bonds (distance) P-C4' energy: -32.583 flat angles C4'-P-C4' energy: -36.293 flat angles P-C4'-P energy: -19.160 tors. eta vs tors. theta energy: -29.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -513.098237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.098237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.098237 (E_RNA) where: Base-Base interactions energy: -355.098 where: short stacking energy: -161.871 Base-Backbone interact. energy: -0.437 local terms energy: -157.562362 where: bonds (distance) C4'-P energy: -26.852 bonds (distance) P-C4' energy: -29.603 flat angles C4'-P-C4' energy: -33.755 flat angles P-C4'-P energy: -23.794 tors. eta vs tors. theta energy: -43.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -496.300633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.300633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.300633 (E_RNA) where: Base-Base interactions energy: -352.490 where: short stacking energy: -140.854 Base-Backbone interact. energy: -0.486 local terms energy: -143.325044 where: bonds (distance) C4'-P energy: -33.890 bonds (distance) P-C4' energy: -28.081 flat angles C4'-P-C4' energy: -33.336 flat angles P-C4'-P energy: -24.135 tors. eta vs tors. theta energy: -23.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -280.784464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.784464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.784464 (E_RNA) where: Base-Base interactions energy: -150.974 where: short stacking energy: -90.998 Base-Backbone interact. energy: -0.784 local terms energy: -129.026168 where: bonds (distance) C4'-P energy: -21.562 bonds (distance) P-C4' energy: -39.010 flat angles C4'-P-C4' energy: -26.230 flat angles P-C4'-P energy: -22.837 tors. eta vs tors. theta energy: -19.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -703.530040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.530040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.530040 (E_RNA) where: Base-Base interactions energy: -490.846 where: short stacking energy: -207.650 Base-Backbone interact. energy: -0.312 local terms energy: -212.371131 where: bonds (distance) C4'-P energy: -36.789 bonds (distance) P-C4' energy: -42.855 flat angles C4'-P-C4' energy: -46.487 flat angles P-C4'-P energy: -27.936 tors. eta vs tors. theta energy: -58.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -679.651475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.651475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.651475 (E_RNA) where: Base-Base interactions energy: -474.886 where: short stacking energy: -214.237 Base-Backbone interact. energy: -0.217 local terms energy: -204.549000 where: bonds (distance) C4'-P energy: -39.637 bonds (distance) P-C4' energy: -40.176 flat angles C4'-P-C4' energy: -41.633 flat angles P-C4'-P energy: -27.485 tors. eta vs tors. theta energy: -55.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -632.032679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.032679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.032679 (E_RNA) where: Base-Base interactions energy: -460.055 where: short stacking energy: -193.951 Base-Backbone interact. energy: 1.001 local terms energy: -172.978988 where: bonds (distance) C4'-P energy: -32.835 bonds (distance) P-C4' energy: -38.136 flat angles C4'-P-C4' energy: -36.973 flat angles P-C4'-P energy: -20.033 tors. eta vs tors. theta energy: -45.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -628.546695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.546695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.546695 (E_RNA) where: Base-Base interactions energy: -460.573 where: short stacking energy: -177.862 Base-Backbone interact. energy: -2.854 local terms energy: -165.119773 where: bonds (distance) C4'-P energy: -34.369 bonds (distance) P-C4' energy: -35.263 flat angles C4'-P-C4' energy: -38.422 flat angles P-C4'-P energy: -13.624 tors. eta vs tors. theta energy: -43.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -598.243038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.243038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.243038 (E_RNA) where: Base-Base interactions energy: -426.383 where: short stacking energy: -183.376 Base-Backbone interact. energy: -1.233 local terms energy: -170.627309 where: bonds (distance) C4'-P energy: -30.825 bonds (distance) P-C4' energy: -34.577 flat angles C4'-P-C4' energy: -41.925 flat angles P-C4'-P energy: -14.157 tors. eta vs tors. theta energy: -49.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -584.278080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.278080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.278080 (E_RNA) where: Base-Base interactions energy: -400.321 where: short stacking energy: -169.225 Base-Backbone interact. energy: -0.600 local terms energy: -183.356574 where: bonds (distance) C4'-P energy: -38.117 bonds (distance) P-C4' energy: -34.551 flat angles C4'-P-C4' energy: -40.329 flat angles P-C4'-P energy: -26.021 tors. eta vs tors. theta energy: -44.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -526.732361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.732361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.732361 (E_RNA) where: Base-Base interactions energy: -363.142 where: short stacking energy: -151.725 Base-Backbone interact. energy: -0.397 local terms energy: -163.193317 where: bonds (distance) C4'-P energy: -29.303 bonds (distance) P-C4' energy: -32.342 flat angles C4'-P-C4' energy: -34.608 flat angles P-C4'-P energy: -29.312 tors. eta vs tors. theta energy: -37.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -510.796088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.796088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.796088 (E_RNA) where: Base-Base interactions energy: -373.774 where: short stacking energy: -153.462 Base-Backbone interact. energy: 0.188 local terms energy: -137.209190 where: bonds (distance) C4'-P energy: -36.032 bonds (distance) P-C4' energy: -33.008 flat angles C4'-P-C4' energy: -20.008 flat angles P-C4'-P energy: -14.554 tors. eta vs tors. theta energy: -33.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -495.567436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.567436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.567436 (E_RNA) where: Base-Base interactions energy: -349.410 where: short stacking energy: -147.234 Base-Backbone interact. energy: -0.135 local terms energy: -146.022984 where: bonds (distance) C4'-P energy: -25.078 bonds (distance) P-C4' energy: -34.487 flat angles C4'-P-C4' energy: -29.475 flat angles P-C4'-P energy: -22.861 tors. eta vs tors. theta energy: -34.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -257.403572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.403572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.403572 (E_RNA) where: Base-Base interactions energy: -135.168 where: short stacking energy: -79.311 Base-Backbone interact. energy: -0.097 local terms energy: -122.138802 where: bonds (distance) C4'-P energy: -32.773 bonds (distance) P-C4' energy: -37.751 flat angles C4'-P-C4' energy: -30.319 flat angles P-C4'-P energy: -15.804 tors. eta vs tors. theta energy: -5.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -705.955861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.955861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.955861 (E_RNA) where: Base-Base interactions energy: -497.127 where: short stacking energy: -213.523 Base-Backbone interact. energy: -0.435 local terms energy: -208.393994 where: bonds (distance) C4'-P energy: -39.145 bonds (distance) P-C4' energy: -42.739 flat angles C4'-P-C4' energy: -38.235 flat angles P-C4'-P energy: -32.958 tors. eta vs tors. theta energy: -55.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -673.371233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.371233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.371233 (E_RNA) where: Base-Base interactions energy: -488.961 where: short stacking energy: -218.763 Base-Backbone interact. energy: -0.138 local terms energy: -184.271803 where: bonds (distance) C4'-P energy: -27.243 bonds (distance) P-C4' energy: -28.400 flat angles C4'-P-C4' energy: -43.338 flat angles P-C4'-P energy: -29.919 tors. eta vs tors. theta energy: -55.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -655.478265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.478265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.478265 (E_RNA) where: Base-Base interactions energy: -473.297 where: short stacking energy: -199.409 Base-Backbone interact. energy: -0.109 local terms energy: -182.071853 where: bonds (distance) C4'-P energy: -37.270 bonds (distance) P-C4' energy: -34.778 flat angles C4'-P-C4' energy: -43.411 flat angles P-C4'-P energy: -19.577 tors. eta vs tors. theta energy: -47.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -649.503245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.503245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.503245 (E_RNA) where: Base-Base interactions energy: -478.394 where: short stacking energy: -186.823 Base-Backbone interact. energy: -0.805 local terms energy: -170.304221 where: bonds (distance) C4'-P energy: -37.074 bonds (distance) P-C4' energy: -33.907 flat angles C4'-P-C4' energy: -39.816 flat angles P-C4'-P energy: -17.499 tors. eta vs tors. theta energy: -42.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -586.498585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.498585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.498585 (E_RNA) where: Base-Base interactions energy: -414.897 where: short stacking energy: -186.560 Base-Backbone interact. energy: -0.801 local terms energy: -170.800436 where: bonds (distance) C4'-P energy: -33.379 bonds (distance) P-C4' energy: -40.029 flat angles C4'-P-C4' energy: -36.459 flat angles P-C4'-P energy: -17.904 tors. eta vs tors. theta energy: -43.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -599.162300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.162300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.162300 (E_RNA) where: Base-Base interactions energy: -430.105 where: short stacking energy: -187.935 Base-Backbone interact. energy: -0.208 local terms energy: -168.849469 where: bonds (distance) C4'-P energy: -28.325 bonds (distance) P-C4' energy: -32.614 flat angles C4'-P-C4' energy: -37.917 flat angles P-C4'-P energy: -25.652 tors. eta vs tors. theta energy: -44.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -542.960056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.960056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.960056 (E_RNA) where: Base-Base interactions energy: -374.394 where: short stacking energy: -163.310 Base-Backbone interact. energy: -0.522 local terms energy: -168.044637 where: bonds (distance) C4'-P energy: -39.713 bonds (distance) P-C4' energy: -38.867 flat angles C4'-P-C4' energy: -40.725 flat angles P-C4'-P energy: -17.698 tors. eta vs tors. theta energy: -31.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -526.513886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.513886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.513886 (E_RNA) where: Base-Base interactions energy: -382.163 where: short stacking energy: -152.198 Base-Backbone interact. energy: 0.120 local terms energy: -144.470703 where: bonds (distance) C4'-P energy: -28.402 bonds (distance) P-C4' energy: -29.998 flat angles C4'-P-C4' energy: -33.657 flat angles P-C4'-P energy: -19.206 tors. eta vs tors. theta energy: -33.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -498.840426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.840426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.840426 (E_RNA) where: Base-Base interactions energy: -353.509 where: short stacking energy: -141.761 Base-Backbone interact. energy: 0.089 local terms energy: -145.420202 where: bonds (distance) C4'-P energy: -31.865 bonds (distance) P-C4' energy: -30.741 flat angles C4'-P-C4' energy: -30.247 flat angles P-C4'-P energy: -14.938 tors. eta vs tors. theta energy: -37.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -261.739013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.739013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.739013 (E_RNA) where: Base-Base interactions energy: -139.272 where: short stacking energy: -78.353 Base-Backbone interact. energy: 0.140 local terms energy: -122.606707 where: bonds (distance) C4'-P energy: -37.271 bonds (distance) P-C4' energy: -38.320 flat angles C4'-P-C4' energy: -18.230 flat angles P-C4'-P energy: -18.228 tors. eta vs tors. theta energy: -10.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -695.163862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.163862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.163862 (E_RNA) where: Base-Base interactions energy: -490.352 where: short stacking energy: -205.308 Base-Backbone interact. energy: -2.251 local terms energy: -202.561028 where: bonds (distance) C4'-P energy: -38.224 bonds (distance) P-C4' energy: -37.716 flat angles C4'-P-C4' energy: -41.307 flat angles P-C4'-P energy: -29.900 tors. eta vs tors. theta energy: -55.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -663.975540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.975540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.975540 (E_RNA) where: Base-Base interactions energy: -466.757 where: short stacking energy: -207.762 Base-Backbone interact. energy: -0.841 local terms energy: -196.376576 where: bonds (distance) C4'-P energy: -31.571 bonds (distance) P-C4' energy: -39.730 flat angles C4'-P-C4' energy: -40.803 flat angles P-C4'-P energy: -29.056 tors. eta vs tors. theta energy: -55.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -659.894987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.894987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.894987 (E_RNA) where: Base-Base interactions energy: -479.268 where: short stacking energy: -201.231 Base-Backbone interact. energy: -0.251 local terms energy: -180.375913 where: bonds (distance) C4'-P energy: -26.755 bonds (distance) P-C4' energy: -32.735 flat angles C4'-P-C4' energy: -46.124 flat angles P-C4'-P energy: -22.617 tors. eta vs tors. theta energy: -52.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -601.637724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.637724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.637724 (E_RNA) where: Base-Base interactions energy: -428.953 where: short stacking energy: -158.560 Base-Backbone interact. energy: -2.738 local terms energy: -169.946835 where: bonds (distance) C4'-P energy: -35.406 bonds (distance) P-C4' energy: -35.477 flat angles C4'-P-C4' energy: -37.663 flat angles P-C4'-P energy: -26.396 tors. eta vs tors. theta energy: -35.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -591.822955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.822955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.822955 (E_RNA) where: Base-Base interactions energy: -414.527 where: short stacking energy: -181.004 Base-Backbone interact. energy: 0.200 local terms energy: -177.496251 where: bonds (distance) C4'-P energy: -31.668 bonds (distance) P-C4' energy: -31.503 flat angles C4'-P-C4' energy: -39.285 flat angles P-C4'-P energy: -29.011 tors. eta vs tors. theta energy: -46.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -599.629769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.629769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.629769 (E_RNA) where: Base-Base interactions energy: -416.908 where: short stacking energy: -176.756 Base-Backbone interact. energy: -1.037 local terms energy: -181.684982 where: bonds (distance) C4'-P energy: -37.471 bonds (distance) P-C4' energy: -36.935 flat angles C4'-P-C4' energy: -37.609 flat angles P-C4'-P energy: -25.020 tors. eta vs tors. theta energy: -44.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -529.760551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.760551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.760551 (E_RNA) where: Base-Base interactions energy: -371.808 where: short stacking energy: -160.342 Base-Backbone interact. energy: -1.036 local terms energy: -156.916052 where: bonds (distance) C4'-P energy: -27.750 bonds (distance) P-C4' energy: -31.531 flat angles C4'-P-C4' energy: -35.055 flat angles P-C4'-P energy: -24.722 tors. eta vs tors. theta energy: -37.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -550.913444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.913444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.913444 (E_RNA) where: Base-Base interactions energy: -382.660 where: short stacking energy: -161.595 Base-Backbone interact. energy: 0.423 local terms energy: -168.676197 where: bonds (distance) C4'-P energy: -30.882 bonds (distance) P-C4' energy: -34.166 flat angles C4'-P-C4' energy: -38.745 flat angles P-C4'-P energy: -24.246 tors. eta vs tors. theta energy: -40.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -519.475370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.475370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.475370 (E_RNA) where: Base-Base interactions energy: -365.230 where: short stacking energy: -135.000 Base-Backbone interact. energy: -1.066 local terms energy: -153.179524 where: bonds (distance) C4'-P energy: -31.172 bonds (distance) P-C4' energy: -38.440 flat angles C4'-P-C4' energy: -35.013 flat angles P-C4'-P energy: -18.906 tors. eta vs tors. theta energy: -29.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -266.095011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.095011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.095011 (E_RNA) where: Base-Base interactions energy: -140.768 where: short stacking energy: -88.538 Base-Backbone interact. energy: 0.085 local terms energy: -125.412074 where: bonds (distance) C4'-P energy: -23.512 bonds (distance) P-C4' energy: -34.093 flat angles C4'-P-C4' energy: -30.413 flat angles P-C4'-P energy: -23.803 tors. eta vs tors. theta energy: -13.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -703.288438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.288438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.288438 (E_RNA) where: Base-Base interactions energy: -497.986 where: short stacking energy: -219.768 Base-Backbone interact. energy: 0.613 local terms energy: -205.915876 where: bonds (distance) C4'-P energy: -40.604 bonds (distance) P-C4' energy: -38.432 flat angles C4'-P-C4' energy: -41.844 flat angles P-C4'-P energy: -28.048 tors. eta vs tors. theta energy: -56.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -662.261933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.261933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.261933 (E_RNA) where: Base-Base interactions energy: -496.334 where: short stacking energy: -204.386 Base-Backbone interact. energy: -0.470 local terms energy: -165.457646 where: bonds (distance) C4'-P energy: -30.474 bonds (distance) P-C4' energy: -28.741 flat angles C4'-P-C4' energy: -33.628 flat angles P-C4'-P energy: -22.901 tors. eta vs tors. theta energy: -49.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -672.345214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.345214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.345214 (E_RNA) where: Base-Base interactions energy: -471.244 where: short stacking energy: -210.509 Base-Backbone interact. energy: -1.258 local terms energy: -199.843648 where: bonds (distance) C4'-P energy: -33.129 bonds (distance) P-C4' energy: -40.443 flat angles C4'-P-C4' energy: -41.428 flat angles P-C4'-P energy: -27.940 tors. eta vs tors. theta energy: -56.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -595.993171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.993171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.993171 (E_RNA) where: Base-Base interactions energy: -445.496 where: short stacking energy: -172.442 Base-Backbone interact. energy: -0.164 local terms energy: -150.332640 where: bonds (distance) C4'-P energy: -33.913 bonds (distance) P-C4' energy: -27.628 flat angles C4'-P-C4' energy: -34.856 flat angles P-C4'-P energy: -17.902 tors. eta vs tors. theta energy: -36.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -564.774746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.774746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.774746 (E_RNA) where: Base-Base interactions energy: -404.850 where: short stacking energy: -173.025 Base-Backbone interact. energy: -0.359 local terms energy: -159.565402 where: bonds (distance) C4'-P energy: -32.318 bonds (distance) P-C4' energy: -39.284 flat angles C4'-P-C4' energy: -29.800 flat angles P-C4'-P energy: -16.636 tors. eta vs tors. theta energy: -41.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -618.410388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.410388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.410388 (E_RNA) where: Base-Base interactions energy: -436.931 where: short stacking energy: -192.245 Base-Backbone interact. energy: 1.303 local terms energy: -182.781996 where: bonds (distance) C4'-P energy: -32.078 bonds (distance) P-C4' energy: -37.439 flat angles C4'-P-C4' energy: -38.282 flat angles P-C4'-P energy: -26.787 tors. eta vs tors. theta energy: -48.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -554.345949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.345949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.345949 (E_RNA) where: Base-Base interactions energy: -393.893 where: short stacking energy: -177.677 Base-Backbone interact. energy: 0.632 local terms energy: -161.084888 where: bonds (distance) C4'-P energy: -27.271 bonds (distance) P-C4' energy: -39.566 flat angles C4'-P-C4' energy: -32.519 flat angles P-C4'-P energy: -22.919 tors. eta vs tors. theta energy: -38.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -536.067665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.067665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.067665 (E_RNA) where: Base-Base interactions energy: -392.616 where: short stacking energy: -154.740 Base-Backbone interact. energy: -1.390 local terms energy: -142.062232 where: bonds (distance) C4'-P energy: -29.144 bonds (distance) P-C4' energy: -38.764 flat angles C4'-P-C4' energy: -27.134 flat angles P-C4'-P energy: -18.472 tors. eta vs tors. theta energy: -28.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -526.370922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.370922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.370922 (E_RNA) where: Base-Base interactions energy: -381.359 where: short stacking energy: -162.301 Base-Backbone interact. energy: 2.199 local terms energy: -147.210559 where: bonds (distance) C4'-P energy: -22.092 bonds (distance) P-C4' energy: -38.654 flat angles C4'-P-C4' energy: -27.559 flat angles P-C4'-P energy: -20.143 tors. eta vs tors. theta energy: -38.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -266.868406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.868406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.868406 (E_RNA) where: Base-Base interactions energy: -152.571 where: short stacking energy: -77.703 Base-Backbone interact. energy: -0.708 local terms energy: -113.589829 where: bonds (distance) C4'-P energy: -26.337 bonds (distance) P-C4' energy: -32.263 flat angles C4'-P-C4' energy: -30.572 flat angles P-C4'-P energy: -15.012 tors. eta vs tors. theta energy: -9.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -694.557359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.557359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.557359 (E_RNA) where: Base-Base interactions energy: -492.437 where: short stacking energy: -212.815 Base-Backbone interact. energy: -0.063 local terms energy: -202.057283 where: bonds (distance) C4'-P energy: -34.194 bonds (distance) P-C4' energy: -37.552 flat angles C4'-P-C4' energy: -44.592 flat angles P-C4'-P energy: -29.982 tors. eta vs tors. theta energy: -55.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -665.997653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.997653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.997653 (E_RNA) where: Base-Base interactions energy: -480.619 where: short stacking energy: -198.214 Base-Backbone interact. energy: -0.865 local terms energy: -184.513426 where: bonds (distance) C4'-P energy: -35.897 bonds (distance) P-C4' energy: -36.047 flat angles C4'-P-C4' energy: -37.441 flat angles P-C4'-P energy: -24.574 tors. eta vs tors. theta energy: -50.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -664.757003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.757003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.757003 (E_RNA) where: Base-Base interactions energy: -470.577 where: short stacking energy: -213.911 Base-Backbone interact. energy: -0.073 local terms energy: -194.107325 where: bonds (distance) C4'-P energy: -32.386 bonds (distance) P-C4' energy: -43.070 flat angles C4'-P-C4' energy: -39.595 flat angles P-C4'-P energy: -22.183 tors. eta vs tors. theta energy: -56.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -607.793487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.793487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.793487 (E_RNA) where: Base-Base interactions energy: -440.197 where: short stacking energy: -181.852 Base-Backbone interact. energy: -1.603 local terms energy: -165.993284 where: bonds (distance) C4'-P energy: -31.590 bonds (distance) P-C4' energy: -35.255 flat angles C4'-P-C4' energy: -38.635 flat angles P-C4'-P energy: -21.152 tors. eta vs tors. theta energy: -39.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -655.160130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.160130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.160130 (E_RNA) where: Base-Base interactions energy: -468.984 where: short stacking energy: -196.978 Base-Backbone interact. energy: -0.594 local terms energy: -185.581733 where: bonds (distance) C4'-P energy: -40.046 bonds (distance) P-C4' energy: -33.749 flat angles C4'-P-C4' energy: -33.766 flat angles P-C4'-P energy: -25.622 tors. eta vs tors. theta energy: -52.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -565.772858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.772858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.772858 (E_RNA) where: Base-Base interactions energy: -394.317 where: short stacking energy: -170.500 Base-Backbone interact. energy: 0.361 local terms energy: -171.816924 where: bonds (distance) C4'-P energy: -32.055 bonds (distance) P-C4' energy: -38.799 flat angles C4'-P-C4' energy: -40.750 flat angles P-C4'-P energy: -16.083 tors. eta vs tors. theta energy: -44.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -608.298683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.298683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.298683 (E_RNA) where: Base-Base interactions energy: -460.005 where: short stacking energy: -171.650 Base-Backbone interact. energy: -0.583 local terms energy: -147.711419 where: bonds (distance) C4'-P energy: -22.071 bonds (distance) P-C4' energy: -39.098 flat angles C4'-P-C4' energy: -33.076 flat angles P-C4'-P energy: -14.306 tors. eta vs tors. theta energy: -39.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -538.129014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.129014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.129014 (E_RNA) where: Base-Base interactions energy: -393.777 where: short stacking energy: -168.749 Base-Backbone interact. energy: -0.564 local terms energy: -143.787636 where: bonds (distance) C4'-P energy: -25.041 bonds (distance) P-C4' energy: -28.073 flat angles C4'-P-C4' energy: -32.656 flat angles P-C4'-P energy: -21.113 tors. eta vs tors. theta energy: -36.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -485.428772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.428772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.428772 (E_RNA) where: Base-Base interactions energy: -335.914 where: short stacking energy: -140.627 Base-Backbone interact. energy: 0.155 local terms energy: -149.670188 where: bonds (distance) C4'-P energy: -34.923 bonds (distance) P-C4' energy: -29.842 flat angles C4'-P-C4' energy: -35.256 flat angles P-C4'-P energy: -16.930 tors. eta vs tors. theta energy: -32.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -276.985059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.985059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.985059 (E_RNA) where: Base-Base interactions energy: -159.183 where: short stacking energy: -70.532 Base-Backbone interact. energy: 1.981 local terms energy: -119.783522 where: bonds (distance) C4'-P energy: -35.010 bonds (distance) P-C4' energy: -33.899 flat angles C4'-P-C4' energy: -28.171 flat angles P-C4'-P energy: -21.751 tors. eta vs tors. theta energy: -0.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -697.328765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.328765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.328765 (E_RNA) where: Base-Base interactions energy: -496.161 where: short stacking energy: -206.128 Base-Backbone interact. energy: -0.175 local terms energy: -200.993529 where: bonds (distance) C4'-P energy: -35.347 bonds (distance) P-C4' energy: -41.617 flat angles C4'-P-C4' energy: -41.031 flat angles P-C4'-P energy: -26.968 tors. eta vs tors. theta energy: -56.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -669.840580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.840580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.840580 (E_RNA) where: Base-Base interactions energy: -484.966 where: short stacking energy: -209.142 Base-Backbone interact. energy: -0.972 local terms energy: -183.902462 where: bonds (distance) C4'-P energy: -39.004 bonds (distance) P-C4' energy: -32.033 flat angles C4'-P-C4' energy: -39.852 flat angles P-C4'-P energy: -20.537 tors. eta vs tors. theta energy: -52.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -642.400998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.400998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.400998 (E_RNA) where: Base-Base interactions energy: -459.250 where: short stacking energy: -207.393 Base-Backbone interact. energy: -0.503 local terms energy: -182.648483 where: bonds (distance) C4'-P energy: -31.332 bonds (distance) P-C4' energy: -37.192 flat angles C4'-P-C4' energy: -35.037 flat angles P-C4'-P energy: -25.737 tors. eta vs tors. theta energy: -53.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -656.351267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.351267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.351267 (E_RNA) where: Base-Base interactions energy: -457.896 where: short stacking energy: -201.141 Base-Backbone interact. energy: -0.940 local terms energy: -197.514947 where: bonds (distance) C4'-P energy: -39.968 bonds (distance) P-C4' energy: -30.603 flat angles C4'-P-C4' energy: -41.801 flat angles P-C4'-P energy: -31.619 tors. eta vs tors. theta energy: -53.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -585.481162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.481162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.481162 (E_RNA) where: Base-Base interactions energy: -428.464 where: short stacking energy: -166.779 Base-Backbone interact. energy: 1.264 local terms energy: -158.281609 where: bonds (distance) C4'-P energy: -20.078 bonds (distance) P-C4' energy: -35.275 flat angles C4'-P-C4' energy: -38.695 flat angles P-C4'-P energy: -27.344 tors. eta vs tors. theta energy: -36.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -616.989144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.989144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.989144 (E_RNA) where: Base-Base interactions energy: -455.146 where: short stacking energy: -181.180 Base-Backbone interact. energy: -1.268 local terms energy: -160.575604 where: bonds (distance) C4'-P energy: -28.092 bonds (distance) P-C4' energy: -27.404 flat angles C4'-P-C4' energy: -41.976 flat angles P-C4'-P energy: -21.738 tors. eta vs tors. theta energy: -41.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -576.407461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.407461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.407461 (E_RNA) where: Base-Base interactions energy: -409.319 where: short stacking energy: -186.495 Base-Backbone interact. energy: -1.259 local terms energy: -165.830143 where: bonds (distance) C4'-P energy: -34.708 bonds (distance) P-C4' energy: -22.641 flat angles C4'-P-C4' energy: -38.400 flat angles P-C4'-P energy: -26.566 tors. eta vs tors. theta energy: -43.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -515.635208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.635208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.635208 (E_RNA) where: Base-Base interactions energy: -376.023 where: short stacking energy: -152.135 Base-Backbone interact. energy: -0.419 local terms energy: -139.193115 where: bonds (distance) C4'-P energy: -23.311 bonds (distance) P-C4' energy: -28.996 flat angles C4'-P-C4' energy: -29.885 flat angles P-C4'-P energy: -16.522 tors. eta vs tors. theta energy: -40.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -520.716111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.716111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.716111 (E_RNA) where: Base-Base interactions energy: -343.569 where: short stacking energy: -159.059 Base-Backbone interact. energy: -0.278 local terms energy: -176.868946 where: bonds (distance) C4'-P energy: -35.641 bonds (distance) P-C4' energy: -37.791 flat angles C4'-P-C4' energy: -31.810 flat angles P-C4'-P energy: -28.565 tors. eta vs tors. theta energy: -43.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -306.984658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.984658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.984658 (E_RNA) where: Base-Base interactions energy: -203.498 where: short stacking energy: -92.464 Base-Backbone interact. energy: 0.212 local terms energy: -103.698401 where: bonds (distance) C4'-P energy: -28.434 bonds (distance) P-C4' energy: -29.740 flat angles C4'-P-C4' energy: -19.593 flat angles P-C4'-P energy: -17.773 tors. eta vs tors. theta energy: -8.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -699.966401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.966401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.966401 (E_RNA) where: Base-Base interactions energy: -500.704 where: short stacking energy: -212.826 Base-Backbone interact. energy: 0.787 local terms energy: -200.048696 where: bonds (distance) C4'-P energy: -35.850 bonds (distance) P-C4' energy: -36.040 flat angles C4'-P-C4' energy: -39.291 flat angles P-C4'-P energy: -34.495 tors. eta vs tors. theta energy: -54.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -666.278367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.278367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.278367 (E_RNA) where: Base-Base interactions energy: -475.233 where: short stacking energy: -197.549 Base-Backbone interact. energy: 0.568 local terms energy: -191.613780 where: bonds (distance) C4'-P energy: -34.715 bonds (distance) P-C4' energy: -41.923 flat angles C4'-P-C4' energy: -38.720 flat angles P-C4'-P energy: -25.677 tors. eta vs tors. theta energy: -50.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -656.609276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.609276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.609276 (E_RNA) where: Base-Base interactions energy: -450.731 where: short stacking energy: -199.456 Base-Backbone interact. energy: -0.899 local terms energy: -204.980205 where: bonds (distance) C4'-P energy: -38.577 bonds (distance) P-C4' energy: -38.946 flat angles C4'-P-C4' energy: -44.132 flat angles P-C4'-P energy: -31.700 tors. eta vs tors. theta energy: -51.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -644.659510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.659510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.659510 (E_RNA) where: Base-Base interactions energy: -458.533 where: short stacking energy: -213.724 Base-Backbone interact. energy: -0.580 local terms energy: -185.546774 where: bonds (distance) C4'-P energy: -28.580 bonds (distance) P-C4' energy: -38.139 flat angles C4'-P-C4' energy: -36.288 flat angles P-C4'-P energy: -27.734 tors. eta vs tors. theta energy: -54.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -631.699981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.699981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.699981 (E_RNA) where: Base-Base interactions energy: -464.924 where: short stacking energy: -179.827 Base-Backbone interact. energy: -0.723 local terms energy: -166.053173 where: bonds (distance) C4'-P energy: -29.490 bonds (distance) P-C4' energy: -34.544 flat angles C4'-P-C4' energy: -42.581 flat angles P-C4'-P energy: -20.613 tors. eta vs tors. theta energy: -38.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -593.073305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.073305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.073305 (E_RNA) where: Base-Base interactions energy: -437.568 where: short stacking energy: -184.578 Base-Backbone interact. energy: -0.763 local terms energy: -154.742258 where: bonds (distance) C4'-P energy: -33.961 bonds (distance) P-C4' energy: -25.176 flat angles C4'-P-C4' energy: -37.192 flat angles P-C4'-P energy: -19.142 tors. eta vs tors. theta energy: -39.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -551.589490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.589490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.589490 (E_RNA) where: Base-Base interactions energy: -396.390 where: short stacking energy: -161.885 Base-Backbone interact. energy: -0.951 local terms energy: -154.249025 where: bonds (distance) C4'-P energy: -26.677 bonds (distance) P-C4' energy: -29.087 flat angles C4'-P-C4' energy: -38.317 flat angles P-C4'-P energy: -22.393 tors. eta vs tors. theta energy: -37.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -521.172604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.172604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.172604 (E_RNA) where: Base-Base interactions energy: -368.599 where: short stacking energy: -152.229 Base-Backbone interact. energy: 1.298 local terms energy: -153.871689 where: bonds (distance) C4'-P energy: -35.140 bonds (distance) P-C4' energy: -33.321 flat angles C4'-P-C4' energy: -26.816 flat angles P-C4'-P energy: -19.493 tors. eta vs tors. theta energy: -39.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -493.742301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.742301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.742301 (E_RNA) where: Base-Base interactions energy: -336.004 where: short stacking energy: -149.780 Base-Backbone interact. energy: 0.446 local terms energy: -158.184198 where: bonds (distance) C4'-P energy: -31.249 bonds (distance) P-C4' energy: -31.234 flat angles C4'-P-C4' energy: -34.718 flat angles P-C4'-P energy: -20.958 tors. eta vs tors. theta energy: -40.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -381.105817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.105817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.105817 (E_RNA) where: Base-Base interactions energy: -252.248 where: short stacking energy: -127.042 Base-Backbone interact. energy: -0.265 local terms energy: -128.593197 where: bonds (distance) C4'-P energy: -21.765 bonds (distance) P-C4' energy: -35.443 flat angles C4'-P-C4' energy: -28.179 flat angles P-C4'-P energy: -20.451 tors. eta vs tors. theta energy: -22.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -700.748493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.748493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.748493 (E_RNA) where: Base-Base interactions energy: -498.252 where: short stacking energy: -223.305 Base-Backbone interact. energy: -0.066 local terms energy: -202.430110 where: bonds (distance) C4'-P energy: -31.574 bonds (distance) P-C4' energy: -44.143 flat angles C4'-P-C4' energy: -38.507 flat angles P-C4'-P energy: -26.882 tors. eta vs tors. theta energy: -61.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -679.663456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.663456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.663456 (E_RNA) where: Base-Base interactions energy: -479.055 where: short stacking energy: -215.067 Base-Backbone interact. energy: -0.197 local terms energy: -200.411254 where: bonds (distance) C4'-P energy: -33.548 bonds (distance) P-C4' energy: -38.128 flat angles C4'-P-C4' energy: -43.502 flat angles P-C4'-P energy: -25.302 tors. eta vs tors. theta energy: -59.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -636.452008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.452008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.452008 (E_RNA) where: Base-Base interactions energy: -458.249 where: short stacking energy: -181.228 Base-Backbone interact. energy: -0.264 local terms energy: -177.938817 where: bonds (distance) C4'-P energy: -32.390 bonds (distance) P-C4' energy: -34.661 flat angles C4'-P-C4' energy: -39.114 flat angles P-C4'-P energy: -29.744 tors. eta vs tors. theta energy: -42.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -642.545749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.545749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.545749 (E_RNA) where: Base-Base interactions energy: -461.649 where: short stacking energy: -191.698 Base-Backbone interact. energy: -0.552 local terms energy: -180.344737 where: bonds (distance) C4'-P energy: -31.748 bonds (distance) P-C4' energy: -36.399 flat angles C4'-P-C4' energy: -39.625 flat angles P-C4'-P energy: -24.239 tors. eta vs tors. theta energy: -48.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -626.718290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.718290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.718290 (E_RNA) where: Base-Base interactions energy: -442.356 where: short stacking energy: -195.023 Base-Backbone interact. energy: -1.742 local terms energy: -182.620173 where: bonds (distance) C4'-P energy: -40.593 bonds (distance) P-C4' energy: -37.249 flat angles C4'-P-C4' energy: -31.983 flat angles P-C4'-P energy: -22.850 tors. eta vs tors. theta energy: -49.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -585.129398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.129398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.129398 (E_RNA) where: Base-Base interactions energy: -427.508 where: short stacking energy: -166.041 Base-Backbone interact. energy: -0.339 local terms energy: -157.282934 where: bonds (distance) C4'-P energy: -35.904 bonds (distance) P-C4' energy: -31.252 flat angles C4'-P-C4' energy: -35.956 flat angles P-C4'-P energy: -14.778 tors. eta vs tors. theta energy: -39.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -541.586535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.586535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.586535 (E_RNA) where: Base-Base interactions energy: -376.300 where: short stacking energy: -166.658 Base-Backbone interact. energy: -0.318 local terms energy: -164.968416 where: bonds (distance) C4'-P energy: -30.952 bonds (distance) P-C4' energy: -38.595 flat angles C4'-P-C4' energy: -38.133 flat angles P-C4'-P energy: -13.667 tors. eta vs tors. theta energy: -43.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -518.822733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.822733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.822733 (E_RNA) where: Base-Base interactions energy: -363.506 where: short stacking energy: -150.883 Base-Backbone interact. energy: -0.303 local terms energy: -155.013942 where: bonds (distance) C4'-P energy: -21.897 bonds (distance) P-C4' energy: -28.447 flat angles C4'-P-C4' energy: -42.941 flat angles P-C4'-P energy: -27.072 tors. eta vs tors. theta energy: -34.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -521.007562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.007562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.007562 (E_RNA) where: Base-Base interactions energy: -373.757 where: short stacking energy: -146.016 Base-Backbone interact. energy: -0.707 local terms energy: -146.543272 where: bonds (distance) C4'-P energy: -26.843 bonds (distance) P-C4' energy: -29.267 flat angles C4'-P-C4' energy: -35.109 flat angles P-C4'-P energy: -17.543 tors. eta vs tors. theta energy: -37.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -400.823265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.823265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.823265 (E_RNA) where: Base-Base interactions energy: -273.755 where: short stacking energy: -123.783 Base-Backbone interact. energy: 0.137 local terms energy: -127.204903 where: bonds (distance) C4'-P energy: -30.306 bonds (distance) P-C4' energy: -33.573 flat angles C4'-P-C4' energy: -29.514 flat angles P-C4'-P energy: -17.812 tors. eta vs tors. theta energy: -16.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -696.945584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.945584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.945584 (E_RNA) where: Base-Base interactions energy: -496.261 where: short stacking energy: -203.605 Base-Backbone interact. energy: -0.107 local terms energy: -200.578414 where: bonds (distance) C4'-P energy: -39.056 bonds (distance) P-C4' energy: -34.037 flat angles C4'-P-C4' energy: -42.649 flat angles P-C4'-P energy: -27.872 tors. eta vs tors. theta energy: -56.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -672.392115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.392115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.392115 (E_RNA) where: Base-Base interactions energy: -470.555 where: short stacking energy: -207.816 Base-Backbone interact. energy: -0.347 local terms energy: -201.489569 where: bonds (distance) C4'-P energy: -36.456 bonds (distance) P-C4' energy: -36.686 flat angles C4'-P-C4' energy: -43.385 flat angles P-C4'-P energy: -31.140 tors. eta vs tors. theta energy: -53.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -629.665602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.665602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.665602 (E_RNA) where: Base-Base interactions energy: -453.149 where: short stacking energy: -189.111 Base-Backbone interact. energy: -0.220 local terms energy: -176.296752 where: bonds (distance) C4'-P energy: -36.671 bonds (distance) P-C4' energy: -26.428 flat angles C4'-P-C4' energy: -39.191 flat angles P-C4'-P energy: -26.004 tors. eta vs tors. theta energy: -48.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -653.008653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.008653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.008653 (E_RNA) where: Base-Base interactions energy: -478.942 where: short stacking energy: -187.354 Base-Backbone interact. energy: -0.649 local terms energy: -173.418389 where: bonds (distance) C4'-P energy: -30.695 bonds (distance) P-C4' energy: -37.143 flat angles C4'-P-C4' energy: -38.810 flat angles P-C4'-P energy: -25.215 tors. eta vs tors. theta energy: -41.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -598.568169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.568169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.568169 (E_RNA) where: Base-Base interactions energy: -430.377 where: short stacking energy: -179.697 Base-Backbone interact. energy: -0.042 local terms energy: -168.148930 where: bonds (distance) C4'-P energy: -27.433 bonds (distance) P-C4' energy: -32.012 flat angles C4'-P-C4' energy: -38.055 flat angles P-C4'-P energy: -21.870 tors. eta vs tors. theta energy: -48.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -579.498315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.498315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.498315 (E_RNA) where: Base-Base interactions energy: -415.037 where: short stacking energy: -161.539 Base-Backbone interact. energy: -1.476 local terms energy: -162.985260 where: bonds (distance) C4'-P energy: -30.742 bonds (distance) P-C4' energy: -28.706 flat angles C4'-P-C4' energy: -39.747 flat angles P-C4'-P energy: -23.319 tors. eta vs tors. theta energy: -40.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -565.846346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.846346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.846346 (E_RNA) where: Base-Base interactions energy: -405.457 where: short stacking energy: -168.649 Base-Backbone interact. energy: -0.144 local terms energy: -160.245271 where: bonds (distance) C4'-P energy: -34.642 bonds (distance) P-C4' energy: -29.972 flat angles C4'-P-C4' energy: -35.287 flat angles P-C4'-P energy: -20.991 tors. eta vs tors. theta energy: -39.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -527.115266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.115266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.115266 (E_RNA) where: Base-Base interactions energy: -375.533 where: short stacking energy: -162.864 Base-Backbone interact. energy: 0.856 local terms energy: -152.438508 where: bonds (distance) C4'-P energy: -32.804 bonds (distance) P-C4' energy: -29.000 flat angles C4'-P-C4' energy: -39.272 flat angles P-C4'-P energy: -19.454 tors. eta vs tors. theta energy: -31.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -507.700844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.700844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.700844 (E_RNA) where: Base-Base interactions energy: -373.979 where: short stacking energy: -164.407 Base-Backbone interact. energy: -1.234 local terms energy: -132.488007 where: bonds (distance) C4'-P energy: -25.547 bonds (distance) P-C4' energy: -35.677 flat angles C4'-P-C4' energy: -20.402 flat angles P-C4'-P energy: -14.810 tors. eta vs tors. theta energy: -36.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -390.523919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.523919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.523919 (E_RNA) where: Base-Base interactions energy: -268.290 where: short stacking energy: -129.986 Base-Backbone interact. energy: -0.940 local terms energy: -121.293857 where: bonds (distance) C4'-P energy: -25.029 bonds (distance) P-C4' energy: -31.351 flat angles C4'-P-C4' energy: -18.541 flat angles P-C4'-P energy: -20.450 tors. eta vs tors. theta energy: -25.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -694.894694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.894694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.894694 (E_RNA) where: Base-Base interactions energy: -497.188 where: short stacking energy: -223.629 Base-Backbone interact. energy: -0.011 local terms energy: -197.695656 where: bonds (distance) C4'-P energy: -34.374 bonds (distance) P-C4' energy: -32.071 flat angles C4'-P-C4' energy: -41.218 flat angles P-C4'-P energy: -31.720 tors. eta vs tors. theta energy: -58.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -670.216080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.216080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.216080 (E_RNA) where: Base-Base interactions energy: -472.846 where: short stacking energy: -211.007 Base-Backbone interact. energy: -0.685 local terms energy: -196.685264 where: bonds (distance) C4'-P energy: -36.912 bonds (distance) P-C4' energy: -42.745 flat angles C4'-P-C4' energy: -41.028 flat angles P-C4'-P energy: -23.778 tors. eta vs tors. theta energy: -52.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -618.889513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.889513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.889513 (E_RNA) where: Base-Base interactions energy: -442.872 where: short stacking energy: -186.495 Base-Backbone interact. energy: 0.247 local terms energy: -176.264780 where: bonds (distance) C4'-P energy: -36.847 bonds (distance) P-C4' energy: -31.767 flat angles C4'-P-C4' energy: -39.775 flat angles P-C4'-P energy: -22.137 tors. eta vs tors. theta energy: -45.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -621.001573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.001573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.001573 (E_RNA) where: Base-Base interactions energy: -424.457 where: short stacking energy: -187.469 Base-Backbone interact. energy: -0.335 local terms energy: -196.210053 where: bonds (distance) C4'-P energy: -37.083 bonds (distance) P-C4' energy: -38.803 flat angles C4'-P-C4' energy: -39.328 flat angles P-C4'-P energy: -31.953 tors. eta vs tors. theta energy: -49.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -642.313566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.313566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.313566 (E_RNA) where: Base-Base interactions energy: -475.129 where: short stacking energy: -182.680 Base-Backbone interact. energy: -0.300 local terms energy: -166.885330 where: bonds (distance) C4'-P energy: -41.125 bonds (distance) P-C4' energy: -29.549 flat angles C4'-P-C4' energy: -34.657 flat angles P-C4'-P energy: -19.786 tors. eta vs tors. theta energy: -41.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -578.945949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.945949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.945949 (E_RNA) where: Base-Base interactions energy: -412.460 where: short stacking energy: -162.611 Base-Backbone interact. energy: -0.046 local terms energy: -166.440361 where: bonds (distance) C4'-P energy: -35.866 bonds (distance) P-C4' energy: -30.332 flat angles C4'-P-C4' energy: -36.710 flat angles P-C4'-P energy: -21.219 tors. eta vs tors. theta energy: -42.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -553.574071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.574071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.574071 (E_RNA) where: Base-Base interactions energy: -389.038 where: short stacking energy: -161.109 Base-Backbone interact. energy: -0.431 local terms energy: -164.104739 where: bonds (distance) C4'-P energy: -28.521 bonds (distance) P-C4' energy: -30.677 flat angles C4'-P-C4' energy: -43.047 flat angles P-C4'-P energy: -19.728 tors. eta vs tors. theta energy: -42.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -547.330955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.330955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -547.330955 (E_RNA) where: Base-Base interactions energy: -378.605 where: short stacking energy: -159.698 Base-Backbone interact. energy: -2.157 local terms energy: -166.568973 where: bonds (distance) C4'-P energy: -27.551 bonds (distance) P-C4' energy: -41.766 flat angles C4'-P-C4' energy: -37.163 flat angles P-C4'-P energy: -24.525 tors. eta vs tors. theta energy: -35.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -516.702091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.702091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.702091 (E_RNA) where: Base-Base interactions energy: -348.075 where: short stacking energy: -153.695 Base-Backbone interact. energy: -0.290 local terms energy: -168.337591 where: bonds (distance) C4'-P energy: -32.090 bonds (distance) P-C4' energy: -34.255 flat angles C4'-P-C4' energy: -31.876 flat angles P-C4'-P energy: -24.145 tors. eta vs tors. theta energy: -45.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -385.295624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.295624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.295624 (E_RNA) where: Base-Base interactions energy: -267.846 where: short stacking energy: -107.743 Base-Backbone interact. energy: -0.534 local terms energy: -116.914932 where: bonds (distance) C4'-P energy: -26.340 bonds (distance) P-C4' energy: -33.925 flat angles C4'-P-C4' energy: -24.683 flat angles P-C4'-P energy: -18.421 tors. eta vs tors. theta energy: -13.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -699.521918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.521918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.521918 (E_RNA) where: Base-Base interactions energy: -490.543 where: short stacking energy: -214.796 Base-Backbone interact. energy: -0.213 local terms energy: -208.765779 where: bonds (distance) C4'-P energy: -36.818 bonds (distance) P-C4' energy: -41.343 flat angles C4'-P-C4' energy: -44.321 flat angles P-C4'-P energy: -25.377 tors. eta vs tors. theta energy: -60.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -673.318462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.318462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.318462 (E_RNA) where: Base-Base interactions energy: -471.037 where: short stacking energy: -207.914 Base-Backbone interact. energy: -0.313 local terms energy: -201.968599 where: bonds (distance) C4'-P energy: -37.645 bonds (distance) P-C4' energy: -37.791 flat angles C4'-P-C4' energy: -44.040 flat angles P-C4'-P energy: -27.162 tors. eta vs tors. theta energy: -55.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -633.914677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.914677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.914677 (E_RNA) where: Base-Base interactions energy: -447.639 where: short stacking energy: -204.955 Base-Backbone interact. energy: -1.030 local terms energy: -185.245482 where: bonds (distance) C4'-P energy: -35.961 bonds (distance) P-C4' energy: -31.977 flat angles C4'-P-C4' energy: -33.228 flat angles P-C4'-P energy: -28.413 tors. eta vs tors. theta energy: -55.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -620.112982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.112982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.112982 (E_RNA) where: Base-Base interactions energy: -445.461 where: short stacking energy: -176.128 Base-Backbone interact. energy: -0.885 local terms energy: -173.766755 where: bonds (distance) C4'-P energy: -39.857 bonds (distance) P-C4' energy: -36.191 flat angles C4'-P-C4' energy: -37.397 flat angles P-C4'-P energy: -20.095 tors. eta vs tors. theta energy: -40.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -594.387446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.387446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.387446 (E_RNA) where: Base-Base interactions energy: -428.297 where: short stacking energy: -165.696 Base-Backbone interact. energy: 1.045 local terms energy: -167.136020 where: bonds (distance) C4'-P energy: -34.965 bonds (distance) P-C4' energy: -35.577 flat angles C4'-P-C4' energy: -34.272 flat angles P-C4'-P energy: -21.882 tors. eta vs tors. theta energy: -40.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -623.011961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.011961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.011961 (E_RNA) where: Base-Base interactions energy: -474.450 where: short stacking energy: -191.173 Base-Backbone interact. energy: 1.370 local terms energy: -149.932341 where: bonds (distance) C4'-P energy: -23.783 bonds (distance) P-C4' energy: -28.810 flat angles C4'-P-C4' energy: -29.658 flat angles P-C4'-P energy: -27.379 tors. eta vs tors. theta energy: -40.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -550.105997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.105997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.105997 (E_RNA) where: Base-Base interactions energy: -407.787 where: short stacking energy: -166.741 Base-Backbone interact. energy: -0.987 local terms energy: -141.332347 where: bonds (distance) C4'-P energy: -28.266 bonds (distance) P-C4' energy: -23.595 flat angles C4'-P-C4' energy: -38.249 flat angles P-C4'-P energy: -12.027 tors. eta vs tors. theta energy: -39.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -548.584865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.584865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.584865 (E_RNA) where: Base-Base interactions energy: -400.345 where: short stacking energy: -159.991 Base-Backbone interact. energy: -0.759 local terms energy: -147.480889 where: bonds (distance) C4'-P energy: -29.959 bonds (distance) P-C4' energy: -26.391 flat angles C4'-P-C4' energy: -35.152 flat angles P-C4'-P energy: -25.304 tors. eta vs tors. theta energy: -30.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -428.440197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.440197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.440197 (E_RNA) where: Base-Base interactions energy: -300.139 where: short stacking energy: -128.850 Base-Backbone interact. energy: 1.803 local terms energy: -130.104134 where: bonds (distance) C4'-P energy: -29.781 bonds (distance) P-C4' energy: -21.694 flat angles C4'-P-C4' energy: -39.056 flat angles P-C4'-P energy: -14.012 tors. eta vs tors. theta energy: -25.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -470.917132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.917132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.917132 (E_RNA) where: Base-Base interactions energy: -335.000 where: short stacking energy: -126.317 Base-Backbone interact. energy: -1.477 local terms energy: -134.440932 where: bonds (distance) C4'-P energy: -26.226 bonds (distance) P-C4' energy: -28.719 flat angles C4'-P-C4' energy: -35.308 flat angles P-C4'-P energy: -18.769 tors. eta vs tors. theta energy: -25.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -694.273787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.273787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.273787 (E_RNA) where: Base-Base interactions energy: -495.508 where: short stacking energy: -210.434 Base-Backbone interact. energy: -0.567 local terms energy: -198.199406 where: bonds (distance) C4'-P energy: -39.916 bonds (distance) P-C4' energy: -41.495 flat angles C4'-P-C4' energy: -40.743 flat angles P-C4'-P energy: -22.365 tors. eta vs tors. theta energy: -53.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -678.388688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.388688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.388688 (E_RNA) where: Base-Base interactions energy: -477.012 where: short stacking energy: -202.885 Base-Backbone interact. energy: -0.160 local terms energy: -201.216167 where: bonds (distance) C4'-P energy: -44.357 bonds (distance) P-C4' energy: -34.026 flat angles C4'-P-C4' energy: -41.572 flat angles P-C4'-P energy: -26.241 tors. eta vs tors. theta energy: -55.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -642.366538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.366538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.366538 (E_RNA) where: Base-Base interactions energy: -461.609 where: short stacking energy: -202.329 Base-Backbone interact. energy: -0.058 local terms energy: -180.699489 where: bonds (distance) C4'-P energy: -33.353 bonds (distance) P-C4' energy: -33.892 flat angles C4'-P-C4' energy: -38.667 flat angles P-C4'-P energy: -24.346 tors. eta vs tors. theta energy: -50.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -596.040586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.040586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.040586 (E_RNA) where: Base-Base interactions energy: -433.519 where: short stacking energy: -167.224 Base-Backbone interact. energy: -0.294 local terms energy: -162.227435 where: bonds (distance) C4'-P energy: -31.444 bonds (distance) P-C4' energy: -37.741 flat angles C4'-P-C4' energy: -30.164 flat angles P-C4'-P energy: -25.111 tors. eta vs tors. theta energy: -37.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -597.126592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.126592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.126592 (E_RNA) where: Base-Base interactions energy: -427.563 where: short stacking energy: -156.060 Base-Backbone interact. energy: -0.012 local terms energy: -169.551432 where: bonds (distance) C4'-P energy: -34.440 bonds (distance) P-C4' energy: -35.585 flat angles C4'-P-C4' energy: -41.257 flat angles P-C4'-P energy: -17.189 tors. eta vs tors. theta energy: -41.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -600.344933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.344933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.344933 (E_RNA) where: Base-Base interactions energy: -448.925 where: short stacking energy: -170.009 Base-Backbone interact. energy: -0.908 local terms energy: -150.510988 where: bonds (distance) C4'-P energy: -30.363 bonds (distance) P-C4' energy: -36.731 flat angles C4'-P-C4' energy: -27.773 flat angles P-C4'-P energy: -22.787 tors. eta vs tors. theta energy: -32.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -557.878557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.878557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.878557 (E_RNA) where: Base-Base interactions energy: -408.246 where: short stacking energy: -167.716 Base-Backbone interact. energy: 1.855 local terms energy: -151.487910 where: bonds (distance) C4'-P energy: -25.885 bonds (distance) P-C4' energy: -32.687 flat angles C4'-P-C4' energy: -42.135 flat angles P-C4'-P energy: -13.369 tors. eta vs tors. theta energy: -37.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -537.368241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.368241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.368241 (E_RNA) where: Base-Base interactions energy: -382.933 where: short stacking energy: -156.058 Base-Backbone interact. energy: -0.851 local terms energy: -153.583819 where: bonds (distance) C4'-P energy: -33.517 bonds (distance) P-C4' energy: -25.127 flat angles C4'-P-C4' energy: -38.455 flat angles P-C4'-P energy: -22.874 tors. eta vs tors. theta energy: -33.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -420.505188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.505188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.505188 (E_RNA) where: Base-Base interactions energy: -268.880 where: short stacking energy: -120.519 Base-Backbone interact. energy: 0.026 local terms energy: -151.651403 where: bonds (distance) C4'-P energy: -28.551 bonds (distance) P-C4' energy: -37.551 flat angles C4'-P-C4' energy: -36.524 flat angles P-C4'-P energy: -24.145 tors. eta vs tors. theta energy: -24.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -474.013224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.013224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.013224 (E_RNA) where: Base-Base interactions energy: -336.400 where: short stacking energy: -139.816 Base-Backbone interact. energy: -1.049 local terms energy: -136.563666 where: bonds (distance) C4'-P energy: -30.525 bonds (distance) P-C4' energy: -24.565 flat angles C4'-P-C4' energy: -32.415 flat angles P-C4'-P energy: -14.308 tors. eta vs tors. theta energy: -34.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -701.027031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.027031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.027031 (E_RNA) where: Base-Base interactions energy: -496.766 where: short stacking energy: -220.410 Base-Backbone interact. energy: -0.406 local terms energy: -203.855357 where: bonds (distance) C4'-P energy: -40.976 bonds (distance) P-C4' energy: -36.795 flat angles C4'-P-C4' energy: -44.676 flat angles P-C4'-P energy: -25.412 tors. eta vs tors. theta energy: -55.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -664.777344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.777344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.777344 (E_RNA) where: Base-Base interactions energy: -471.840 where: short stacking energy: -199.018 Base-Backbone interact. energy: -0.539 local terms energy: -192.397918 where: bonds (distance) C4'-P energy: -38.466 bonds (distance) P-C4' energy: -37.643 flat angles C4'-P-C4' energy: -35.927 flat angles P-C4'-P energy: -28.772 tors. eta vs tors. theta energy: -51.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -638.435505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.435505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.435505 (E_RNA) where: Base-Base interactions energy: -454.776 where: short stacking energy: -195.326 Base-Backbone interact. energy: -0.740 local terms energy: -182.919074 where: bonds (distance) C4'-P energy: -39.709 bonds (distance) P-C4' energy: -29.193 flat angles C4'-P-C4' energy: -36.650 flat angles P-C4'-P energy: -26.317 tors. eta vs tors. theta energy: -51.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -589.496670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.496670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.496670 (E_RNA) where: Base-Base interactions energy: -413.490 where: short stacking energy: -159.249 Base-Backbone interact. energy: 0.436 local terms energy: -176.443038 where: bonds (distance) C4'-P energy: -37.270 bonds (distance) P-C4' energy: -38.499 flat angles C4'-P-C4' energy: -41.815 flat angles P-C4'-P energy: -24.585 tors. eta vs tors. theta energy: -34.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -629.544364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.544364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.544364 (E_RNA) where: Base-Base interactions energy: -464.597 where: short stacking energy: -176.434 Base-Backbone interact. energy: 2.727 local terms energy: -167.674724 where: bonds (distance) C4'-P energy: -34.427 bonds (distance) P-C4' energy: -28.394 flat angles C4'-P-C4' energy: -40.578 flat angles P-C4'-P energy: -18.615 tors. eta vs tors. theta energy: -45.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -581.307372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.307372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.307372 (E_RNA) where: Base-Base interactions energy: -418.359 where: short stacking energy: -163.777 Base-Backbone interact. energy: 1.625 local terms energy: -164.572643 where: bonds (distance) C4'-P energy: -28.015 bonds (distance) P-C4' energy: -34.375 flat angles C4'-P-C4' energy: -36.588 flat angles P-C4'-P energy: -24.337 tors. eta vs tors. theta energy: -41.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -541.470989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.470989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.470989 (E_RNA) where: Base-Base interactions energy: -367.208 where: short stacking energy: -150.621 Base-Backbone interact. energy: -0.659 local terms energy: -173.604106 where: bonds (distance) C4'-P energy: -36.844 bonds (distance) P-C4' energy: -39.945 flat angles C4'-P-C4' energy: -40.015 flat angles P-C4'-P energy: -19.805 tors. eta vs tors. theta energy: -36.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -523.016465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.016465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.016465 (E_RNA) where: Base-Base interactions energy: -370.685 where: short stacking energy: -160.143 Base-Backbone interact. energy: -0.492 local terms energy: -151.839820 where: bonds (distance) C4'-P energy: -30.279 bonds (distance) P-C4' energy: -26.461 flat angles C4'-P-C4' energy: -34.557 flat angles P-C4'-P energy: -17.651 tors. eta vs tors. theta energy: -42.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -483.404564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.404564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.404564 (E_RNA) where: Base-Base interactions energy: -336.388 where: short stacking energy: -148.682 Base-Backbone interact. energy: 0.042 local terms energy: -147.058014 where: bonds (distance) C4'-P energy: -24.573 bonds (distance) P-C4' energy: -36.880 flat angles C4'-P-C4' energy: -33.603 flat angles P-C4'-P energy: -21.486 tors. eta vs tors. theta energy: -30.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -416.879597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.879597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.879597 (E_RNA) where: Base-Base interactions energy: -294.510 where: short stacking energy: -117.439 Base-Backbone interact. energy: 0.943 local terms energy: -123.312219 where: bonds (distance) C4'-P energy: -28.047 bonds (distance) P-C4' energy: -27.250 flat angles C4'-P-C4' energy: -35.727 flat angles P-C4'-P energy: -19.528 tors. eta vs tors. theta energy: -12.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -696.953152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.953152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.953152 (E_RNA) where: Base-Base interactions energy: -485.991 where: short stacking energy: -218.062 Base-Backbone interact. energy: -0.727 local terms energy: -210.234772 where: bonds (distance) C4'-P energy: -39.847 bonds (distance) P-C4' energy: -40.259 flat angles C4'-P-C4' energy: -39.619 flat angles P-C4'-P energy: -28.688 tors. eta vs tors. theta energy: -61.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -657.188439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.188439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.188439 (E_RNA) where: Base-Base interactions energy: -455.599 where: short stacking energy: -195.265 Base-Backbone interact. energy: -0.175 local terms energy: -201.414646 where: bonds (distance) C4'-P energy: -38.437 bonds (distance) P-C4' energy: -38.628 flat angles C4'-P-C4' energy: -37.998 flat angles P-C4'-P energy: -32.714 tors. eta vs tors. theta energy: -53.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -684.562123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.562123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.562123 (E_RNA) where: Base-Base interactions energy: -480.167 where: short stacking energy: -219.846 Base-Backbone interact. energy: -0.150 local terms energy: -204.245751 where: bonds (distance) C4'-P energy: -38.467 bonds (distance) P-C4' energy: -38.572 flat angles C4'-P-C4' energy: -38.634 flat angles P-C4'-P energy: -29.530 tors. eta vs tors. theta energy: -59.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -643.663856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.663856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.663856 (E_RNA) where: Base-Base interactions energy: -463.089 where: short stacking energy: -179.173 Base-Backbone interact. energy: -1.393 local terms energy: -179.181264 where: bonds (distance) C4'-P energy: -31.866 bonds (distance) P-C4' energy: -37.682 flat angles C4'-P-C4' energy: -38.920 flat angles P-C4'-P energy: -23.882 tors. eta vs tors. theta energy: -46.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -591.090022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.090022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.090022 (E_RNA) where: Base-Base interactions energy: -424.725 where: short stacking energy: -177.051 Base-Backbone interact. energy: -1.010 local terms energy: -165.355248 where: bonds (distance) C4'-P energy: -38.197 bonds (distance) P-C4' energy: -36.163 flat angles C4'-P-C4' energy: -39.913 flat angles P-C4'-P energy: -17.424 tors. eta vs tors. theta energy: -33.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -534.910405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.910405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.910405 (E_RNA) where: Base-Base interactions energy: -368.605 where: short stacking energy: -152.445 Base-Backbone interact. energy: 0.104 local terms energy: -166.408640 where: bonds (distance) C4'-P energy: -27.763 bonds (distance) P-C4' energy: -40.334 flat angles C4'-P-C4' energy: -39.706 flat angles P-C4'-P energy: -29.392 tors. eta vs tors. theta energy: -29.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -571.658339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.658339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.658339 (E_RNA) where: Base-Base interactions energy: -415.572 where: short stacking energy: -162.391 Base-Backbone interact. energy: -0.735 local terms energy: -155.351319 where: bonds (distance) C4'-P energy: -26.217 bonds (distance) P-C4' energy: -27.580 flat angles C4'-P-C4' energy: -38.558 flat angles P-C4'-P energy: -22.996 tors. eta vs tors. theta energy: -40.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -507.845923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.845923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.845923 (E_RNA) where: Base-Base interactions energy: -356.954 where: short stacking energy: -156.310 Base-Backbone interact. energy: 0.424 local terms energy: -151.315549 where: bonds (distance) C4'-P energy: -27.883 bonds (distance) P-C4' energy: -33.342 flat angles C4'-P-C4' energy: -38.448 flat angles P-C4'-P energy: -19.840 tors. eta vs tors. theta energy: -31.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -500.328321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.328321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.328321 (E_RNA) where: Base-Base interactions energy: -358.761 where: short stacking energy: -156.998 Base-Backbone interact. energy: 0.118 local terms energy: -141.685406 where: bonds (distance) C4'-P energy: -20.555 bonds (distance) P-C4' energy: -35.666 flat angles C4'-P-C4' energy: -29.724 flat angles P-C4'-P energy: -19.311 tors. eta vs tors. theta energy: -36.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -489.478709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.478709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.478709 (E_RNA) where: Base-Base interactions energy: -337.869 where: short stacking energy: -141.826 Base-Backbone interact. energy: 0.463 local terms energy: -152.072711 where: bonds (distance) C4'-P energy: -33.516 bonds (distance) P-C4' energy: -32.780 flat angles C4'-P-C4' energy: -36.974 flat angles P-C4'-P energy: -19.030 tors. eta vs tors. theta energy: -29.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -676.128955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.128955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.128955 (E_RNA) where: Base-Base interactions energy: -472.146 where: short stacking energy: -203.388 Base-Backbone interact. energy: -0.571 local terms energy: -203.411658 where: bonds (distance) C4'-P energy: -43.916 bonds (distance) P-C4' energy: -35.806 flat angles C4'-P-C4' energy: -37.805 flat angles P-C4'-P energy: -32.291 tors. eta vs tors. theta energy: -53.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -700.720925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.720925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.720925 (E_RNA) where: Base-Base interactions energy: -491.322 where: short stacking energy: -216.246 Base-Backbone interact. energy: -0.015 local terms energy: -209.384285 where: bonds (distance) C4'-P energy: -38.359 bonds (distance) P-C4' energy: -37.198 flat angles C4'-P-C4' energy: -40.046 flat angles P-C4'-P energy: -32.006 tors. eta vs tors. theta energy: -61.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -662.611597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.611597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.611597 (E_RNA) where: Base-Base interactions energy: -460.485 where: short stacking energy: -205.834 Base-Backbone interact. energy: -0.516 local terms energy: -201.610712 where: bonds (distance) C4'-P energy: -41.278 bonds (distance) P-C4' energy: -42.026 flat angles C4'-P-C4' energy: -37.186 flat angles P-C4'-P energy: -27.062 tors. eta vs tors. theta energy: -54.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -646.473711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.473711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.473711 (E_RNA) where: Base-Base interactions energy: -475.792 where: short stacking energy: -195.827 Base-Backbone interact. energy: -0.372 local terms energy: -170.309265 where: bonds (distance) C4'-P energy: -26.271 bonds (distance) P-C4' energy: -36.314 flat angles C4'-P-C4' energy: -44.860 flat angles P-C4'-P energy: -17.451 tors. eta vs tors. theta energy: -45.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -575.684613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.684613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.684613 (E_RNA) where: Base-Base interactions energy: -420.770 where: short stacking energy: -162.255 Base-Backbone interact. energy: 0.235 local terms energy: -155.149190 where: bonds (distance) C4'-P energy: -36.029 bonds (distance) P-C4' energy: -36.148 flat angles C4'-P-C4' energy: -33.460 flat angles P-C4'-P energy: -14.407 tors. eta vs tors. theta energy: -35.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -571.537353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.537353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.537353 (E_RNA) where: Base-Base interactions energy: -399.636 where: short stacking energy: -143.167 Base-Backbone interact. energy: 2.819 local terms energy: -174.721041 where: bonds (distance) C4'-P energy: -33.144 bonds (distance) P-C4' energy: -44.360 flat angles C4'-P-C4' energy: -38.955 flat angles P-C4'-P energy: -25.421 tors. eta vs tors. theta energy: -32.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -579.755908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.755908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.755908 (E_RNA) where: Base-Base interactions energy: -407.938 where: short stacking energy: -161.730 Base-Backbone interact. energy: -3.605 local terms energy: -168.212746 where: bonds (distance) C4'-P energy: -25.129 bonds (distance) P-C4' energy: -36.207 flat angles C4'-P-C4' energy: -41.484 flat angles P-C4'-P energy: -27.312 tors. eta vs tors. theta energy: -38.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -517.487731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.487731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.487731 (E_RNA) where: Base-Base interactions energy: -357.017 where: short stacking energy: -159.104 Base-Backbone interact. energy: -0.603 local terms energy: -159.867268 where: bonds (distance) C4'-P energy: -37.904 bonds (distance) P-C4' energy: -23.031 flat angles C4'-P-C4' energy: -36.755 flat angles P-C4'-P energy: -26.919 tors. eta vs tors. theta energy: -35.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -494.005742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.005742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.005742 (E_RNA) where: Base-Base interactions energy: -354.320 where: short stacking energy: -147.189 Base-Backbone interact. energy: -0.715 local terms energy: -138.970755 where: bonds (distance) C4'-P energy: -27.999 bonds (distance) P-C4' energy: -30.458 flat angles C4'-P-C4' energy: -28.877 flat angles P-C4'-P energy: -24.221 tors. eta vs tors. theta energy: -27.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -508.956584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.956584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.956584 (E_RNA) where: Base-Base interactions energy: -354.534 where: short stacking energy: -156.433 Base-Backbone interact. energy: -0.666 local terms energy: -153.756675 where: bonds (distance) C4'-P energy: -30.626 bonds (distance) P-C4' energy: -29.576 flat angles C4'-P-C4' energy: -33.431 flat angles P-C4'-P energy: -18.041 tors. eta vs tors. theta energy: -42.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -678.900386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.900386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.900386 (E_RNA) where: Base-Base interactions energy: -486.358 where: short stacking energy: -210.695 Base-Backbone interact. energy: 0.277 local terms energy: -192.819604 where: bonds (distance) C4'-P energy: -36.812 bonds (distance) P-C4' energy: -36.229 flat angles C4'-P-C4' energy: -41.741 flat angles P-C4'-P energy: -28.732 tors. eta vs tors. theta energy: -49.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -676.905638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.905638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.905638 (E_RNA) where: Base-Base interactions energy: -485.427 where: short stacking energy: -213.932 Base-Backbone interact. energy: -1.080 local terms energy: -190.398753 where: bonds (distance) C4'-P energy: -32.221 bonds (distance) P-C4' energy: -38.491 flat angles C4'-P-C4' energy: -38.999 flat angles P-C4'-P energy: -23.721 tors. eta vs tors. theta energy: -56.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -671.600593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.600593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.600593 (E_RNA) where: Base-Base interactions energy: -468.914 where: short stacking energy: -194.790 Base-Backbone interact. energy: -0.291 local terms energy: -202.395650 where: bonds (distance) C4'-P energy: -40.020 bonds (distance) P-C4' energy: -40.997 flat angles C4'-P-C4' energy: -39.424 flat angles P-C4'-P energy: -26.191 tors. eta vs tors. theta energy: -55.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -637.671920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.671920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.671920 (E_RNA) where: Base-Base interactions energy: -453.841 where: short stacking energy: -179.192 Base-Backbone interact. energy: -1.417 local terms energy: -182.413433 where: bonds (distance) C4'-P energy: -31.672 bonds (distance) P-C4' energy: -37.596 flat angles C4'-P-C4' energy: -41.696 flat angles P-C4'-P energy: -26.459 tors. eta vs tors. theta energy: -44.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -584.127539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.127539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.127539 (E_RNA) where: Base-Base interactions energy: -412.658 where: short stacking energy: -164.367 Base-Backbone interact. energy: -1.930 local terms energy: -169.539757 where: bonds (distance) C4'-P energy: -36.550 bonds (distance) P-C4' energy: -31.446 flat angles C4'-P-C4' energy: -39.949 flat angles P-C4'-P energy: -26.138 tors. eta vs tors. theta energy: -35.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -572.537938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.537938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.537938 (E_RNA) where: Base-Base interactions energy: -400.899 where: short stacking energy: -158.715 Base-Backbone interact. energy: -0.452 local terms energy: -171.187227 where: bonds (distance) C4'-P energy: -24.718 bonds (distance) P-C4' energy: -35.754 flat angles C4'-P-C4' energy: -42.121 flat angles P-C4'-P energy: -26.626 tors. eta vs tors. theta energy: -41.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -559.186904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.186904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.186904 (E_RNA) where: Base-Base interactions energy: -390.584 where: short stacking energy: -142.776 Base-Backbone interact. energy: 1.369 local terms energy: -169.971508 where: bonds (distance) C4'-P energy: -30.722 bonds (distance) P-C4' energy: -37.554 flat angles C4'-P-C4' energy: -40.645 flat angles P-C4'-P energy: -23.444 tors. eta vs tors. theta energy: -37.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -534.603058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.603058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.603058 (E_RNA) where: Base-Base interactions energy: -372.794 where: short stacking energy: -171.257 Base-Backbone interact. energy: -0.598 local terms energy: -161.211211 where: bonds (distance) C4'-P energy: -32.211 bonds (distance) P-C4' energy: -36.011 flat angles C4'-P-C4' energy: -30.783 flat angles P-C4'-P energy: -20.698 tors. eta vs tors. theta energy: -41.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -511.188203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.188203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.188203 (E_RNA) where: Base-Base interactions energy: -358.545 where: short stacking energy: -144.300 Base-Backbone interact. energy: -1.285 local terms energy: -151.358018 where: bonds (distance) C4'-P energy: -33.051 bonds (distance) P-C4' energy: -34.751 flat angles C4'-P-C4' energy: -35.043 flat angles P-C4'-P energy: -21.510 tors. eta vs tors. theta energy: -27.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -427.942710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.942710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.942710 (E_RNA) where: Base-Base interactions energy: -289.940 where: short stacking energy: -120.889 Base-Backbone interact. energy: 1.685 local terms energy: -139.686757 where: bonds (distance) C4'-P energy: -33.401 bonds (distance) P-C4' energy: -30.722 flat angles C4'-P-C4' energy: -40.382 flat angles P-C4'-P energy: -21.150 tors. eta vs tors. theta energy: -14.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -706.141821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.141821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.141821 (E_RNA) where: Base-Base interactions energy: -501.203 where: short stacking energy: -211.680 Base-Backbone interact. energy: 0.373 local terms energy: -205.311783 where: bonds (distance) C4'-P energy: -38.496 bonds (distance) P-C4' energy: -39.118 flat angles C4'-P-C4' energy: -43.663 flat angles P-C4'-P energy: -29.393 tors. eta vs tors. theta energy: -54.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -678.455835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.455835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.455835 (E_RNA) where: Base-Base interactions energy: -489.421 where: short stacking energy: -224.013 Base-Backbone interact. energy: -0.083 local terms energy: -188.952130 where: bonds (distance) C4'-P energy: -32.004 bonds (distance) P-C4' energy: -35.698 flat angles C4'-P-C4' energy: -40.763 flat angles P-C4'-P energy: -24.356 tors. eta vs tors. theta energy: -56.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -669.084167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.084167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.084167 (E_RNA) where: Base-Base interactions energy: -487.376 where: short stacking energy: -213.219 Base-Backbone interact. energy: 0.852 local terms energy: -182.559863 where: bonds (distance) C4'-P energy: -36.147 bonds (distance) P-C4' energy: -32.187 flat angles C4'-P-C4' energy: -41.002 flat angles P-C4'-P energy: -17.307 tors. eta vs tors. theta energy: -55.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -643.894932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.894932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.894932 (E_RNA) where: Base-Base interactions energy: -452.846 where: short stacking energy: -180.675 Base-Backbone interact. energy: -0.143 local terms energy: -190.905991 where: bonds (distance) C4'-P energy: -39.141 bonds (distance) P-C4' energy: -36.808 flat angles C4'-P-C4' energy: -42.035 flat angles P-C4'-P energy: -26.990 tors. eta vs tors. theta energy: -45.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -598.511686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.511686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.511686 (E_RNA) where: Base-Base interactions energy: -431.056 where: short stacking energy: -177.515 Base-Backbone interact. energy: -0.343 local terms energy: -167.113027 where: bonds (distance) C4'-P energy: -36.596 bonds (distance) P-C4' energy: -36.836 flat angles C4'-P-C4' energy: -34.022 flat angles P-C4'-P energy: -22.037 tors. eta vs tors. theta energy: -37.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -574.114134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.114134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.114134 (E_RNA) where: Base-Base interactions energy: -422.455 where: short stacking energy: -184.965 Base-Backbone interact. energy: -0.052 local terms energy: -151.606934 where: bonds (distance) C4'-P energy: -32.894 bonds (distance) P-C4' energy: -29.274 flat angles C4'-P-C4' energy: -32.509 flat angles P-C4'-P energy: -16.506 tors. eta vs tors. theta energy: -40.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -576.019378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.019378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.019378 (E_RNA) where: Base-Base interactions energy: -422.047 where: short stacking energy: -163.192 Base-Backbone interact. energy: 1.757 local terms energy: -155.729519 where: bonds (distance) C4'-P energy: -38.830 bonds (distance) P-C4' energy: -25.156 flat angles C4'-P-C4' energy: -28.926 flat angles P-C4'-P energy: -20.792 tors. eta vs tors. theta energy: -42.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -523.822978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.822978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.822978 (E_RNA) where: Base-Base interactions energy: -376.134 where: short stacking energy: -156.365 Base-Backbone interact. energy: -0.218 local terms energy: -147.470033 where: bonds (distance) C4'-P energy: -19.385 bonds (distance) P-C4' energy: -25.992 flat angles C4'-P-C4' energy: -32.587 flat angles P-C4'-P energy: -31.354 tors. eta vs tors. theta energy: -38.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -457.332486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.332486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.332486 (E_RNA) where: Base-Base interactions energy: -314.331 where: short stacking energy: -146.567 Base-Backbone interact. energy: 1.398 local terms energy: -144.399239 where: bonds (distance) C4'-P energy: -25.995 bonds (distance) P-C4' energy: -27.797 flat angles C4'-P-C4' energy: -32.364 flat angles P-C4'-P energy: -22.599 tors. eta vs tors. theta energy: -35.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -476.664630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.664630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.664630 (E_RNA) where: Base-Base interactions energy: -327.015 where: short stacking energy: -135.592 Base-Backbone interact. energy: -0.592 local terms energy: -149.057647 where: bonds (distance) C4'-P energy: -36.633 bonds (distance) P-C4' energy: -25.754 flat angles C4'-P-C4' energy: -36.684 flat angles P-C4'-P energy: -18.306 tors. eta vs tors. theta energy: -31.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -690.224378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.224378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.224378 (E_RNA) where: Base-Base interactions energy: -501.374 where: short stacking energy: -197.924 Base-Backbone interact. energy: -0.461 local terms energy: -188.388923 where: bonds (distance) C4'-P energy: -32.258 bonds (distance) P-C4' energy: -35.072 flat angles C4'-P-C4' energy: -44.537 flat angles P-C4'-P energy: -25.258 tors. eta vs tors. theta energy: -51.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -680.159587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.159587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.159587 (E_RNA) where: Base-Base interactions energy: -482.212 where: short stacking energy: -214.991 Base-Backbone interact. energy: -0.585 local terms energy: -197.363203 where: bonds (distance) C4'-P energy: -32.633 bonds (distance) P-C4' energy: -38.057 flat angles C4'-P-C4' energy: -40.798 flat angles P-C4'-P energy: -25.320 tors. eta vs tors. theta energy: -60.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -661.533228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.533228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.533228 (E_RNA) where: Base-Base interactions energy: -469.539 where: short stacking energy: -208.639 Base-Backbone interact. energy: -0.310 local terms energy: -191.683907 where: bonds (distance) C4'-P energy: -38.220 bonds (distance) P-C4' energy: -37.248 flat angles C4'-P-C4' energy: -39.093 flat angles P-C4'-P energy: -25.757 tors. eta vs tors. theta energy: -51.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -608.114730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.114730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.114730 (E_RNA) where: Base-Base interactions energy: -431.816 where: short stacking energy: -182.168 Base-Backbone interact. energy: -0.751 local terms energy: -175.547474 where: bonds (distance) C4'-P energy: -28.589 bonds (distance) P-C4' energy: -37.388 flat angles C4'-P-C4' energy: -41.842 flat angles P-C4'-P energy: -25.519 tors. eta vs tors. theta energy: -42.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -635.994585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.994585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.994585 (E_RNA) where: Base-Base interactions energy: -480.206 where: short stacking energy: -199.909 Base-Backbone interact. energy: 6.595 local terms energy: -162.383442 where: bonds (distance) C4'-P energy: -26.755 bonds (distance) P-C4' energy: -29.120 flat angles C4'-P-C4' energy: -37.692 flat angles P-C4'-P energy: -25.028 tors. eta vs tors. theta energy: -43.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -607.135829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.135829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.135829 (E_RNA) where: Base-Base interactions energy: -438.266 where: short stacking energy: -176.857 Base-Backbone interact. energy: 4.025 local terms energy: -172.894303 where: bonds (distance) C4'-P energy: -36.059 bonds (distance) P-C4' energy: -35.154 flat angles C4'-P-C4' energy: -31.772 flat angles P-C4'-P energy: -27.825 tors. eta vs tors. theta energy: -42.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -586.590425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.590425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.590425 (E_RNA) where: Base-Base interactions energy: -405.076 where: short stacking energy: -175.369 Base-Backbone interact. energy: 0.054 local terms energy: -181.568624 where: bonds (distance) C4'-P energy: -34.070 bonds (distance) P-C4' energy: -41.347 flat angles C4'-P-C4' energy: -37.145 flat angles P-C4'-P energy: -19.570 tors. eta vs tors. theta energy: -49.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -524.968745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.968745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.968745 (E_RNA) where: Base-Base interactions energy: -375.474 where: short stacking energy: -155.673 Base-Backbone interact. energy: -0.610 local terms energy: -148.884584 where: bonds (distance) C4'-P energy: -27.930 bonds (distance) P-C4' energy: -27.796 flat angles C4'-P-C4' energy: -26.511 flat angles P-C4'-P energy: -27.178 tors. eta vs tors. theta energy: -39.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -522.621315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.621315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.621315 (E_RNA) where: Base-Base interactions energy: -365.567 where: short stacking energy: -161.042 Base-Backbone interact. energy: 0.379 local terms energy: -157.433105 where: bonds (distance) C4'-P energy: -30.006 bonds (distance) P-C4' energy: -26.972 flat angles C4'-P-C4' energy: -37.288 flat angles P-C4'-P energy: -21.045 tors. eta vs tors. theta energy: -42.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -450.156885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.156885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.156885 (E_RNA) where: Base-Base interactions energy: -311.508 where: short stacking energy: -132.521 Base-Backbone interact. energy: -1.351 local terms energy: -137.297928 where: bonds (distance) C4'-P energy: -30.784 bonds (distance) P-C4' energy: -34.077 flat angles C4'-P-C4' energy: -30.387 flat angles P-C4'-P energy: -20.711 tors. eta vs tors. theta energy: -21.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -699.140432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.140432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.140432 (E_RNA) where: Base-Base interactions energy: -500.360 where: short stacking energy: -211.998 Base-Backbone interact. energy: -0.136 local terms energy: -198.643978 where: bonds (distance) C4'-P energy: -36.839 bonds (distance) P-C4' energy: -36.691 flat angles C4'-P-C4' energy: -41.853 flat angles P-C4'-P energy: -30.255 tors. eta vs tors. theta energy: -53.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -679.332676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.332676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.332676 (E_RNA) where: Base-Base interactions energy: -482.473 where: short stacking energy: -205.746 Base-Backbone interact. energy: -0.396 local terms energy: -196.463456 where: bonds (distance) C4'-P energy: -32.862 bonds (distance) P-C4' energy: -41.408 flat angles C4'-P-C4' energy: -36.483 flat angles P-C4'-P energy: -26.705 tors. eta vs tors. theta energy: -59.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -621.440646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.440646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.440646 (E_RNA) where: Base-Base interactions energy: -425.713 where: short stacking energy: -178.170 Base-Backbone interact. energy: -1.778 local terms energy: -193.949138 where: bonds (distance) C4'-P energy: -40.864 bonds (distance) P-C4' energy: -36.138 flat angles C4'-P-C4' energy: -42.181 flat angles P-C4'-P energy: -29.826 tors. eta vs tors. theta energy: -44.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -651.155530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.155530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.155530 (E_RNA) where: Base-Base interactions energy: -462.594 where: short stacking energy: -205.459 Base-Backbone interact. energy: -0.008 local terms energy: -188.554071 where: bonds (distance) C4'-P energy: -33.588 bonds (distance) P-C4' energy: -36.687 flat angles C4'-P-C4' energy: -40.522 flat angles P-C4'-P energy: -26.053 tors. eta vs tors. theta energy: -51.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -593.168475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.168475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.168475 (E_RNA) where: Base-Base interactions energy: -433.332 where: short stacking energy: -175.164 Base-Backbone interact. energy: -0.311 local terms energy: -159.525288 where: bonds (distance) C4'-P energy: -36.546 bonds (distance) P-C4' energy: -22.293 flat angles C4'-P-C4' energy: -39.622 flat angles P-C4'-P energy: -21.924 tors. eta vs tors. theta energy: -39.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -610.915214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.915214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.915214 (E_RNA) where: Base-Base interactions energy: -453.700 where: short stacking energy: -188.849 Base-Backbone interact. energy: 0.891 local terms energy: -158.106841 where: bonds (distance) C4'-P energy: -28.534 bonds (distance) P-C4' energy: -30.507 flat angles C4'-P-C4' energy: -35.161 flat angles P-C4'-P energy: -18.343 tors. eta vs tors. theta energy: -45.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -586.150239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.150239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.150239 (E_RNA) where: Base-Base interactions energy: -430.510 where: short stacking energy: -170.427 Base-Backbone interact. energy: 0.283 local terms energy: -155.922783 where: bonds (distance) C4'-P energy: -29.053 bonds (distance) P-C4' energy: -36.412 flat angles C4'-P-C4' energy: -33.223 flat angles P-C4'-P energy: -17.625 tors. eta vs tors. theta energy: -39.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -527.647538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.647538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.647538 (E_RNA) where: Base-Base interactions energy: -375.406 where: short stacking energy: -178.249 Base-Backbone interact. energy: 0.605 local terms energy: -152.845716 where: bonds (distance) C4'-P energy: -20.598 bonds (distance) P-C4' energy: -25.860 flat angles C4'-P-C4' energy: -39.916 flat angles P-C4'-P energy: -27.991 tors. eta vs tors. theta energy: -38.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -494.196700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.196700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.196700 (E_RNA) where: Base-Base interactions energy: -357.159 where: short stacking energy: -152.217 Base-Backbone interact. energy: -0.904 local terms energy: -136.133723 where: bonds (distance) C4'-P energy: -22.828 bonds (distance) P-C4' energy: -28.807 flat angles C4'-P-C4' energy: -29.490 flat angles P-C4'-P energy: -22.260 tors. eta vs tors. theta energy: -32.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -462.711239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.711239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.711239 (E_RNA) where: Base-Base interactions energy: -320.929 where: short stacking energy: -126.650 Base-Backbone interact. energy: -1.655 local terms energy: -140.127028 where: bonds (distance) C4'-P energy: -38.646 bonds (distance) P-C4' energy: -36.193 flat angles C4'-P-C4' energy: -31.540 flat angles P-C4'-P energy: -18.106 tors. eta vs tors. theta energy: -15.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -689.121739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.121739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.121739 (E_RNA) where: Base-Base interactions energy: -477.989 where: short stacking energy: -204.062 Base-Backbone interact. energy: -0.355 local terms energy: -210.777574 where: bonds (distance) C4'-P energy: -37.511 bonds (distance) P-C4' energy: -34.769 flat angles C4'-P-C4' energy: -48.931 flat angles P-C4'-P energy: -33.016 tors. eta vs tors. theta energy: -56.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -676.755494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.755494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.755494 (E_RNA) where: Base-Base interactions energy: -481.214 where: short stacking energy: -205.489 Base-Backbone interact. energy: 1.202 local terms energy: -196.743128 where: bonds (distance) C4'-P energy: -28.480 bonds (distance) P-C4' energy: -34.563 flat angles C4'-P-C4' energy: -44.505 flat angles P-C4'-P energy: -30.488 tors. eta vs tors. theta energy: -58.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -620.727174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.727174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.727174 (E_RNA) where: Base-Base interactions energy: -437.297 where: short stacking energy: -170.663 Base-Backbone interact. energy: -2.378 local terms energy: -181.051591 where: bonds (distance) C4'-P energy: -37.223 bonds (distance) P-C4' energy: -32.723 flat angles C4'-P-C4' energy: -41.502 flat angles P-C4'-P energy: -30.181 tors. eta vs tors. theta energy: -39.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -638.606638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.606638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.606638 (E_RNA) where: Base-Base interactions energy: -451.788 where: short stacking energy: -208.190 Base-Backbone interact. energy: -0.006 local terms energy: -186.812788 where: bonds (distance) C4'-P energy: -35.113 bonds (distance) P-C4' energy: -36.215 flat angles C4'-P-C4' energy: -42.663 flat angles P-C4'-P energy: -20.263 tors. eta vs tors. theta energy: -52.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -589.965712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.965712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.965712 (E_RNA) where: Base-Base interactions energy: -434.384 where: short stacking energy: -167.171 Base-Backbone interact. energy: -0.136 local terms energy: -155.445728 where: bonds (distance) C4'-P energy: -32.684 bonds (distance) P-C4' energy: -32.954 flat angles C4'-P-C4' energy: -34.220 flat angles P-C4'-P energy: -18.899 tors. eta vs tors. theta energy: -36.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -589.564888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.564888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.564888 (E_RNA) where: Base-Base interactions energy: -412.495 where: short stacking energy: -170.197 Base-Backbone interact. energy: -1.242 local terms energy: -175.828066 where: bonds (distance) C4'-P energy: -31.006 bonds (distance) P-C4' energy: -31.629 flat angles C4'-P-C4' energy: -38.042 flat angles P-C4'-P energy: -23.822 tors. eta vs tors. theta energy: -51.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -573.568287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.568287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.568287 (E_RNA) where: Base-Base interactions energy: -430.819 where: short stacking energy: -154.083 Base-Backbone interact. energy: -1.045 local terms energy: -141.703868 where: bonds (distance) C4'-P energy: -29.633 bonds (distance) P-C4' energy: -25.355 flat angles C4'-P-C4' energy: -35.898 flat angles P-C4'-P energy: -21.819 tors. eta vs tors. theta energy: -28.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -518.345359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.345359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.345359 (E_RNA) where: Base-Base interactions energy: -358.813 where: short stacking energy: -148.136 Base-Backbone interact. energy: -0.689 local terms energy: -158.843904 where: bonds (distance) C4'-P energy: -30.760 bonds (distance) P-C4' energy: -36.832 flat angles C4'-P-C4' energy: -26.461 flat angles P-C4'-P energy: -27.471 tors. eta vs tors. theta energy: -37.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -452.358294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.358294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.358294 (E_RNA) where: Base-Base interactions energy: -323.387 where: short stacking energy: -131.277 Base-Backbone interact. energy: -0.444 local terms energy: -128.528026 where: bonds (distance) C4'-P energy: -26.308 bonds (distance) P-C4' energy: -29.048 flat angles C4'-P-C4' energy: -24.093 flat angles P-C4'-P energy: -23.118 tors. eta vs tors. theta energy: -25.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -454.778394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.778394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.778394 (E_RNA) where: Base-Base interactions energy: -309.300 where: short stacking energy: -134.287 Base-Backbone interact. energy: 1.023 local terms energy: -146.501359 where: bonds (distance) C4'-P energy: -28.236 bonds (distance) P-C4' energy: -39.316 flat angles C4'-P-C4' energy: -28.047 flat angles P-C4'-P energy: -20.182 tors. eta vs tors. theta energy: -30.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -683.359755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.359755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.359755 (E_RNA) where: Base-Base interactions energy: -498.230 where: short stacking energy: -210.285 Base-Backbone interact. energy: -0.013 local terms energy: -185.116700 where: bonds (distance) C4'-P energy: -32.692 bonds (distance) P-C4' energy: -32.483 flat angles C4'-P-C4' energy: -39.347 flat angles P-C4'-P energy: -19.423 tors. eta vs tors. theta energy: -61.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -691.449974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.449974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.449974 (E_RNA) where: Base-Base interactions energy: -481.524 where: short stacking energy: -202.218 Base-Backbone interact. energy: -1.182 local terms energy: -208.744556 where: bonds (distance) C4'-P energy: -39.764 bonds (distance) P-C4' energy: -40.094 flat angles C4'-P-C4' energy: -42.446 flat angles P-C4'-P energy: -25.985 tors. eta vs tors. theta energy: -60.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -646.617621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.617621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.617621 (E_RNA) where: Base-Base interactions energy: -455.915 where: short stacking energy: -209.573 Base-Backbone interact. energy: -0.479 local terms energy: -190.223906 where: bonds (distance) C4'-P energy: -38.326 bonds (distance) P-C4' energy: -34.162 flat angles C4'-P-C4' energy: -37.290 flat angles P-C4'-P energy: -27.975 tors. eta vs tors. theta energy: -52.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -610.232691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.232691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.232691 (E_RNA) where: Base-Base interactions energy: -429.598 where: short stacking energy: -181.214 Base-Backbone interact. energy: 0.173 local terms energy: -180.808381 where: bonds (distance) C4'-P energy: -33.255 bonds (distance) P-C4' energy: -37.308 flat angles C4'-P-C4' energy: -34.004 flat angles P-C4'-P energy: -31.619 tors. eta vs tors. theta energy: -44.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -617.731513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.731513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.731513 (E_RNA) where: Base-Base interactions energy: -448.082 where: short stacking energy: -190.004 Base-Backbone interact. energy: -0.619 local terms energy: -169.029947 where: bonds (distance) C4'-P energy: -32.475 bonds (distance) P-C4' energy: -32.150 flat angles C4'-P-C4' energy: -37.153 flat angles P-C4'-P energy: -20.631 tors. eta vs tors. theta energy: -46.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -589.059018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.059018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.059018 (E_RNA) where: Base-Base interactions energy: -425.375 where: short stacking energy: -171.047 Base-Backbone interact. energy: 1.048 local terms energy: -164.731554 where: bonds (distance) C4'-P energy: -27.398 bonds (distance) P-C4' energy: -35.216 flat angles C4'-P-C4' energy: -39.302 flat angles P-C4'-P energy: -23.052 tors. eta vs tors. theta energy: -39.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -561.532394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.532394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.532394 (E_RNA) where: Base-Base interactions energy: -397.496 where: short stacking energy: -166.073 Base-Backbone interact. energy: 2.105 local terms energy: -166.141118 where: bonds (distance) C4'-P energy: -34.582 bonds (distance) P-C4' energy: -29.760 flat angles C4'-P-C4' energy: -38.283 flat angles P-C4'-P energy: -20.260 tors. eta vs tors. theta energy: -43.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -536.528094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.528094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.528094 (E_RNA) where: Base-Base interactions energy: -388.250 where: short stacking energy: -154.753 Base-Backbone interact. energy: 2.329 local terms energy: -150.606894 where: bonds (distance) C4'-P energy: -22.133 bonds (distance) P-C4' energy: -29.188 flat angles C4'-P-C4' energy: -34.402 flat angles P-C4'-P energy: -18.261 tors. eta vs tors. theta energy: -46.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -464.059599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.059599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.059599 (E_RNA) where: Base-Base interactions energy: -328.112 where: short stacking energy: -132.449 Base-Backbone interact. energy: -0.062 local terms energy: -135.886148 where: bonds (distance) C4'-P energy: -29.601 bonds (distance) P-C4' energy: -29.328 flat angles C4'-P-C4' energy: -34.600 flat angles P-C4'-P energy: -15.978 tors. eta vs tors. theta energy: -26.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -432.173088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.173088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.173088 (E_RNA) where: Base-Base interactions energy: -318.130 where: short stacking energy: -137.684 Base-Backbone interact. energy: -0.633 local terms energy: -113.409190 where: bonds (distance) C4'-P energy: -20.703 bonds (distance) P-C4' energy: -21.879 flat angles C4'-P-C4' energy: -35.915 flat angles P-C4'-P energy: -11.088 tors. eta vs tors. theta energy: -23.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -683.944646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.944646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.944646 (E_RNA) where: Base-Base interactions energy: -471.714 where: short stacking energy: -205.051 Base-Backbone interact. energy: -0.046 local terms energy: -212.184473 where: bonds (distance) C4'-P energy: -41.090 bonds (distance) P-C4' energy: -44.394 flat angles C4'-P-C4' energy: -41.534 flat angles P-C4'-P energy: -28.348 tors. eta vs tors. theta energy: -56.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -678.727102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.727102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.727102 (E_RNA) where: Base-Base interactions energy: -492.078 where: short stacking energy: -208.975 Base-Backbone interact. energy: -0.440 local terms energy: -186.209809 where: bonds (distance) C4'-P energy: -34.854 bonds (distance) P-C4' energy: -33.653 flat angles C4'-P-C4' energy: -36.613 flat angles P-C4'-P energy: -28.445 tors. eta vs tors. theta energy: -52.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -640.085555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.085555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.085555 (E_RNA) where: Base-Base interactions energy: -450.679 where: short stacking energy: -193.939 Base-Backbone interact. energy: -0.198 local terms energy: -189.209079 where: bonds (distance) C4'-P energy: -38.341 bonds (distance) P-C4' energy: -37.840 flat angles C4'-P-C4' energy: -36.190 flat angles P-C4'-P energy: -29.052 tors. eta vs tors. theta energy: -47.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -632.050967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.050967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.050967 (E_RNA) where: Base-Base interactions energy: -445.027 where: short stacking energy: -181.159 Base-Backbone interact. energy: -1.316 local terms energy: -185.707598 where: bonds (distance) C4'-P energy: -38.367 bonds (distance) P-C4' energy: -38.134 flat angles C4'-P-C4' energy: -41.608 flat angles P-C4'-P energy: -25.917 tors. eta vs tors. theta energy: -41.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -631.758615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.758615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.758615 (E_RNA) where: Base-Base interactions energy: -453.247 where: short stacking energy: -194.019 Base-Backbone interact. energy: -0.595 local terms energy: -177.917184 where: bonds (distance) C4'-P energy: -36.573 bonds (distance) P-C4' energy: -30.495 flat angles C4'-P-C4' energy: -38.104 flat angles P-C4'-P energy: -26.210 tors. eta vs tors. theta energy: -46.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -598.987344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.987344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.987344 (E_RNA) where: Base-Base interactions energy: -433.819 where: short stacking energy: -168.687 Base-Backbone interact. energy: -0.532 local terms energy: -164.636511 where: bonds (distance) C4'-P energy: -30.700 bonds (distance) P-C4' energy: -32.064 flat angles C4'-P-C4' energy: -39.159 flat angles P-C4'-P energy: -25.049 tors. eta vs tors. theta energy: -37.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -552.977695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.977695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.977695 (E_RNA) where: Base-Base interactions energy: -392.041 where: short stacking energy: -162.946 Base-Backbone interact. energy: -0.411 local terms energy: -160.525357 where: bonds (distance) C4'-P energy: -36.471 bonds (distance) P-C4' energy: -32.629 flat angles C4'-P-C4' energy: -33.269 flat angles P-C4'-P energy: -21.241 tors. eta vs tors. theta energy: -36.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -530.530370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.530370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.530370 (E_RNA) where: Base-Base interactions energy: -376.311 where: short stacking energy: -157.549 Base-Backbone interact. energy: -0.578 local terms energy: -153.641744 where: bonds (distance) C4'-P energy: -31.494 bonds (distance) P-C4' energy: -31.059 flat angles C4'-P-C4' energy: -36.517 flat angles P-C4'-P energy: -18.675 tors. eta vs tors. theta energy: -35.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -463.300284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.300284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.300284 (E_RNA) where: Base-Base interactions energy: -336.775 where: short stacking energy: -140.358 Base-Backbone interact. energy: -0.766 local terms energy: -125.759923 where: bonds (distance) C4'-P energy: -28.543 bonds (distance) P-C4' energy: -38.420 flat angles C4'-P-C4' energy: -29.970 flat angles P-C4'-P energy: -7.965 tors. eta vs tors. theta energy: -20.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -385.625151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.625151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.625151 (E_RNA) where: Base-Base interactions energy: -255.917 where: short stacking energy: -115.930 Base-Backbone interact. energy: 0.482 local terms energy: -130.189833 where: bonds (distance) C4'-P energy: -33.840 bonds (distance) P-C4' energy: -28.052 flat angles C4'-P-C4' energy: -36.633 flat angles P-C4'-P energy: -12.661 tors. eta vs tors. theta energy: -19.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 5 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 6005867 moves confirmed later: 6746836 all moves confirmed: 12752703 percent of confirmed moves: 7.970439 current total energy: -660.952065 recalc. total energy: -660.952065 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 5496746 moves confirmed later: 6092206 all moves confirmed: 11588952 percent of confirmed moves: 7.243095 current total energy: -628.492781 recalc. total energy: -628.492781 replica 10 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 5916165 moves confirmed later: 6700323 all moves confirmed: 12616488 percent of confirmed moves: 7.885305 current total energy: -576.295143 recalc. total energy: -576.295143 replica 6 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 5882700 moves confirmed later: 6560657 all moves confirmed: 12443357 percent of confirmed moves: 7.777098 current total energy: -566.185353 recalc. total energy: -566.185353 replica 4 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 6695023 moves confirmed later: 7638833 all moves confirmed: 14333856 percent of confirmed moves: 8.958660 current total energy: -543.324783 recalc. total energy: -543.324783 replica 8 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 7773933 moves confirmed later: 9242329 all moves confirmed: 17016262 percent of confirmed moves: 10.635164 current total energy: -509.436260 recalc. total energy: -509.436260 replica 7 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 6485876 moves confirmed later: 7449666 all moves confirmed: 13935542 percent of confirmed moves: 8.709714 current total energy: -513.568238 recalc. total energy: -513.568238 replica 3 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 7075145 moves confirmed later: 8215017 all moves confirmed: 15290162 percent of confirmed moves: 9.556351 current total energy: -420.901933 recalc. total energy: -420.901933 replica 9 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 9400644 moves confirmed later: 11191102 all moves confirmed: 20591746 percent of confirmed moves: 12.869841 current total energy: -373.497199 recalc. total energy: -373.497199 replica 1 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 6962168 moves confirmed later: 7996198 all moves confirmed: 14958366 percent of confirmed moves: 9.348979 current total energy: -307.808312 recalc. total energy: -307.808312 out arg RESULTS//1/Apt_6_t-9e2689dc_01 Time of doing 1600000 iterations: 7516.338 seconds