SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-fc6ee7c4/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....((((...))))...(((.(((....))).)))....(((.(((((((...))))...))).)))....((((((...((....))...))))))..((((((((((((((((((((.....((.((..((.((((.(((((....((.((((((.((..((((........))))..))))))))))....))))).))))...))..))))...._ chain: 2: _))))))))))))))))))))_ nucl1: 7, chain1: 0, <---> nucl2: 11, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 11 nucl1: 6, chain1: 0, <---> nucl2: 12, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 12 nucl1: 5, chain1: 0, <---> nucl2: 13, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 13 nucl1: 4, chain1: 0, <---> nucl2: 14, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 14 nucl1: 24, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 23, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 22, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 19, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 18, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 50, chain1: 0, <---> nucl2: 54, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 54 nucl1: 49, chain1: 0, <---> nucl2: 55, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 55 nucl1: 48, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 47, chain1: 0, <---> nucl2: 57, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 47, chainIndex_2: 0, nuclIndex_2: 57 nucl1: 46, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 46, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 45, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 45, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 44, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 44, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 42, chain1: 0, <---> nucl2: 65, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 42, chainIndex_2: 0, nuclIndex_2: 65 nucl1: 41, chain1: 0, <---> nucl2: 66, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 41, chainIndex_2: 0, nuclIndex_2: 66 nucl1: 40, chain1: 0, <---> nucl2: 67, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 40, chainIndex_2: 0, nuclIndex_2: 67 nucl1: 82, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 82, chainIndex_2: 0, nuclIndex_2: 87 nucl1: 81, chain1: 0, <---> nucl2: 88, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 81, chainIndex_2: 0, nuclIndex_2: 88 nucl1: 77, chain1: 0, <---> nucl2: 92, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 92 nucl1: 76, chain1: 0, <---> nucl2: 93, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 93 nucl1: 75, chain1: 0, <---> nucl2: 94, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 94 nucl1: 74, chain1: 0, <---> nucl2: 95, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 95 nucl1: 73, chain1: 0, <---> nucl2: 96, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 96 nucl1: 72, chain1: 0, <---> nucl2: 97, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 97 nucl1: 166, chain1: 0, <---> nucl2: 175, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 166, chainIndex_2: 0, nuclIndex_2: 175 nucl1: 165, chain1: 0, <---> nucl2: 176, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 165, chainIndex_2: 0, nuclIndex_2: 176 nucl1: 164, chain1: 0, <---> nucl2: 177, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 164, chainIndex_2: 0, nuclIndex_2: 177 nucl1: 163, chain1: 0, <---> nucl2: 178, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 163, chainIndex_2: 0, nuclIndex_2: 178 nucl1: 160, chain1: 0, <---> nucl2: 181, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 160, chainIndex_2: 0, nuclIndex_2: 181 nucl1: 159, chain1: 0, <---> nucl2: 182, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 159, chainIndex_2: 0, nuclIndex_2: 182 nucl1: 157, chain1: 0, <---> nucl2: 183, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 157, chainIndex_2: 0, nuclIndex_2: 183 nucl1: 156, chain1: 0, <---> nucl2: 184, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 156, chainIndex_2: 0, nuclIndex_2: 184 nucl1: 155, chain1: 0, <---> nucl2: 185, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 155, chainIndex_2: 0, nuclIndex_2: 185 nucl1: 154, chain1: 0, <---> nucl2: 186, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 154, chainIndex_2: 0, nuclIndex_2: 186 nucl1: 153, chain1: 0, <---> nucl2: 187, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 153, chainIndex_2: 0, nuclIndex_2: 187 nucl1: 152, chain1: 0, <---> nucl2: 188, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 152, chainIndex_2: 0, nuclIndex_2: 188 nucl1: 150, chain1: 0, <---> nucl2: 189, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 150, chainIndex_2: 0, nuclIndex_2: 189 nucl1: 149, chain1: 0, <---> nucl2: 190, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 149, chainIndex_2: 0, nuclIndex_2: 190 nucl1: 144, chain1: 0, <---> nucl2: 195, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 144, chainIndex_2: 0, nuclIndex_2: 195 nucl1: 143, chain1: 0, <---> nucl2: 196, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 143, chainIndex_2: 0, nuclIndex_2: 196 nucl1: 142, chain1: 0, <---> nucl2: 197, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 142, chainIndex_2: 0, nuclIndex_2: 197 nucl1: 141, chain1: 0, <---> nucl2: 198, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 141, chainIndex_2: 0, nuclIndex_2: 198 nucl1: 140, chain1: 0, <---> nucl2: 199, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 140, chainIndex_2: 0, nuclIndex_2: 199 nucl1: 138, chain1: 0, <---> nucl2: 201, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 138, chainIndex_2: 0, nuclIndex_2: 201 nucl1: 137, chain1: 0, <---> nucl2: 202, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 137, chainIndex_2: 0, nuclIndex_2: 202 nucl1: 136, chain1: 0, <---> nucl2: 203, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 136, chainIndex_2: 0, nuclIndex_2: 203 nucl1: 135, chain1: 0, <---> nucl2: 204, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 135, chainIndex_2: 0, nuclIndex_2: 204 nucl1: 133, chain1: 0, <---> nucl2: 208, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 133, chainIndex_2: 0, nuclIndex_2: 208 nucl1: 132, chain1: 0, <---> nucl2: 209, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 132, chainIndex_2: 0, nuclIndex_2: 209 nucl1: 129, chain1: 0, <---> nucl2: 212, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 129, chainIndex_2: 0, nuclIndex_2: 212 nucl1: 128, chain1: 0, <---> nucl2: 213, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 213 nucl1: 126, chain1: 0, <---> nucl2: 214, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 214 nucl1: 125, chain1: 0, <---> nucl2: 215, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 215 nucl1: 119, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 119, chainIndex_2: 1, nuclIndex_2: 221 nucl1: 118, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 118, chainIndex_2: 1, nuclIndex_2: 222 nucl1: 117, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 117, chainIndex_2: 1, nuclIndex_2: 223 nucl1: 116, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 116, chainIndex_2: 1, nuclIndex_2: 224 nucl1: 115, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 115, chainIndex_2: 1, nuclIndex_2: 225 nucl1: 114, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 114, chainIndex_2: 1, nuclIndex_2: 226 nucl1: 113, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 113, chainIndex_2: 1, nuclIndex_2: 227 nucl1: 112, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 112, chainIndex_2: 1, nuclIndex_2: 228 nucl1: 111, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 111, chainIndex_2: 1, nuclIndex_2: 229 nucl1: 110, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 110, chainIndex_2: 1, nuclIndex_2: 230 nucl1: 109, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 109, chainIndex_2: 1, nuclIndex_2: 231 nucl1: 108, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 108, chainIndex_2: 1, nuclIndex_2: 232 nucl1: 107, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 107, chainIndex_2: 1, nuclIndex_2: 233 nucl1: 106, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 106, chainIndex_2: 1, nuclIndex_2: 234 nucl1: 105, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 105, chainIndex_2: 1, nuclIndex_2: 235 nucl1: 104, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 104, chainIndex_2: 1, nuclIndex_2: 236 nucl1: 103, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 103, chainIndex_2: 1, nuclIndex_2: 237 nucl1: 102, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 102, chainIndex_2: 1, nuclIndex_2: 238 nucl1: 101, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 1, nuclIndex_2: 239 nucl1: 100, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 1, nuclIndex_2: 240 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 11793.684216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 11793.684216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 12769.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -445.869649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.869649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.108249 (E_RNA) where: Base-Base interactions energy: -912.097 where: short stacking energy: -470.397 Base-Backbone interact. energy: 2.333 local terms energy: -616.344425 where: bonds (distance) C4'-P energy: -129.959 bonds (distance) P-C4' energy: -160.390 flat angles C4'-P-C4' energy: -123.920 flat angles P-C4'-P energy: -84.284 tors. eta vs tors. theta energy: -117.792 Dist. restrs. and SS energy: 1080.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -443.982185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.982185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.618368 (E_RNA) where: Base-Base interactions energy: -836.272 where: short stacking energy: -427.188 Base-Backbone interact. energy: -2.286 local terms energy: -522.060049 where: bonds (distance) C4'-P energy: -129.507 bonds (distance) P-C4' energy: -132.873 flat angles C4'-P-C4' energy: -90.045 flat angles P-C4'-P energy: -68.814 tors. eta vs tors. theta energy: -100.822 Dist. restrs. and SS energy: 916.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -918.648211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.648211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.579606 (E_RNA) where: Base-Base interactions energy: -895.473 where: short stacking energy: -472.839 Base-Backbone interact. energy: -2.817 local terms energy: -555.288933 where: bonds (distance) C4'-P energy: -133.182 bonds (distance) P-C4' energy: -139.495 flat angles C4'-P-C4' energy: -121.271 flat angles P-C4'-P energy: -62.959 tors. eta vs tors. theta energy: -98.382 Dist. restrs. and SS energy: 534.931 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -500.277588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.277588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.320148 (E_RNA) where: Base-Base interactions energy: -732.083 where: short stacking energy: -354.540 Base-Backbone interact. energy: -2.594 local terms energy: -502.643076 where: bonds (distance) C4'-P energy: -127.593 bonds (distance) P-C4' energy: -157.273 flat angles C4'-P-C4' energy: -93.031 flat angles P-C4'-P energy: -57.210 tors. eta vs tors. theta energy: -67.536 Dist. restrs. and SS energy: 737.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1009.204205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.204205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.896849 (E_RNA) where: Base-Base interactions energy: -762.819 where: short stacking energy: -369.410 Base-Backbone interact. energy: -1.386 local terms energy: -517.691156 where: bonds (distance) C4'-P energy: -125.211 bonds (distance) P-C4' energy: -130.256 flat angles C4'-P-C4' energy: -117.735 flat angles P-C4'-P energy: -66.215 tors. eta vs tors. theta energy: -78.274 Dist. restrs. and SS energy: 272.693 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1036.232982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.232982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.483211 (E_RNA) where: Base-Base interactions energy: -835.025 where: short stacking energy: -380.885 Base-Backbone interact. energy: -4.198 local terms energy: -491.260283 where: bonds (distance) C4'-P energy: -125.374 bonds (distance) P-C4' energy: -126.577 flat angles C4'-P-C4' energy: -110.290 flat angles P-C4'-P energy: -58.840 tors. eta vs tors. theta energy: -70.180 Dist. restrs. and SS energy: 294.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -879.940284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.940284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.606103 (E_RNA) where: Base-Base interactions energy: -706.919 where: short stacking energy: -302.324 Base-Backbone interact. energy: 1.428 local terms energy: -471.114613 where: bonds (distance) C4'-P energy: -115.066 bonds (distance) P-C4' energy: -123.503 flat angles C4'-P-C4' energy: -99.987 flat angles P-C4'-P energy: -45.413 tors. eta vs tors. theta energy: -87.146 Dist. restrs. and SS energy: 296.666 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -763.420753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.420753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.810594 (E_RNA) where: Base-Base interactions energy: -680.970 where: short stacking energy: -311.683 Base-Backbone interact. energy: -4.925 local terms energy: -435.914982 where: bonds (distance) C4'-P energy: -106.668 bonds (distance) P-C4' energy: -114.578 flat angles C4'-P-C4' energy: -99.929 flat angles P-C4'-P energy: -54.015 tors. eta vs tors. theta energy: -60.725 Dist. restrs. and SS energy: 358.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -960.432297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.432297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.795093 (E_RNA) where: Base-Base interactions energy: -660.983 where: short stacking energy: -297.784 Base-Backbone interact. energy: 3.325 local terms energy: -452.136269 where: bonds (distance) C4'-P energy: -114.573 bonds (distance) P-C4' energy: -117.805 flat angles C4'-P-C4' energy: -112.473 flat angles P-C4'-P energy: -56.967 tors. eta vs tors. theta energy: -50.319 Dist. restrs. and SS energy: 149.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -805.804639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.804639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.555774 (E_RNA) where: Base-Base interactions energy: -513.967 where: short stacking energy: -246.087 Base-Backbone interact. energy: -1.780 local terms energy: -421.809414 where: bonds (distance) C4'-P energy: -118.660 bonds (distance) P-C4' energy: -119.213 flat angles C4'-P-C4' energy: -93.366 flat angles P-C4'-P energy: -58.659 tors. eta vs tors. theta energy: -31.913 Dist. restrs. and SS energy: 131.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1688.998422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.998422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.033644 (E_RNA) where: Base-Base interactions energy: -1180.161 where: short stacking energy: -482.092 Base-Backbone interact. energy: -4.614 local terms energy: -653.258639 where: bonds (distance) C4'-P energy: -155.602 bonds (distance) P-C4' energy: -150.488 flat angles C4'-P-C4' energy: -153.544 flat angles P-C4'-P energy: -82.278 tors. eta vs tors. theta energy: -111.347 Dist. restrs. and SS energy: 149.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1812.599458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.599458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.439996 (E_RNA) where: Base-Base interactions energy: -1249.439 where: short stacking energy: -520.394 Base-Backbone interact. energy: 0.541 local terms energy: -611.542097 where: bonds (distance) C4'-P energy: -131.576 bonds (distance) P-C4' energy: -144.052 flat angles C4'-P-C4' energy: -141.762 flat angles P-C4'-P energy: -82.162 tors. eta vs tors. theta energy: -111.990 Dist. restrs. and SS energy: 47.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1602.239780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.239780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.639199 (E_RNA) where: Base-Base interactions energy: -1105.504 where: short stacking energy: -472.196 Base-Backbone interact. energy: -1.634 local terms energy: -584.500836 where: bonds (distance) C4'-P energy: -147.092 bonds (distance) P-C4' energy: -136.767 flat angles C4'-P-C4' energy: -120.469 flat angles P-C4'-P energy: -75.788 tors. eta vs tors. theta energy: -104.385 Dist. restrs. and SS energy: 89.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1600.900734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.900734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.507789 (E_RNA) where: Base-Base interactions energy: -1062.780 where: short stacking energy: -414.054 Base-Backbone interact. energy: -2.611 local terms energy: -585.116952 where: bonds (distance) C4'-P energy: -142.028 bonds (distance) P-C4' energy: -126.970 flat angles C4'-P-C4' energy: -127.634 flat angles P-C4'-P energy: -92.541 tors. eta vs tors. theta energy: -95.943 Dist. restrs. and SS energy: 49.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1439.457389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.457389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.926931 (E_RNA) where: Base-Base interactions energy: -929.391 where: short stacking energy: -387.866 Base-Backbone interact. energy: -3.768 local terms energy: -588.768028 where: bonds (distance) C4'-P energy: -134.332 bonds (distance) P-C4' energy: -136.343 flat angles C4'-P-C4' energy: -133.774 flat angles P-C4'-P energy: -90.103 tors. eta vs tors. theta energy: -94.216 Dist. restrs. and SS energy: 82.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1566.683782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.683782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.041185 (E_RNA) where: Base-Base interactions energy: -1126.581 where: short stacking energy: -441.229 Base-Backbone interact. energy: -1.592 local terms energy: -509.868280 where: bonds (distance) C4'-P energy: -104.189 bonds (distance) P-C4' energy: -129.490 flat angles C4'-P-C4' energy: -124.295 flat angles P-C4'-P energy: -63.142 tors. eta vs tors. theta energy: -88.752 Dist. restrs. and SS energy: 71.357 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -1587.631515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.631515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.704832 (E_RNA) where: Base-Base interactions energy: -1118.792 where: short stacking energy: -476.122 Base-Backbone interact. energy: 1.311 local terms energy: -524.224120 where: bonds (distance) C4'-P energy: -102.459 bonds (distance) P-C4' energy: -126.482 flat angles C4'-P-C4' energy: -111.498 flat angles P-C4'-P energy: -69.335 tors. eta vs tors. theta energy: -114.449 Dist. restrs. and SS energy: 54.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -1422.776100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.776100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.930801 (E_RNA) where: Base-Base interactions energy: -1001.188 where: short stacking energy: -402.342 Base-Backbone interact. energy: 3.829 local terms energy: -481.571895 where: bonds (distance) C4'-P energy: -108.621 bonds (distance) P-C4' energy: -111.075 flat angles C4'-P-C4' energy: -126.599 flat angles P-C4'-P energy: -58.115 tors. eta vs tors. theta energy: -77.161 Dist. restrs. and SS energy: 56.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -1339.923591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.923591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.296044 (E_RNA) where: Base-Base interactions energy: -962.586 where: short stacking energy: -399.237 Base-Backbone interact. energy: 0.756 local terms energy: -441.466512 where: bonds (distance) C4'-P energy: -107.008 bonds (distance) P-C4' energy: -105.840 flat angles C4'-P-C4' energy: -99.948 flat angles P-C4'-P energy: -42.355 tors. eta vs tors. theta energy: -86.316 Dist. restrs. and SS energy: 63.372 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -1291.373284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.373284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.169355 (E_RNA) where: Base-Base interactions energy: -898.398 where: short stacking energy: -354.053 Base-Backbone interact. energy: 4.747 local terms energy: -457.518271 where: bonds (distance) C4'-P energy: -106.491 bonds (distance) P-C4' energy: -107.330 flat angles C4'-P-C4' energy: -107.858 flat angles P-C4'-P energy: -72.377 tors. eta vs tors. theta energy: -63.463 Dist. restrs. and SS energy: 59.796 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -2106.870484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.870484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2135.622013 (E_RNA) where: Base-Base interactions energy: -1449.209 where: short stacking energy: -605.644 Base-Backbone interact. energy: 0.409 local terms energy: -686.821216 where: bonds (distance) C4'-P energy: -146.554 bonds (distance) P-C4' energy: -143.280 flat angles C4'-P-C4' energy: -154.756 flat angles P-C4'-P energy: -97.865 tors. eta vs tors. theta energy: -144.366 Dist. restrs. and SS energy: 28.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1864.399703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1864.399703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1930.179599 (E_RNA) where: Base-Base interactions energy: -1262.134 where: short stacking energy: -526.888 Base-Backbone interact. energy: -3.153 local terms energy: -664.892424 where: bonds (distance) C4'-P energy: -136.923 bonds (distance) P-C4' energy: -149.536 flat angles C4'-P-C4' energy: -158.490 flat angles P-C4'-P energy: -93.943 tors. eta vs tors. theta energy: -126.000 Dist. restrs. and SS energy: 65.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1770.226450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.226450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.863618 (E_RNA) where: Base-Base interactions energy: -1186.654 where: short stacking energy: -500.012 Base-Backbone interact. energy: -1.586 local terms energy: -636.624024 where: bonds (distance) C4'-P energy: -136.627 bonds (distance) P-C4' energy: -147.625 flat angles C4'-P-C4' energy: -155.339 flat angles P-C4'-P energy: -82.356 tors. eta vs tors. theta energy: -114.676 Dist. restrs. and SS energy: 54.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1685.328253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.328253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.214381 (E_RNA) where: Base-Base interactions energy: -1132.944 where: short stacking energy: -472.807 Base-Backbone interact. energy: -1.203 local terms energy: -595.067359 where: bonds (distance) C4'-P energy: -133.275 bonds (distance) P-C4' energy: -142.811 flat angles C4'-P-C4' energy: -134.220 flat angles P-C4'-P energy: -77.912 tors. eta vs tors. theta energy: -106.849 Dist. restrs. and SS energy: 43.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1872.266177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1872.266177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1920.911513 (E_RNA) where: Base-Base interactions energy: -1304.730 where: short stacking energy: -534.688 Base-Backbone interact. energy: 3.606 local terms energy: -619.787594 where: bonds (distance) C4'-P energy: -116.636 bonds (distance) P-C4' energy: -131.519 flat angles C4'-P-C4' energy: -141.678 flat angles P-C4'-P energy: -84.747 tors. eta vs tors. theta energy: -145.208 Dist. restrs. and SS energy: 48.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1613.388923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.388923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.031683 (E_RNA) where: Base-Base interactions energy: -1065.742 where: short stacking energy: -457.904 Base-Backbone interact. energy: 1.953 local terms energy: -594.242689 where: bonds (distance) C4'-P energy: -142.205 bonds (distance) P-C4' energy: -132.503 flat angles C4'-P-C4' energy: -126.546 flat angles P-C4'-P energy: -73.843 tors. eta vs tors. theta energy: -119.146 Dist. restrs. and SS energy: 44.643 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1770.631147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.631147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.579175 (E_RNA) where: Base-Base interactions energy: -1270.982 where: short stacking energy: -500.630 Base-Backbone interact. energy: -1.803 local terms energy: -534.794290 where: bonds (distance) C4'-P energy: -99.597 bonds (distance) P-C4' energy: -134.838 flat angles C4'-P-C4' energy: -127.881 flat angles P-C4'-P energy: -66.253 tors. eta vs tors. theta energy: -106.224 Dist. restrs. and SS energy: 36.948 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -1493.855513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.855513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.051745 (E_RNA) where: Base-Base interactions energy: -1060.045 where: short stacking energy: -431.664 Base-Backbone interact. energy: -1.795 local terms energy: -473.212367 where: bonds (distance) C4'-P energy: -90.295 bonds (distance) P-C4' energy: -118.636 flat angles C4'-P-C4' energy: -98.023 flat angles P-C4'-P energy: -65.979 tors. eta vs tors. theta energy: -100.280 Dist. restrs. and SS energy: 41.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -1497.589602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.589602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.073517 (E_RNA) where: Base-Base interactions energy: -1053.470 where: short stacking energy: -423.936 Base-Backbone interact. energy: -2.793 local terms energy: -484.810418 where: bonds (distance) C4'-P energy: -107.398 bonds (distance) P-C4' energy: -111.842 flat angles C4'-P-C4' energy: -97.791 flat angles P-C4'-P energy: -62.298 tors. eta vs tors. theta energy: -105.482 Dist. restrs. and SS energy: 43.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -1260.370705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.370705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.509855 (E_RNA) where: Base-Base interactions energy: -836.426 where: short stacking energy: -360.691 Base-Backbone interact. energy: -1.702 local terms energy: -488.381177 where: bonds (distance) C4'-P energy: -96.257 bonds (distance) P-C4' energy: -117.990 flat angles C4'-P-C4' energy: -115.873 flat angles P-C4'-P energy: -83.861 tors. eta vs tors. theta energy: -74.400 Dist. restrs. and SS energy: 66.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -2110.190849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.190849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2135.574884 (E_RNA) where: Base-Base interactions energy: -1465.131 where: short stacking energy: -613.345 Base-Backbone interact. energy: -1.284 local terms energy: -669.159434 where: bonds (distance) C4'-P energy: -143.478 bonds (distance) P-C4' energy: -141.826 flat angles C4'-P-C4' energy: -158.892 flat angles P-C4'-P energy: -91.050 tors. eta vs tors. theta energy: -133.913 Dist. restrs. and SS energy: 25.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1993.491186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.491186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2025.921468 (E_RNA) where: Base-Base interactions energy: -1373.036 where: short stacking energy: -554.787 Base-Backbone interact. energy: -0.470 local terms energy: -652.414740 where: bonds (distance) C4'-P energy: -153.595 bonds (distance) P-C4' energy: -136.886 flat angles C4'-P-C4' energy: -143.022 flat angles P-C4'-P energy: -89.799 tors. eta vs tors. theta energy: -129.112 Dist. restrs. and SS energy: 32.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1892.757737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1892.757737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1940.763752 (E_RNA) where: Base-Base interactions energy: -1288.014 where: short stacking energy: -537.338 Base-Backbone interact. energy: -1.204 local terms energy: -651.546028 where: bonds (distance) C4'-P energy: -145.132 bonds (distance) P-C4' energy: -138.034 flat angles C4'-P-C4' energy: -137.469 flat angles P-C4'-P energy: -85.393 tors. eta vs tors. theta energy: -145.518 Dist. restrs. and SS energy: 48.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -2003.116982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2003.116982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2048.743122 (E_RNA) where: Base-Base interactions energy: -1409.529 where: short stacking energy: -549.709 Base-Backbone interact. energy: -4.663 local terms energy: -634.551023 where: bonds (distance) C4'-P energy: -126.797 bonds (distance) P-C4' energy: -132.354 flat angles C4'-P-C4' energy: -140.502 flat angles P-C4'-P energy: -85.760 tors. eta vs tors. theta energy: -149.138 Dist. restrs. and SS energy: 45.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1704.163356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.163356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.201018 (E_RNA) where: Base-Base interactions energy: -1150.256 where: short stacking energy: -480.295 Base-Backbone interact. energy: -3.206 local terms energy: -597.738401 where: bonds (distance) C4'-P energy: -139.676 bonds (distance) P-C4' energy: -144.969 flat angles C4'-P-C4' energy: -130.241 flat angles P-C4'-P energy: -67.370 tors. eta vs tors. theta energy: -115.482 Dist. restrs. and SS energy: 47.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1943.644268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.644268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.673119 (E_RNA) where: Base-Base interactions energy: -1341.907 where: short stacking energy: -551.072 Base-Backbone interact. energy: -1.208 local terms energy: -618.558206 where: bonds (distance) C4'-P energy: -142.705 bonds (distance) P-C4' energy: -130.133 flat angles C4'-P-C4' energy: -124.347 flat angles P-C4'-P energy: -83.381 tors. eta vs tors. theta energy: -137.991 Dist. restrs. and SS energy: 18.029 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1771.753604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1771.753604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.360699 (E_RNA) where: Base-Base interactions energy: -1232.925 where: short stacking energy: -491.206 Base-Backbone interact. energy: -2.880 local terms energy: -559.555505 where: bonds (distance) C4'-P energy: -133.223 bonds (distance) P-C4' energy: -115.191 flat angles C4'-P-C4' energy: -114.224 flat angles P-C4'-P energy: -62.263 tors. eta vs tors. theta energy: -134.653 Dist. restrs. and SS energy: 23.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -1651.763122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.763122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.700417 (E_RNA) where: Base-Base interactions energy: -1157.527 where: short stacking energy: -490.257 Base-Backbone interact. energy: -0.679 local terms energy: -534.494065 where: bonds (distance) C4'-P energy: -106.519 bonds (distance) P-C4' energy: -105.948 flat angles C4'-P-C4' energy: -125.524 flat angles P-C4'-P energy: -78.342 tors. eta vs tors. theta energy: -118.161 Dist. restrs. and SS energy: 40.937 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -1626.793499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.793499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.143720 (E_RNA) where: Base-Base interactions energy: -1111.668 where: short stacking energy: -461.641 Base-Backbone interact. energy: -1.154 local terms energy: -548.322281 where: bonds (distance) C4'-P energy: -107.910 bonds (distance) P-C4' energy: -125.155 flat angles C4'-P-C4' energy: -126.835 flat angles P-C4'-P energy: -73.650 tors. eta vs tors. theta energy: -114.772 Dist. restrs. and SS energy: 34.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -1325.459762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.459762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.628841 (E_RNA) where: Base-Base interactions energy: -896.423 where: short stacking energy: -367.921 Base-Backbone interact. energy: -1.791 local terms energy: -485.414525 where: bonds (distance) C4'-P energy: -111.394 bonds (distance) P-C4' energy: -127.688 flat angles C4'-P-C4' energy: -105.289 flat angles P-C4'-P energy: -55.544 tors. eta vs tors. theta energy: -85.499 Dist. restrs. and SS energy: 58.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -2171.003910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2171.003910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.894586 (E_RNA) where: Base-Base interactions energy: -1519.562 where: short stacking energy: -618.657 Base-Backbone interact. energy: -4.575 local terms energy: -676.757605 where: bonds (distance) C4'-P energy: -123.787 bonds (distance) P-C4' energy: -149.010 flat angles C4'-P-C4' energy: -152.195 flat angles P-C4'-P energy: -101.436 tors. eta vs tors. theta energy: -150.330 Dist. restrs. and SS energy: 29.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -2046.393132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.393132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2071.903920 (E_RNA) where: Base-Base interactions energy: -1420.848 where: short stacking energy: -596.769 Base-Backbone interact. energy: 0.699 local terms energy: -651.754763 where: bonds (distance) C4'-P energy: -134.146 bonds (distance) P-C4' energy: -144.837 flat angles C4'-P-C4' energy: -151.370 flat angles P-C4'-P energy: -89.964 tors. eta vs tors. theta energy: -131.438 Dist. restrs. and SS energy: 25.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -2071.626340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2071.626340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.035715 (E_RNA) where: Base-Base interactions energy: -1450.246 where: short stacking energy: -605.764 Base-Backbone interact. energy: -1.972 local terms energy: -659.817624 where: bonds (distance) C4'-P energy: -129.706 bonds (distance) P-C4' energy: -144.315 flat angles C4'-P-C4' energy: -143.230 flat angles P-C4'-P energy: -90.738 tors. eta vs tors. theta energy: -151.829 Dist. restrs. and SS energy: 40.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1916.610114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1916.610114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.964341 (E_RNA) where: Base-Base interactions energy: -1326.529 where: short stacking energy: -550.865 Base-Backbone interact. energy: -3.193 local terms energy: -614.242593 where: bonds (distance) C4'-P energy: -132.963 bonds (distance) P-C4' energy: -145.776 flat angles C4'-P-C4' energy: -130.166 flat angles P-C4'-P energy: -75.369 tors. eta vs tors. theta energy: -129.967 Dist. restrs. and SS energy: 27.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -2096.653046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2096.653046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2117.993199 (E_RNA) where: Base-Base interactions energy: -1429.721 where: short stacking energy: -607.544 Base-Backbone interact. energy: -2.032 local terms energy: -686.240098 where: bonds (distance) C4'-P energy: -141.829 bonds (distance) P-C4' energy: -141.764 flat angles C4'-P-C4' energy: -157.317 flat angles P-C4'-P energy: -85.288 tors. eta vs tors. theta energy: -160.043 Dist. restrs. and SS energy: 21.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1640.207165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.207165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1670.942670 (E_RNA) where: Base-Base interactions energy: -1096.796 where: short stacking energy: -443.057 Base-Backbone interact. energy: -2.061 local terms energy: -572.085724 where: bonds (distance) C4'-P energy: -126.625 bonds (distance) P-C4' energy: -129.285 flat angles C4'-P-C4' energy: -138.672 flat angles P-C4'-P energy: -82.014 tors. eta vs tors. theta energy: -95.490 Dist. restrs. and SS energy: 30.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1855.944005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1855.944005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1892.569213 (E_RNA) where: Base-Base interactions energy: -1285.754 where: short stacking energy: -515.247 Base-Backbone interact. energy: -1.069 local terms energy: -605.745450 where: bonds (distance) C4'-P energy: -131.633 bonds (distance) P-C4' energy: -121.250 flat angles C4'-P-C4' energy: -142.593 flat angles P-C4'-P energy: -69.861 tors. eta vs tors. theta energy: -140.409 Dist. restrs. and SS energy: 36.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -1717.151336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.151336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.561762 (E_RNA) where: Base-Base interactions energy: -1208.684 where: short stacking energy: -492.172 Base-Backbone interact. energy: -1.336 local terms energy: -537.541622 where: bonds (distance) C4'-P energy: -101.885 bonds (distance) P-C4' energy: -120.776 flat angles C4'-P-C4' energy: -125.103 flat angles P-C4'-P energy: -74.149 tors. eta vs tors. theta energy: -115.628 Dist. restrs. and SS energy: 30.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -1706.406061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.406061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.697437 (E_RNA) where: Base-Base interactions energy: -1207.292 where: short stacking energy: -462.113 Base-Backbone interact. energy: 1.090 local terms energy: -523.496136 where: bonds (distance) C4'-P energy: -92.353 bonds (distance) P-C4' energy: -120.838 flat angles C4'-P-C4' energy: -113.112 flat angles P-C4'-P energy: -78.513 tors. eta vs tors. theta energy: -118.680 Dist. restrs. and SS energy: 23.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -1556.624472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.624472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.324613 (E_RNA) where: Base-Base interactions energy: -1085.290 where: short stacking energy: -421.330 Base-Backbone interact. energy: 4.391 local terms energy: -496.425632 where: bonds (distance) C4'-P energy: -109.452 bonds (distance) P-C4' energy: -110.149 flat angles C4'-P-C4' energy: -104.391 flat angles P-C4'-P energy: -63.621 tors. eta vs tors. theta energy: -108.813 Dist. restrs. and SS energy: 20.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -2239.345778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2239.345778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.559021 (E_RNA) where: Base-Base interactions energy: -1542.297 where: short stacking energy: -659.070 Base-Backbone interact. energy: -1.339 local terms energy: -717.923130 where: bonds (distance) C4'-P energy: -140.569 bonds (distance) P-C4' energy: -155.102 flat angles C4'-P-C4' energy: -146.427 flat angles P-C4'-P energy: -110.818 tors. eta vs tors. theta energy: -165.007 Dist. restrs. and SS energy: 22.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -2143.137254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2143.137254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2172.393025 (E_RNA) where: Base-Base interactions energy: -1486.544 where: short stacking energy: -632.095 Base-Backbone interact. energy: 4.889 local terms energy: -690.737842 where: bonds (distance) C4'-P energy: -142.730 bonds (distance) P-C4' energy: -140.983 flat angles C4'-P-C4' energy: -146.864 flat angles P-C4'-P energy: -92.702 tors. eta vs tors. theta energy: -167.458 Dist. restrs. and SS energy: 29.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -2050.387861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2050.387861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2073.489621 (E_RNA) where: Base-Base interactions energy: -1404.661 where: short stacking energy: -580.632 Base-Backbone interact. energy: -0.909 local terms energy: -667.919918 where: bonds (distance) C4'-P energy: -151.638 bonds (distance) P-C4' energy: -142.521 flat angles C4'-P-C4' energy: -148.951 flat angles P-C4'-P energy: -86.126 tors. eta vs tors. theta energy: -138.683 Dist. restrs. and SS energy: 23.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -2195.635640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2195.635640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.244042 (E_RNA) where: Base-Base interactions energy: -1537.615 where: short stacking energy: -616.838 Base-Backbone interact. energy: -0.761 local terms energy: -672.867636 where: bonds (distance) C4'-P energy: -131.223 bonds (distance) P-C4' energy: -160.076 flat angles C4'-P-C4' energy: -136.657 flat angles P-C4'-P energy: -75.752 tors. eta vs tors. theta energy: -169.160 Dist. restrs. and SS energy: 15.608 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1889.334423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1889.334423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.701299 (E_RNA) where: Base-Base interactions energy: -1294.824 where: short stacking energy: -529.974 Base-Backbone interact. energy: 1.611 local terms energy: -624.488929 where: bonds (distance) C4'-P energy: -121.235 bonds (distance) P-C4' energy: -144.086 flat angles C4'-P-C4' energy: -130.983 flat angles P-C4'-P energy: -91.756 tors. eta vs tors. theta energy: -136.429 Dist. restrs. and SS energy: 28.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1992.062084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1992.062084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.782283 (E_RNA) where: Base-Base interactions energy: -1360.320 where: short stacking energy: -558.688 Base-Backbone interact. energy: -3.152 local terms energy: -648.310718 where: bonds (distance) C4'-P energy: -120.898 bonds (distance) P-C4' energy: -149.652 flat angles C4'-P-C4' energy: -131.763 flat angles P-C4'-P energy: -97.835 tors. eta vs tors. theta energy: -148.163 Dist. restrs. and SS energy: 19.720 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1630.016898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.016898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.308550 (E_RNA) where: Base-Base interactions energy: -1119.347 where: short stacking energy: -488.954 Base-Backbone interact. energy: -3.551 local terms energy: -545.410493 where: bonds (distance) C4'-P energy: -94.146 bonds (distance) P-C4' energy: -124.945 flat angles C4'-P-C4' energy: -133.715 flat angles P-C4'-P energy: -73.810 tors. eta vs tors. theta energy: -118.795 Dist. restrs. and SS energy: 38.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -1823.937942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1823.937942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1844.876193 (E_RNA) where: Base-Base interactions energy: -1286.868 where: short stacking energy: -520.799 Base-Backbone interact. energy: 0.308 local terms energy: -558.316358 where: bonds (distance) C4'-P energy: -104.219 bonds (distance) P-C4' energy: -124.365 flat angles C4'-P-C4' energy: -108.263 flat angles P-C4'-P energy: -89.193 tors. eta vs tors. theta energy: -132.277 Dist. restrs. and SS energy: 20.938 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -1652.967570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.967570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.711181 (E_RNA) where: Base-Base interactions energy: -1127.248 where: short stacking energy: -476.786 Base-Backbone interact. energy: -3.533 local terms energy: -557.930536 where: bonds (distance) C4'-P energy: -113.041 bonds (distance) P-C4' energy: -130.379 flat angles C4'-P-C4' energy: -133.347 flat angles P-C4'-P energy: -59.844 tors. eta vs tors. theta energy: -121.320 Dist. restrs. and SS energy: 35.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -1554.181646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.181646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.853985 (E_RNA) where: Base-Base interactions energy: -1097.340 where: short stacking energy: -435.754 Base-Backbone interact. energy: -3.129 local terms energy: -500.385203 where: bonds (distance) C4'-P energy: -121.780 bonds (distance) P-C4' energy: -112.190 flat angles C4'-P-C4' energy: -92.410 flat angles P-C4'-P energy: -63.510 tors. eta vs tors. theta energy: -110.496 Dist. restrs. and SS energy: 46.672 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -2296.373878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2296.373878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2310.891105 (E_RNA) where: Base-Base interactions energy: -1598.240 where: short stacking energy: -640.265 Base-Backbone interact. energy: -1.887 local terms energy: -710.764485 where: bonds (distance) C4'-P energy: -144.611 bonds (distance) P-C4' energy: -159.535 flat angles C4'-P-C4' energy: -155.164 flat angles P-C4'-P energy: -101.081 tors. eta vs tors. theta energy: -150.373 Dist. restrs. and SS energy: 14.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -2227.171636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2227.171636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2257.566377 (E_RNA) where: Base-Base interactions energy: -1582.601 where: short stacking energy: -640.093 Base-Backbone interact. energy: 0.450 local terms energy: -675.415016 where: bonds (distance) C4'-P energy: -131.255 bonds (distance) P-C4' energy: -141.050 flat angles C4'-P-C4' energy: -148.297 flat angles P-C4'-P energy: -89.655 tors. eta vs tors. theta energy: -165.158 Dist. restrs. and SS energy: 30.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -2272.439551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2272.439551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2285.488592 (E_RNA) where: Base-Base interactions energy: -1592.993 where: short stacking energy: -658.186 Base-Backbone interact. energy: -2.642 local terms energy: -689.853286 where: bonds (distance) C4'-P energy: -130.628 bonds (distance) P-C4' energy: -150.414 flat angles C4'-P-C4' energy: -138.139 flat angles P-C4'-P energy: -92.594 tors. eta vs tors. theta energy: -178.077 Dist. restrs. and SS energy: 13.049 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1983.459616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.459616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.810071 (E_RNA) where: Base-Base interactions energy: -1352.319 where: short stacking energy: -577.809 Base-Backbone interact. energy: -3.324 local terms energy: -657.166890 where: bonds (distance) C4'-P energy: -116.646 bonds (distance) P-C4' energy: -153.625 flat angles C4'-P-C4' energy: -144.905 flat angles P-C4'-P energy: -90.550 tors. eta vs tors. theta energy: -151.442 Dist. restrs. and SS energy: 29.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -2075.470867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2075.470867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2094.313217 (E_RNA) where: Base-Base interactions energy: -1444.915 where: short stacking energy: -575.899 Base-Backbone interact. energy: -2.074 local terms energy: -647.323935 where: bonds (distance) C4'-P energy: -123.405 bonds (distance) P-C4' energy: -136.380 flat angles C4'-P-C4' energy: -148.687 flat angles P-C4'-P energy: -92.687 tors. eta vs tors. theta energy: -146.166 Dist. restrs. and SS energy: 18.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1798.432624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1798.432624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.143891 (E_RNA) where: Base-Base interactions energy: -1237.362 where: short stacking energy: -492.270 Base-Backbone interact. energy: -2.350 local terms energy: -584.431707 where: bonds (distance) C4'-P energy: -122.276 bonds (distance) P-C4' energy: -124.977 flat angles C4'-P-C4' energy: -128.716 flat angles P-C4'-P energy: -74.507 tors. eta vs tors. theta energy: -133.957 Dist. restrs. and SS energy: 25.711 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1973.702165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1973.702165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.242975 (E_RNA) where: Base-Base interactions energy: -1410.223 where: short stacking energy: -577.534 Base-Backbone interact. energy: -0.977 local terms energy: -582.042790 where: bonds (distance) C4'-P energy: -119.258 bonds (distance) P-C4' energy: -113.803 flat angles C4'-P-C4' energy: -125.203 flat angles P-C4'-P energy: -86.540 tors. eta vs tors. theta energy: -137.238 Dist. restrs. and SS energy: 19.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1592.780819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.780819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.821696 (E_RNA) where: Base-Base interactions energy: -1103.542 where: short stacking energy: -467.651 Base-Backbone interact. energy: 2.346 local terms energy: -529.625450 where: bonds (distance) C4'-P energy: -112.188 bonds (distance) P-C4' energy: -113.257 flat angles C4'-P-C4' energy: -112.054 flat angles P-C4'-P energy: -80.073 tors. eta vs tors. theta energy: -112.053 Dist. restrs. and SS energy: 38.041 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -1785.759856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1785.759856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1817.400604 (E_RNA) where: Base-Base interactions energy: -1262.191 where: short stacking energy: -517.388 Base-Backbone interact. energy: 1.353 local terms energy: -556.562013 where: bonds (distance) C4'-P energy: -127.992 bonds (distance) P-C4' energy: -112.676 flat angles C4'-P-C4' energy: -114.835 flat angles P-C4'-P energy: -64.982 tors. eta vs tors. theta energy: -136.078 Dist. restrs. and SS energy: 31.641 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -1659.821358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.821358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.625120 (E_RNA) where: Base-Base interactions energy: -1193.484 where: short stacking energy: -500.757 Base-Backbone interact. energy: -1.249 local terms energy: -506.892458 where: bonds (distance) C4'-P energy: -100.866 bonds (distance) P-C4' energy: -93.742 flat angles C4'-P-C4' energy: -117.750 flat angles P-C4'-P energy: -67.581 tors. eta vs tors. theta energy: -126.953 Dist. restrs. and SS energy: 41.804 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -2343.418135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2343.418135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2357.170384 (E_RNA) where: Base-Base interactions energy: -1624.340 where: short stacking energy: -672.185 Base-Backbone interact. energy: 0.539 local terms energy: -733.369615 where: bonds (distance) C4'-P energy: -154.904 bonds (distance) P-C4' energy: -156.575 flat angles C4'-P-C4' energy: -162.094 flat angles P-C4'-P energy: -98.616 tors. eta vs tors. theta energy: -161.181 Dist. restrs. and SS energy: 13.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -2357.781524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2357.781524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.000246 (E_RNA) where: Base-Base interactions energy: -1618.143 where: short stacking energy: -705.600 Base-Backbone interact. energy: -0.622 local terms energy: -754.234728 where: bonds (distance) C4'-P energy: -132.679 bonds (distance) P-C4' energy: -164.101 flat angles C4'-P-C4' energy: -157.561 flat angles P-C4'-P energy: -107.323 tors. eta vs tors. theta energy: -192.571 Dist. restrs. and SS energy: 15.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -2223.414214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2223.414214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.447572 (E_RNA) where: Base-Base interactions energy: -1540.485 where: short stacking energy: -643.089 Base-Backbone interact. energy: -1.286 local terms energy: -718.676241 where: bonds (distance) C4'-P energy: -138.680 bonds (distance) P-C4' energy: -149.207 flat angles C4'-P-C4' energy: -152.586 flat angles P-C4'-P energy: -98.667 tors. eta vs tors. theta energy: -179.537 Dist. restrs. and SS energy: 37.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -2162.388170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.388170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2185.252170 (E_RNA) where: Base-Base interactions energy: -1480.999 where: short stacking energy: -646.129 Base-Backbone interact. energy: 0.098 local terms energy: -704.351140 where: bonds (distance) C4'-P energy: -127.688 bonds (distance) P-C4' energy: -137.746 flat angles C4'-P-C4' energy: -149.222 flat angles P-C4'-P energy: -107.943 tors. eta vs tors. theta energy: -181.752 Dist. restrs. and SS energy: 22.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -2033.714321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.714321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2052.128242 (E_RNA) where: Base-Base interactions energy: -1397.675 where: short stacking energy: -556.686 Base-Backbone interact. energy: -1.183 local terms energy: -653.269918 where: bonds (distance) C4'-P energy: -140.145 bonds (distance) P-C4' energy: -136.960 flat angles C4'-P-C4' energy: -139.211 flat angles P-C4'-P energy: -85.111 tors. eta vs tors. theta energy: -151.842 Dist. restrs. and SS energy: 18.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -2053.541429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2053.541429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2064.433233 (E_RNA) where: Base-Base interactions energy: -1431.713 where: short stacking energy: -563.964 Base-Backbone interact. energy: -0.350 local terms energy: -632.369967 where: bonds (distance) C4'-P energy: -122.449 bonds (distance) P-C4' energy: -132.022 flat angles C4'-P-C4' energy: -142.682 flat angles P-C4'-P energy: -85.810 tors. eta vs tors. theta energy: -149.407 Dist. restrs. and SS energy: 10.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1898.714386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1898.714386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.828254 (E_RNA) where: Base-Base interactions energy: -1308.315 where: short stacking energy: -546.058 Base-Backbone interact. energy: -1.545 local terms energy: -608.967445 where: bonds (distance) C4'-P energy: -117.940 bonds (distance) P-C4' energy: -117.267 flat angles C4'-P-C4' energy: -143.660 flat angles P-C4'-P energy: -83.506 tors. eta vs tors. theta energy: -146.595 Dist. restrs. and SS energy: 20.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1840.043483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1840.043483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.513897 (E_RNA) where: Base-Base interactions energy: -1285.503 where: short stacking energy: -523.707 Base-Backbone interact. energy: -1.822 local terms energy: -586.188742 where: bonds (distance) C4'-P energy: -110.169 bonds (distance) P-C4' energy: -119.637 flat angles C4'-P-C4' energy: -143.128 flat angles P-C4'-P energy: -79.751 tors. eta vs tors. theta energy: -133.503 Dist. restrs. and SS energy: 33.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -1613.448274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.448274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.754675 (E_RNA) where: Base-Base interactions energy: -1105.534 where: short stacking energy: -433.384 Base-Backbone interact. energy: -2.150 local terms energy: -545.069877 where: bonds (distance) C4'-P energy: -111.879 bonds (distance) P-C4' energy: -111.259 flat angles C4'-P-C4' energy: -143.815 flat angles P-C4'-P energy: -69.730 tors. eta vs tors. theta energy: -108.386 Dist. restrs. and SS energy: 39.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -1733.668501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.668501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.929080 (E_RNA) where: Base-Base interactions energy: -1207.570 where: short stacking energy: -495.679 Base-Backbone interact. energy: 1.598 local terms energy: -552.956734 where: bonds (distance) C4'-P energy: -100.873 bonds (distance) P-C4' energy: -115.751 flat angles C4'-P-C4' energy: -121.867 flat angles P-C4'-P energy: -77.389 tors. eta vs tors. theta energy: -137.076 Dist. restrs. and SS energy: 25.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -2418.562178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2418.562178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2432.293702 (E_RNA) where: Base-Base interactions energy: -1684.663 where: short stacking energy: -715.627 Base-Backbone interact. energy: 0.217 local terms energy: -747.848183 where: bonds (distance) C4'-P energy: -157.085 bonds (distance) P-C4' energy: -148.629 flat angles C4'-P-C4' energy: -153.596 flat angles P-C4'-P energy: -95.577 tors. eta vs tors. theta energy: -192.962 Dist. restrs. and SS energy: 13.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -2284.398267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2284.398267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2297.049430 (E_RNA) where: Base-Base interactions energy: -1557.915 where: short stacking energy: -642.864 Base-Backbone interact. energy: -2.682 local terms energy: -736.452853 where: bonds (distance) C4'-P energy: -157.453 bonds (distance) P-C4' energy: -158.417 flat angles C4'-P-C4' energy: -153.693 flat angles P-C4'-P energy: -94.489 tors. eta vs tors. theta energy: -172.401 Dist. restrs. and SS energy: 12.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -2249.761711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2249.761711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.240771 (E_RNA) where: Base-Base interactions energy: -1582.250 where: short stacking energy: -674.497 Base-Backbone interact. energy: -1.909 local terms energy: -691.081587 where: bonds (distance) C4'-P energy: -119.904 bonds (distance) P-C4' energy: -145.982 flat angles C4'-P-C4' energy: -152.938 flat angles P-C4'-P energy: -95.052 tors. eta vs tors. theta energy: -177.206 Dist. restrs. and SS energy: 25.479 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -2139.447452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2139.447452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.027254 (E_RNA) where: Base-Base interactions energy: -1509.745 where: short stacking energy: -613.521 Base-Backbone interact. energy: -4.338 local terms energy: -659.943830 where: bonds (distance) C4'-P energy: -129.681 bonds (distance) P-C4' energy: -128.293 flat angles C4'-P-C4' energy: -143.089 flat angles P-C4'-P energy: -82.264 tors. eta vs tors. theta energy: -176.617 Dist. restrs. and SS energy: 34.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -2112.458237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.458237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.273747 (E_RNA) where: Base-Base interactions energy: -1496.699 where: short stacking energy: -622.016 Base-Backbone interact. energy: -3.449 local terms energy: -628.125589 where: bonds (distance) C4'-P energy: -124.853 bonds (distance) P-C4' energy: -117.311 flat angles C4'-P-C4' energy: -139.079 flat angles P-C4'-P energy: -86.265 tors. eta vs tors. theta energy: -160.617 Dist. restrs. and SS energy: 15.816 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1970.871278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.871278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1989.350946 (E_RNA) where: Base-Base interactions energy: -1399.719 where: short stacking energy: -562.380 Base-Backbone interact. energy: -2.733 local terms energy: -586.898874 where: bonds (distance) C4'-P energy: -118.265 bonds (distance) P-C4' energy: -106.157 flat angles C4'-P-C4' energy: -138.672 flat angles P-C4'-P energy: -75.269 tors. eta vs tors. theta energy: -148.535 Dist. restrs. and SS energy: 18.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1955.319185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1955.319185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1969.281928 (E_RNA) where: Base-Base interactions energy: -1387.310 where: short stacking energy: -539.701 Base-Backbone interact. energy: 0.912 local terms energy: -582.883678 where: bonds (distance) C4'-P energy: -121.099 bonds (distance) P-C4' energy: -123.381 flat angles C4'-P-C4' energy: -128.144 flat angles P-C4'-P energy: -71.081 tors. eta vs tors. theta energy: -139.179 Dist. restrs. and SS energy: 13.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -1859.650885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1859.650885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1884.733372 (E_RNA) where: Base-Base interactions energy: -1305.040 where: short stacking energy: -558.767 Base-Backbone interact. energy: 2.553 local terms energy: -582.246922 where: bonds (distance) C4'-P energy: -109.294 bonds (distance) P-C4' energy: -128.806 flat angles C4'-P-C4' energy: -116.284 flat angles P-C4'-P energy: -84.864 tors. eta vs tors. theta energy: -142.999 Dist. restrs. and SS energy: 25.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1776.329364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.329364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1808.637975 (E_RNA) where: Base-Base interactions energy: -1238.867 where: short stacking energy: -495.665 Base-Backbone interact. energy: -2.898 local terms energy: -566.873313 where: bonds (distance) C4'-P energy: -116.864 bonds (distance) P-C4' energy: -123.077 flat angles C4'-P-C4' energy: -96.235 flat angles P-C4'-P energy: -74.817 tors. eta vs tors. theta energy: -155.881 Dist. restrs. and SS energy: 32.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -1547.997122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.997122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.159018 (E_RNA) where: Base-Base interactions energy: -1070.040 where: short stacking energy: -412.432 Base-Backbone interact. energy: 0.779 local terms energy: -520.897961 where: bonds (distance) C4'-P energy: -120.670 bonds (distance) P-C4' energy: -123.275 flat angles C4'-P-C4' energy: -118.353 flat angles P-C4'-P energy: -65.941 tors. eta vs tors. theta energy: -92.659 Dist. restrs. and SS energy: 42.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -2424.326890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2424.326890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2440.944869 (E_RNA) where: Base-Base interactions energy: -1669.429 where: short stacking energy: -694.831 Base-Backbone interact. energy: -1.299 local terms energy: -770.216531 where: bonds (distance) C4'-P energy: -154.860 bonds (distance) P-C4' energy: -154.846 flat angles C4'-P-C4' energy: -167.686 flat angles P-C4'-P energy: -99.350 tors. eta vs tors. theta energy: -193.474 Dist. restrs. and SS energy: 16.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -2334.722145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2334.722145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2349.235921 (E_RNA) where: Base-Base interactions energy: -1647.229 where: short stacking energy: -679.422 Base-Backbone interact. energy: 0.633 local terms energy: -702.639713 where: bonds (distance) C4'-P energy: -131.767 bonds (distance) P-C4' energy: -143.288 flat angles C4'-P-C4' energy: -151.104 flat angles P-C4'-P energy: -100.855 tors. eta vs tors. theta energy: -175.627 Dist. restrs. and SS energy: 14.514 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -2290.308866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2290.308866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2308.035347 (E_RNA) where: Base-Base interactions energy: -1609.497 where: short stacking energy: -691.898 Base-Backbone interact. energy: -1.159 local terms energy: -697.379482 where: bonds (distance) C4'-P energy: -134.289 bonds (distance) P-C4' energy: -123.093 flat angles C4'-P-C4' energy: -161.975 flat angles P-C4'-P energy: -97.057 tors. eta vs tors. theta energy: -180.964 Dist. restrs. and SS energy: 17.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -2245.863508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2245.863508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.739966 (E_RNA) where: Base-Base interactions energy: -1559.883 where: short stacking energy: -636.651 Base-Backbone interact. energy: -3.333 local terms energy: -698.523942 where: bonds (distance) C4'-P energy: -137.663 bonds (distance) P-C4' energy: -153.268 flat angles C4'-P-C4' energy: -150.768 flat angles P-C4'-P energy: -80.610 tors. eta vs tors. theta energy: -176.214 Dist. restrs. and SS energy: 15.876 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -2119.338893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2119.338893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2166.145502 (E_RNA) where: Base-Base interactions energy: -1500.821 where: short stacking energy: -604.673 Base-Backbone interact. energy: -0.693 local terms energy: -664.631805 where: bonds (distance) C4'-P energy: -124.235 bonds (distance) P-C4' energy: -136.625 flat angles C4'-P-C4' energy: -154.820 flat angles P-C4'-P energy: -88.276 tors. eta vs tors. theta energy: -160.676 Dist. restrs. and SS energy: 46.807 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -2031.732896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2031.732896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2053.294271 (E_RNA) where: Base-Base interactions energy: -1415.067 where: short stacking energy: -597.749 Base-Backbone interact. energy: -1.874 local terms energy: -636.353339 where: bonds (distance) C4'-P energy: -140.549 bonds (distance) P-C4' energy: -113.514 flat angles C4'-P-C4' energy: -129.306 flat angles P-C4'-P energy: -85.214 tors. eta vs tors. theta energy: -167.771 Dist. restrs. and SS energy: 21.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1914.499510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.499510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.462384 (E_RNA) where: Base-Base interactions energy: -1323.282 where: short stacking energy: -538.463 Base-Backbone interact. energy: -2.057 local terms energy: -606.123397 where: bonds (distance) C4'-P energy: -122.757 bonds (distance) P-C4' energy: -125.751 flat angles C4'-P-C4' energy: -135.905 flat angles P-C4'-P energy: -86.373 tors. eta vs tors. theta energy: -135.336 Dist. restrs. and SS energy: 16.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1993.634846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.634846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.884493 (E_RNA) where: Base-Base interactions energy: -1376.607 where: short stacking energy: -562.205 Base-Backbone interact. energy: 0.347 local terms energy: -639.624824 where: bonds (distance) C4'-P energy: -142.821 bonds (distance) P-C4' energy: -140.868 flat angles C4'-P-C4' energy: -114.212 flat angles P-C4'-P energy: -85.991 tors. eta vs tors. theta energy: -155.732 Dist. restrs. and SS energy: 22.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1778.772968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1778.772968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.809736 (E_RNA) where: Base-Base interactions energy: -1245.938 where: short stacking energy: -508.762 Base-Backbone interact. energy: -2.880 local terms energy: -551.991878 where: bonds (distance) C4'-P energy: -116.571 bonds (distance) P-C4' energy: -116.760 flat angles C4'-P-C4' energy: -136.371 flat angles P-C4'-P energy: -58.252 tors. eta vs tors. theta energy: -124.037 Dist. restrs. and SS energy: 22.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -1615.832095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.832095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.266915 (E_RNA) where: Base-Base interactions energy: -1131.557 where: short stacking energy: -452.113 Base-Backbone interact. energy: -1.216 local terms energy: -518.494674 where: bonds (distance) C4'-P energy: -102.045 bonds (distance) P-C4' energy: -123.640 flat angles C4'-P-C4' energy: -119.907 flat angles P-C4'-P energy: -62.335 tors. eta vs tors. theta energy: -110.567 Dist. restrs. and SS energy: 35.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -2431.484475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2431.484475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2443.380746 (E_RNA) where: Base-Base interactions energy: -1706.503 where: short stacking energy: -708.863 Base-Backbone interact. energy: -0.065 local terms energy: -736.813528 where: bonds (distance) C4'-P energy: -131.800 bonds (distance) P-C4' energy: -142.425 flat angles C4'-P-C4' energy: -158.026 flat angles P-C4'-P energy: -116.966 tors. eta vs tors. theta energy: -187.596 Dist. restrs. and SS energy: 11.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -2366.956223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.956223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.743567 (E_RNA) where: Base-Base interactions energy: -1679.383 where: short stacking energy: -707.738 Base-Backbone interact. energy: -2.598 local terms energy: -699.762693 where: bonds (distance) C4'-P energy: -141.197 bonds (distance) P-C4' energy: -134.527 flat angles C4'-P-C4' energy: -156.040 flat angles P-C4'-P energy: -86.312 tors. eta vs tors. theta energy: -181.687 Dist. restrs. and SS energy: 14.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -2328.463869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2328.463869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.323553 (E_RNA) where: Base-Base interactions energy: -1641.156 where: short stacking energy: -669.337 Base-Backbone interact. energy: -1.683 local terms energy: -697.485115 where: bonds (distance) C4'-P energy: -126.269 bonds (distance) P-C4' energy: -143.538 flat angles C4'-P-C4' energy: -156.650 flat angles P-C4'-P energy: -91.109 tors. eta vs tors. theta energy: -179.919 Dist. restrs. and SS energy: 11.860 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -2248.533358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2248.533358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2268.680050 (E_RNA) where: Base-Base interactions energy: -1557.732 where: short stacking energy: -665.851 Base-Backbone interact. energy: -2.561 local terms energy: -708.387510 where: bonds (distance) C4'-P energy: -132.298 bonds (distance) P-C4' energy: -125.085 flat angles C4'-P-C4' energy: -157.007 flat angles P-C4'-P energy: -99.782 tors. eta vs tors. theta energy: -194.216 Dist. restrs. and SS energy: 20.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -2084.717191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2084.717191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2105.590565 (E_RNA) where: Base-Base interactions energy: -1428.868 where: short stacking energy: -603.217 Base-Backbone interact. energy: -4.450 local terms energy: -672.272808 where: bonds (distance) C4'-P energy: -128.896 bonds (distance) P-C4' energy: -129.924 flat angles C4'-P-C4' energy: -148.048 flat angles P-C4'-P energy: -86.320 tors. eta vs tors. theta energy: -179.086 Dist. restrs. and SS energy: 20.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -2030.448976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2030.448976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2073.609655 (E_RNA) where: Base-Base interactions energy: -1441.851 where: short stacking energy: -567.378 Base-Backbone interact. energy: -0.297 local terms energy: -631.460827 where: bonds (distance) C4'-P energy: -131.008 bonds (distance) P-C4' energy: -140.999 flat angles C4'-P-C4' energy: -124.327 flat angles P-C4'-P energy: -70.773 tors. eta vs tors. theta energy: -164.354 Dist. restrs. and SS energy: 43.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -2007.949704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2007.949704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2030.134116 (E_RNA) where: Base-Base interactions energy: -1379.649 where: short stacking energy: -563.638 Base-Backbone interact. energy: -2.907 local terms energy: -647.578132 where: bonds (distance) C4'-P energy: -132.871 bonds (distance) P-C4' energy: -148.284 flat angles C4'-P-C4' energy: -135.019 flat angles P-C4'-P energy: -83.968 tors. eta vs tors. theta energy: -147.435 Dist. restrs. and SS energy: 22.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1937.369366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1937.369366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1956.220422 (E_RNA) where: Base-Base interactions energy: -1339.909 where: short stacking energy: -526.148 Base-Backbone interact. energy: -2.409 local terms energy: -613.903350 where: bonds (distance) C4'-P energy: -125.979 bonds (distance) P-C4' energy: -123.040 flat angles C4'-P-C4' energy: -138.026 flat angles P-C4'-P energy: -92.226 tors. eta vs tors. theta energy: -134.632 Dist. restrs. and SS energy: 18.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1851.869078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1851.869078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1880.257218 (E_RNA) where: Base-Base interactions energy: -1276.531 where: short stacking energy: -536.699 Base-Backbone interact. energy: -3.333 local terms energy: -600.393732 where: bonds (distance) C4'-P energy: -118.839 bonds (distance) P-C4' energy: -139.414 flat angles C4'-P-C4' energy: -122.392 flat angles P-C4'-P energy: -77.977 tors. eta vs tors. theta energy: -141.772 Dist. restrs. and SS energy: 28.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -1567.135156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.135156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.643677 (E_RNA) where: Base-Base interactions energy: -1094.257 where: short stacking energy: -465.228 Base-Backbone interact. energy: 2.198 local terms energy: -519.584555 where: bonds (distance) C4'-P energy: -123.087 bonds (distance) P-C4' energy: -132.237 flat angles C4'-P-C4' energy: -117.955 flat angles P-C4'-P energy: -40.692 tors. eta vs tors. theta energy: -105.614 Dist. restrs. and SS energy: 44.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -2463.366767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2463.366767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2474.611599 (E_RNA) where: Base-Base interactions energy: -1710.127 where: short stacking energy: -709.884 Base-Backbone interact. energy: -2.591 local terms energy: -761.894009 where: bonds (distance) C4'-P energy: -159.408 bonds (distance) P-C4' energy: -167.223 flat angles C4'-P-C4' energy: -155.836 flat angles P-C4'-P energy: -92.321 tors. eta vs tors. theta energy: -187.107 Dist. restrs. and SS energy: 11.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -2422.088901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2422.088901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2430.924539 (E_RNA) where: Base-Base interactions energy: -1702.470 where: short stacking energy: -702.516 Base-Backbone interact. energy: 3.450 local terms energy: -731.904142 where: bonds (distance) C4'-P energy: -151.307 bonds (distance) P-C4' energy: -145.311 flat angles C4'-P-C4' energy: -148.413 flat angles P-C4'-P energy: -97.026 tors. eta vs tors. theta energy: -189.847 Dist. restrs. and SS energy: 8.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -2288.167432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2288.167432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2304.467897 (E_RNA) where: Base-Base interactions energy: -1602.307 where: short stacking energy: -660.446 Base-Backbone interact. energy: -3.122 local terms energy: -699.039231 where: bonds (distance) C4'-P energy: -128.452 bonds (distance) P-C4' energy: -143.460 flat angles C4'-P-C4' energy: -146.587 flat angles P-C4'-P energy: -102.631 tors. eta vs tors. theta energy: -177.909 Dist. restrs. and SS energy: 16.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -2238.106044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2238.106044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.602449 (E_RNA) where: Base-Base interactions energy: -1549.879 where: short stacking energy: -675.798 Base-Backbone interact. energy: -3.448 local terms energy: -702.274966 where: bonds (distance) C4'-P energy: -120.098 bonds (distance) P-C4' energy: -143.811 flat angles C4'-P-C4' energy: -156.562 flat angles P-C4'-P energy: -98.089 tors. eta vs tors. theta energy: -183.716 Dist. restrs. and SS energy: 17.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -2040.914258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2040.914258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2065.386272 (E_RNA) where: Base-Base interactions energy: -1421.314 where: short stacking energy: -597.404 Base-Backbone interact. energy: 0.553 local terms energy: -644.624689 where: bonds (distance) C4'-P energy: -125.996 bonds (distance) P-C4' energy: -151.355 flat angles C4'-P-C4' energy: -129.547 flat angles P-C4'-P energy: -80.303 tors. eta vs tors. theta energy: -157.423 Dist. restrs. and SS energy: 24.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -2108.453023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2108.453023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2120.778652 (E_RNA) where: Base-Base interactions energy: -1482.561 where: short stacking energy: -596.009 Base-Backbone interact. energy: 0.794 local terms energy: -639.011724 where: bonds (distance) C4'-P energy: -113.113 bonds (distance) P-C4' energy: -131.006 flat angles C4'-P-C4' energy: -140.583 flat angles P-C4'-P energy: -80.943 tors. eta vs tors. theta energy: -173.368 Dist. restrs. and SS energy: 12.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1874.489412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1874.489412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1908.434552 (E_RNA) where: Base-Base interactions energy: -1321.452 where: short stacking energy: -545.084 Base-Backbone interact. energy: 1.325 local terms energy: -588.307713 where: bonds (distance) C4'-P energy: -124.496 bonds (distance) P-C4' energy: -125.071 flat angles C4'-P-C4' energy: -129.852 flat angles P-C4'-P energy: -73.410 tors. eta vs tors. theta energy: -135.479 Dist. restrs. and SS energy: 33.945 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1946.400547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1946.400547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.811806 (E_RNA) where: Base-Base interactions energy: -1385.971 where: short stacking energy: -548.760 Base-Backbone interact. energy: 0.005 local terms energy: -571.845612 where: bonds (distance) C4'-P energy: -98.639 bonds (distance) P-C4' energy: -130.989 flat angles C4'-P-C4' energy: -130.962 flat angles P-C4'-P energy: -63.691 tors. eta vs tors. theta energy: -147.564 Dist. restrs. and SS energy: 11.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1855.012421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1855.012421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.131245 (E_RNA) where: Base-Base interactions energy: -1301.234 where: short stacking energy: -545.079 Base-Backbone interact. energy: -2.907 local terms energy: -568.990069 where: bonds (distance) C4'-P energy: -106.342 bonds (distance) P-C4' energy: -112.559 flat angles C4'-P-C4' energy: -123.113 flat angles P-C4'-P energy: -72.499 tors. eta vs tors. theta energy: -154.476 Dist. restrs. and SS energy: 18.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -1651.424814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.424814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.266616 (E_RNA) where: Base-Base interactions energy: -1192.530 where: short stacking energy: -482.146 Base-Backbone interact. energy: -0.768 local terms energy: -493.968779 where: bonds (distance) C4'-P energy: -109.866 bonds (distance) P-C4' energy: -114.150 flat angles C4'-P-C4' energy: -83.851 flat angles P-C4'-P energy: -63.338 tors. eta vs tors. theta energy: -122.764 Dist. restrs. and SS energy: 35.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -2469.107825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2469.107825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2484.592325 (E_RNA) where: Base-Base interactions energy: -1732.104 where: short stacking energy: -738.780 Base-Backbone interact. energy: -5.257 local terms energy: -747.231956 where: bonds (distance) C4'-P energy: -136.622 bonds (distance) P-C4' energy: -143.855 flat angles C4'-P-C4' energy: -161.119 flat angles P-C4'-P energy: -105.322 tors. eta vs tors. theta energy: -200.314 Dist. restrs. and SS energy: 15.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -2421.024068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2421.024068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2431.370850 (E_RNA) where: Base-Base interactions energy: -1689.898 where: short stacking energy: -706.829 Base-Backbone interact. energy: 1.455 local terms energy: -742.926924 where: bonds (distance) C4'-P energy: -147.779 bonds (distance) P-C4' energy: -132.387 flat angles C4'-P-C4' energy: -170.105 flat angles P-C4'-P energy: -103.454 tors. eta vs tors. theta energy: -189.202 Dist. restrs. and SS energy: 10.347 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -2315.273115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2315.273115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2323.891194 (E_RNA) where: Base-Base interactions energy: -1624.294 where: short stacking energy: -678.640 Base-Backbone interact. energy: -1.985 local terms energy: -697.612877 where: bonds (distance) C4'-P energy: -119.258 bonds (distance) P-C4' energy: -143.694 flat angles C4'-P-C4' energy: -156.563 flat angles P-C4'-P energy: -91.275 tors. eta vs tors. theta energy: -186.824 Dist. restrs. and SS energy: 8.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -2257.086225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.086225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2266.347174 (E_RNA) where: Base-Base interactions energy: -1571.019 where: short stacking energy: -674.724 Base-Backbone interact. energy: -3.166 local terms energy: -692.162089 where: bonds (distance) C4'-P energy: -120.795 bonds (distance) P-C4' energy: -132.030 flat angles C4'-P-C4' energy: -144.899 flat angles P-C4'-P energy: -106.313 tors. eta vs tors. theta energy: -188.124 Dist. restrs. and SS energy: 9.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -2198.273982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2198.273982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2231.078500 (E_RNA) where: Base-Base interactions energy: -1521.755 where: short stacking energy: -665.551 Base-Backbone interact. energy: -1.194 local terms energy: -708.129127 where: bonds (distance) C4'-P energy: -133.538 bonds (distance) P-C4' energy: -144.083 flat angles C4'-P-C4' energy: -149.085 flat angles P-C4'-P energy: -95.590 tors. eta vs tors. theta energy: -185.833 Dist. restrs. and SS energy: 32.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -2034.928695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.928695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2059.563769 (E_RNA) where: Base-Base interactions energy: -1396.979 where: short stacking energy: -595.008 Base-Backbone interact. energy: -3.926 local terms energy: -658.658577 where: bonds (distance) C4'-P energy: -136.632 bonds (distance) P-C4' energy: -128.564 flat angles C4'-P-C4' energy: -148.484 flat angles P-C4'-P energy: -66.903 tors. eta vs tors. theta energy: -178.076 Dist. restrs. and SS energy: 24.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -2088.269180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.269180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2096.835970 (E_RNA) where: Base-Base interactions energy: -1470.797 where: short stacking energy: -591.095 Base-Backbone interact. energy: -0.739 local terms energy: -625.299855 where: bonds (distance) C4'-P energy: -114.066 bonds (distance) P-C4' energy: -140.184 flat angles C4'-P-C4' energy: -121.492 flat angles P-C4'-P energy: -83.427 tors. eta vs tors. theta energy: -166.131 Dist. restrs. and SS energy: 8.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1907.918563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.918563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1937.671311 (E_RNA) where: Base-Base interactions energy: -1347.076 where: short stacking energy: -525.940 Base-Backbone interact. energy: -0.025 local terms energy: -590.570619 where: bonds (distance) C4'-P energy: -108.209 bonds (distance) P-C4' energy: -131.569 flat angles C4'-P-C4' energy: -134.492 flat angles P-C4'-P energy: -74.105 tors. eta vs tors. theta energy: -142.196 Dist. restrs. and SS energy: 29.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1870.906693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1870.906693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.311709 (E_RNA) where: Base-Base interactions energy: -1344.432 where: short stacking energy: -535.365 Base-Backbone interact. energy: 3.120 local terms energy: -545.000067 where: bonds (distance) C4'-P energy: -103.166 bonds (distance) P-C4' energy: -116.463 flat angles C4'-P-C4' energy: -116.609 flat angles P-C4'-P energy: -84.535 tors. eta vs tors. theta energy: -124.227 Dist. restrs. and SS energy: 15.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -1654.899803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.899803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.444368 (E_RNA) where: Base-Base interactions energy: -1163.858 where: short stacking energy: -487.915 Base-Backbone interact. energy: 0.264 local terms energy: -523.850807 where: bonds (distance) C4'-P energy: -104.999 bonds (distance) P-C4' energy: -112.687 flat angles C4'-P-C4' energy: -115.955 flat angles P-C4'-P energy: -65.252 tors. eta vs tors. theta energy: -124.958 Dist. restrs. and SS energy: 32.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2487.007967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2487.007967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.990161 (E_RNA) where: Base-Base interactions energy: -1720.888 where: short stacking energy: -701.791 Base-Backbone interact. energy: -3.128 local terms energy: -775.974277 where: bonds (distance) C4'-P energy: -145.359 bonds (distance) P-C4' energy: -156.711 flat angles C4'-P-C4' energy: -167.093 flat angles P-C4'-P energy: -109.591 tors. eta vs tors. theta energy: -197.221 Dist. restrs. and SS energy: 12.982 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -2382.428941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2382.428941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2388.580144 (E_RNA) where: Base-Base interactions energy: -1652.567 where: short stacking energy: -692.481 Base-Backbone interact. energy: -1.682 local terms energy: -734.331215 where: bonds (distance) C4'-P energy: -149.103 bonds (distance) P-C4' energy: -148.570 flat angles C4'-P-C4' energy: -156.921 flat angles P-C4'-P energy: -92.883 tors. eta vs tors. theta energy: -186.855 Dist. restrs. and SS energy: 6.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -2253.031980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2253.031980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2269.201896 (E_RNA) where: Base-Base interactions energy: -1552.873 where: short stacking energy: -646.600 Base-Backbone interact. energy: -0.404 local terms energy: -715.925325 where: bonds (distance) C4'-P energy: -146.110 bonds (distance) P-C4' energy: -135.557 flat angles C4'-P-C4' energy: -151.667 flat angles P-C4'-P energy: -94.753 tors. eta vs tors. theta energy: -187.838 Dist. restrs. and SS energy: 16.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -2315.383663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2315.383663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2322.079923 (E_RNA) where: Base-Base interactions energy: -1608.765 where: short stacking energy: -659.589 Base-Backbone interact. energy: -0.382 local terms energy: -712.932082 where: bonds (distance) C4'-P energy: -135.112 bonds (distance) P-C4' energy: -147.672 flat angles C4'-P-C4' energy: -152.945 flat angles P-C4'-P energy: -82.509 tors. eta vs tors. theta energy: -194.694 Dist. restrs. and SS energy: 6.696 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -2216.285530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.285530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2228.901880 (E_RNA) where: Base-Base interactions energy: -1542.557 where: short stacking energy: -622.803 Base-Backbone interact. energy: -1.210 local terms energy: -685.135029 where: bonds (distance) C4'-P energy: -126.282 bonds (distance) P-C4' energy: -137.565 flat angles C4'-P-C4' energy: -138.656 flat angles P-C4'-P energy: -107.435 tors. eta vs tors. theta energy: -175.197 Dist. restrs. and SS energy: 12.616 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -2019.975323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2019.975323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2039.893965 (E_RNA) where: Base-Base interactions energy: -1403.552 where: short stacking energy: -579.607 Base-Backbone interact. energy: -3.170 local terms energy: -633.171838 where: bonds (distance) C4'-P energy: -126.668 bonds (distance) P-C4' energy: -131.500 flat angles C4'-P-C4' energy: -128.163 flat angles P-C4'-P energy: -76.668 tors. eta vs tors. theta energy: -170.173 Dist. restrs. and SS energy: 19.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -2088.528359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.528359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2097.100809 (E_RNA) where: Base-Base interactions energy: -1431.150 where: short stacking energy: -582.345 Base-Backbone interact. energy: -4.693 local terms energy: -661.257596 where: bonds (distance) C4'-P energy: -136.929 bonds (distance) P-C4' energy: -136.601 flat angles C4'-P-C4' energy: -139.083 flat angles P-C4'-P energy: -92.553 tors. eta vs tors. theta energy: -156.093 Dist. restrs. and SS energy: 8.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1908.908255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1908.908255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.802921 (E_RNA) where: Base-Base interactions energy: -1320.931 where: short stacking energy: -537.798 Base-Backbone interact. energy: -0.872 local terms energy: -615.000515 where: bonds (distance) C4'-P energy: -113.309 bonds (distance) P-C4' energy: -142.994 flat angles C4'-P-C4' energy: -125.576 flat angles P-C4'-P energy: -73.734 tors. eta vs tors. theta energy: -159.388 Dist. restrs. and SS energy: 27.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1897.121827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1897.121827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.402705 (E_RNA) where: Base-Base interactions energy: -1367.354 where: short stacking energy: -574.381 Base-Backbone interact. energy: 1.663 local terms energy: -551.711838 where: bonds (distance) C4'-P energy: -101.716 bonds (distance) P-C4' energy: -110.753 flat angles C4'-P-C4' energy: -126.360 flat angles P-C4'-P energy: -82.147 tors. eta vs tors. theta energy: -130.735 Dist. restrs. and SS energy: 20.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -1734.175284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.175284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.040067 (E_RNA) where: Base-Base interactions energy: -1232.503 where: short stacking energy: -497.965 Base-Backbone interact. energy: 2.839 local terms energy: -527.376376 where: bonds (distance) C4'-P energy: -98.200 bonds (distance) P-C4' energy: -109.263 flat angles C4'-P-C4' energy: -120.746 flat angles P-C4'-P energy: -71.019 tors. eta vs tors. theta energy: -128.149 Dist. restrs. and SS energy: 22.865 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2545.588294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2545.588294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2560.722592 (E_RNA) where: Base-Base interactions energy: -1781.921 where: short stacking energy: -749.382 Base-Backbone interact. energy: -1.654 local terms energy: -777.148083 where: bonds (distance) C4'-P energy: -149.473 bonds (distance) P-C4' energy: -156.619 flat angles C4'-P-C4' energy: -166.777 flat angles P-C4'-P energy: -107.001 tors. eta vs tors. theta energy: -197.279 Dist. restrs. and SS energy: 15.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -2393.502421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2393.502421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2400.896739 (E_RNA) where: Base-Base interactions energy: -1682.532 where: short stacking energy: -738.781 Base-Backbone interact. energy: 0.460 local terms energy: -718.825029 where: bonds (distance) C4'-P energy: -117.248 bonds (distance) P-C4' energy: -144.760 flat angles C4'-P-C4' energy: -158.388 flat angles P-C4'-P energy: -114.660 tors. eta vs tors. theta energy: -183.770 Dist. restrs. and SS energy: 7.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -2372.055000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2372.055000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.977457 (E_RNA) where: Base-Base interactions energy: -1678.852 where: short stacking energy: -686.672 Base-Backbone interact. energy: -2.029 local terms energy: -701.095869 where: bonds (distance) C4'-P energy: -122.404 bonds (distance) P-C4' energy: -145.012 flat angles C4'-P-C4' energy: -155.934 flat angles P-C4'-P energy: -96.659 tors. eta vs tors. theta energy: -181.087 Dist. restrs. and SS energy: 9.922 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -2233.802527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2233.802527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.593211 (E_RNA) where: Base-Base interactions energy: -1547.132 where: short stacking energy: -660.522 Base-Backbone interact. energy: 0.578 local terms energy: -705.039657 where: bonds (distance) C4'-P energy: -133.583 bonds (distance) P-C4' energy: -137.439 flat angles C4'-P-C4' energy: -151.109 flat angles P-C4'-P energy: -95.825 tors. eta vs tors. theta energy: -187.084 Dist. restrs. and SS energy: 17.791 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -2233.812428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2233.812428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2249.453333 (E_RNA) where: Base-Base interactions energy: -1560.139 where: short stacking energy: -652.773 Base-Backbone interact. energy: -3.097 local terms energy: -686.217763 where: bonds (distance) C4'-P energy: -129.408 bonds (distance) P-C4' energy: -138.869 flat angles C4'-P-C4' energy: -141.321 flat angles P-C4'-P energy: -93.655 tors. eta vs tors. theta energy: -182.965 Dist. restrs. and SS energy: 15.641 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -2070.797437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2070.797437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2093.794768 (E_RNA) where: Base-Base interactions energy: -1450.396 where: short stacking energy: -596.014 Base-Backbone interact. energy: -2.856 local terms energy: -640.542626 where: bonds (distance) C4'-P energy: -107.727 bonds (distance) P-C4' energy: -127.536 flat angles C4'-P-C4' energy: -147.646 flat angles P-C4'-P energy: -97.978 tors. eta vs tors. theta energy: -159.656 Dist. restrs. and SS energy: 22.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -2150.488489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2150.488489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2161.509666 (E_RNA) where: Base-Base interactions energy: -1513.861 where: short stacking energy: -621.535 Base-Backbone interact. energy: 2.821 local terms energy: -650.469317 where: bonds (distance) C4'-P energy: -123.373 bonds (distance) P-C4' energy: -113.962 flat angles C4'-P-C4' energy: -146.226 flat angles P-C4'-P energy: -102.346 tors. eta vs tors. theta energy: -164.563 Dist. restrs. and SS energy: 11.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1913.798434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1913.798434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1940.691342 (E_RNA) where: Base-Base interactions energy: -1324.293 where: short stacking energy: -555.557 Base-Backbone interact. energy: -0.411 local terms energy: -615.987778 where: bonds (distance) C4'-P energy: -113.281 bonds (distance) P-C4' energy: -143.555 flat angles C4'-P-C4' energy: -130.898 flat angles P-C4'-P energy: -78.546 tors. eta vs tors. theta energy: -149.708 Dist. restrs. and SS energy: 26.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1942.691598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.691598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.029574 (E_RNA) where: Base-Base interactions energy: -1368.903 where: short stacking energy: -590.397 Base-Backbone interact. energy: 3.223 local terms energy: -592.349598 where: bonds (distance) C4'-P energy: -113.625 bonds (distance) P-C4' energy: -125.930 flat angles C4'-P-C4' energy: -124.389 flat angles P-C4'-P energy: -65.251 tors. eta vs tors. theta energy: -163.154 Dist. restrs. and SS energy: 15.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -1789.726347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1789.726347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.262932 (E_RNA) where: Base-Base interactions energy: -1230.701 where: short stacking energy: -488.529 Base-Backbone interact. energy: -2.029 local terms energy: -576.533215 where: bonds (distance) C4'-P energy: -113.567 bonds (distance) P-C4' energy: -130.641 flat angles C4'-P-C4' energy: -127.103 flat angles P-C4'-P energy: -69.958 tors. eta vs tors. theta energy: -135.265 Dist. restrs. and SS energy: 19.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2559.621075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2559.621075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2575.409432 (E_RNA) where: Base-Base interactions energy: -1797.018 where: short stacking energy: -762.319 Base-Backbone interact. energy: -1.276 local terms energy: -777.115529 where: bonds (distance) C4'-P energy: -158.426 bonds (distance) P-C4' energy: -148.591 flat angles C4'-P-C4' energy: -168.608 flat angles P-C4'-P energy: -112.754 tors. eta vs tors. theta energy: -188.737 Dist. restrs. and SS energy: 15.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -2425.722603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2425.722603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2433.966905 (E_RNA) where: Base-Base interactions energy: -1683.126 where: short stacking energy: -698.353 Base-Backbone interact. energy: -1.639 local terms energy: -749.201956 where: bonds (distance) C4'-P energy: -145.758 bonds (distance) P-C4' energy: -150.180 flat angles C4'-P-C4' energy: -155.497 flat angles P-C4'-P energy: -99.144 tors. eta vs tors. theta energy: -198.622 Dist. restrs. and SS energy: 8.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -2406.262870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.262870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2419.766311 (E_RNA) where: Base-Base interactions energy: -1663.199 where: short stacking energy: -678.675 Base-Backbone interact. energy: -2.405 local terms energy: -754.161896 where: bonds (distance) C4'-P energy: -155.526 bonds (distance) P-C4' energy: -128.076 flat angles C4'-P-C4' energy: -163.835 flat angles P-C4'-P energy: -111.477 tors. eta vs tors. theta energy: -195.248 Dist. restrs. and SS energy: 13.503 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -2220.099445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.099445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.286608 (E_RNA) where: Base-Base interactions energy: -1534.946 where: short stacking energy: -623.915 Base-Backbone interact. energy: -3.262 local terms energy: -702.078244 where: bonds (distance) C4'-P energy: -143.699 bonds (distance) P-C4' energy: -137.437 flat angles C4'-P-C4' energy: -137.464 flat angles P-C4'-P energy: -91.381 tors. eta vs tors. theta energy: -192.096 Dist. restrs. and SS energy: 20.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -2267.929098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2267.929098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.474163 (E_RNA) where: Base-Base interactions energy: -1616.958 where: short stacking energy: -679.225 Base-Backbone interact. energy: -3.637 local terms energy: -661.878684 where: bonds (distance) C4'-P energy: -113.597 bonds (distance) P-C4' energy: -119.587 flat angles C4'-P-C4' energy: -131.905 flat angles P-C4'-P energy: -103.964 tors. eta vs tors. theta energy: -192.826 Dist. restrs. and SS energy: 14.545 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -2206.391349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2206.391349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2212.305948 (E_RNA) where: Base-Base interactions energy: -1553.659 where: short stacking energy: -631.428 Base-Backbone interact. energy: -0.164 local terms energy: -658.482589 where: bonds (distance) C4'-P energy: -137.031 bonds (distance) P-C4' energy: -107.092 flat angles C4'-P-C4' energy: -137.935 flat angles P-C4'-P energy: -91.972 tors. eta vs tors. theta energy: -184.453 Dist. restrs. and SS energy: 5.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1991.270898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1991.270898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.907951 (E_RNA) where: Base-Base interactions energy: -1393.826 where: short stacking energy: -557.477 Base-Backbone interact. energy: 2.235 local terms energy: -610.317633 where: bonds (distance) C4'-P energy: -123.263 bonds (distance) P-C4' energy: -130.389 flat angles C4'-P-C4' energy: -126.650 flat angles P-C4'-P energy: -78.078 tors. eta vs tors. theta energy: -151.937 Dist. restrs. and SS energy: 10.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -2105.993883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2105.993883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2125.243816 (E_RNA) where: Base-Base interactions energy: -1495.317 where: short stacking energy: -614.255 Base-Backbone interact. energy: -0.568 local terms energy: -629.358677 where: bonds (distance) C4'-P energy: -116.987 bonds (distance) P-C4' energy: -119.122 flat angles C4'-P-C4' energy: -138.376 flat angles P-C4'-P energy: -80.019 tors. eta vs tors. theta energy: -174.855 Dist. restrs. and SS energy: 19.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1896.984195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1896.984195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.538884 (E_RNA) where: Base-Base interactions energy: -1346.081 where: short stacking energy: -566.138 Base-Backbone interact. energy: -1.433 local terms energy: -568.025232 where: bonds (distance) C4'-P energy: -100.269 bonds (distance) P-C4' energy: -102.317 flat angles C4'-P-C4' energy: -136.509 flat angles P-C4'-P energy: -66.626 tors. eta vs tors. theta energy: -162.304 Dist. restrs. and SS energy: 18.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -1881.683532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1881.683532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.485436 (E_RNA) where: Base-Base interactions energy: -1324.773 where: short stacking energy: -542.065 Base-Backbone interact. energy: 1.461 local terms energy: -568.173231 where: bonds (distance) C4'-P energy: -119.990 bonds (distance) P-C4' energy: -113.560 flat angles C4'-P-C4' energy: -106.282 flat angles P-C4'-P energy: -68.675 tors. eta vs tors. theta energy: -159.666 Dist. restrs. and SS energy: 9.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2530.057373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2530.057373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2545.859526 (E_RNA) where: Base-Base interactions energy: -1749.416 where: short stacking energy: -741.250 Base-Backbone interact. energy: 0.462 local terms energy: -796.905443 where: bonds (distance) C4'-P energy: -138.541 bonds (distance) P-C4' energy: -165.123 flat angles C4'-P-C4' energy: -177.467 flat angles P-C4'-P energy: -107.555 tors. eta vs tors. theta energy: -208.219 Dist. restrs. and SS energy: 15.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -2405.161416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2405.161416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2417.628653 (E_RNA) where: Base-Base interactions energy: -1673.846 where: short stacking energy: -715.228 Base-Backbone interact. energy: 1.056 local terms energy: -744.838447 where: bonds (distance) C4'-P energy: -141.352 bonds (distance) P-C4' energy: -145.230 flat angles C4'-P-C4' energy: -161.508 flat angles P-C4'-P energy: -99.903 tors. eta vs tors. theta energy: -196.845 Dist. restrs. and SS energy: 12.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -2415.179547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2415.179547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2419.227113 (E_RNA) where: Base-Base interactions energy: -1689.186 where: short stacking energy: -708.595 Base-Backbone interact. energy: -1.856 local terms energy: -728.184610 where: bonds (distance) C4'-P energy: -145.068 bonds (distance) P-C4' energy: -143.828 flat angles C4'-P-C4' energy: -144.895 flat angles P-C4'-P energy: -108.019 tors. eta vs tors. theta energy: -186.374 Dist. restrs. and SS energy: 4.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -2162.258132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.258132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.087254 (E_RNA) where: Base-Base interactions energy: -1502.478 where: short stacking energy: -623.123 Base-Backbone interact. energy: -1.330 local terms energy: -677.279618 where: bonds (distance) C4'-P energy: -127.520 bonds (distance) P-C4' energy: -128.961 flat angles C4'-P-C4' energy: -150.213 flat angles P-C4'-P energy: -97.495 tors. eta vs tors. theta energy: -173.091 Dist. restrs. and SS energy: 18.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -2267.401332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2267.401332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2278.366105 (E_RNA) where: Base-Base interactions energy: -1640.722 where: short stacking energy: -683.870 Base-Backbone interact. energy: 0.017 local terms energy: -637.661479 where: bonds (distance) C4'-P energy: -103.231 bonds (distance) P-C4' energy: -116.926 flat angles C4'-P-C4' energy: -154.691 flat angles P-C4'-P energy: -81.172 tors. eta vs tors. theta energy: -181.641 Dist. restrs. and SS energy: 10.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -2199.123905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.123905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2209.640601 (E_RNA) where: Base-Base interactions energy: -1527.371 where: short stacking energy: -648.260 Base-Backbone interact. energy: -2.163 local terms energy: -680.106982 where: bonds (distance) C4'-P energy: -136.902 bonds (distance) P-C4' energy: -136.499 flat angles C4'-P-C4' energy: -155.322 flat angles P-C4'-P energy: -67.871 tors. eta vs tors. theta energy: -183.513 Dist. restrs. and SS energy: 10.517 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -2187.840105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.840105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2205.298870 (E_RNA) where: Base-Base interactions energy: -1535.481 where: short stacking energy: -634.800 Base-Backbone interact. energy: 1.241 local terms energy: -671.058774 where: bonds (distance) C4'-P energy: -130.029 bonds (distance) P-C4' energy: -130.206 flat angles C4'-P-C4' energy: -146.053 flat angles P-C4'-P energy: -93.603 tors. eta vs tors. theta energy: -171.168 Dist. restrs. and SS energy: 17.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1937.130787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1937.130787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.864789 (E_RNA) where: Base-Base interactions energy: -1336.464 where: short stacking energy: -569.801 Base-Backbone interact. energy: -2.856 local terms energy: -622.544304 where: bonds (distance) C4'-P energy: -119.715 bonds (distance) P-C4' energy: -120.297 flat angles C4'-P-C4' energy: -146.892 flat angles P-C4'-P energy: -80.543 tors. eta vs tors. theta energy: -155.098 Dist. restrs. and SS energy: 24.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -2059.977276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2059.977276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2069.657639 (E_RNA) where: Base-Base interactions energy: -1433.858 where: short stacking energy: -577.611 Base-Backbone interact. energy: -4.024 local terms energy: -631.775293 where: bonds (distance) C4'-P energy: -113.044 bonds (distance) P-C4' energy: -133.553 flat angles C4'-P-C4' energy: -145.525 flat angles P-C4'-P energy: -76.955 tors. eta vs tors. theta energy: -162.698 Dist. restrs. and SS energy: 9.680 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -1834.117862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1834.117862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1857.277674 (E_RNA) where: Base-Base interactions energy: -1284.148 where: short stacking energy: -532.841 Base-Backbone interact. energy: 3.635 local terms energy: -576.764148 where: bonds (distance) C4'-P energy: -112.716 bonds (distance) P-C4' energy: -129.408 flat angles C4'-P-C4' energy: -119.565 flat angles P-C4'-P energy: -78.827 tors. eta vs tors. theta energy: -136.248 Dist. restrs. and SS energy: 23.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2525.042773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2525.042773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2539.612750 (E_RNA) where: Base-Base interactions energy: -1788.418 where: short stacking energy: -744.623 Base-Backbone interact. energy: -0.575 local terms energy: -750.619906 where: bonds (distance) C4'-P energy: -132.668 bonds (distance) P-C4' energy: -150.797 flat angles C4'-P-C4' energy: -165.864 flat angles P-C4'-P energy: -108.760 tors. eta vs tors. theta energy: -192.532 Dist. restrs. and SS energy: 14.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2434.134899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2434.134899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2443.544673 (E_RNA) where: Base-Base interactions energy: -1691.315 where: short stacking energy: -713.014 Base-Backbone interact. energy: -2.238 local terms energy: -749.991638 where: bonds (distance) C4'-P energy: -135.217 bonds (distance) P-C4' energy: -141.516 flat angles C4'-P-C4' energy: -161.848 flat angles P-C4'-P energy: -106.632 tors. eta vs tors. theta energy: -204.779 Dist. restrs. and SS energy: 9.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -2449.991174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2449.991174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2456.697908 (E_RNA) where: Base-Base interactions energy: -1707.709 where: short stacking energy: -704.374 Base-Backbone interact. energy: -0.569 local terms energy: -748.419948 where: bonds (distance) C4'-P energy: -136.651 bonds (distance) P-C4' energy: -137.632 flat angles C4'-P-C4' energy: -164.243 flat angles P-C4'-P energy: -106.679 tors. eta vs tors. theta energy: -203.214 Dist. restrs. and SS energy: 6.707 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -2371.242618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.242618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2382.378082 (E_RNA) where: Base-Base interactions energy: -1679.434 where: short stacking energy: -688.815 Base-Backbone interact. energy: -2.854 local terms energy: -700.090091 where: bonds (distance) C4'-P energy: -127.711 bonds (distance) P-C4' energy: -130.265 flat angles C4'-P-C4' energy: -155.814 flat angles P-C4'-P energy: -88.092 tors. eta vs tors. theta energy: -198.207 Dist. restrs. and SS energy: 11.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -2136.157697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2136.157697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2148.808949 (E_RNA) where: Base-Base interactions energy: -1469.139 where: short stacking energy: -598.887 Base-Backbone interact. energy: -0.708 local terms energy: -678.962697 where: bonds (distance) C4'-P energy: -147.509 bonds (distance) P-C4' energy: -118.491 flat angles C4'-P-C4' energy: -147.536 flat angles P-C4'-P energy: -94.615 tors. eta vs tors. theta energy: -170.813 Dist. restrs. and SS energy: 12.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -2247.348433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2247.348433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2263.606966 (E_RNA) where: Base-Base interactions energy: -1583.369 where: short stacking energy: -678.530 Base-Backbone interact. energy: -2.166 local terms energy: -678.071463 where: bonds (distance) C4'-P energy: -118.284 bonds (distance) P-C4' energy: -139.303 flat angles C4'-P-C4' energy: -147.384 flat angles P-C4'-P energy: -78.152 tors. eta vs tors. theta energy: -194.947 Dist. restrs. and SS energy: 16.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -2157.723363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2157.723363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2166.498410 (E_RNA) where: Base-Base interactions energy: -1520.611 where: short stacking energy: -605.527 Base-Backbone interact. energy: -2.836 local terms energy: -643.051571 where: bonds (distance) C4'-P energy: -121.386 bonds (distance) P-C4' energy: -116.726 flat angles C4'-P-C4' energy: -145.651 flat angles P-C4'-P energy: -92.898 tors. eta vs tors. theta energy: -166.391 Dist. restrs. and SS energy: 8.775 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -2110.552844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.552844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.481597 (E_RNA) where: Base-Base interactions energy: -1496.708 where: short stacking energy: -639.146 Base-Backbone interact. energy: 1.290 local terms energy: -623.063403 where: bonds (distance) C4'-P energy: -92.319 bonds (distance) P-C4' energy: -129.155 flat angles C4'-P-C4' energy: -145.508 flat angles P-C4'-P energy: -86.602 tors. eta vs tors. theta energy: -169.480 Dist. restrs. and SS energy: 7.929 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1896.057830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1896.057830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.108498 (E_RNA) where: Base-Base interactions energy: -1342.495 where: short stacking energy: -569.213 Base-Backbone interact. energy: -1.849 local terms energy: -572.764742 where: bonds (distance) C4'-P energy: -115.379 bonds (distance) P-C4' energy: -115.724 flat angles C4'-P-C4' energy: -119.743 flat angles P-C4'-P energy: -75.095 tors. eta vs tors. theta energy: -146.824 Dist. restrs. and SS energy: 21.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -1846.142629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1846.142629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1877.092148 (E_RNA) where: Base-Base interactions energy: -1320.433 where: short stacking energy: -530.742 Base-Backbone interact. energy: -1.794 local terms energy: -554.865668 where: bonds (distance) C4'-P energy: -111.386 bonds (distance) P-C4' energy: -117.478 flat angles C4'-P-C4' energy: -117.625 flat angles P-C4'-P energy: -59.188 tors. eta vs tors. theta energy: -149.188 Dist. restrs. and SS energy: 30.950 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2543.065442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2543.065442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2559.917630 (E_RNA) where: Base-Base interactions energy: -1789.504 where: short stacking energy: -726.768 Base-Backbone interact. energy: -0.488 local terms energy: -769.925840 where: bonds (distance) C4'-P energy: -147.806 bonds (distance) P-C4' energy: -149.648 flat angles C4'-P-C4' energy: -168.522 flat angles P-C4'-P energy: -108.719 tors. eta vs tors. theta energy: -195.230 Dist. restrs. and SS energy: 16.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -2431.290820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2431.290820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2440.658482 (E_RNA) where: Base-Base interactions energy: -1680.993 where: short stacking energy: -724.271 Base-Backbone interact. energy: 0.401 local terms energy: -760.065851 where: bonds (distance) C4'-P energy: -137.741 bonds (distance) P-C4' energy: -152.836 flat angles C4'-P-C4' energy: -166.489 flat angles P-C4'-P energy: -104.111 tors. eta vs tors. theta energy: -198.889 Dist. restrs. and SS energy: 9.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -2522.656513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2522.656513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2527.947457 (E_RNA) where: Base-Base interactions energy: -1788.293 where: short stacking energy: -769.765 Base-Backbone interact. energy: 1.056 local terms energy: -740.710348 where: bonds (distance) C4'-P energy: -131.957 bonds (distance) P-C4' energy: -123.609 flat angles C4'-P-C4' energy: -163.792 flat angles P-C4'-P energy: -98.297 tors. eta vs tors. theta energy: -223.055 Dist. restrs. and SS energy: 5.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -2333.023630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2333.023630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2353.994312 (E_RNA) where: Base-Base interactions energy: -1631.586 where: short stacking energy: -717.110 Base-Backbone interact. energy: -1.732 local terms energy: -720.676736 where: bonds (distance) C4'-P energy: -141.137 bonds (distance) P-C4' energy: -123.723 flat angles C4'-P-C4' energy: -146.888 flat angles P-C4'-P energy: -108.714 tors. eta vs tors. theta energy: -200.214 Dist. restrs. and SS energy: 20.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -2294.951007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2294.951007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.086060 (E_RNA) where: Base-Base interactions energy: -1620.122 where: short stacking energy: -683.106 Base-Backbone interact. energy: -2.994 local terms energy: -687.969089 where: bonds (distance) C4'-P energy: -136.342 bonds (distance) P-C4' energy: -121.784 flat angles C4'-P-C4' energy: -150.709 flat angles P-C4'-P energy: -90.276 tors. eta vs tors. theta energy: -188.859 Dist. restrs. and SS energy: 16.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -2102.597403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.597403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2114.648380 (E_RNA) where: Base-Base interactions energy: -1479.270 where: short stacking energy: -605.726 Base-Backbone interact. energy: -0.689 local terms energy: -634.689140 where: bonds (distance) C4'-P energy: -106.500 bonds (distance) P-C4' energy: -136.702 flat angles C4'-P-C4' energy: -140.835 flat angles P-C4'-P energy: -83.853 tors. eta vs tors. theta energy: -166.799 Dist. restrs. and SS energy: 12.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -2159.040139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2159.040139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2173.360194 (E_RNA) where: Base-Base interactions energy: -1514.246 where: short stacking energy: -645.372 Base-Backbone interact. energy: -1.515 local terms energy: -657.598595 where: bonds (distance) C4'-P energy: -127.423 bonds (distance) P-C4' energy: -112.266 flat angles C4'-P-C4' energy: -156.487 flat angles P-C4'-P energy: -82.653 tors. eta vs tors. theta energy: -178.770 Dist. restrs. and SS energy: 14.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -2100.829689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2100.829689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2107.336399 (E_RNA) where: Base-Base interactions energy: -1494.583 where: short stacking energy: -613.552 Base-Backbone interact. energy: 0.635 local terms energy: -613.389016 where: bonds (distance) C4'-P energy: -100.797 bonds (distance) P-C4' energy: -117.988 flat angles C4'-P-C4' energy: -135.089 flat angles P-C4'-P energy: -88.514 tors. eta vs tors. theta energy: -171.001 Dist. restrs. and SS energy: 6.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1828.743872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1828.743872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1862.627108 (E_RNA) where: Base-Base interactions energy: -1300.216 where: short stacking energy: -544.398 Base-Backbone interact. energy: 1.728 local terms energy: -564.138725 where: bonds (distance) C4'-P energy: -110.073 bonds (distance) P-C4' energy: -104.800 flat angles C4'-P-C4' energy: -127.158 flat angles P-C4'-P energy: -86.714 tors. eta vs tors. theta energy: -135.393 Dist. restrs. and SS energy: 33.883 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -1871.393422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.393422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1888.875977 (E_RNA) where: Base-Base interactions energy: -1352.945 where: short stacking energy: -550.770 Base-Backbone interact. energy: 3.363 local terms energy: -539.293880 where: bonds (distance) C4'-P energy: -101.189 bonds (distance) P-C4' energy: -127.584 flat angles C4'-P-C4' energy: -121.728 flat angles P-C4'-P energy: -37.055 tors. eta vs tors. theta energy: -151.737 Dist. restrs. and SS energy: 17.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2584.686164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2584.686164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2599.680467 (E_RNA) where: Base-Base interactions energy: -1828.722 where: short stacking energy: -750.258 Base-Backbone interact. energy: -1.671 local terms energy: -769.287241 where: bonds (distance) C4'-P energy: -160.066 bonds (distance) P-C4' energy: -142.963 flat angles C4'-P-C4' energy: -159.736 flat angles P-C4'-P energy: -94.031 tors. eta vs tors. theta energy: -212.491 Dist. restrs. and SS energy: 14.994 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -2591.920957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2591.920957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2596.662858 (E_RNA) where: Base-Base interactions energy: -1821.136 where: short stacking energy: -771.228 Base-Backbone interact. energy: 5.422 local terms energy: -780.948615 where: bonds (distance) C4'-P energy: -136.150 bonds (distance) P-C4' energy: -149.589 flat angles C4'-P-C4' energy: -171.521 flat angles P-C4'-P energy: -102.013 tors. eta vs tors. theta energy: -221.675 Dist. restrs. and SS energy: 4.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -2378.496815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2378.496815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2395.490992 (E_RNA) where: Base-Base interactions energy: -1662.259 where: short stacking energy: -727.495 Base-Backbone interact. energy: -2.818 local terms energy: -730.413864 where: bonds (distance) C4'-P energy: -152.982 bonds (distance) P-C4' energy: -140.591 flat angles C4'-P-C4' energy: -148.176 flat angles P-C4'-P energy: -97.726 tors. eta vs tors. theta energy: -190.939 Dist. restrs. and SS energy: 16.994 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -2378.397946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2378.397946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2388.889163 (E_RNA) where: Base-Base interactions energy: -1686.549 where: short stacking energy: -724.096 Base-Backbone interact. energy: -0.789 local terms energy: -701.551132 where: bonds (distance) C4'-P energy: -137.682 bonds (distance) P-C4' energy: -125.970 flat angles C4'-P-C4' energy: -136.858 flat angles P-C4'-P energy: -97.276 tors. eta vs tors. theta energy: -203.765 Dist. restrs. and SS energy: 10.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -2275.138186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.138186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2294.002538 (E_RNA) where: Base-Base interactions energy: -1570.906 where: short stacking energy: -662.798 Base-Backbone interact. energy: 0.545 local terms energy: -723.641834 where: bonds (distance) C4'-P energy: -134.202 bonds (distance) P-C4' energy: -136.604 flat angles C4'-P-C4' energy: -158.753 flat angles P-C4'-P energy: -104.787 tors. eta vs tors. theta energy: -189.296 Dist. restrs. and SS energy: 18.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -2185.322030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2185.322030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.821682 (E_RNA) where: Base-Base interactions energy: -1530.036 where: short stacking energy: -617.286 Base-Backbone interact. energy: -2.885 local terms energy: -661.900721 where: bonds (distance) C4'-P energy: -135.883 bonds (distance) P-C4' energy: -130.631 flat angles C4'-P-C4' energy: -133.416 flat angles P-C4'-P energy: -90.819 tors. eta vs tors. theta energy: -171.152 Dist. restrs. and SS energy: 9.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1995.975938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1995.975938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.772481 (E_RNA) where: Base-Base interactions energy: -1382.319 where: short stacking energy: -558.172 Base-Backbone interact. energy: 3.734 local terms energy: -634.187751 where: bonds (distance) C4'-P energy: -130.100 bonds (distance) P-C4' energy: -127.119 flat angles C4'-P-C4' energy: -138.751 flat angles P-C4'-P energy: -85.349 tors. eta vs tors. theta energy: -152.868 Dist. restrs. and SS energy: 16.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -2060.440381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2060.440381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2067.915062 (E_RNA) where: Base-Base interactions energy: -1455.659 where: short stacking energy: -578.765 Base-Backbone interact. energy: 5.783 local terms energy: -618.039530 where: bonds (distance) C4'-P energy: -121.252 bonds (distance) P-C4' energy: -112.264 flat angles C4'-P-C4' energy: -143.951 flat angles P-C4'-P energy: -75.028 tors. eta vs tors. theta energy: -165.545 Dist. restrs. and SS energy: 7.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1903.728123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1903.728123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1923.080748 (E_RNA) where: Base-Base interactions energy: -1314.972 where: short stacking energy: -540.434 Base-Backbone interact. energy: -1.528 local terms energy: -606.581296 where: bonds (distance) C4'-P energy: -128.030 bonds (distance) P-C4' energy: -116.915 flat angles C4'-P-C4' energy: -127.732 flat angles P-C4'-P energy: -69.605 tors. eta vs tors. theta energy: -164.299 Dist. restrs. and SS energy: 19.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -1868.571823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.571823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.419675 (E_RNA) where: Base-Base interactions energy: -1336.385 where: short stacking energy: -550.813 Base-Backbone interact. energy: 2.267 local terms energy: -557.301717 where: bonds (distance) C4'-P energy: -96.362 bonds (distance) P-C4' energy: -113.707 flat angles C4'-P-C4' energy: -135.950 flat angles P-C4'-P energy: -72.733 tors. eta vs tors. theta energy: -138.549 Dist. restrs. and SS energy: 22.848 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2566.282650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2566.282650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2578.154241 (E_RNA) where: Base-Base interactions energy: -1824.155 where: short stacking energy: -752.535 Base-Backbone interact. energy: 3.073 local terms energy: -757.072579 where: bonds (distance) C4'-P energy: -136.012 bonds (distance) P-C4' energy: -145.488 flat angles C4'-P-C4' energy: -156.395 flat angles P-C4'-P energy: -114.517 tors. eta vs tors. theta energy: -204.661 Dist. restrs. and SS energy: 11.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -2584.203861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2584.203861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2586.954817 (E_RNA) where: Base-Base interactions energy: -1803.766 where: short stacking energy: -764.365 Base-Backbone interact. energy: -3.201 local terms energy: -779.986911 where: bonds (distance) C4'-P energy: -135.004 bonds (distance) P-C4' energy: -146.847 flat angles C4'-P-C4' energy: -162.066 flat angles P-C4'-P energy: -112.733 tors. eta vs tors. theta energy: -223.337 Dist. restrs. and SS energy: 2.751 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -2448.457531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2448.457531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2462.976887 (E_RNA) where: Base-Base interactions energy: -1702.276 where: short stacking energy: -754.122 Base-Backbone interact. energy: -3.098 local terms energy: -757.602391 where: bonds (distance) C4'-P energy: -143.458 bonds (distance) P-C4' energy: -142.000 flat angles C4'-P-C4' energy: -159.435 flat angles P-C4'-P energy: -108.459 tors. eta vs tors. theta energy: -204.251 Dist. restrs. and SS energy: 14.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -2338.713598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2338.713598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.205030 (E_RNA) where: Base-Base interactions energy: -1651.671 where: short stacking energy: -667.755 Base-Backbone interact. energy: -3.696 local terms energy: -688.838490 where: bonds (distance) C4'-P energy: -124.219 bonds (distance) P-C4' energy: -134.529 flat angles C4'-P-C4' energy: -151.754 flat angles P-C4'-P energy: -99.930 tors. eta vs tors. theta energy: -178.407 Dist. restrs. and SS energy: 5.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -2283.567327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.567327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.581218 (E_RNA) where: Base-Base interactions energy: -1588.292 where: short stacking energy: -638.902 Base-Backbone interact. energy: -0.945 local terms energy: -706.344246 where: bonds (distance) C4'-P energy: -141.890 bonds (distance) P-C4' energy: -136.333 flat angles C4'-P-C4' energy: -158.018 flat angles P-C4'-P energy: -89.211 tors. eta vs tors. theta energy: -180.891 Dist. restrs. and SS energy: 12.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -2227.345054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2227.345054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.672545 (E_RNA) where: Base-Base interactions energy: -1579.018 where: short stacking energy: -689.518 Base-Backbone interact. energy: 0.034 local terms energy: -656.688907 where: bonds (distance) C4'-P energy: -122.301 bonds (distance) P-C4' energy: -116.095 flat angles C4'-P-C4' energy: -144.694 flat angles P-C4'-P energy: -86.567 tors. eta vs tors. theta energy: -187.033 Dist. restrs. and SS energy: 8.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -2192.663980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2192.663980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2198.828317 (E_RNA) where: Base-Base interactions energy: -1526.717 where: short stacking energy: -633.490 Base-Backbone interact. energy: -1.110 local terms energy: -671.001008 where: bonds (distance) C4'-P energy: -128.412 bonds (distance) P-C4' energy: -121.999 flat angles C4'-P-C4' energy: -146.385 flat angles P-C4'-P energy: -87.705 tors. eta vs tors. theta energy: -186.499 Dist. restrs. and SS energy: 6.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1970.519663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.519663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1984.977015 (E_RNA) where: Base-Base interactions energy: -1378.666 where: short stacking energy: -584.922 Base-Backbone interact. energy: 0.200 local terms energy: -606.510894 where: bonds (distance) C4'-P energy: -123.013 bonds (distance) P-C4' energy: -112.490 flat angles C4'-P-C4' energy: -130.810 flat angles P-C4'-P energy: -72.478 tors. eta vs tors. theta energy: -167.720 Dist. restrs. and SS energy: 14.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1929.929115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.929115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1954.300197 (E_RNA) where: Base-Base interactions energy: -1364.440 where: short stacking energy: -563.539 Base-Backbone interact. energy: 2.155 local terms energy: -592.015233 where: bonds (distance) C4'-P energy: -105.012 bonds (distance) P-C4' energy: -105.791 flat angles C4'-P-C4' energy: -137.726 flat angles P-C4'-P energy: -98.388 tors. eta vs tors. theta energy: -145.098 Dist. restrs. and SS energy: 24.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -1924.172709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1924.172709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1949.858129 (E_RNA) where: Base-Base interactions energy: -1359.685 where: short stacking energy: -559.635 Base-Backbone interact. energy: 1.132 local terms energy: -591.305912 where: bonds (distance) C4'-P energy: -120.374 bonds (distance) P-C4' energy: -119.120 flat angles C4'-P-C4' energy: -127.491 flat angles P-C4'-P energy: -85.474 tors. eta vs tors. theta energy: -138.847 Dist. restrs. and SS energy: 25.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2578.723060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2578.723060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2595.889524 (E_RNA) where: Base-Base interactions energy: -1798.657 where: short stacking energy: -760.312 Base-Backbone interact. energy: -1.773 local terms energy: -795.459014 where: bonds (distance) C4'-P energy: -134.427 bonds (distance) P-C4' energy: -149.042 flat angles C4'-P-C4' energy: -182.959 flat angles P-C4'-P energy: -121.735 tors. eta vs tors. theta energy: -207.297 Dist. restrs. and SS energy: 17.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2594.066760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2594.066760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2597.585871 (E_RNA) where: Base-Base interactions energy: -1793.995 where: short stacking energy: -787.195 Base-Backbone interact. energy: -4.655 local terms energy: -798.936589 where: bonds (distance) C4'-P energy: -144.756 bonds (distance) P-C4' energy: -156.638 flat angles C4'-P-C4' energy: -163.166 flat angles P-C4'-P energy: -108.829 tors. eta vs tors. theta energy: -225.547 Dist. restrs. and SS energy: 3.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -2456.139929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2456.139929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2462.527140 (E_RNA) where: Base-Base interactions energy: -1708.716 where: short stacking energy: -738.740 Base-Backbone interact. energy: -0.560 local terms energy: -753.251501 where: bonds (distance) C4'-P energy: -124.722 bonds (distance) P-C4' energy: -140.708 flat angles C4'-P-C4' energy: -162.117 flat angles P-C4'-P energy: -112.951 tors. eta vs tors. theta energy: -212.753 Dist. restrs. and SS energy: 6.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -2281.906843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2281.906843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2290.286724 (E_RNA) where: Base-Base interactions energy: -1601.942 where: short stacking energy: -651.017 Base-Backbone interact. energy: 0.681 local terms energy: -689.025570 where: bonds (distance) C4'-P energy: -117.632 bonds (distance) P-C4' energy: -145.087 flat angles C4'-P-C4' energy: -163.697 flat angles P-C4'-P energy: -83.436 tors. eta vs tors. theta energy: -179.172 Dist. restrs. and SS energy: 8.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -2277.702317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2277.702317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2288.115983 (E_RNA) where: Base-Base interactions energy: -1593.930 where: short stacking energy: -658.373 Base-Backbone interact. energy: -2.099 local terms energy: -692.087240 where: bonds (distance) C4'-P energy: -117.358 bonds (distance) P-C4' energy: -138.195 flat angles C4'-P-C4' energy: -139.584 flat angles P-C4'-P energy: -105.606 tors. eta vs tors. theta energy: -191.345 Dist. restrs. and SS energy: 10.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -2257.721175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.721175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2265.600978 (E_RNA) where: Base-Base interactions energy: -1559.187 where: short stacking energy: -670.641 Base-Backbone interact. energy: 1.726 local terms energy: -708.139482 where: bonds (distance) C4'-P energy: -132.178 bonds (distance) P-C4' energy: -136.463 flat angles C4'-P-C4' energy: -148.954 flat angles P-C4'-P energy: -102.291 tors. eta vs tors. theta energy: -188.252 Dist. restrs. and SS energy: 7.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -2141.320781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2141.320781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2155.819382 (E_RNA) where: Base-Base interactions energy: -1534.072 where: short stacking energy: -619.702 Base-Backbone interact. energy: -1.879 local terms energy: -619.869015 where: bonds (distance) C4'-P energy: -109.083 bonds (distance) P-C4' energy: -118.175 flat angles C4'-P-C4' energy: -138.349 flat angles P-C4'-P energy: -82.013 tors. eta vs tors. theta energy: -172.248 Dist. restrs. and SS energy: 14.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1973.893769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1973.893769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1995.100446 (E_RNA) where: Base-Base interactions energy: -1397.315 where: short stacking energy: -585.814 Base-Backbone interact. energy: -3.896 local terms energy: -593.889941 where: bonds (distance) C4'-P energy: -103.870 bonds (distance) P-C4' energy: -126.225 flat angles C4'-P-C4' energy: -143.491 flat angles P-C4'-P energy: -59.356 tors. eta vs tors. theta energy: -160.948 Dist. restrs. and SS energy: 21.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1935.294669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.294669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.309296 (E_RNA) where: Base-Base interactions energy: -1389.680 where: short stacking energy: -567.773 Base-Backbone interact. energy: -1.185 local terms energy: -573.444307 where: bonds (distance) C4'-P energy: -104.843 bonds (distance) P-C4' energy: -113.523 flat angles C4'-P-C4' energy: -131.616 flat angles P-C4'-P energy: -92.356 tors. eta vs tors. theta energy: -131.106 Dist. restrs. and SS energy: 29.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -1898.407447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1898.407447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.964824 (E_RNA) where: Base-Base interactions energy: -1318.201 where: short stacking energy: -527.782 Base-Backbone interact. energy: -4.388 local terms energy: -593.375592 where: bonds (distance) C4'-P energy: -126.828 bonds (distance) P-C4' energy: -128.519 flat angles C4'-P-C4' energy: -124.989 flat angles P-C4'-P energy: -69.951 tors. eta vs tors. theta energy: -143.089 Dist. restrs. and SS energy: 17.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2572.974053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2572.974053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2592.390032 (E_RNA) where: Base-Base interactions energy: -1794.355 where: short stacking energy: -778.260 Base-Backbone interact. energy: -3.836 local terms energy: -794.198453 where: bonds (distance) C4'-P energy: -148.961 bonds (distance) P-C4' energy: -151.821 flat angles C4'-P-C4' energy: -174.709 flat angles P-C4'-P energy: -105.162 tors. eta vs tors. theta energy: -213.545 Dist. restrs. and SS energy: 19.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2587.861203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2587.861203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2589.868952 (E_RNA) where: Base-Base interactions energy: -1807.649 where: short stacking energy: -777.424 Base-Backbone interact. energy: -4.191 local terms energy: -778.029252 where: bonds (distance) C4'-P energy: -144.253 bonds (distance) P-C4' energy: -148.040 flat angles C4'-P-C4' energy: -151.467 flat angles P-C4'-P energy: -106.315 tors. eta vs tors. theta energy: -227.954 Dist. restrs. and SS energy: 2.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -2473.529504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2473.529504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2485.069853 (E_RNA) where: Base-Base interactions energy: -1718.727 where: short stacking energy: -723.519 Base-Backbone interact. energy: 0.576 local terms energy: -766.918808 where: bonds (distance) C4'-P energy: -132.205 bonds (distance) P-C4' energy: -142.306 flat angles C4'-P-C4' energy: -162.196 flat angles P-C4'-P energy: -117.905 tors. eta vs tors. theta energy: -212.307 Dist. restrs. and SS energy: 11.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -2288.567042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2288.567042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2299.902484 (E_RNA) where: Base-Base interactions energy: -1605.849 where: short stacking energy: -684.149 Base-Backbone interact. energy: 0.467 local terms energy: -694.520341 where: bonds (distance) C4'-P energy: -137.746 bonds (distance) P-C4' energy: -130.905 flat angles C4'-P-C4' energy: -143.369 flat angles P-C4'-P energy: -96.497 tors. eta vs tors. theta energy: -186.004 Dist. restrs. and SS energy: 11.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -2257.924220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.924220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2271.653795 (E_RNA) where: Base-Base interactions energy: -1575.149 where: short stacking energy: -692.857 Base-Backbone interact. energy: 5.050 local terms energy: -701.554425 where: bonds (distance) C4'-P energy: -142.301 bonds (distance) P-C4' energy: -130.142 flat angles C4'-P-C4' energy: -144.349 flat angles P-C4'-P energy: -87.208 tors. eta vs tors. theta energy: -197.555 Dist. restrs. and SS energy: 13.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -2253.166205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2253.166205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.104192 (E_RNA) where: Base-Base interactions energy: -1553.530 where: short stacking energy: -631.180 Base-Backbone interact. energy: -3.323 local terms energy: -699.250989 where: bonds (distance) C4'-P energy: -118.790 bonds (distance) P-C4' energy: -137.209 flat angles C4'-P-C4' energy: -159.266 flat angles P-C4'-P energy: -97.120 tors. eta vs tors. theta energy: -186.867 Dist. restrs. and SS energy: 2.938 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -2206.483965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2206.483965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.643230 (E_RNA) where: Base-Base interactions energy: -1564.562 where: short stacking energy: -639.282 Base-Backbone interact. energy: -1.312 local terms energy: -645.769968 where: bonds (distance) C4'-P energy: -123.396 bonds (distance) P-C4' energy: -123.514 flat angles C4'-P-C4' energy: -143.844 flat angles P-C4'-P energy: -84.181 tors. eta vs tors. theta energy: -170.836 Dist. restrs. and SS energy: 5.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1928.476190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.476190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1952.844630 (E_RNA) where: Base-Base interactions energy: -1340.030 where: short stacking energy: -583.515 Base-Backbone interact. energy: -0.491 local terms energy: -612.323901 where: bonds (distance) C4'-P energy: -124.163 bonds (distance) P-C4' energy: -132.608 flat angles C4'-P-C4' energy: -130.356 flat angles P-C4'-P energy: -62.511 tors. eta vs tors. theta energy: -162.685 Dist. restrs. and SS energy: 24.368 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1932.108528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.108528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1955.016695 (E_RNA) where: Base-Base interactions energy: -1376.666 where: short stacking energy: -569.788 Base-Backbone interact. energy: -1.938 local terms energy: -576.413270 where: bonds (distance) C4'-P energy: -96.912 bonds (distance) P-C4' energy: -106.065 flat angles C4'-P-C4' energy: -131.142 flat angles P-C4'-P energy: -87.118 tors. eta vs tors. theta energy: -155.176 Dist. restrs. and SS energy: 22.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -1959.939083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.939083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1970.702559 (E_RNA) where: Base-Base interactions energy: -1407.272 where: short stacking energy: -553.397 Base-Backbone interact. energy: 3.513 local terms energy: -566.942689 where: bonds (distance) C4'-P energy: -117.258 bonds (distance) P-C4' energy: -102.983 flat angles C4'-P-C4' energy: -117.978 flat angles P-C4'-P energy: -69.889 tors. eta vs tors. theta energy: -158.835 Dist. restrs. and SS energy: 10.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2575.408139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2575.408139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2585.122375 (E_RNA) where: Base-Base interactions energy: -1810.715 where: short stacking energy: -755.344 Base-Backbone interact. energy: -1.217 local terms energy: -773.190261 where: bonds (distance) C4'-P energy: -143.644 bonds (distance) P-C4' energy: -145.946 flat angles C4'-P-C4' energy: -168.782 flat angles P-C4'-P energy: -102.078 tors. eta vs tors. theta energy: -212.741 Dist. restrs. and SS energy: 9.714 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2574.203164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2574.203164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2578.313945 (E_RNA) where: Base-Base interactions energy: -1787.466 where: short stacking energy: -787.009 Base-Backbone interact. energy: -0.536 local terms energy: -790.311926 where: bonds (distance) C4'-P energy: -142.228 bonds (distance) P-C4' energy: -143.907 flat angles C4'-P-C4' energy: -180.840 flat angles P-C4'-P energy: -99.828 tors. eta vs tors. theta energy: -223.509 Dist. restrs. and SS energy: 4.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -2530.766401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2530.766401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2537.940896 (E_RNA) where: Base-Base interactions energy: -1787.132 where: short stacking energy: -767.404 Base-Backbone interact. energy: -0.905 local terms energy: -749.904079 where: bonds (distance) C4'-P energy: -120.320 bonds (distance) P-C4' energy: -145.835 flat angles C4'-P-C4' energy: -164.826 flat angles P-C4'-P energy: -104.999 tors. eta vs tors. theta energy: -213.924 Dist. restrs. and SS energy: 7.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -2298.533604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2298.533604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.084496 (E_RNA) where: Base-Base interactions energy: -1612.957 where: short stacking energy: -687.766 Base-Backbone interact. energy: -3.514 local terms energy: -694.613612 where: bonds (distance) C4'-P energy: -125.394 bonds (distance) P-C4' energy: -146.360 flat angles C4'-P-C4' energy: -144.529 flat angles P-C4'-P energy: -97.077 tors. eta vs tors. theta energy: -181.254 Dist. restrs. and SS energy: 12.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -2285.842936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2285.842936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2300.051935 (E_RNA) where: Base-Base interactions energy: -1602.759 where: short stacking energy: -664.296 Base-Backbone interact. energy: 1.042 local terms energy: -698.335023 where: bonds (distance) C4'-P energy: -139.766 bonds (distance) P-C4' energy: -117.321 flat angles C4'-P-C4' energy: -157.947 flat angles P-C4'-P energy: -90.308 tors. eta vs tors. theta energy: -192.991 Dist. restrs. and SS energy: 14.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -2273.878947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2273.878947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2281.589066 (E_RNA) where: Base-Base interactions energy: -1633.943 where: short stacking energy: -721.693 Base-Backbone interact. energy: -0.599 local terms energy: -647.046697 where: bonds (distance) C4'-P energy: -100.471 bonds (distance) P-C4' energy: -125.842 flat angles C4'-P-C4' energy: -146.538 flat angles P-C4'-P energy: -87.194 tors. eta vs tors. theta energy: -187.001 Dist. restrs. and SS energy: 7.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -2174.222612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2174.222612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2184.279436 (E_RNA) where: Base-Base interactions energy: -1520.208 where: short stacking energy: -650.551 Base-Backbone interact. energy: -2.365 local terms energy: -661.707074 where: bonds (distance) C4'-P energy: -117.541 bonds (distance) P-C4' energy: -109.417 flat angles C4'-P-C4' energy: -145.419 flat angles P-C4'-P energy: -98.851 tors. eta vs tors. theta energy: -190.479 Dist. restrs. and SS energy: 10.057 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1994.310651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1994.310651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.122095 (E_RNA) where: Base-Base interactions energy: -1390.655 where: short stacking energy: -555.581 Base-Backbone interact. energy: 0.444 local terms energy: -624.910849 where: bonds (distance) C4'-P energy: -130.596 bonds (distance) P-C4' energy: -129.123 flat angles C4'-P-C4' energy: -128.607 flat angles P-C4'-P energy: -79.133 tors. eta vs tors. theta energy: -157.452 Dist. restrs. and SS energy: 20.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1810.499972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1810.499972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1848.167402 (E_RNA) where: Base-Base interactions energy: -1279.031 where: short stacking energy: -542.638 Base-Backbone interact. energy: -2.430 local terms energy: -566.706103 where: bonds (distance) C4'-P energy: -118.391 bonds (distance) P-C4' energy: -119.279 flat angles C4'-P-C4' energy: -130.468 flat angles P-C4'-P energy: -47.125 tors. eta vs tors. theta energy: -151.442 Dist. restrs. and SS energy: 37.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -1907.690517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.690517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1924.152877 (E_RNA) where: Base-Base interactions energy: -1366.241 where: short stacking energy: -542.981 Base-Backbone interact. energy: 1.581 local terms energy: -559.492694 where: bonds (distance) C4'-P energy: -107.097 bonds (distance) P-C4' energy: -110.099 flat angles C4'-P-C4' energy: -128.183 flat angles P-C4'-P energy: -73.429 tors. eta vs tors. theta energy: -140.685 Dist. restrs. and SS energy: 16.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2633.441758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2633.441758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2635.907536 (E_RNA) where: Base-Base interactions energy: -1846.924 where: short stacking energy: -782.770 Base-Backbone interact. energy: -2.652 local terms energy: -786.331105 where: bonds (distance) C4'-P energy: -151.147 bonds (distance) P-C4' energy: -142.257 flat angles C4'-P-C4' energy: -165.362 flat angles P-C4'-P energy: -104.393 tors. eta vs tors. theta energy: -223.172 Dist. restrs. and SS energy: 2.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2506.851973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2506.851973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2522.080131 (E_RNA) where: Base-Base interactions energy: -1756.666 where: short stacking energy: -750.831 Base-Backbone interact. energy: -3.167 local terms energy: -762.247251 where: bonds (distance) C4'-P energy: -135.541 bonds (distance) P-C4' energy: -147.141 flat angles C4'-P-C4' energy: -162.654 flat angles P-C4'-P energy: -101.805 tors. eta vs tors. theta energy: -215.107 Dist. restrs. and SS energy: 15.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -2550.696299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2550.696299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2556.532147 (E_RNA) where: Base-Base interactions energy: -1792.978 where: short stacking energy: -760.268 Base-Backbone interact. energy: 1.470 local terms energy: -765.024245 where: bonds (distance) C4'-P energy: -135.802 bonds (distance) P-C4' energy: -151.704 flat angles C4'-P-C4' energy: -157.773 flat angles P-C4'-P energy: -114.457 tors. eta vs tors. theta energy: -205.288 Dist. restrs. and SS energy: 5.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -2318.504322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.504322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2328.051968 (E_RNA) where: Base-Base interactions energy: -1632.622 where: short stacking energy: -689.180 Base-Backbone interact. energy: -0.098 local terms energy: -695.332323 where: bonds (distance) C4'-P energy: -128.113 bonds (distance) P-C4' energy: -137.698 flat angles C4'-P-C4' energy: -160.114 flat angles P-C4'-P energy: -84.535 tors. eta vs tors. theta energy: -184.873 Dist. restrs. and SS energy: 9.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -2328.737524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2328.737524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2334.023061 (E_RNA) where: Base-Base interactions energy: -1624.988 where: short stacking energy: -699.116 Base-Backbone interact. energy: 1.915 local terms energy: -710.950425 where: bonds (distance) C4'-P energy: -123.468 bonds (distance) P-C4' energy: -145.353 flat angles C4'-P-C4' energy: -152.350 flat angles P-C4'-P energy: -94.741 tors. eta vs tors. theta energy: -195.038 Dist. restrs. and SS energy: 5.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -2199.017408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.017408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.034309 (E_RNA) where: Base-Base interactions energy: -1532.661 where: short stacking energy: -625.144 Base-Backbone interact. energy: -1.758 local terms energy: -680.615253 where: bonds (distance) C4'-P energy: -140.493 bonds (distance) P-C4' energy: -121.650 flat angles C4'-P-C4' energy: -143.978 flat angles P-C4'-P energy: -97.769 tors. eta vs tors. theta energy: -176.726 Dist. restrs. and SS energy: 16.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -2209.090294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2209.090294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2222.564072 (E_RNA) where: Base-Base interactions energy: -1551.687 where: short stacking energy: -634.536 Base-Backbone interact. energy: -1.018 local terms energy: -669.858451 where: bonds (distance) C4'-P energy: -132.987 bonds (distance) P-C4' energy: -120.292 flat angles C4'-P-C4' energy: -146.031 flat angles P-C4'-P energy: -95.526 tors. eta vs tors. theta energy: -175.023 Dist. restrs. and SS energy: 13.474 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -2015.478520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.478520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.258792 (E_RNA) where: Base-Base interactions energy: -1427.481 where: short stacking energy: -577.039 Base-Backbone interact. energy: -0.407 local terms energy: -605.370737 where: bonds (distance) C4'-P energy: -117.482 bonds (distance) P-C4' energy: -124.095 flat angles C4'-P-C4' energy: -138.706 flat angles P-C4'-P energy: -73.152 tors. eta vs tors. theta energy: -151.937 Dist. restrs. and SS energy: 17.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1990.846723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1990.846723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.038255 (E_RNA) where: Base-Base interactions energy: -1399.404 where: short stacking energy: -603.125 Base-Backbone interact. energy: -1.668 local terms energy: -610.966237 where: bonds (distance) C4'-P energy: -98.020 bonds (distance) P-C4' energy: -122.480 flat angles C4'-P-C4' energy: -123.895 flat angles P-C4'-P energy: -106.557 tors. eta vs tors. theta energy: -160.015 Dist. restrs. and SS energy: 21.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -1792.369241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1792.369241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1814.840829 (E_RNA) where: Base-Base interactions energy: -1273.521 where: short stacking energy: -541.286 Base-Backbone interact. energy: 3.799 local terms energy: -545.118943 where: bonds (distance) C4'-P energy: -115.264 bonds (distance) P-C4' energy: -126.287 flat angles C4'-P-C4' energy: -128.165 flat angles P-C4'-P energy: -34.751 tors. eta vs tors. theta energy: -140.652 Dist. restrs. and SS energy: 22.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2677.504555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2677.504555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2682.128381 (E_RNA) where: Base-Base interactions energy: -1876.795 where: short stacking energy: -794.377 Base-Backbone interact. energy: -1.708 local terms energy: -803.625496 where: bonds (distance) C4'-P energy: -153.258 bonds (distance) P-C4' energy: -152.486 flat angles C4'-P-C4' energy: -167.328 flat angles P-C4'-P energy: -103.559 tors. eta vs tors. theta energy: -226.995 Dist. restrs. and SS energy: 4.624 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2543.995027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2543.995027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2557.705384 (E_RNA) where: Base-Base interactions energy: -1763.422 where: short stacking energy: -750.092 Base-Backbone interact. energy: -2.835 local terms energy: -791.447821 where: bonds (distance) C4'-P energy: -160.048 bonds (distance) P-C4' energy: -141.464 flat angles C4'-P-C4' energy: -170.266 flat angles P-C4'-P energy: -115.651 tors. eta vs tors. theta energy: -204.019 Dist. restrs. and SS energy: 13.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -2519.346357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2519.346357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.086275 (E_RNA) where: Base-Base interactions energy: -1793.471 where: short stacking energy: -760.380 Base-Backbone interact. energy: -1.356 local terms energy: -731.259966 where: bonds (distance) C4'-P energy: -135.487 bonds (distance) P-C4' energy: -137.982 flat angles C4'-P-C4' energy: -154.559 flat angles P-C4'-P energy: -99.795 tors. eta vs tors. theta energy: -203.437 Dist. restrs. and SS energy: 6.740 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -2425.993591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2425.993591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2433.191842 (E_RNA) where: Base-Base interactions energy: -1692.898 where: short stacking energy: -728.456 Base-Backbone interact. energy: -0.882 local terms energy: -739.411897 where: bonds (distance) C4'-P energy: -132.144 bonds (distance) P-C4' energy: -142.118 flat angles C4'-P-C4' energy: -158.011 flat angles P-C4'-P energy: -99.370 tors. eta vs tors. theta energy: -207.769 Dist. restrs. and SS energy: 7.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -2290.793288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2290.793288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.630580 (E_RNA) where: Base-Base interactions energy: -1583.004 where: short stacking energy: -684.538 Base-Backbone interact. energy: 0.238 local terms energy: -723.864276 where: bonds (distance) C4'-P energy: -141.078 bonds (distance) P-C4' energy: -132.336 flat angles C4'-P-C4' energy: -162.938 flat angles P-C4'-P energy: -94.170 tors. eta vs tors. theta energy: -193.342 Dist. restrs. and SS energy: 15.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -2211.723615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2211.723615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2224.971305 (E_RNA) where: Base-Base interactions energy: -1572.920 where: short stacking energy: -612.506 Base-Backbone interact. energy: -1.584 local terms energy: -650.467190 where: bonds (distance) C4'-P energy: -116.635 bonds (distance) P-C4' energy: -120.943 flat angles C4'-P-C4' energy: -142.688 flat angles P-C4'-P energy: -90.292 tors. eta vs tors. theta energy: -179.909 Dist. restrs. and SS energy: 13.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -2235.837263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2235.837263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.426527 (E_RNA) where: Base-Base interactions energy: -1579.468 where: short stacking energy: -670.536 Base-Backbone interact. energy: 0.210 local terms energy: -662.168301 where: bonds (distance) C4'-P energy: -128.230 bonds (distance) P-C4' energy: -111.840 flat angles C4'-P-C4' energy: -138.135 flat angles P-C4'-P energy: -86.055 tors. eta vs tors. theta energy: -197.908 Dist. restrs. and SS energy: 5.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -2158.539929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2158.539929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.212916 (E_RNA) where: Base-Base interactions energy: -1540.364 where: short stacking energy: -663.272 Base-Backbone interact. energy: -0.490 local terms energy: -633.358192 where: bonds (distance) C4'-P energy: -122.908 bonds (distance) P-C4' energy: -121.351 flat angles C4'-P-C4' energy: -136.872 flat angles P-C4'-P energy: -73.003 tors. eta vs tors. theta energy: -179.224 Dist. restrs. and SS energy: 15.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1980.593395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1980.593395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1998.721271 (E_RNA) where: Base-Base interactions energy: -1465.304 where: short stacking energy: -602.822 Base-Backbone interact. energy: 3.247 local terms energy: -536.664773 where: bonds (distance) C4'-P energy: -93.065 bonds (distance) P-C4' energy: -102.915 flat angles C4'-P-C4' energy: -113.833 flat angles P-C4'-P energy: -74.950 tors. eta vs tors. theta energy: -151.902 Dist. restrs. and SS energy: 18.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -1801.091234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1801.091234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.144212 (E_RNA) where: Base-Base interactions energy: -1292.382 where: short stacking energy: -515.024 Base-Backbone interact. energy: -2.176 local terms energy: -532.586270 where: bonds (distance) C4'-P energy: -101.193 bonds (distance) P-C4' energy: -123.984 flat angles C4'-P-C4' energy: -111.307 flat angles P-C4'-P energy: -72.331 tors. eta vs tors. theta energy: -123.770 Dist. restrs. and SS energy: 26.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2676.092909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2676.092909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2678.713179 (E_RNA) where: Base-Base interactions energy: -1883.456 where: short stacking energy: -785.881 Base-Backbone interact. energy: -4.529 local terms energy: -790.728176 where: bonds (distance) C4'-P energy: -148.962 bonds (distance) P-C4' energy: -138.739 flat angles C4'-P-C4' energy: -171.746 flat angles P-C4'-P energy: -105.446 tors. eta vs tors. theta energy: -225.836 Dist. restrs. and SS energy: 2.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2555.542121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2555.542121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2565.241531 (E_RNA) where: Base-Base interactions energy: -1778.878 where: short stacking energy: -724.115 Base-Backbone interact. energy: -1.663 local terms energy: -784.700352 where: bonds (distance) C4'-P energy: -138.005 bonds (distance) P-C4' energy: -152.788 flat angles C4'-P-C4' energy: -168.622 flat angles P-C4'-P energy: -110.151 tors. eta vs tors. theta energy: -215.134 Dist. restrs. and SS energy: 9.699 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2457.369710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2457.369710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2463.750098 (E_RNA) where: Base-Base interactions energy: -1712.059 where: short stacking energy: -733.202 Base-Backbone interact. energy: -1.071 local terms energy: -750.620956 where: bonds (distance) C4'-P energy: -140.393 bonds (distance) P-C4' energy: -132.790 flat angles C4'-P-C4' energy: -158.331 flat angles P-C4'-P energy: -113.985 tors. eta vs tors. theta energy: -205.122 Dist. restrs. and SS energy: 6.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -2449.617636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2449.617636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2455.137063 (E_RNA) where: Base-Base interactions energy: -1756.173 where: short stacking energy: -732.326 Base-Backbone interact. energy: -1.387 local terms energy: -697.577045 where: bonds (distance) C4'-P energy: -122.219 bonds (distance) P-C4' energy: -117.556 flat angles C4'-P-C4' energy: -147.827 flat angles P-C4'-P energy: -103.609 tors. eta vs tors. theta energy: -206.366 Dist. restrs. and SS energy: 5.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -2300.932045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2300.932045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2308.956375 (E_RNA) where: Base-Base interactions energy: -1592.686 where: short stacking energy: -647.940 Base-Backbone interact. energy: -1.807 local terms energy: -714.463732 where: bonds (distance) C4'-P energy: -143.639 bonds (distance) P-C4' energy: -139.569 flat angles C4'-P-C4' energy: -152.046 flat angles P-C4'-P energy: -99.102 tors. eta vs tors. theta energy: -180.107 Dist. restrs. and SS energy: 8.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -2171.952493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2171.952493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2180.798984 (E_RNA) where: Base-Base interactions energy: -1521.086 where: short stacking energy: -649.420 Base-Backbone interact. energy: 3.290 local terms energy: -663.003034 where: bonds (distance) C4'-P energy: -120.625 bonds (distance) P-C4' energy: -117.356 flat angles C4'-P-C4' energy: -145.616 flat angles P-C4'-P energy: -98.851 tors. eta vs tors. theta energy: -180.556 Dist. restrs. and SS energy: 8.846 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -2230.386047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2230.386047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.019761 (E_RNA) where: Base-Base interactions energy: -1555.400 where: short stacking energy: -642.877 Base-Backbone interact. energy: -1.655 local terms energy: -679.964331 where: bonds (distance) C4'-P energy: -124.362 bonds (distance) P-C4' energy: -122.299 flat angles C4'-P-C4' energy: -129.927 flat angles P-C4'-P energy: -113.370 tors. eta vs tors. theta energy: -190.007 Dist. restrs. and SS energy: 6.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -2158.828098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2158.828098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2172.396458 (E_RNA) where: Base-Base interactions energy: -1533.847 where: short stacking energy: -624.654 Base-Backbone interact. energy: -1.772 local terms energy: -636.778395 where: bonds (distance) C4'-P energy: -106.269 bonds (distance) P-C4' energy: -119.554 flat angles C4'-P-C4' energy: -145.929 flat angles P-C4'-P energy: -93.976 tors. eta vs tors. theta energy: -171.050 Dist. restrs. and SS energy: 13.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1935.270746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.270746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1951.025635 (E_RNA) where: Base-Base interactions energy: -1433.486 where: short stacking energy: -580.324 Base-Backbone interact. energy: -1.148 local terms energy: -516.392131 where: bonds (distance) C4'-P energy: -90.673 bonds (distance) P-C4' energy: -105.897 flat angles C4'-P-C4' energy: -112.100 flat angles P-C4'-P energy: -53.685 tors. eta vs tors. theta energy: -154.037 Dist. restrs. and SS energy: 15.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -1837.151817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1837.151817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1861.102417 (E_RNA) where: Base-Base interactions energy: -1306.244 where: short stacking energy: -536.527 Base-Backbone interact. energy: 0.908 local terms energy: -555.766692 where: bonds (distance) C4'-P energy: -109.805 bonds (distance) P-C4' energy: -115.280 flat angles C4'-P-C4' energy: -126.562 flat angles P-C4'-P energy: -75.299 tors. eta vs tors. theta energy: -128.821 Dist. restrs. and SS energy: 23.951 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2651.873432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2651.873432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2654.771956 (E_RNA) where: Base-Base interactions energy: -1871.364 where: short stacking energy: -799.454 Base-Backbone interact. energy: -3.788 local terms energy: -779.619366 where: bonds (distance) C4'-P energy: -146.019 bonds (distance) P-C4' energy: -140.919 flat angles C4'-P-C4' energy: -176.065 flat angles P-C4'-P energy: -94.882 tors. eta vs tors. theta energy: -221.735 Dist. restrs. and SS energy: 2.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2526.052722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.052722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.580712 (E_RNA) where: Base-Base interactions energy: -1764.363 where: short stacking energy: -724.933 Base-Backbone interact. energy: 0.109 local terms energy: -770.326693 where: bonds (distance) C4'-P energy: -141.413 bonds (distance) P-C4' energy: -150.179 flat angles C4'-P-C4' energy: -167.026 flat angles P-C4'-P energy: -111.513 tors. eta vs tors. theta energy: -200.196 Dist. restrs. and SS energy: 8.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -2515.676896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2515.676896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.320437 (E_RNA) where: Base-Base interactions energy: -1750.578 where: short stacking energy: -741.094 Base-Backbone interact. energy: -2.274 local terms energy: -768.468103 where: bonds (distance) C4'-P energy: -131.514 bonds (distance) P-C4' energy: -157.363 flat angles C4'-P-C4' energy: -154.865 flat angles P-C4'-P energy: -113.939 tors. eta vs tors. theta energy: -210.788 Dist. restrs. and SS energy: 5.644 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -2461.326598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2461.326598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2467.297636 (E_RNA) where: Base-Base interactions energy: -1705.816 where: short stacking energy: -701.832 Base-Backbone interact. energy: -1.291 local terms energy: -760.191454 where: bonds (distance) C4'-P energy: -138.197 bonds (distance) P-C4' energy: -142.202 flat angles C4'-P-C4' energy: -169.749 flat angles P-C4'-P energy: -96.665 tors. eta vs tors. theta energy: -213.378 Dist. restrs. and SS energy: 5.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -2271.545349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2271.545349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2278.643508 (E_RNA) where: Base-Base interactions energy: -1610.138 where: short stacking energy: -679.006 Base-Backbone interact. energy: -3.762 local terms energy: -664.743588 where: bonds (distance) C4'-P energy: -135.986 bonds (distance) P-C4' energy: -108.000 flat angles C4'-P-C4' energy: -149.956 flat angles P-C4'-P energy: -96.073 tors. eta vs tors. theta energy: -174.729 Dist. restrs. and SS energy: 7.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -2317.711526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2317.711526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.846936 (E_RNA) where: Base-Base interactions energy: -1638.753 where: short stacking energy: -675.863 Base-Backbone interact. energy: -0.041 local terms energy: -686.052993 where: bonds (distance) C4'-P energy: -114.264 bonds (distance) P-C4' energy: -131.092 flat angles C4'-P-C4' energy: -148.291 flat angles P-C4'-P energy: -98.173 tors. eta vs tors. theta energy: -194.234 Dist. restrs. and SS energy: 7.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -2095.979280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2095.979280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2108.241758 (E_RNA) where: Base-Base interactions energy: -1488.114 where: short stacking energy: -630.763 Base-Backbone interact. energy: -1.385 local terms energy: -618.743615 where: bonds (distance) C4'-P energy: -123.255 bonds (distance) P-C4' energy: -112.701 flat angles C4'-P-C4' energy: -130.978 flat angles P-C4'-P energy: -81.404 tors. eta vs tors. theta energy: -170.406 Dist. restrs. and SS energy: 12.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -2186.938619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.938619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.815121 (E_RNA) where: Base-Base interactions energy: -1549.099 where: short stacking energy: -640.427 Base-Backbone interact. energy: -4.468 local terms energy: -643.248121 where: bonds (distance) C4'-P energy: -126.234 bonds (distance) P-C4' energy: -110.106 flat angles C4'-P-C4' energy: -145.316 flat angles P-C4'-P energy: -84.010 tors. eta vs tors. theta energy: -177.583 Dist. restrs. and SS energy: 9.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1947.563221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1947.563221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.352948 (E_RNA) where: Base-Base interactions energy: -1407.047 where: short stacking energy: -562.686 Base-Backbone interact. energy: 1.079 local terms energy: -555.385395 where: bonds (distance) C4'-P energy: -118.495 bonds (distance) P-C4' energy: -108.079 flat angles C4'-P-C4' energy: -114.342 flat angles P-C4'-P energy: -68.993 tors. eta vs tors. theta energy: -145.476 Dist. restrs. and SS energy: 13.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -1742.814985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1742.814985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.504668 (E_RNA) where: Base-Base interactions energy: -1213.879 where: short stacking energy: -507.200 Base-Backbone interact. energy: -2.687 local terms energy: -555.938423 where: bonds (distance) C4'-P energy: -120.316 bonds (distance) P-C4' energy: -121.617 flat angles C4'-P-C4' energy: -125.671 flat angles P-C4'-P energy: -55.336 tors. eta vs tors. theta energy: -132.998 Dist. restrs. and SS energy: 29.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2644.338720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2644.338720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2648.394180 (E_RNA) where: Base-Base interactions energy: -1828.812 where: short stacking energy: -793.495 Base-Backbone interact. energy: -2.076 local terms energy: -817.506052 where: bonds (distance) C4'-P energy: -154.623 bonds (distance) P-C4' energy: -153.547 flat angles C4'-P-C4' energy: -170.713 flat angles P-C4'-P energy: -111.603 tors. eta vs tors. theta energy: -227.020 Dist. restrs. and SS energy: 4.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2547.115051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.115051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2556.106039 (E_RNA) where: Base-Base interactions energy: -1784.273 where: short stacking energy: -751.076 Base-Backbone interact. energy: -2.901 local terms energy: -768.932008 where: bonds (distance) C4'-P energy: -130.055 bonds (distance) P-C4' energy: -147.685 flat angles C4'-P-C4' energy: -171.184 flat angles P-C4'-P energy: -110.099 tors. eta vs tors. theta energy: -209.908 Dist. restrs. and SS energy: 8.991 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2505.708683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.708683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2517.684308 (E_RNA) where: Base-Base interactions energy: -1759.777 where: short stacking energy: -750.814 Base-Backbone interact. energy: -3.897 local terms energy: -754.009788 where: bonds (distance) C4'-P energy: -141.299 bonds (distance) P-C4' energy: -130.489 flat angles C4'-P-C4' energy: -155.759 flat angles P-C4'-P energy: -108.507 tors. eta vs tors. theta energy: -217.955 Dist. restrs. and SS energy: 11.976 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -2464.396812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2464.396812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2467.075065 (E_RNA) where: Base-Base interactions energy: -1718.528 where: short stacking energy: -730.095 Base-Backbone interact. energy: -2.333 local terms energy: -746.214133 where: bonds (distance) C4'-P energy: -125.885 bonds (distance) P-C4' energy: -139.144 flat angles C4'-P-C4' energy: -154.405 flat angles P-C4'-P energy: -107.518 tors. eta vs tors. theta energy: -219.261 Dist. restrs. and SS energy: 2.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -2433.761760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2433.761760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2438.160049 (E_RNA) where: Base-Base interactions energy: -1709.887 where: short stacking energy: -722.859 Base-Backbone interact. energy: -1.109 local terms energy: -727.164037 where: bonds (distance) C4'-P energy: -125.764 bonds (distance) P-C4' energy: -134.147 flat angles C4'-P-C4' energy: -159.172 flat angles P-C4'-P energy: -100.484 tors. eta vs tors. theta energy: -207.598 Dist. restrs. and SS energy: 4.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -2257.670376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.670376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.684488 (E_RNA) where: Base-Base interactions energy: -1623.870 where: short stacking energy: -675.277 Base-Backbone interact. energy: -2.430 local terms energy: -636.385023 where: bonds (distance) C4'-P energy: -115.864 bonds (distance) P-C4' energy: -128.976 flat angles C4'-P-C4' energy: -124.267 flat angles P-C4'-P energy: -89.250 tors. eta vs tors. theta energy: -178.027 Dist. restrs. and SS energy: 5.014 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -2089.388999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.388999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2103.516236 (E_RNA) where: Base-Base interactions energy: -1452.081 where: short stacking energy: -630.334 Base-Backbone interact. energy: 0.890 local terms energy: -652.325125 where: bonds (distance) C4'-P energy: -115.730 bonds (distance) P-C4' energy: -128.183 flat angles C4'-P-C4' energy: -147.643 flat angles P-C4'-P energy: -84.375 tors. eta vs tors. theta energy: -176.394 Dist. restrs. and SS energy: 14.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -2159.191302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2159.191302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.157010 (E_RNA) where: Base-Base interactions energy: -1515.450 where: short stacking energy: -641.995 Base-Backbone interact. energy: 1.740 local terms energy: -662.447223 where: bonds (distance) C4'-P energy: -112.991 bonds (distance) P-C4' energy: -130.654 flat angles C4'-P-C4' energy: -147.554 flat angles P-C4'-P energy: -76.248 tors. eta vs tors. theta energy: -195.000 Dist. restrs. and SS energy: 16.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1928.465884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.465884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.859019 (E_RNA) where: Base-Base interactions energy: -1357.122 where: short stacking energy: -546.494 Base-Backbone interact. energy: -1.611 local terms energy: -584.125815 where: bonds (distance) C4'-P energy: -118.038 bonds (distance) P-C4' energy: -118.011 flat angles C4'-P-C4' energy: -122.845 flat angles P-C4'-P energy: -76.131 tors. eta vs tors. theta energy: -149.102 Dist. restrs. and SS energy: 14.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -1846.943902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1846.943902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1861.994230 (E_RNA) where: Base-Base interactions energy: -1302.867 where: short stacking energy: -528.887 Base-Backbone interact. energy: 0.953 local terms energy: -560.080169 where: bonds (distance) C4'-P energy: -99.820 bonds (distance) P-C4' energy: -121.527 flat angles C4'-P-C4' energy: -130.075 flat angles P-C4'-P energy: -74.354 tors. eta vs tors. theta energy: -134.304 Dist. restrs. and SS energy: 15.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2668.088900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2668.088900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2672.116202 (E_RNA) where: Base-Base interactions energy: -1865.658 where: short stacking energy: -803.214 Base-Backbone interact. energy: 0.094 local terms energy: -806.552363 where: bonds (distance) C4'-P energy: -145.563 bonds (distance) P-C4' energy: -142.912 flat angles C4'-P-C4' energy: -167.568 flat angles P-C4'-P energy: -117.790 tors. eta vs tors. theta energy: -232.719 Dist. restrs. and SS energy: 4.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2544.397632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2544.397632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2554.824975 (E_RNA) where: Base-Base interactions energy: -1796.671 where: short stacking energy: -764.199 Base-Backbone interact. energy: -3.694 local terms energy: -754.459652 where: bonds (distance) C4'-P energy: -129.786 bonds (distance) P-C4' energy: -142.089 flat angles C4'-P-C4' energy: -169.740 flat angles P-C4'-P energy: -92.886 tors. eta vs tors. theta energy: -219.960 Dist. restrs. and SS energy: 10.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -2450.713777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2450.713777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2458.125191 (E_RNA) where: Base-Base interactions energy: -1724.024 where: short stacking energy: -742.191 Base-Backbone interact. energy: -2.353 local terms energy: -731.749095 where: bonds (distance) C4'-P energy: -124.927 bonds (distance) P-C4' energy: -127.585 flat angles C4'-P-C4' energy: -154.137 flat angles P-C4'-P energy: -109.758 tors. eta vs tors. theta energy: -215.342 Dist. restrs. and SS energy: 7.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -2478.992323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2478.992323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2481.679863 (E_RNA) where: Base-Base interactions energy: -1761.504 where: short stacking energy: -729.578 Base-Backbone interact. energy: -1.359 local terms energy: -718.816777 where: bonds (distance) C4'-P energy: -126.657 bonds (distance) P-C4' energy: -129.633 flat angles C4'-P-C4' energy: -144.487 flat angles P-C4'-P energy: -110.153 tors. eta vs tors. theta energy: -207.886 Dist. restrs. and SS energy: 2.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -2375.362707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2375.362707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2381.960173 (E_RNA) where: Base-Base interactions energy: -1673.626 where: short stacking energy: -701.680 Base-Backbone interact. energy: -3.977 local terms energy: -704.356410 where: bonds (distance) C4'-P energy: -122.863 bonds (distance) P-C4' energy: -135.442 flat angles C4'-P-C4' energy: -151.490 flat angles P-C4'-P energy: -94.925 tors. eta vs tors. theta energy: -199.636 Dist. restrs. and SS energy: 6.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -2257.611686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.611686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2266.874297 (E_RNA) where: Base-Base interactions energy: -1577.940 where: short stacking energy: -667.628 Base-Backbone interact. energy: -4.188 local terms energy: -684.746729 where: bonds (distance) C4'-P energy: -127.321 bonds (distance) P-C4' energy: -133.562 flat angles C4'-P-C4' energy: -148.278 flat angles P-C4'-P energy: -96.388 tors. eta vs tors. theta energy: -179.199 Dist. restrs. and SS energy: 9.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -2092.677053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2092.677053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2109.648572 (E_RNA) where: Base-Base interactions energy: -1462.468 where: short stacking energy: -611.219 Base-Backbone interact. energy: -1.940 local terms energy: -645.240330 where: bonds (distance) C4'-P energy: -127.637 bonds (distance) P-C4' energy: -102.921 flat angles C4'-P-C4' energy: -155.539 flat angles P-C4'-P energy: -78.835 tors. eta vs tors. theta energy: -180.308 Dist. restrs. and SS energy: 16.972 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -2136.729947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2136.729947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2145.991675 (E_RNA) where: Base-Base interactions energy: -1485.047 where: short stacking energy: -628.295 Base-Backbone interact. energy: -0.115 local terms energy: -660.829599 where: bonds (distance) C4'-P energy: -124.976 bonds (distance) P-C4' energy: -119.780 flat angles C4'-P-C4' energy: -142.806 flat angles P-C4'-P energy: -99.064 tors. eta vs tors. theta energy: -174.203 Dist. restrs. and SS energy: 9.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1932.419314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.419314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1950.583895 (E_RNA) where: Base-Base interactions energy: -1360.136 where: short stacking energy: -548.298 Base-Backbone interact. energy: -1.430 local terms energy: -589.017304 where: bonds (distance) C4'-P energy: -109.786 bonds (distance) P-C4' energy: -117.961 flat angles C4'-P-C4' energy: -128.643 flat angles P-C4'-P energy: -84.832 tors. eta vs tors. theta energy: -147.794 Dist. restrs. and SS energy: 18.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1918.154508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.154508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1938.388444 (E_RNA) where: Base-Base interactions energy: -1336.087 where: short stacking energy: -554.074 Base-Backbone interact. energy: 2.987 local terms energy: -605.289332 where: bonds (distance) C4'-P energy: -140.504 bonds (distance) P-C4' energy: -116.831 flat angles C4'-P-C4' energy: -115.232 flat angles P-C4'-P energy: -77.609 tors. eta vs tors. theta energy: -155.113 Dist. restrs. and SS energy: 20.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2689.542850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2689.542850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2692.413595 (E_RNA) where: Base-Base interactions energy: -1900.040 where: short stacking energy: -799.204 Base-Backbone interact. energy: 1.375 local terms energy: -793.748831 where: bonds (distance) C4'-P energy: -139.527 bonds (distance) P-C4' energy: -151.827 flat angles C4'-P-C4' energy: -172.358 flat angles P-C4'-P energy: -100.021 tors. eta vs tors. theta energy: -230.016 Dist. restrs. and SS energy: 2.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2516.194913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.194913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2527.683289 (E_RNA) where: Base-Base interactions energy: -1739.745 where: short stacking energy: -716.332 Base-Backbone interact. energy: -2.225 local terms energy: -785.713561 where: bonds (distance) C4'-P energy: -148.521 bonds (distance) P-C4' energy: -156.408 flat angles C4'-P-C4' energy: -164.366 flat angles P-C4'-P energy: -112.680 tors. eta vs tors. theta energy: -203.739 Dist. restrs. and SS energy: 11.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2553.871922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2553.871922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2556.181337 (E_RNA) where: Base-Base interactions energy: -1777.251 where: short stacking energy: -727.375 Base-Backbone interact. energy: -3.230 local terms energy: -775.699568 where: bonds (distance) C4'-P energy: -142.853 bonds (distance) P-C4' energy: -141.543 flat angles C4'-P-C4' energy: -158.207 flat angles P-C4'-P energy: -112.437 tors. eta vs tors. theta energy: -220.660 Dist. restrs. and SS energy: 2.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -2417.203927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2417.203927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2422.941021 (E_RNA) where: Base-Base interactions energy: -1703.591 where: short stacking energy: -706.978 Base-Backbone interact. energy: -2.427 local terms energy: -716.923695 where: bonds (distance) C4'-P energy: -133.238 bonds (distance) P-C4' energy: -136.466 flat angles C4'-P-C4' energy: -162.317 flat angles P-C4'-P energy: -93.171 tors. eta vs tors. theta energy: -191.732 Dist. restrs. and SS energy: 5.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -2401.933413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2401.933413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2413.100736 (E_RNA) where: Base-Base interactions energy: -1662.241 where: short stacking energy: -734.932 Base-Backbone interact. energy: -3.441 local terms energy: -747.418960 where: bonds (distance) C4'-P energy: -116.732 bonds (distance) P-C4' energy: -148.605 flat angles C4'-P-C4' energy: -154.285 flat angles P-C4'-P energy: -106.621 tors. eta vs tors. theta energy: -221.177 Dist. restrs. and SS energy: 11.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -2264.919033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2264.919033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2271.906891 (E_RNA) where: Base-Base interactions energy: -1583.076 where: short stacking energy: -671.332 Base-Backbone interact. energy: -0.659 local terms energy: -688.171733 where: bonds (distance) C4'-P energy: -119.197 bonds (distance) P-C4' energy: -121.781 flat angles C4'-P-C4' energy: -155.707 flat angles P-C4'-P energy: -96.804 tors. eta vs tors. theta energy: -194.683 Dist. restrs. and SS energy: 6.988 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -2167.245076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2167.245076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.213147 (E_RNA) where: Base-Base interactions energy: -1543.277 where: short stacking energy: -635.898 Base-Backbone interact. energy: -4.393 local terms energy: -628.542983 where: bonds (distance) C4'-P energy: -122.713 bonds (distance) P-C4' energy: -119.614 flat angles C4'-P-C4' energy: -130.189 flat angles P-C4'-P energy: -87.169 tors. eta vs tors. theta energy: -168.858 Dist. restrs. and SS energy: 8.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -2046.111670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.111670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2061.181208 (E_RNA) where: Base-Base interactions energy: -1472.878 where: short stacking energy: -612.126 Base-Backbone interact. energy: -2.377 local terms energy: -585.926281 where: bonds (distance) C4'-P energy: -103.149 bonds (distance) P-C4' energy: -117.421 flat angles C4'-P-C4' energy: -128.084 flat angles P-C4'-P energy: -81.319 tors. eta vs tors. theta energy: -155.953 Dist. restrs. and SS energy: 15.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -2001.987060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.987060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2010.437393 (E_RNA) where: Base-Base interactions energy: -1401.544 where: short stacking energy: -579.805 Base-Backbone interact. energy: 0.505 local terms energy: -609.398524 where: bonds (distance) C4'-P energy: -111.685 bonds (distance) P-C4' energy: -118.791 flat angles C4'-P-C4' energy: -129.315 flat angles P-C4'-P energy: -87.363 tors. eta vs tors. theta energy: -162.245 Dist. restrs. and SS energy: 8.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1886.572585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.572585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1903.259621 (E_RNA) where: Base-Base interactions energy: -1348.886 where: short stacking energy: -553.704 Base-Backbone interact. energy: -1.095 local terms energy: -553.278455 where: bonds (distance) C4'-P energy: -111.457 bonds (distance) P-C4' energy: -98.311 flat angles C4'-P-C4' energy: -122.111 flat angles P-C4'-P energy: -72.783 tors. eta vs tors. theta energy: -148.617 Dist. restrs. and SS energy: 16.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2677.935557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2677.935557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2680.204144 (E_RNA) where: Base-Base interactions energy: -1874.858 where: short stacking energy: -782.293 Base-Backbone interact. energy: -1.697 local terms energy: -803.648903 where: bonds (distance) C4'-P energy: -140.466 bonds (distance) P-C4' energy: -152.632 flat angles C4'-P-C4' energy: -163.257 flat angles P-C4'-P energy: -122.903 tors. eta vs tors. theta energy: -224.391 Dist. restrs. and SS energy: 2.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2658.349176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2658.349176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2660.192273 (E_RNA) where: Base-Base interactions energy: -1856.707 where: short stacking energy: -797.028 Base-Backbone interact. energy: -1.935 local terms energy: -801.550915 where: bonds (distance) C4'-P energy: -133.662 bonds (distance) P-C4' energy: -156.966 flat angles C4'-P-C4' energy: -160.927 flat angles P-C4'-P energy: -120.644 tors. eta vs tors. theta energy: -229.352 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2511.387472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2511.387472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2519.559433 (E_RNA) where: Base-Base interactions energy: -1742.293 where: short stacking energy: -730.382 Base-Backbone interact. energy: -5.031 local terms energy: -772.234852 where: bonds (distance) C4'-P energy: -144.170 bonds (distance) P-C4' energy: -150.197 flat angles C4'-P-C4' energy: -163.432 flat angles P-C4'-P energy: -110.220 tors. eta vs tors. theta energy: -204.217 Dist. restrs. and SS energy: 8.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -2504.889897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2504.889897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2513.123095 (E_RNA) where: Base-Base interactions energy: -1772.789 where: short stacking energy: -767.627 Base-Backbone interact. energy: -1.574 local terms energy: -738.759823 where: bonds (distance) C4'-P energy: -126.375 bonds (distance) P-C4' energy: -123.131 flat angles C4'-P-C4' energy: -159.619 flat angles P-C4'-P energy: -107.566 tors. eta vs tors. theta energy: -222.069 Dist. restrs. and SS energy: 8.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -2343.553289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2343.553289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2351.713475 (E_RNA) where: Base-Base interactions energy: -1618.098 where: short stacking energy: -716.273 Base-Backbone interact. energy: 0.726 local terms energy: -734.341767 where: bonds (distance) C4'-P energy: -139.722 bonds (distance) P-C4' energy: -125.086 flat angles C4'-P-C4' energy: -163.324 flat angles P-C4'-P energy: -96.006 tors. eta vs tors. theta energy: -210.204 Dist. restrs. and SS energy: 8.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -2296.260552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2296.260552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2314.229064 (E_RNA) where: Base-Base interactions energy: -1619.293 where: short stacking energy: -674.301 Base-Backbone interact. energy: 0.222 local terms energy: -695.158213 where: bonds (distance) C4'-P energy: -116.338 bonds (distance) P-C4' energy: -130.010 flat angles C4'-P-C4' energy: -147.911 flat angles P-C4'-P energy: -89.923 tors. eta vs tors. theta energy: -210.977 Dist. restrs. and SS energy: 17.969 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -2229.995125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2229.995125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2238.134550 (E_RNA) where: Base-Base interactions energy: -1578.071 where: short stacking energy: -664.590 Base-Backbone interact. energy: 2.057 local terms energy: -662.120905 where: bonds (distance) C4'-P energy: -109.703 bonds (distance) P-C4' energy: -121.502 flat angles C4'-P-C4' energy: -148.629 flat angles P-C4'-P energy: -91.311 tors. eta vs tors. theta energy: -190.975 Dist. restrs. and SS energy: 8.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -2061.587356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2061.587356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.422306 (E_RNA) where: Base-Base interactions energy: -1456.094 where: short stacking energy: -617.700 Base-Backbone interact. energy: -1.098 local terms energy: -617.229720 where: bonds (distance) C4'-P energy: -104.968 bonds (distance) P-C4' energy: -119.214 flat angles C4'-P-C4' energy: -144.278 flat angles P-C4'-P energy: -85.082 tors. eta vs tors. theta energy: -163.688 Dist. restrs. and SS energy: 12.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1887.180043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1887.180043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1905.409611 (E_RNA) where: Base-Base interactions energy: -1304.994 where: short stacking energy: -540.796 Base-Backbone interact. energy: 1.525 local terms energy: -601.940381 where: bonds (distance) C4'-P energy: -115.672 bonds (distance) P-C4' energy: -116.196 flat angles C4'-P-C4' energy: -142.168 flat angles P-C4'-P energy: -77.237 tors. eta vs tors. theta energy: -150.668 Dist. restrs. and SS energy: 18.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -1861.475122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1861.475122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1878.359768 (E_RNA) where: Base-Base interactions energy: -1318.499 where: short stacking energy: -548.361 Base-Backbone interact. energy: -0.274 local terms energy: -559.586143 where: bonds (distance) C4'-P energy: -119.510 bonds (distance) P-C4' energy: -98.501 flat angles C4'-P-C4' energy: -137.748 flat angles P-C4'-P energy: -62.572 tors. eta vs tors. theta energy: -141.255 Dist. restrs. and SS energy: 16.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2709.476145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2709.476145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2710.719651 (E_RNA) where: Base-Base interactions energy: -1921.917 where: short stacking energy: -822.740 Base-Backbone interact. energy: -2.590 local terms energy: -786.212337 where: bonds (distance) C4'-P energy: -142.034 bonds (distance) P-C4' energy: -126.214 flat angles C4'-P-C4' energy: -170.034 flat angles P-C4'-P energy: -108.909 tors. eta vs tors. theta energy: -239.022 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2642.824295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2642.824295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2647.538985 (E_RNA) where: Base-Base interactions energy: -1848.070 where: short stacking energy: -781.677 Base-Backbone interact. energy: -2.075 local terms energy: -797.393589 where: bonds (distance) C4'-P energy: -137.566 bonds (distance) P-C4' energy: -156.281 flat angles C4'-P-C4' energy: -169.785 flat angles P-C4'-P energy: -98.617 tors. eta vs tors. theta energy: -235.144 Dist. restrs. and SS energy: 4.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2489.489019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2489.489019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2498.493611 (E_RNA) where: Base-Base interactions energy: -1767.672 where: short stacking energy: -746.870 Base-Backbone interact. energy: -2.668 local terms energy: -728.153451 where: bonds (distance) C4'-P energy: -140.931 bonds (distance) P-C4' energy: -130.565 flat angles C4'-P-C4' energy: -156.832 flat angles P-C4'-P energy: -89.434 tors. eta vs tors. theta energy: -210.391 Dist. restrs. and SS energy: 9.005 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -2483.444856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2483.444856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2489.405951 (E_RNA) where: Base-Base interactions energy: -1727.769 where: short stacking energy: -728.343 Base-Backbone interact. energy: -1.399 local terms energy: -760.237840 where: bonds (distance) C4'-P energy: -129.000 bonds (distance) P-C4' energy: -140.087 flat angles C4'-P-C4' energy: -174.708 flat angles P-C4'-P energy: -111.889 tors. eta vs tors. theta energy: -204.553 Dist. restrs. and SS energy: 5.961 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -2345.586692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2345.586692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.910118 (E_RNA) where: Base-Base interactions energy: -1631.624 where: short stacking energy: -668.535 Base-Backbone interact. energy: -2.954 local terms energy: -720.331839 where: bonds (distance) C4'-P energy: -132.144 bonds (distance) P-C4' energy: -137.968 flat angles C4'-P-C4' energy: -142.963 flat angles P-C4'-P energy: -116.373 tors. eta vs tors. theta energy: -190.884 Dist. restrs. and SS energy: 9.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -2316.564485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.564485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2327.123313 (E_RNA) where: Base-Base interactions energy: -1623.729 where: short stacking energy: -680.680 Base-Backbone interact. energy: -0.094 local terms energy: -703.300164 where: bonds (distance) C4'-P energy: -121.976 bonds (distance) P-C4' energy: -132.412 flat angles C4'-P-C4' energy: -153.651 flat angles P-C4'-P energy: -93.988 tors. eta vs tors. theta energy: -201.273 Dist. restrs. and SS energy: 10.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -2202.938641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2202.938641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.084924 (E_RNA) where: Base-Base interactions energy: -1541.146 where: short stacking energy: -628.720 Base-Backbone interact. energy: -1.874 local terms energy: -668.065524 where: bonds (distance) C4'-P energy: -136.280 bonds (distance) P-C4' energy: -144.988 flat angles C4'-P-C4' energy: -130.727 flat angles P-C4'-P energy: -69.720 tors. eta vs tors. theta energy: -186.350 Dist. restrs. and SS energy: 8.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -2095.191554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2095.191554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.812937 (E_RNA) where: Base-Base interactions energy: -1467.922 where: short stacking energy: -596.278 Base-Backbone interact. energy: -0.344 local terms energy: -647.547648 where: bonds (distance) C4'-P energy: -108.564 bonds (distance) P-C4' energy: -129.873 flat angles C4'-P-C4' energy: -142.480 flat angles P-C4'-P energy: -90.663 tors. eta vs tors. theta energy: -175.966 Dist. restrs. and SS energy: 20.621 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1931.286768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.286768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.747022 (E_RNA) where: Base-Base interactions energy: -1353.577 where: short stacking energy: -549.528 Base-Backbone interact. energy: 0.837 local terms energy: -593.007094 where: bonds (distance) C4'-P energy: -98.718 bonds (distance) P-C4' energy: -120.366 flat angles C4'-P-C4' energy: -133.318 flat angles P-C4'-P energy: -76.899 tors. eta vs tors. theta energy: -163.705 Dist. restrs. and SS energy: 14.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1885.969439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.969439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1903.207021 (E_RNA) where: Base-Base interactions energy: -1315.917 where: short stacking energy: -527.482 Base-Backbone interact. energy: 0.609 local terms energy: -587.899577 where: bonds (distance) C4'-P energy: -124.373 bonds (distance) P-C4' energy: -120.136 flat angles C4'-P-C4' energy: -124.814 flat angles P-C4'-P energy: -84.727 tors. eta vs tors. theta energy: -133.850 Dist. restrs. and SS energy: 17.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2741.385998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2741.385998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2743.814957 (E_RNA) where: Base-Base interactions energy: -1926.691 where: short stacking energy: -816.644 Base-Backbone interact. energy: -2.254 local terms energy: -814.869744 where: bonds (distance) C4'-P energy: -155.622 bonds (distance) P-C4' energy: -140.209 flat angles C4'-P-C4' energy: -171.151 flat angles P-C4'-P energy: -118.464 tors. eta vs tors. theta energy: -229.424 Dist. restrs. and SS energy: 2.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2668.737437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2668.737437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2672.185099 (E_RNA) where: Base-Base interactions energy: -1855.624 where: short stacking energy: -784.682 Base-Backbone interact. energy: -7.005 local terms energy: -809.556742 where: bonds (distance) C4'-P energy: -147.884 bonds (distance) P-C4' energy: -148.462 flat angles C4'-P-C4' energy: -163.047 flat angles P-C4'-P energy: -122.281 tors. eta vs tors. theta energy: -227.884 Dist. restrs. and SS energy: 3.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2512.235089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2512.235089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.662283 (E_RNA) where: Base-Base interactions energy: -1763.160 where: short stacking energy: -744.031 Base-Backbone interact. energy: -4.647 local terms energy: -753.855957 where: bonds (distance) C4'-P energy: -142.127 bonds (distance) P-C4' energy: -136.596 flat angles C4'-P-C4' energy: -161.581 flat angles P-C4'-P energy: -101.351 tors. eta vs tors. theta energy: -212.201 Dist. restrs. and SS energy: 9.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -2448.468493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2448.468493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2451.731346 (E_RNA) where: Base-Base interactions energy: -1718.995 where: short stacking energy: -723.831 Base-Backbone interact. energy: -2.728 local terms energy: -730.008269 where: bonds (distance) C4'-P energy: -129.870 bonds (distance) P-C4' energy: -118.864 flat angles C4'-P-C4' energy: -166.428 flat angles P-C4'-P energy: -105.504 tors. eta vs tors. theta energy: -209.343 Dist. restrs. and SS energy: 3.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -2383.573392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.573392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2395.187232 (E_RNA) where: Base-Base interactions energy: -1642.123 where: short stacking energy: -708.826 Base-Backbone interact. energy: -4.773 local terms energy: -748.290822 where: bonds (distance) C4'-P energy: -137.335 bonds (distance) P-C4' energy: -141.645 flat angles C4'-P-C4' energy: -144.937 flat angles P-C4'-P energy: -116.655 tors. eta vs tors. theta energy: -207.720 Dist. restrs. and SS energy: 11.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -2299.987003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2299.987003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2309.646574 (E_RNA) where: Base-Base interactions energy: -1617.484 where: short stacking energy: -677.174 Base-Backbone interact. energy: 5.353 local terms energy: -697.516227 where: bonds (distance) C4'-P energy: -131.794 bonds (distance) P-C4' energy: -112.192 flat angles C4'-P-C4' energy: -150.200 flat angles P-C4'-P energy: -101.865 tors. eta vs tors. theta energy: -201.465 Dist. restrs. and SS energy: 9.660 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -2242.266307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2242.266307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.612421 (E_RNA) where: Base-Base interactions energy: -1577.379 where: short stacking energy: -667.393 Base-Backbone interact. energy: -2.962 local terms energy: -679.270635 where: bonds (distance) C4'-P energy: -143.981 bonds (distance) P-C4' energy: -118.032 flat angles C4'-P-C4' energy: -143.584 flat angles P-C4'-P energy: -80.401 tors. eta vs tors. theta energy: -193.273 Dist. restrs. and SS energy: 17.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -2106.433592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.433592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.382745 (E_RNA) where: Base-Base interactions energy: -1475.215 where: short stacking energy: -620.402 Base-Backbone interact. energy: -1.093 local terms energy: -652.074411 where: bonds (distance) C4'-P energy: -121.774 bonds (distance) P-C4' energy: -131.116 flat angles C4'-P-C4' energy: -153.182 flat angles P-C4'-P energy: -70.131 tors. eta vs tors. theta energy: -175.871 Dist. restrs. and SS energy: 21.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -2014.137912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2014.137912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2027.602906 (E_RNA) where: Base-Base interactions energy: -1420.942 where: short stacking energy: -590.338 Base-Backbone interact. energy: 4.723 local terms energy: -611.383861 where: bonds (distance) C4'-P energy: -118.145 bonds (distance) P-C4' energy: -116.450 flat angles C4'-P-C4' energy: -125.368 flat angles P-C4'-P energy: -88.676 tors. eta vs tors. theta energy: -162.744 Dist. restrs. and SS energy: 13.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1816.780189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1816.780189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.855179 (E_RNA) where: Base-Base interactions energy: -1260.649 where: short stacking energy: -537.505 Base-Backbone interact. energy: -4.085 local terms energy: -574.121513 where: bonds (distance) C4'-P energy: -108.800 bonds (distance) P-C4' energy: -108.404 flat angles C4'-P-C4' energy: -122.574 flat angles P-C4'-P energy: -94.011 tors. eta vs tors. theta energy: -140.334 Dist. restrs. and SS energy: 22.075 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2730.312171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2730.312171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2731.546874 (E_RNA) where: Base-Base interactions energy: -1903.054 where: short stacking energy: -819.936 Base-Backbone interact. energy: -0.432 local terms energy: -828.061708 where: bonds (distance) C4'-P energy: -159.527 bonds (distance) P-C4' energy: -137.396 flat angles C4'-P-C4' energy: -173.700 flat angles P-C4'-P energy: -116.485 tors. eta vs tors. theta energy: -240.954 Dist. restrs. and SS energy: 1.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2599.437304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2599.437304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2602.429361 (E_RNA) where: Base-Base interactions energy: -1794.388 where: short stacking energy: -762.383 Base-Backbone interact. energy: -1.912 local terms energy: -806.128868 where: bonds (distance) C4'-P energy: -149.721 bonds (distance) P-C4' energy: -138.743 flat angles C4'-P-C4' energy: -169.920 flat angles P-C4'-P energy: -115.799 tors. eta vs tors. theta energy: -231.946 Dist. restrs. and SS energy: 2.992 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2514.876353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.876353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.417242 (E_RNA) where: Base-Base interactions energy: -1768.827 where: short stacking energy: -738.881 Base-Backbone interact. energy: -2.305 local terms energy: -755.284544 where: bonds (distance) C4'-P energy: -134.327 bonds (distance) P-C4' energy: -135.772 flat angles C4'-P-C4' energy: -161.633 flat angles P-C4'-P energy: -112.409 tors. eta vs tors. theta energy: -211.143 Dist. restrs. and SS energy: 11.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -2487.625192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2487.625192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2491.532989 (E_RNA) where: Base-Base interactions energy: -1733.834 where: short stacking energy: -733.086 Base-Backbone interact. energy: -0.394 local terms energy: -757.304707 where: bonds (distance) C4'-P energy: -125.024 bonds (distance) P-C4' energy: -148.531 flat angles C4'-P-C4' energy: -164.449 flat angles P-C4'-P energy: -101.653 tors. eta vs tors. theta energy: -217.647 Dist. restrs. and SS energy: 3.908 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -2419.474188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2419.474188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2428.360598 (E_RNA) where: Base-Base interactions energy: -1680.269 where: short stacking energy: -724.910 Base-Backbone interact. energy: -4.351 local terms energy: -743.739673 where: bonds (distance) C4'-P energy: -122.724 bonds (distance) P-C4' energy: -133.821 flat angles C4'-P-C4' energy: -166.246 flat angles P-C4'-P energy: -111.181 tors. eta vs tors. theta energy: -209.768 Dist. restrs. and SS energy: 8.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -2288.191769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2288.191769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2296.016605 (E_RNA) where: Base-Base interactions energy: -1616.770 where: short stacking energy: -669.906 Base-Backbone interact. energy: -1.840 local terms energy: -677.406659 where: bonds (distance) C4'-P energy: -117.346 bonds (distance) P-C4' energy: -125.954 flat angles C4'-P-C4' energy: -147.917 flat angles P-C4'-P energy: -84.248 tors. eta vs tors. theta energy: -201.942 Dist. restrs. and SS energy: 7.825 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -2281.256327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2281.256327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2288.654615 (E_RNA) where: Base-Base interactions energy: -1614.553 where: short stacking energy: -667.945 Base-Backbone interact. energy: -1.623 local terms energy: -672.478783 where: bonds (distance) C4'-P energy: -134.945 bonds (distance) P-C4' energy: -124.678 flat angles C4'-P-C4' energy: -129.839 flat angles P-C4'-P energy: -89.969 tors. eta vs tors. theta energy: -193.048 Dist. restrs. and SS energy: 7.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -2115.682921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.682921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2124.004385 (E_RNA) where: Base-Base interactions energy: -1474.881 where: short stacking energy: -607.724 Base-Backbone interact. energy: -0.743 local terms energy: -648.380592 where: bonds (distance) C4'-P energy: -127.235 bonds (distance) P-C4' energy: -119.520 flat angles C4'-P-C4' energy: -132.182 flat angles P-C4'-P energy: -82.434 tors. eta vs tors. theta energy: -187.011 Dist. restrs. and SS energy: 8.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1976.491870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1976.491870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1992.363099 (E_RNA) where: Base-Base interactions energy: -1391.214 where: short stacking energy: -559.964 Base-Backbone interact. energy: -0.024 local terms energy: -601.124994 where: bonds (distance) C4'-P energy: -127.221 bonds (distance) P-C4' energy: -102.533 flat angles C4'-P-C4' energy: -133.566 flat angles P-C4'-P energy: -71.584 tors. eta vs tors. theta energy: -166.222 Dist. restrs. and SS energy: 15.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1790.788416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1790.788416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.790322 (E_RNA) where: Base-Base interactions energy: -1243.413 where: short stacking energy: -542.253 Base-Backbone interact. energy: -1.195 local terms energy: -568.182225 where: bonds (distance) C4'-P energy: -120.001 bonds (distance) P-C4' energy: -128.512 flat angles C4'-P-C4' energy: -130.931 flat angles P-C4'-P energy: -48.202 tors. eta vs tors. theta energy: -140.537 Dist. restrs. and SS energy: 22.002 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2755.588918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2755.588918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.113354 (E_RNA) where: Base-Base interactions energy: -1937.768 where: short stacking energy: -836.958 Base-Backbone interact. energy: -1.512 local terms energy: -817.833209 where: bonds (distance) C4'-P energy: -149.825 bonds (distance) P-C4' energy: -143.730 flat angles C4'-P-C4' energy: -172.936 flat angles P-C4'-P energy: -109.864 tors. eta vs tors. theta energy: -241.478 Dist. restrs. and SS energy: 1.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2611.348356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2611.348356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2620.811116 (E_RNA) where: Base-Base interactions energy: -1845.911 where: short stacking energy: -771.669 Base-Backbone interact. energy: -4.063 local terms energy: -770.837292 where: bonds (distance) C4'-P energy: -138.556 bonds (distance) P-C4' energy: -139.319 flat angles C4'-P-C4' energy: -170.248 flat angles P-C4'-P energy: -102.460 tors. eta vs tors. theta energy: -220.254 Dist. restrs. and SS energy: 9.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2567.351594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2567.351594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2570.039003 (E_RNA) where: Base-Base interactions energy: -1794.111 where: short stacking energy: -751.382 Base-Backbone interact. energy: -1.517 local terms energy: -774.411583 where: bonds (distance) C4'-P energy: -128.645 bonds (distance) P-C4' energy: -151.104 flat angles C4'-P-C4' energy: -164.773 flat angles P-C4'-P energy: -104.430 tors. eta vs tors. theta energy: -225.460 Dist. restrs. and SS energy: 2.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -2493.834400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2493.834400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2500.102182 (E_RNA) where: Base-Base interactions energy: -1751.766 where: short stacking energy: -747.781 Base-Backbone interact. energy: -1.505 local terms energy: -746.831223 where: bonds (distance) C4'-P energy: -130.334 bonds (distance) P-C4' energy: -142.021 flat angles C4'-P-C4' energy: -158.523 flat angles P-C4'-P energy: -98.332 tors. eta vs tors. theta energy: -217.621 Dist. restrs. and SS energy: 6.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -2409.895448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2409.895448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2414.819268 (E_RNA) where: Base-Base interactions energy: -1699.990 where: short stacking energy: -724.066 Base-Backbone interact. energy: -2.050 local terms energy: -712.779343 where: bonds (distance) C4'-P energy: -123.240 bonds (distance) P-C4' energy: -128.643 flat angles C4'-P-C4' energy: -141.789 flat angles P-C4'-P energy: -104.578 tors. eta vs tors. theta energy: -214.530 Dist. restrs. and SS energy: 4.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -2284.468248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2284.468248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.720121 (E_RNA) where: Base-Base interactions energy: -1656.117 where: short stacking energy: -682.153 Base-Backbone interact. energy: -2.621 local terms energy: -636.981659 where: bonds (distance) C4'-P energy: -110.999 bonds (distance) P-C4' energy: -127.641 flat angles C4'-P-C4' energy: -130.282 flat angles P-C4'-P energy: -76.788 tors. eta vs tors. theta energy: -191.271 Dist. restrs. and SS energy: 11.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -2249.950130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2249.950130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.687982 (E_RNA) where: Base-Base interactions energy: -1596.810 where: short stacking energy: -685.274 Base-Backbone interact. energy: -2.112 local terms energy: -656.766188 where: bonds (distance) C4'-P energy: -108.579 bonds (distance) P-C4' energy: -126.798 flat angles C4'-P-C4' energy: -138.538 flat angles P-C4'-P energy: -78.062 tors. eta vs tors. theta energy: -204.789 Dist. restrs. and SS energy: 5.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -2151.867759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2151.867759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2158.411544 (E_RNA) where: Base-Base interactions energy: -1507.563 where: short stacking energy: -613.525 Base-Backbone interact. energy: -0.342 local terms energy: -650.506426 where: bonds (distance) C4'-P energy: -118.770 bonds (distance) P-C4' energy: -132.164 flat angles C4'-P-C4' energy: -142.789 flat angles P-C4'-P energy: -84.761 tors. eta vs tors. theta energy: -172.023 Dist. restrs. and SS energy: 6.544 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1986.572383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1986.572383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2003.930711 (E_RNA) where: Base-Base interactions energy: -1440.092 where: short stacking energy: -569.086 Base-Backbone interact. energy: -2.499 local terms energy: -561.339479 where: bonds (distance) C4'-P energy: -121.633 bonds (distance) P-C4' energy: -95.571 flat angles C4'-P-C4' energy: -113.882 flat angles P-C4'-P energy: -69.670 tors. eta vs tors. theta energy: -160.584 Dist. restrs. and SS energy: 17.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1816.068327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1816.068327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1837.260432 (E_RNA) where: Base-Base interactions energy: -1291.709 where: short stacking energy: -508.849 Base-Backbone interact. energy: -3.025 local terms energy: -542.525735 where: bonds (distance) C4'-P energy: -117.634 bonds (distance) P-C4' energy: -93.815 flat angles C4'-P-C4' energy: -111.080 flat angles P-C4'-P energy: -79.070 tors. eta vs tors. theta energy: -140.927 Dist. restrs. and SS energy: 21.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2755.274472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2755.274472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2756.935848 (E_RNA) where: Base-Base interactions energy: -1925.349 where: short stacking energy: -842.517 Base-Backbone interact. energy: -0.996 local terms energy: -830.590396 where: bonds (distance) C4'-P energy: -151.518 bonds (distance) P-C4' energy: -155.193 flat angles C4'-P-C4' energy: -176.592 flat angles P-C4'-P energy: -108.944 tors. eta vs tors. theta energy: -238.343 Dist. restrs. and SS energy: 1.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2610.938151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2610.938151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2618.733858 (E_RNA) where: Base-Base interactions energy: -1834.343 where: short stacking energy: -749.671 Base-Backbone interact. energy: -1.722 local terms energy: -782.668230 where: bonds (distance) C4'-P energy: -142.374 bonds (distance) P-C4' energy: -143.620 flat angles C4'-P-C4' energy: -172.967 flat angles P-C4'-P energy: -98.354 tors. eta vs tors. theta energy: -225.353 Dist. restrs. and SS energy: 7.796 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2531.085129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2531.085129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.877961 (E_RNA) where: Base-Base interactions energy: -1781.156 where: short stacking energy: -761.600 Base-Backbone interact. energy: -2.583 local terms energy: -751.138952 where: bonds (distance) C4'-P energy: -145.224 bonds (distance) P-C4' energy: -128.934 flat angles C4'-P-C4' energy: -161.923 flat angles P-C4'-P energy: -95.560 tors. eta vs tors. theta energy: -219.498 Dist. restrs. and SS energy: 3.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -2505.566103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.566103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2515.844428 (E_RNA) where: Base-Base interactions energy: -1743.316 where: short stacking energy: -740.853 Base-Backbone interact. energy: -3.347 local terms energy: -769.181731 where: bonds (distance) C4'-P energy: -133.082 bonds (distance) P-C4' energy: -142.712 flat angles C4'-P-C4' energy: -163.759 flat angles P-C4'-P energy: -112.153 tors. eta vs tors. theta energy: -217.475 Dist. restrs. and SS energy: 10.278 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -2425.360581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2425.360581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2429.689969 (E_RNA) where: Base-Base interactions energy: -1714.306 where: short stacking energy: -727.868 Base-Backbone interact. energy: -3.185 local terms energy: -712.198559 where: bonds (distance) C4'-P energy: -123.618 bonds (distance) P-C4' energy: -132.431 flat angles C4'-P-C4' energy: -155.022 flat angles P-C4'-P energy: -98.179 tors. eta vs tors. theta energy: -202.949 Dist. restrs. and SS energy: 4.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -2250.531614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2250.531614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.871088 (E_RNA) where: Base-Base interactions energy: -1586.295 where: short stacking energy: -659.457 Base-Backbone interact. energy: -0.897 local terms energy: -675.678888 where: bonds (distance) C4'-P energy: -120.787 bonds (distance) P-C4' energy: -123.162 flat angles C4'-P-C4' energy: -150.335 flat angles P-C4'-P energy: -87.266 tors. eta vs tors. theta energy: -194.128 Dist. restrs. and SS energy: 12.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -2216.292200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.292200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2221.278761 (E_RNA) where: Base-Base interactions energy: -1550.928 where: short stacking energy: -652.533 Base-Backbone interact. energy: -0.651 local terms energy: -669.699651 where: bonds (distance) C4'-P energy: -128.739 bonds (distance) P-C4' energy: -114.660 flat angles C4'-P-C4' energy: -151.457 flat angles P-C4'-P energy: -88.951 tors. eta vs tors. theta energy: -185.893 Dist. restrs. and SS energy: 4.987 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -2160.666974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2160.666974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2168.949870 (E_RNA) where: Base-Base interactions energy: -1532.375 where: short stacking energy: -642.973 Base-Backbone interact. energy: -3.928 local terms energy: -632.646031 where: bonds (distance) C4'-P energy: -96.266 bonds (distance) P-C4' energy: -135.542 flat angles C4'-P-C4' energy: -128.349 flat angles P-C4'-P energy: -87.372 tors. eta vs tors. theta energy: -185.118 Dist. restrs. and SS energy: 8.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -2071.808852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2071.808852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.131233 (E_RNA) where: Base-Base interactions energy: -1465.929 where: short stacking energy: -608.811 Base-Backbone interact. energy: -1.370 local terms energy: -620.832258 where: bonds (distance) C4'-P energy: -109.552 bonds (distance) P-C4' energy: -131.498 flat angles C4'-P-C4' energy: -125.920 flat angles P-C4'-P energy: -91.166 tors. eta vs tors. theta energy: -162.696 Dist. restrs. and SS energy: 16.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1779.933178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1779.933178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.980907 (E_RNA) where: Base-Base interactions energy: -1269.312 where: short stacking energy: -517.572 Base-Backbone interact. energy: 0.264 local terms energy: -523.932781 where: bonds (distance) C4'-P energy: -109.571 bonds (distance) P-C4' energy: -105.384 flat angles C4'-P-C4' energy: -115.917 flat angles P-C4'-P energy: -51.805 tors. eta vs tors. theta energy: -141.255 Dist. restrs. and SS energy: 13.048 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2748.041626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2748.041626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2750.167952 (E_RNA) where: Base-Base interactions energy: -1923.517 where: short stacking energy: -821.619 Base-Backbone interact. energy: -2.525 local terms energy: -824.126099 where: bonds (distance) C4'-P energy: -141.285 bonds (distance) P-C4' energy: -156.850 flat angles C4'-P-C4' energy: -170.599 flat angles P-C4'-P energy: -107.124 tors. eta vs tors. theta energy: -248.269 Dist. restrs. and SS energy: 2.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2601.367088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2601.367088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2612.037487 (E_RNA) where: Base-Base interactions energy: -1821.076 where: short stacking energy: -764.756 Base-Backbone interact. energy: -0.571 local terms energy: -790.389582 where: bonds (distance) C4'-P energy: -132.849 bonds (distance) P-C4' energy: -146.252 flat angles C4'-P-C4' energy: -174.522 flat angles P-C4'-P energy: -120.468 tors. eta vs tors. theta energy: -216.298 Dist. restrs. and SS energy: 10.670 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2564.323243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2564.323243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2568.835330 (E_RNA) where: Base-Base interactions energy: -1798.144 where: short stacking energy: -780.416 Base-Backbone interact. energy: -0.075 local terms energy: -770.616470 where: bonds (distance) C4'-P energy: -131.259 bonds (distance) P-C4' energy: -152.490 flat angles C4'-P-C4' energy: -161.609 flat angles P-C4'-P energy: -107.356 tors. eta vs tors. theta energy: -217.902 Dist. restrs. and SS energy: 4.512 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -2475.469945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2475.469945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2480.689065 (E_RNA) where: Base-Base interactions energy: -1736.561 where: short stacking energy: -734.860 Base-Backbone interact. energy: 0.507 local terms energy: -744.635887 where: bonds (distance) C4'-P energy: -139.740 bonds (distance) P-C4' energy: -138.774 flat angles C4'-P-C4' energy: -158.464 flat angles P-C4'-P energy: -94.563 tors. eta vs tors. theta energy: -213.094 Dist. restrs. and SS energy: 5.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -2421.324779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2421.324779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2424.785704 (E_RNA) where: Base-Base interactions energy: -1746.609 where: short stacking energy: -725.508 Base-Backbone interact. energy: -3.500 local terms energy: -674.676274 where: bonds (distance) C4'-P energy: -96.285 bonds (distance) P-C4' energy: -127.127 flat angles C4'-P-C4' energy: -157.838 flat angles P-C4'-P energy: -92.540 tors. eta vs tors. theta energy: -200.887 Dist. restrs. and SS energy: 3.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -2276.333919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2276.333919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.431147 (E_RNA) where: Base-Base interactions energy: -1611.652 where: short stacking energy: -685.280 Base-Backbone interact. energy: -4.844 local terms energy: -663.934913 where: bonds (distance) C4'-P energy: -124.333 bonds (distance) P-C4' energy: -118.277 flat angles C4'-P-C4' energy: -147.949 flat angles P-C4'-P energy: -78.320 tors. eta vs tors. theta energy: -195.056 Dist. restrs. and SS energy: 4.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -2231.609185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2231.609185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.242699 (E_RNA) where: Base-Base interactions energy: -1548.677 where: short stacking energy: -640.432 Base-Backbone interact. energy: -1.866 local terms energy: -684.699942 where: bonds (distance) C4'-P energy: -109.396 bonds (distance) P-C4' energy: -128.276 flat angles C4'-P-C4' energy: -137.472 flat angles P-C4'-P energy: -111.600 tors. eta vs tors. theta energy: -197.957 Dist. restrs. and SS energy: 3.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -2154.477841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2154.477841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2166.225970 (E_RNA) where: Base-Base interactions energy: -1481.196 where: short stacking energy: -637.655 Base-Backbone interact. energy: -2.777 local terms energy: -682.253330 where: bonds (distance) C4'-P energy: -133.746 bonds (distance) P-C4' energy: -132.046 flat angles C4'-P-C4' energy: -143.523 flat angles P-C4'-P energy: -87.066 tors. eta vs tors. theta energy: -185.873 Dist. restrs. and SS energy: 11.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -2078.961063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2078.961063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.147193 (E_RNA) where: Base-Base interactions energy: -1496.884 where: short stacking energy: -620.034 Base-Backbone interact. energy: -1.328 local terms energy: -589.935331 where: bonds (distance) C4'-P energy: -97.287 bonds (distance) P-C4' energy: -119.584 flat angles C4'-P-C4' energy: -130.530 flat angles P-C4'-P energy: -72.424 tors. eta vs tors. theta energy: -170.110 Dist. restrs. and SS energy: 9.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1811.747131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1811.747131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1830.085463 (E_RNA) where: Base-Base interactions energy: -1302.997 where: short stacking energy: -508.020 Base-Backbone interact. energy: -1.171 local terms energy: -525.918158 where: bonds (distance) C4'-P energy: -109.470 bonds (distance) P-C4' energy: -118.892 flat angles C4'-P-C4' energy: -108.291 flat angles P-C4'-P energy: -63.105 tors. eta vs tors. theta energy: -126.161 Dist. restrs. and SS energy: 18.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2739.586056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2739.586056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2741.267541 (E_RNA) where: Base-Base interactions energy: -1924.111 where: short stacking energy: -805.676 Base-Backbone interact. energy: -2.983 local terms energy: -814.173028 where: bonds (distance) C4'-P energy: -147.294 bonds (distance) P-C4' energy: -142.758 flat angles C4'-P-C4' energy: -176.228 flat angles P-C4'-P energy: -116.367 tors. eta vs tors. theta energy: -231.525 Dist. restrs. and SS energy: 1.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2597.797364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2597.797364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2607.579534 (E_RNA) where: Base-Base interactions energy: -1814.223 where: short stacking energy: -757.268 Base-Backbone interact. energy: -2.000 local terms energy: -791.356661 where: bonds (distance) C4'-P energy: -152.556 bonds (distance) P-C4' energy: -138.101 flat angles C4'-P-C4' energy: -158.896 flat angles P-C4'-P energy: -115.230 tors. eta vs tors. theta energy: -226.574 Dist. restrs. and SS energy: 9.782 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2549.154818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2549.154818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2554.670319 (E_RNA) where: Base-Base interactions energy: -1773.368 where: short stacking energy: -739.358 Base-Backbone interact. energy: 1.266 local terms energy: -782.568068 where: bonds (distance) C4'-P energy: -138.792 bonds (distance) P-C4' energy: -140.131 flat angles C4'-P-C4' energy: -166.700 flat angles P-C4'-P energy: -116.735 tors. eta vs tors. theta energy: -220.211 Dist. restrs. and SS energy: 5.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -2440.262672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2440.262672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2448.180284 (E_RNA) where: Base-Base interactions energy: -1727.494 where: short stacking energy: -720.614 Base-Backbone interact. energy: -2.051 local terms energy: -718.635465 where: bonds (distance) C4'-P energy: -115.886 bonds (distance) P-C4' energy: -139.714 flat angles C4'-P-C4' energy: -153.119 flat angles P-C4'-P energy: -104.553 tors. eta vs tors. theta energy: -205.364 Dist. restrs. and SS energy: 7.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -2442.416842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2442.416842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2444.847071 (E_RNA) where: Base-Base interactions energy: -1728.011 where: short stacking energy: -725.997 Base-Backbone interact. energy: -1.626 local terms energy: -715.210797 where: bonds (distance) C4'-P energy: -115.857 bonds (distance) P-C4' energy: -136.166 flat angles C4'-P-C4' energy: -153.013 flat angles P-C4'-P energy: -98.799 tors. eta vs tors. theta energy: -211.376 Dist. restrs. and SS energy: 2.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -2280.582260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.582260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2286.382176 (E_RNA) where: Base-Base interactions energy: -1620.591 where: short stacking energy: -663.524 Base-Backbone interact. energy: -1.099 local terms energy: -664.692043 where: bonds (distance) C4'-P energy: -129.889 bonds (distance) P-C4' energy: -136.380 flat angles C4'-P-C4' energy: -126.321 flat angles P-C4'-P energy: -91.666 tors. eta vs tors. theta energy: -180.435 Dist. restrs. and SS energy: 5.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -2268.855252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2268.855252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2287.574522 (E_RNA) where: Base-Base interactions energy: -1616.543 where: short stacking energy: -668.875 Base-Backbone interact. energy: -5.502 local terms energy: -665.530020 where: bonds (distance) C4'-P energy: -107.215 bonds (distance) P-C4' energy: -160.782 flat angles C4'-P-C4' energy: -139.039 flat angles P-C4'-P energy: -91.201 tors. eta vs tors. theta energy: -167.293 Dist. restrs. and SS energy: 18.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -2176.541846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.541846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2185.310592 (E_RNA) where: Base-Base interactions energy: -1583.735 where: short stacking energy: -666.998 Base-Backbone interact. energy: -0.550 local terms energy: -601.026075 where: bonds (distance) C4'-P energy: -113.714 bonds (distance) P-C4' energy: -122.770 flat angles C4'-P-C4' energy: -122.262 flat angles P-C4'-P energy: -65.383 tors. eta vs tors. theta energy: -176.897 Dist. restrs. and SS energy: 8.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -2046.293878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.293878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.641759 (E_RNA) where: Base-Base interactions energy: -1450.649 where: short stacking energy: -604.662 Base-Backbone interact. energy: -2.714 local terms energy: -605.278626 where: bonds (distance) C4'-P energy: -133.929 bonds (distance) P-C4' energy: -92.326 flat angles C4'-P-C4' energy: -121.754 flat angles P-C4'-P energy: -75.175 tors. eta vs tors. theta energy: -182.094 Dist. restrs. and SS energy: 12.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1870.886122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1870.886122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1893.270164 (E_RNA) where: Base-Base interactions energy: -1341.715 where: short stacking energy: -576.653 Base-Backbone interact. energy: -0.856 local terms energy: -550.699109 where: bonds (distance) C4'-P energy: -106.407 bonds (distance) P-C4' energy: -106.693 flat angles C4'-P-C4' energy: -115.715 flat angles P-C4'-P energy: -71.817 tors. eta vs tors. theta energy: -150.067 Dist. restrs. and SS energy: 22.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2781.809230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2781.809230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2785.174058 (E_RNA) where: Base-Base interactions energy: -1960.355 where: short stacking energy: -840.011 Base-Backbone interact. energy: -0.960 local terms energy: -823.859121 where: bonds (distance) C4'-P energy: -141.841 bonds (distance) P-C4' energy: -155.016 flat angles C4'-P-C4' energy: -169.934 flat angles P-C4'-P energy: -112.441 tors. eta vs tors. theta energy: -244.628 Dist. restrs. and SS energy: 3.365 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2603.211030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2603.211030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2610.683532 (E_RNA) where: Base-Base interactions energy: -1847.462 where: short stacking energy: -775.925 Base-Backbone interact. energy: 2.998 local terms energy: -766.219497 where: bonds (distance) C4'-P energy: -145.385 bonds (distance) P-C4' energy: -142.807 flat angles C4'-P-C4' energy: -170.143 flat angles P-C4'-P energy: -88.227 tors. eta vs tors. theta energy: -219.658 Dist. restrs. and SS energy: 7.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2530.718951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2530.718951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2538.101690 (E_RNA) where: Base-Base interactions energy: -1785.303 where: short stacking energy: -765.396 Base-Backbone interact. energy: -3.683 local terms energy: -749.116214 where: bonds (distance) C4'-P energy: -142.954 bonds (distance) P-C4' energy: -135.408 flat angles C4'-P-C4' energy: -172.223 flat angles P-C4'-P energy: -95.298 tors. eta vs tors. theta energy: -203.233 Dist. restrs. and SS energy: 7.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2493.906120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2493.906120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2496.468728 (E_RNA) where: Base-Base interactions energy: -1760.348 where: short stacking energy: -753.498 Base-Backbone interact. energy: 3.514 local terms energy: -739.634507 where: bonds (distance) C4'-P energy: -128.865 bonds (distance) P-C4' energy: -136.005 flat angles C4'-P-C4' energy: -161.305 flat angles P-C4'-P energy: -99.968 tors. eta vs tors. theta energy: -213.492 Dist. restrs. and SS energy: 2.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -2371.129331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.129331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2378.120223 (E_RNA) where: Base-Base interactions energy: -1654.628 where: short stacking energy: -690.366 Base-Backbone interact. energy: 2.732 local terms energy: -726.224408 where: bonds (distance) C4'-P energy: -132.078 bonds (distance) P-C4' energy: -150.887 flat angles C4'-P-C4' energy: -149.931 flat angles P-C4'-P energy: -93.919 tors. eta vs tors. theta energy: -199.410 Dist. restrs. and SS energy: 6.991 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -2373.085340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.085340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2380.518750 (E_RNA) where: Base-Base interactions energy: -1663.672 where: short stacking energy: -722.073 Base-Backbone interact. energy: -2.092 local terms energy: -714.754889 where: bonds (distance) C4'-P energy: -118.920 bonds (distance) P-C4' energy: -140.387 flat angles C4'-P-C4' energy: -150.136 flat angles P-C4'-P energy: -96.408 tors. eta vs tors. theta energy: -208.904 Dist. restrs. and SS energy: 7.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -2231.134436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2231.134436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.659415 (E_RNA) where: Base-Base interactions energy: -1542.477 where: short stacking energy: -645.309 Base-Backbone interact. energy: 4.431 local terms energy: -699.612566 where: bonds (distance) C4'-P energy: -121.117 bonds (distance) P-C4' energy: -127.880 flat angles C4'-P-C4' energy: -149.232 flat angles P-C4'-P energy: -97.600 tors. eta vs tors. theta energy: -203.784 Dist. restrs. and SS energy: 6.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -2160.415913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2160.415913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2168.910478 (E_RNA) where: Base-Base interactions energy: -1532.650 where: short stacking energy: -630.130 Base-Backbone interact. energy: -1.742 local terms energy: -634.518085 where: bonds (distance) C4'-P energy: -120.203 bonds (distance) P-C4' energy: -103.114 flat angles C4'-P-C4' energy: -147.240 flat angles P-C4'-P energy: -85.776 tors. eta vs tors. theta energy: -178.185 Dist. restrs. and SS energy: 8.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -2091.811168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2091.811168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2105.209949 (E_RNA) where: Base-Base interactions energy: -1479.043 where: short stacking energy: -590.656 Base-Backbone interact. energy: -3.135 local terms energy: -623.031236 where: bonds (distance) C4'-P energy: -130.479 bonds (distance) P-C4' energy: -106.281 flat angles C4'-P-C4' energy: -135.305 flat angles P-C4'-P energy: -80.914 tors. eta vs tors. theta energy: -170.052 Dist. restrs. and SS energy: 13.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1860.861971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.861971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1878.046341 (E_RNA) where: Base-Base interactions energy: -1343.497 where: short stacking energy: -553.676 Base-Backbone interact. energy: -1.984 local terms energy: -532.564748 where: bonds (distance) C4'-P energy: -116.324 bonds (distance) P-C4' energy: -116.472 flat angles C4'-P-C4' energy: -116.683 flat angles P-C4'-P energy: -53.207 tors. eta vs tors. theta energy: -129.878 Dist. restrs. and SS energy: 17.184 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2774.194422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2774.194422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2775.438864 (E_RNA) where: Base-Base interactions energy: -1938.313 where: short stacking energy: -820.712 Base-Backbone interact. energy: -3.444 local terms energy: -833.681567 where: bonds (distance) C4'-P energy: -138.229 bonds (distance) P-C4' energy: -150.665 flat angles C4'-P-C4' energy: -171.286 flat angles P-C4'-P energy: -123.427 tors. eta vs tors. theta energy: -250.074 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2615.181476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2615.181476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2624.735411 (E_RNA) where: Base-Base interactions energy: -1828.798 where: short stacking energy: -785.216 Base-Backbone interact. energy: -4.282 local terms energy: -791.655104 where: bonds (distance) C4'-P energy: -131.256 bonds (distance) P-C4' energy: -150.139 flat angles C4'-P-C4' energy: -171.566 flat angles P-C4'-P energy: -111.664 tors. eta vs tors. theta energy: -227.031 Dist. restrs. and SS energy: 9.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2569.306921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2569.306921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2574.569804 (E_RNA) where: Base-Base interactions energy: -1811.290 where: short stacking energy: -770.333 Base-Backbone interact. energy: -0.002 local terms energy: -763.277859 where: bonds (distance) C4'-P energy: -123.117 bonds (distance) P-C4' energy: -141.399 flat angles C4'-P-C4' energy: -161.205 flat angles P-C4'-P energy: -102.400 tors. eta vs tors. theta energy: -235.158 Dist. restrs. and SS energy: 5.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2530.379092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2530.379092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2533.291535 (E_RNA) where: Base-Base interactions energy: -1815.262 where: short stacking energy: -739.875 Base-Backbone interact. energy: -1.314 local terms energy: -716.715595 where: bonds (distance) C4'-P energy: -106.394 bonds (distance) P-C4' energy: -146.341 flat angles C4'-P-C4' energy: -152.351 flat angles P-C4'-P energy: -105.002 tors. eta vs tors. theta energy: -206.628 Dist. restrs. and SS energy: 2.912 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -2450.329660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2450.329660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2457.548211 (E_RNA) where: Base-Base interactions energy: -1723.860 where: short stacking energy: -715.133 Base-Backbone interact. energy: 0.028 local terms energy: -733.715492 where: bonds (distance) C4'-P energy: -133.140 bonds (distance) P-C4' energy: -138.725 flat angles C4'-P-C4' energy: -158.713 flat angles P-C4'-P energy: -100.179 tors. eta vs tors. theta energy: -202.957 Dist. restrs. and SS energy: 7.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -2335.991385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.991385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2347.178950 (E_RNA) where: Base-Base interactions energy: -1650.005 where: short stacking energy: -696.109 Base-Backbone interact. energy: -0.856 local terms energy: -696.317531 where: bonds (distance) C4'-P energy: -110.464 bonds (distance) P-C4' energy: -148.560 flat angles C4'-P-C4' energy: -148.995 flat angles P-C4'-P energy: -91.680 tors. eta vs tors. theta energy: -196.618 Dist. restrs. and SS energy: 11.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -2234.484251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2234.484251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.746488 (E_RNA) where: Base-Base interactions energy: -1586.985 where: short stacking energy: -655.608 Base-Backbone interact. energy: -1.698 local terms energy: -652.062994 where: bonds (distance) C4'-P energy: -115.071 bonds (distance) P-C4' energy: -140.513 flat angles C4'-P-C4' energy: -143.287 flat angles P-C4'-P energy: -71.650 tors. eta vs tors. theta energy: -181.542 Dist. restrs. and SS energy: 6.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -2168.388900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2168.388900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.110185 (E_RNA) where: Base-Base interactions energy: -1536.106 where: short stacking energy: -652.961 Base-Backbone interact. energy: -2.507 local terms energy: -636.497292 where: bonds (distance) C4'-P energy: -109.004 bonds (distance) P-C4' energy: -109.556 flat angles C4'-P-C4' energy: -146.227 flat angles P-C4'-P energy: -96.327 tors. eta vs tors. theta energy: -175.383 Dist. restrs. and SS energy: 6.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -2111.434508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2111.434508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2119.842766 (E_RNA) where: Base-Base interactions energy: -1485.166 where: short stacking energy: -613.037 Base-Backbone interact. energy: 2.524 local terms energy: -637.199946 where: bonds (distance) C4'-P energy: -120.188 bonds (distance) P-C4' energy: -128.705 flat angles C4'-P-C4' energy: -129.195 flat angles P-C4'-P energy: -84.466 tors. eta vs tors. theta energy: -174.646 Dist. restrs. and SS energy: 8.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1867.541755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1867.541755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1898.493895 (E_RNA) where: Base-Base interactions energy: -1343.631 where: short stacking energy: -552.700 Base-Backbone interact. energy: -1.682 local terms energy: -553.181446 where: bonds (distance) C4'-P energy: -107.972 bonds (distance) P-C4' energy: -95.216 flat angles C4'-P-C4' energy: -131.981 flat angles P-C4'-P energy: -79.191 tors. eta vs tors. theta energy: -138.822 Dist. restrs. and SS energy: 30.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2776.261766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2776.261766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2778.691666 (E_RNA) where: Base-Base interactions energy: -1938.036 where: short stacking energy: -837.122 Base-Backbone interact. energy: -2.809 local terms energy: -837.846992 where: bonds (distance) C4'-P energy: -135.463 bonds (distance) P-C4' energy: -146.027 flat angles C4'-P-C4' energy: -174.520 flat angles P-C4'-P energy: -128.591 tors. eta vs tors. theta energy: -253.246 Dist. restrs. and SS energy: 2.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2634.435880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2634.435880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2637.534475 (E_RNA) where: Base-Base interactions energy: -1835.882 where: short stacking energy: -782.633 Base-Backbone interact. energy: -2.276 local terms energy: -799.376544 where: bonds (distance) C4'-P energy: -141.047 bonds (distance) P-C4' energy: -148.828 flat angles C4'-P-C4' energy: -160.541 flat angles P-C4'-P energy: -120.565 tors. eta vs tors. theta energy: -228.394 Dist. restrs. and SS energy: 3.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2535.988201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.988201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2544.885020 (E_RNA) where: Base-Base interactions energy: -1768.828 where: short stacking energy: -778.810 Base-Backbone interact. energy: -3.359 local terms energy: -772.698150 where: bonds (distance) C4'-P energy: -131.738 bonds (distance) P-C4' energy: -136.104 flat angles C4'-P-C4' energy: -163.800 flat angles P-C4'-P energy: -121.069 tors. eta vs tors. theta energy: -219.987 Dist. restrs. and SS energy: 8.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2539.944817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2539.944817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2544.397676 (E_RNA) where: Base-Base interactions energy: -1779.434 where: short stacking energy: -760.904 Base-Backbone interact. energy: -3.208 local terms energy: -761.755603 where: bonds (distance) C4'-P energy: -137.949 bonds (distance) P-C4' energy: -136.431 flat angles C4'-P-C4' energy: -170.438 flat angles P-C4'-P energy: -102.857 tors. eta vs tors. theta energy: -214.080 Dist. restrs. and SS energy: 4.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -2459.121095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2459.121095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2468.433374 (E_RNA) where: Base-Base interactions energy: -1748.100 where: short stacking energy: -759.864 Base-Backbone interact. energy: -1.843 local terms energy: -718.490232 where: bonds (distance) C4'-P energy: -118.882 bonds (distance) P-C4' energy: -112.416 flat angles C4'-P-C4' energy: -160.070 flat angles P-C4'-P energy: -108.623 tors. eta vs tors. theta energy: -218.499 Dist. restrs. and SS energy: 9.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -2349.031049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2349.031049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2356.026507 (E_RNA) where: Base-Base interactions energy: -1658.771 where: short stacking energy: -717.462 Base-Backbone interact. energy: -2.722 local terms energy: -694.532900 where: bonds (distance) C4'-P energy: -138.052 bonds (distance) P-C4' energy: -118.570 flat angles C4'-P-C4' energy: -164.623 flat angles P-C4'-P energy: -83.209 tors. eta vs tors. theta energy: -190.078 Dist. restrs. and SS energy: 6.995 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -2236.428664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.428664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2246.153970 (E_RNA) where: Base-Base interactions energy: -1572.552 where: short stacking energy: -669.889 Base-Backbone interact. energy: -0.657 local terms energy: -672.945147 where: bonds (distance) C4'-P energy: -114.252 bonds (distance) P-C4' energy: -119.783 flat angles C4'-P-C4' energy: -143.059 flat angles P-C4'-P energy: -100.233 tors. eta vs tors. theta energy: -195.619 Dist. restrs. and SS energy: 9.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -2184.103212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2184.103212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2191.803467 (E_RNA) where: Base-Base interactions energy: -1573.473 where: short stacking energy: -616.037 Base-Backbone interact. energy: 1.801 local terms energy: -620.131172 where: bonds (distance) C4'-P energy: -116.067 bonds (distance) P-C4' energy: -115.026 flat angles C4'-P-C4' energy: -136.757 flat angles P-C4'-P energy: -82.789 tors. eta vs tors. theta energy: -169.492 Dist. restrs. and SS energy: 7.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -2126.406275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2126.406275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2134.169715 (E_RNA) where: Base-Base interactions energy: -1506.604 where: short stacking energy: -618.460 Base-Backbone interact. energy: 1.429 local terms energy: -628.994595 where: bonds (distance) C4'-P energy: -105.211 bonds (distance) P-C4' energy: -120.504 flat angles C4'-P-C4' energy: -151.973 flat angles P-C4'-P energy: -88.824 tors. eta vs tors. theta energy: -162.483 Dist. restrs. and SS energy: 7.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1876.203050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1876.203050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1901.513086 (E_RNA) where: Base-Base interactions energy: -1320.984 where: short stacking energy: -523.381 Base-Backbone interact. energy: -2.858 local terms energy: -577.670918 where: bonds (distance) C4'-P energy: -93.481 bonds (distance) P-C4' energy: -113.234 flat angles C4'-P-C4' energy: -134.537 flat angles P-C4'-P energy: -84.900 tors. eta vs tors. theta energy: -151.519 Dist. restrs. and SS energy: 25.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2772.510117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2772.510117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2778.350360 (E_RNA) where: Base-Base interactions energy: -1952.306 where: short stacking energy: -838.726 Base-Backbone interact. energy: -3.739 local terms energy: -822.305358 where: bonds (distance) C4'-P energy: -138.866 bonds (distance) P-C4' energy: -151.974 flat angles C4'-P-C4' energy: -169.948 flat angles P-C4'-P energy: -109.505 tors. eta vs tors. theta energy: -252.012 Dist. restrs. and SS energy: 5.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2630.309522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2630.309522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2635.884985 (E_RNA) where: Base-Base interactions energy: -1852.522 where: short stacking energy: -765.557 Base-Backbone interact. energy: -6.365 local terms energy: -776.998739 where: bonds (distance) C4'-P energy: -151.242 bonds (distance) P-C4' energy: -133.505 flat angles C4'-P-C4' energy: -161.891 flat angles P-C4'-P energy: -117.479 tors. eta vs tors. theta energy: -212.882 Dist. restrs. and SS energy: 5.575 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2565.313608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2565.313608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2575.142506 (E_RNA) where: Base-Base interactions energy: -1804.114 where: short stacking energy: -762.668 Base-Backbone interact. energy: -1.629 local terms energy: -769.400059 where: bonds (distance) C4'-P energy: -134.800 bonds (distance) P-C4' energy: -136.648 flat angles C4'-P-C4' energy: -164.825 flat angles P-C4'-P energy: -113.924 tors. eta vs tors. theta energy: -219.203 Dist. restrs. and SS energy: 9.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2503.914333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2503.914333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2512.106624 (E_RNA) where: Base-Base interactions energy: -1755.403 where: short stacking energy: -739.171 Base-Backbone interact. energy: -1.730 local terms energy: -754.974036 where: bonds (distance) C4'-P energy: -135.774 bonds (distance) P-C4' energy: -135.075 flat angles C4'-P-C4' energy: -159.028 flat angles P-C4'-P energy: -108.543 tors. eta vs tors. theta energy: -216.553 Dist. restrs. and SS energy: 8.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -2485.304226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2485.304226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2493.293127 (E_RNA) where: Base-Base interactions energy: -1776.553 where: short stacking energy: -757.150 Base-Backbone interact. energy: -1.816 local terms energy: -714.923914 where: bonds (distance) C4'-P energy: -130.709 bonds (distance) P-C4' energy: -109.934 flat angles C4'-P-C4' energy: -150.969 flat angles P-C4'-P energy: -95.409 tors. eta vs tors. theta energy: -227.903 Dist. restrs. and SS energy: 7.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -2333.916009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2333.916009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.832230 (E_RNA) where: Base-Base interactions energy: -1637.190 where: short stacking energy: -692.164 Base-Backbone interact. energy: -2.806 local terms energy: -700.836304 where: bonds (distance) C4'-P energy: -118.701 bonds (distance) P-C4' energy: -120.534 flat angles C4'-P-C4' energy: -165.023 flat angles P-C4'-P energy: -97.331 tors. eta vs tors. theta energy: -199.249 Dist. restrs. and SS energy: 6.916 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -2214.208242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2214.208242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2226.484509 (E_RNA) where: Base-Base interactions energy: -1583.540 where: short stacking energy: -646.506 Base-Backbone interact. energy: 3.817 local terms energy: -646.762295 where: bonds (distance) C4'-P energy: -114.189 bonds (distance) P-C4' energy: -120.472 flat angles C4'-P-C4' energy: -144.591 flat angles P-C4'-P energy: -92.183 tors. eta vs tors. theta energy: -175.328 Dist. restrs. and SS energy: 12.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -2238.968966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2238.968966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.859480 (E_RNA) where: Base-Base interactions energy: -1585.401 where: short stacking energy: -677.981 Base-Backbone interact. energy: -1.782 local terms energy: -668.677138 where: bonds (distance) C4'-P energy: -134.133 bonds (distance) P-C4' energy: -102.911 flat angles C4'-P-C4' energy: -141.403 flat angles P-C4'-P energy: -90.582 tors. eta vs tors. theta energy: -199.648 Dist. restrs. and SS energy: 16.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -2111.425142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2111.425142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.432753 (E_RNA) where: Base-Base interactions energy: -1500.501 where: short stacking energy: -598.343 Base-Backbone interact. energy: 0.570 local terms energy: -616.501404 where: bonds (distance) C4'-P energy: -94.553 bonds (distance) P-C4' energy: -122.438 flat angles C4'-P-C4' energy: -151.934 flat angles P-C4'-P energy: -75.934 tors. eta vs tors. theta energy: -171.642 Dist. restrs. and SS energy: 5.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1910.908447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1910.908447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1937.025759 (E_RNA) where: Base-Base interactions energy: -1326.746 where: short stacking energy: -558.683 Base-Backbone interact. energy: -2.528 local terms energy: -607.752443 where: bonds (distance) C4'-P energy: -113.178 bonds (distance) P-C4' energy: -117.076 flat angles C4'-P-C4' energy: -137.813 flat angles P-C4'-P energy: -83.407 tors. eta vs tors. theta energy: -156.278 Dist. restrs. and SS energy: 26.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2802.093501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2802.093501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2807.544918 (E_RNA) where: Base-Base interactions energy: -1975.532 where: short stacking energy: -845.900 Base-Backbone interact. energy: -3.745 local terms energy: -828.268525 where: bonds (distance) C4'-P energy: -144.594 bonds (distance) P-C4' energy: -147.836 flat angles C4'-P-C4' energy: -174.714 flat angles P-C4'-P energy: -112.386 tors. eta vs tors. theta energy: -248.739 Dist. restrs. and SS energy: 5.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2626.155302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2626.155302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2631.614195 (E_RNA) where: Base-Base interactions energy: -1851.837 where: short stacking energy: -770.068 Base-Backbone interact. energy: -5.229 local terms energy: -774.548038 where: bonds (distance) C4'-P energy: -133.443 bonds (distance) P-C4' energy: -139.157 flat angles C4'-P-C4' energy: -166.644 flat angles P-C4'-P energy: -112.344 tors. eta vs tors. theta energy: -222.961 Dist. restrs. and SS energy: 5.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2582.432279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2582.432279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2588.103578 (E_RNA) where: Base-Base interactions energy: -1812.458 where: short stacking energy: -771.052 Base-Backbone interact. energy: -3.590 local terms energy: -772.055790 where: bonds (distance) C4'-P energy: -137.209 bonds (distance) P-C4' energy: -143.271 flat angles C4'-P-C4' energy: -152.743 flat angles P-C4'-P energy: -109.802 tors. eta vs tors. theta energy: -229.030 Dist. restrs. and SS energy: 5.671 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2527.723755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2527.723755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.901635 (E_RNA) where: Base-Base interactions energy: -1778.318 where: short stacking energy: -760.416 Base-Backbone interact. energy: -2.232 local terms energy: -754.351522 where: bonds (distance) C4'-P energy: -139.887 bonds (distance) P-C4' energy: -123.232 flat angles C4'-P-C4' energy: -155.585 flat angles P-C4'-P energy: -111.307 tors. eta vs tors. theta energy: -224.341 Dist. restrs. and SS energy: 7.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -2421.250871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2421.250871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2432.602193 (E_RNA) where: Base-Base interactions energy: -1709.674 where: short stacking energy: -705.247 Base-Backbone interact. energy: -0.950 local terms energy: -721.978856 where: bonds (distance) C4'-P energy: -133.489 bonds (distance) P-C4' energy: -127.431 flat angles C4'-P-C4' energy: -152.787 flat angles P-C4'-P energy: -97.829 tors. eta vs tors. theta energy: -210.443 Dist. restrs. and SS energy: 11.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -2327.955951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2327.955951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.066133 (E_RNA) where: Base-Base interactions energy: -1649.237 where: short stacking energy: -689.642 Base-Backbone interact. energy: -0.118 local terms energy: -687.710672 where: bonds (distance) C4'-P energy: -124.861 bonds (distance) P-C4' energy: -121.361 flat angles C4'-P-C4' energy: -149.435 flat angles P-C4'-P energy: -90.570 tors. eta vs tors. theta energy: -201.484 Dist. restrs. and SS energy: 9.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -2276.431161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2276.431161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2285.033616 (E_RNA) where: Base-Base interactions energy: -1606.500 where: short stacking energy: -668.798 Base-Backbone interact. energy: -4.303 local terms energy: -674.230876 where: bonds (distance) C4'-P energy: -111.104 bonds (distance) P-C4' energy: -126.740 flat angles C4'-P-C4' energy: -139.586 flat angles P-C4'-P energy: -100.452 tors. eta vs tors. theta energy: -196.349 Dist. restrs. and SS energy: 8.602 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -2204.619438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2204.619438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2209.657671 (E_RNA) where: Base-Base interactions energy: -1556.288 where: short stacking energy: -643.201 Base-Backbone interact. energy: -0.257 local terms energy: -653.113094 where: bonds (distance) C4'-P energy: -121.067 bonds (distance) P-C4' energy: -141.133 flat angles C4'-P-C4' energy: -138.399 flat angles P-C4'-P energy: -72.452 tors. eta vs tors. theta energy: -180.062 Dist. restrs. and SS energy: 5.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -2128.751382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.751382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2140.557452 (E_RNA) where: Base-Base interactions energy: -1497.917 where: short stacking energy: -633.174 Base-Backbone interact. energy: -1.249 local terms energy: -641.391468 where: bonds (distance) C4'-P energy: -107.989 bonds (distance) P-C4' energy: -132.650 flat angles C4'-P-C4' energy: -138.351 flat angles P-C4'-P energy: -75.463 tors. eta vs tors. theta energy: -186.938 Dist. restrs. and SS energy: 11.806 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1781.751581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1781.751581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1810.597283 (E_RNA) where: Base-Base interactions energy: -1260.287 where: short stacking energy: -539.730 Base-Backbone interact. energy: -1.421 local terms energy: -548.889552 where: bonds (distance) C4'-P energy: -125.865 bonds (distance) P-C4' energy: -107.632 flat angles C4'-P-C4' energy: -105.002 flat angles P-C4'-P energy: -78.960 tors. eta vs tors. theta energy: -131.431 Dist. restrs. and SS energy: 28.846 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2779.088851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2779.088851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2780.549620 (E_RNA) where: Base-Base interactions energy: -1935.669 where: short stacking energy: -828.515 Base-Backbone interact. energy: -2.539 local terms energy: -842.341486 where: bonds (distance) C4'-P energy: -153.823 bonds (distance) P-C4' energy: -143.878 flat angles C4'-P-C4' energy: -175.440 flat angles P-C4'-P energy: -119.637 tors. eta vs tors. theta energy: -249.563 Dist. restrs. and SS energy: 1.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2654.173206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2654.173206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2659.388938 (E_RNA) where: Base-Base interactions energy: -1862.620 where: short stacking energy: -809.936 Base-Backbone interact. energy: -2.304 local terms energy: -794.464280 where: bonds (distance) C4'-P energy: -121.332 bonds (distance) P-C4' energy: -165.775 flat angles C4'-P-C4' energy: -167.958 flat angles P-C4'-P energy: -113.787 tors. eta vs tors. theta energy: -225.613 Dist. restrs. and SS energy: 5.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2580.759085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.759085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2588.988030 (E_RNA) where: Base-Base interactions energy: -1842.193 where: short stacking energy: -769.297 Base-Backbone interact. energy: -3.850 local terms energy: -742.945162 where: bonds (distance) C4'-P energy: -118.881 bonds (distance) P-C4' energy: -135.881 flat angles C4'-P-C4' energy: -158.823 flat angles P-C4'-P energy: -92.962 tors. eta vs tors. theta energy: -236.398 Dist. restrs. and SS energy: 8.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -2542.228936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.228936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2548.787068 (E_RNA) where: Base-Base interactions energy: -1810.837 where: short stacking energy: -791.003 Base-Backbone interact. energy: 1.496 local terms energy: -739.445964 where: bonds (distance) C4'-P energy: -133.328 bonds (distance) P-C4' energy: -141.449 flat angles C4'-P-C4' energy: -146.468 flat angles P-C4'-P energy: -99.528 tors. eta vs tors. theta energy: -218.673 Dist. restrs. and SS energy: 6.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -2384.897202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2384.897202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2394.462891 (E_RNA) where: Base-Base interactions energy: -1686.393 where: short stacking energy: -711.465 Base-Backbone interact. energy: -1.059 local terms energy: -707.010726 where: bonds (distance) C4'-P energy: -133.135 bonds (distance) P-C4' energy: -132.771 flat angles C4'-P-C4' energy: -153.959 flat angles P-C4'-P energy: -93.326 tors. eta vs tors. theta energy: -193.821 Dist. restrs. and SS energy: 9.566 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -2275.797649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.797649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2292.189364 (E_RNA) where: Base-Base interactions energy: -1612.736 where: short stacking energy: -666.703 Base-Backbone interact. energy: -0.466 local terms energy: -678.986978 where: bonds (distance) C4'-P energy: -141.865 bonds (distance) P-C4' energy: -128.280 flat angles C4'-P-C4' energy: -134.931 flat angles P-C4'-P energy: -88.152 tors. eta vs tors. theta energy: -185.758 Dist. restrs. and SS energy: 16.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -2268.208026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2268.208026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.211535 (E_RNA) where: Base-Base interactions energy: -1603.633 where: short stacking energy: -664.834 Base-Backbone interact. energy: -0.129 local terms energy: -671.449101 where: bonds (distance) C4'-P energy: -99.970 bonds (distance) P-C4' energy: -137.723 flat angles C4'-P-C4' energy: -150.913 flat angles P-C4'-P energy: -89.863 tors. eta vs tors. theta energy: -192.979 Dist. restrs. and SS energy: 7.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -2229.200206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2229.200206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.658401 (E_RNA) where: Base-Base interactions energy: -1570.880 where: short stacking energy: -651.068 Base-Backbone interact. energy: -2.256 local terms energy: -668.522639 where: bonds (distance) C4'-P energy: -114.664 bonds (distance) P-C4' energy: -110.916 flat angles C4'-P-C4' energy: -164.292 flat angles P-C4'-P energy: -79.739 tors. eta vs tors. theta energy: -198.912 Dist. restrs. and SS energy: 12.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -2128.499168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.499168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2140.210992 (E_RNA) where: Base-Base interactions energy: -1489.496 where: short stacking energy: -630.162 Base-Backbone interact. energy: 3.684 local terms energy: -654.398924 where: bonds (distance) C4'-P energy: -114.503 bonds (distance) P-C4' energy: -118.259 flat angles C4'-P-C4' energy: -140.412 flat angles P-C4'-P energy: -82.761 tors. eta vs tors. theta energy: -198.463 Dist. restrs. and SS energy: 11.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1854.325972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1854.325972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1876.218047 (E_RNA) where: Base-Base interactions energy: -1314.413 where: short stacking energy: -538.147 Base-Backbone interact. energy: 1.661 local terms energy: -563.466186 where: bonds (distance) C4'-P energy: -112.742 bonds (distance) P-C4' energy: -109.401 flat angles C4'-P-C4' energy: -124.774 flat angles P-C4'-P energy: -81.728 tors. eta vs tors. theta energy: -134.821 Dist. restrs. and SS energy: 21.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2752.612123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2752.612123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2755.317744 (E_RNA) where: Base-Base interactions energy: -1923.452 where: short stacking energy: -833.501 Base-Backbone interact. energy: -2.019 local terms energy: -829.846892 where: bonds (distance) C4'-P energy: -149.234 bonds (distance) P-C4' energy: -145.979 flat angles C4'-P-C4' energy: -173.786 flat angles P-C4'-P energy: -123.636 tors. eta vs tors. theta energy: -237.211 Dist. restrs. and SS energy: 2.706 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2649.312648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2649.312648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2654.118390 (E_RNA) where: Base-Base interactions energy: -1837.508 where: short stacking energy: -786.699 Base-Backbone interact. energy: -3.631 local terms energy: -812.979967 where: bonds (distance) C4'-P energy: -147.207 bonds (distance) P-C4' energy: -147.452 flat angles C4'-P-C4' energy: -169.064 flat angles P-C4'-P energy: -117.486 tors. eta vs tors. theta energy: -231.771 Dist. restrs. and SS energy: 4.806 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2620.690823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2620.690823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2623.895066 (E_RNA) where: Base-Base interactions energy: -1864.970 where: short stacking energy: -795.984 Base-Backbone interact. energy: -1.644 local terms energy: -757.281128 where: bonds (distance) C4'-P energy: -114.902 bonds (distance) P-C4' energy: -144.434 flat angles C4'-P-C4' energy: -164.893 flat angles P-C4'-P energy: -101.076 tors. eta vs tors. theta energy: -231.976 Dist. restrs. and SS energy: 3.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2563.753871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2563.753871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2567.315754 (E_RNA) where: Base-Base interactions energy: -1790.274 where: short stacking energy: -753.643 Base-Backbone interact. energy: -4.484 local terms energy: -772.557690 where: bonds (distance) C4'-P energy: -134.492 bonds (distance) P-C4' energy: -143.647 flat angles C4'-P-C4' energy: -163.674 flat angles P-C4'-P energy: -111.751 tors. eta vs tors. theta energy: -218.993 Dist. restrs. and SS energy: 3.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -2366.226770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.226770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.696698 (E_RNA) where: Base-Base interactions energy: -1625.295 where: short stacking energy: -682.817 Base-Backbone interact. energy: -2.155 local terms energy: -744.246000 where: bonds (distance) C4'-P energy: -139.284 bonds (distance) P-C4' energy: -145.715 flat angles C4'-P-C4' energy: -153.373 flat angles P-C4'-P energy: -101.693 tors. eta vs tors. theta energy: -204.181 Dist. restrs. and SS energy: 5.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -2287.646134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2287.646134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2298.026426 (E_RNA) where: Base-Base interactions energy: -1617.810 where: short stacking energy: -637.319 Base-Backbone interact. energy: 2.172 local terms energy: -682.388083 where: bonds (distance) C4'-P energy: -120.576 bonds (distance) P-C4' energy: -122.582 flat angles C4'-P-C4' energy: -146.301 flat angles P-C4'-P energy: -103.918 tors. eta vs tors. theta energy: -189.011 Dist. restrs. and SS energy: 10.380 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -2288.254627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2288.254627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.658674 (E_RNA) where: Base-Base interactions energy: -1635.759 where: short stacking energy: -712.810 Base-Backbone interact. energy: -0.097 local terms energy: -665.803076 where: bonds (distance) C4'-P energy: -120.233 bonds (distance) P-C4' energy: -110.072 flat angles C4'-P-C4' energy: -140.630 flat angles P-C4'-P energy: -92.087 tors. eta vs tors. theta energy: -202.782 Dist. restrs. and SS energy: 13.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -2194.954988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.954988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.300086 (E_RNA) where: Base-Base interactions energy: -1564.038 where: short stacking energy: -653.260 Base-Backbone interact. energy: -2.146 local terms energy: -634.115505 where: bonds (distance) C4'-P energy: -115.977 bonds (distance) P-C4' energy: -127.356 flat angles C4'-P-C4' energy: -130.875 flat angles P-C4'-P energy: -79.125 tors. eta vs tors. theta energy: -180.782 Dist. restrs. and SS energy: 5.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -2097.610458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2097.610458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.366037 (E_RNA) where: Base-Base interactions energy: -1495.872 where: short stacking energy: -630.665 Base-Backbone interact. energy: -4.142 local terms energy: -615.351776 where: bonds (distance) C4'-P energy: -87.907 bonds (distance) P-C4' energy: -119.701 flat angles C4'-P-C4' energy: -135.493 flat angles P-C4'-P energy: -93.899 tors. eta vs tors. theta energy: -178.352 Dist. restrs. and SS energy: 17.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -1882.863717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1882.863717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1898.655375 (E_RNA) where: Base-Base interactions energy: -1314.750 where: short stacking energy: -494.244 Base-Backbone interact. energy: 0.949 local terms energy: -584.853834 where: bonds (distance) C4'-P energy: -110.703 bonds (distance) P-C4' energy: -120.217 flat angles C4'-P-C4' energy: -121.693 flat angles P-C4'-P energy: -79.145 tors. eta vs tors. theta energy: -153.097 Dist. restrs. and SS energy: 15.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2767.632273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2767.632273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2770.011481 (E_RNA) where: Base-Base interactions energy: -1922.452 where: short stacking energy: -838.660 Base-Backbone interact. energy: -2.440 local terms energy: -845.119883 where: bonds (distance) C4'-P energy: -157.503 bonds (distance) P-C4' energy: -137.845 flat angles C4'-P-C4' energy: -172.310 flat angles P-C4'-P energy: -129.280 tors. eta vs tors. theta energy: -248.183 Dist. restrs. and SS energy: 2.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2626.953157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2626.953157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2629.826510 (E_RNA) where: Base-Base interactions energy: -1845.016 where: short stacking energy: -760.184 Base-Backbone interact. energy: 4.284 local terms energy: -789.094693 where: bonds (distance) C4'-P energy: -139.405 bonds (distance) P-C4' energy: -151.705 flat angles C4'-P-C4' energy: -166.436 flat angles P-C4'-P energy: -113.341 tors. eta vs tors. theta energy: -218.208 Dist. restrs. and SS energy: 2.873 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2600.158739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2600.158739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2602.839813 (E_RNA) where: Base-Base interactions energy: -1837.280 where: short stacking energy: -784.651 Base-Backbone interact. energy: -1.423 local terms energy: -764.136472 where: bonds (distance) C4'-P energy: -130.198 bonds (distance) P-C4' energy: -133.824 flat angles C4'-P-C4' energy: -170.424 flat angles P-C4'-P energy: -102.925 tors. eta vs tors. theta energy: -226.766 Dist. restrs. and SS energy: 2.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2566.816327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2566.816327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2570.778710 (E_RNA) where: Base-Base interactions energy: -1813.937 where: short stacking energy: -766.898 Base-Backbone interact. energy: -1.253 local terms energy: -755.588780 where: bonds (distance) C4'-P energy: -143.839 bonds (distance) P-C4' energy: -121.395 flat angles C4'-P-C4' energy: -152.856 flat angles P-C4'-P energy: -101.215 tors. eta vs tors. theta energy: -236.284 Dist. restrs. and SS energy: 3.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -2380.471783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2380.471783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2392.171982 (E_RNA) where: Base-Base interactions energy: -1684.411 where: short stacking energy: -688.170 Base-Backbone interact. energy: -3.740 local terms energy: -704.021304 where: bonds (distance) C4'-P energy: -137.709 bonds (distance) P-C4' energy: -123.535 flat angles C4'-P-C4' energy: -157.349 flat angles P-C4'-P energy: -79.252 tors. eta vs tors. theta energy: -206.176 Dist. restrs. and SS energy: 11.700 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -2304.538061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2304.538061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2315.763770 (E_RNA) where: Base-Base interactions energy: -1616.827 where: short stacking energy: -666.671 Base-Backbone interact. energy: -2.286 local terms energy: -696.650165 where: bonds (distance) C4'-P energy: -134.125 bonds (distance) P-C4' energy: -130.664 flat angles C4'-P-C4' energy: -158.406 flat angles P-C4'-P energy: -81.494 tors. eta vs tors. theta energy: -191.960 Dist. restrs. and SS energy: 11.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -2237.820206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2237.820206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.773871 (E_RNA) where: Base-Base interactions energy: -1592.153 where: short stacking energy: -652.258 Base-Backbone interact. energy: -0.410 local terms energy: -649.210883 where: bonds (distance) C4'-P energy: -102.415 bonds (distance) P-C4' energy: -132.230 flat angles C4'-P-C4' energy: -131.783 flat angles P-C4'-P energy: -86.502 tors. eta vs tors. theta energy: -196.280 Dist. restrs. and SS energy: 3.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -2192.298123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2192.298123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2202.401268 (E_RNA) where: Base-Base interactions energy: -1559.003 where: short stacking energy: -640.443 Base-Backbone interact. energy: -3.017 local terms energy: -640.381644 where: bonds (distance) C4'-P energy: -102.201 bonds (distance) P-C4' energy: -115.599 flat angles C4'-P-C4' energy: -142.683 flat angles P-C4'-P energy: -95.090 tors. eta vs tors. theta energy: -184.809 Dist. restrs. and SS energy: 10.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -2177.032640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2177.032640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.695175 (E_RNA) where: Base-Base interactions energy: -1485.556 where: short stacking energy: -621.507 Base-Backbone interact. energy: -1.876 local terms energy: -695.263359 where: bonds (distance) C4'-P energy: -114.974 bonds (distance) P-C4' energy: -146.403 flat angles C4'-P-C4' energy: -149.097 flat angles P-C4'-P energy: -98.347 tors. eta vs tors. theta energy: -186.441 Dist. restrs. and SS energy: 5.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1885.445890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.445890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.266550 (E_RNA) where: Base-Base interactions energy: -1323.017 where: short stacking energy: -557.020 Base-Backbone interact. energy: 2.018 local terms energy: -578.267528 where: bonds (distance) C4'-P energy: -117.184 bonds (distance) P-C4' energy: -126.977 flat angles C4'-P-C4' energy: -115.156 flat angles P-C4'-P energy: -63.726 tors. eta vs tors. theta energy: -155.224 Dist. restrs. and SS energy: 13.821 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2778.596209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2778.596209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2780.515270 (E_RNA) where: Base-Base interactions energy: -1945.915 where: short stacking energy: -852.637 Base-Backbone interact. energy: -2.405 local terms energy: -832.194331 where: bonds (distance) C4'-P energy: -153.517 bonds (distance) P-C4' energy: -141.146 flat angles C4'-P-C4' energy: -173.033 flat angles P-C4'-P energy: -117.000 tors. eta vs tors. theta energy: -247.499 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2671.215466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2671.215466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2675.079382 (E_RNA) where: Base-Base interactions energy: -1858.604 where: short stacking energy: -789.835 Base-Backbone interact. energy: -2.933 local terms energy: -813.542038 where: bonds (distance) C4'-P energy: -156.119 bonds (distance) P-C4' energy: -140.363 flat angles C4'-P-C4' energy: -160.377 flat angles P-C4'-P energy: -127.957 tors. eta vs tors. theta energy: -228.726 Dist. restrs. and SS energy: 3.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2634.760862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2634.760862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2637.826939 (E_RNA) where: Base-Base interactions energy: -1881.569 where: short stacking energy: -785.204 Base-Backbone interact. energy: -1.425 local terms energy: -754.832803 where: bonds (distance) C4'-P energy: -136.950 bonds (distance) P-C4' energy: -120.828 flat angles C4'-P-C4' energy: -161.776 flat angles P-C4'-P energy: -107.734 tors. eta vs tors. theta energy: -227.544 Dist. restrs. and SS energy: 3.066 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2557.372629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2557.372629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2559.495148 (E_RNA) where: Base-Base interactions energy: -1797.109 where: short stacking energy: -777.751 Base-Backbone interact. energy: -2.373 local terms energy: -760.012841 where: bonds (distance) C4'-P energy: -124.496 bonds (distance) P-C4' energy: -135.147 flat angles C4'-P-C4' energy: -156.830 flat angles P-C4'-P energy: -101.614 tors. eta vs tors. theta energy: -241.927 Dist. restrs. and SS energy: 2.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -2418.397987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2418.397987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2424.067323 (E_RNA) where: Base-Base interactions energy: -1713.770 where: short stacking energy: -730.482 Base-Backbone interact. energy: 2.381 local terms energy: -712.678816 where: bonds (distance) C4'-P energy: -129.484 bonds (distance) P-C4' energy: -116.983 flat angles C4'-P-C4' energy: -165.178 flat angles P-C4'-P energy: -90.321 tors. eta vs tors. theta energy: -210.712 Dist. restrs. and SS energy: 5.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -2307.621029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2307.621029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2314.210436 (E_RNA) where: Base-Base interactions energy: -1610.680 where: short stacking energy: -670.686 Base-Backbone interact. energy: 1.051 local terms energy: -704.581845 where: bonds (distance) C4'-P energy: -123.202 bonds (distance) P-C4' energy: -134.375 flat angles C4'-P-C4' energy: -148.319 flat angles P-C4'-P energy: -98.050 tors. eta vs tors. theta energy: -200.636 Dist. restrs. and SS energy: 6.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -2297.007127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2297.007127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2307.351688 (E_RNA) where: Base-Base interactions energy: -1615.295 where: short stacking energy: -686.614 Base-Backbone interact. energy: -2.197 local terms energy: -689.859569 where: bonds (distance) C4'-P energy: -138.146 bonds (distance) P-C4' energy: -121.535 flat angles C4'-P-C4' energy: -156.447 flat angles P-C4'-P energy: -80.166 tors. eta vs tors. theta energy: -193.565 Dist. restrs. and SS energy: 10.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -2187.662488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.662488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.096435 (E_RNA) where: Base-Base interactions energy: -1541.992 where: short stacking energy: -647.825 Base-Backbone interact. energy: -2.688 local terms energy: -648.416503 where: bonds (distance) C4'-P energy: -120.483 bonds (distance) P-C4' energy: -106.853 flat angles C4'-P-C4' energy: -146.700 flat angles P-C4'-P energy: -97.876 tors. eta vs tors. theta energy: -176.504 Dist. restrs. and SS energy: 5.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -2160.349142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2160.349142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2172.308261 (E_RNA) where: Base-Base interactions energy: -1547.048 where: short stacking energy: -635.656 Base-Backbone interact. energy: -0.378 local terms energy: -624.882205 where: bonds (distance) C4'-P energy: -96.836 bonds (distance) P-C4' energy: -120.646 flat angles C4'-P-C4' energy: -124.795 flat angles P-C4'-P energy: -100.979 tors. eta vs tors. theta energy: -181.626 Dist. restrs. and SS energy: 11.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -1864.560657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1864.560657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1877.785100 (E_RNA) where: Base-Base interactions energy: -1328.882 where: short stacking energy: -556.702 Base-Backbone interact. energy: 0.695 local terms energy: -549.598090 where: bonds (distance) C4'-P energy: -110.493 bonds (distance) P-C4' energy: -106.123 flat angles C4'-P-C4' energy: -127.450 flat angles P-C4'-P energy: -51.215 tors. eta vs tors. theta energy: -154.317 Dist. restrs. and SS energy: 13.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2759.998367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2759.998367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2762.613460 (E_RNA) where: Base-Base interactions energy: -1917.996 where: short stacking energy: -825.055 Base-Backbone interact. energy: -4.327 local terms energy: -840.289686 where: bonds (distance) C4'-P energy: -149.387 bonds (distance) P-C4' energy: -150.287 flat angles C4'-P-C4' energy: -172.809 flat angles P-C4'-P energy: -123.991 tors. eta vs tors. theta energy: -243.816 Dist. restrs. and SS energy: 2.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2676.236458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2676.236458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2677.564557 (E_RNA) where: Base-Base interactions energy: -1878.510 where: short stacking energy: -789.301 Base-Backbone interact. energy: -1.640 local terms energy: -797.414259 where: bonds (distance) C4'-P energy: -142.176 bonds (distance) P-C4' energy: -145.325 flat angles C4'-P-C4' energy: -166.577 flat angles P-C4'-P energy: -116.857 tors. eta vs tors. theta energy: -226.480 Dist. restrs. and SS energy: 1.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2626.993857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2626.993857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2630.618467 (E_RNA) where: Base-Base interactions energy: -1863.210 where: short stacking energy: -802.219 Base-Backbone interact. energy: 4.371 local terms energy: -771.779147 where: bonds (distance) C4'-P energy: -135.520 bonds (distance) P-C4' energy: -145.656 flat angles C4'-P-C4' energy: -158.921 flat angles P-C4'-P energy: -108.639 tors. eta vs tors. theta energy: -223.043 Dist. restrs. and SS energy: 3.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2546.702935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2546.702935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2553.383851 (E_RNA) where: Base-Base interactions energy: -1805.824 where: short stacking energy: -774.569 Base-Backbone interact. energy: -2.044 local terms energy: -745.515709 where: bonds (distance) C4'-P energy: -128.865 bonds (distance) P-C4' energy: -124.720 flat angles C4'-P-C4' energy: -153.641 flat angles P-C4'-P energy: -109.978 tors. eta vs tors. theta energy: -228.312 Dist. restrs. and SS energy: 6.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -2428.286364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.286364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2436.168103 (E_RNA) where: Base-Base interactions energy: -1732.036 where: short stacking energy: -743.126 Base-Backbone interact. energy: -0.396 local terms energy: -703.736116 where: bonds (distance) C4'-P energy: -107.024 bonds (distance) P-C4' energy: -113.882 flat angles C4'-P-C4' energy: -175.986 flat angles P-C4'-P energy: -94.663 tors. eta vs tors. theta energy: -212.181 Dist. restrs. and SS energy: 7.882 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -2308.854063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2308.854063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2320.322985 (E_RNA) where: Base-Base interactions energy: -1630.215 where: short stacking energy: -689.292 Base-Backbone interact. energy: -0.028 local terms energy: -690.080325 where: bonds (distance) C4'-P energy: -121.022 bonds (distance) P-C4' energy: -130.140 flat angles C4'-P-C4' energy: -135.624 flat angles P-C4'-P energy: -99.853 tors. eta vs tors. theta energy: -203.442 Dist. restrs. and SS energy: 11.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -2326.011465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.011465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2331.467926 (E_RNA) where: Base-Base interactions energy: -1635.769 where: short stacking energy: -678.504 Base-Backbone interact. energy: 1.645 local terms energy: -697.344466 where: bonds (distance) C4'-P energy: -130.385 bonds (distance) P-C4' energy: -121.699 flat angles C4'-P-C4' energy: -151.459 flat angles P-C4'-P energy: -90.402 tors. eta vs tors. theta energy: -203.400 Dist. restrs. and SS energy: 5.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -2116.907221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.907221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2127.422494 (E_RNA) where: Base-Base interactions energy: -1501.411 where: short stacking energy: -618.300 Base-Backbone interact. energy: -2.230 local terms energy: -623.781896 where: bonds (distance) C4'-P energy: -99.909 bonds (distance) P-C4' energy: -124.015 flat angles C4'-P-C4' energy: -146.968 flat angles P-C4'-P energy: -79.986 tors. eta vs tors. theta energy: -172.903 Dist. restrs. and SS energy: 10.515 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -2106.027997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.027997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.164774 (E_RNA) where: Base-Base interactions energy: -1498.684 where: short stacking energy: -632.496 Base-Backbone interact. energy: -1.455 local terms energy: -618.026228 where: bonds (distance) C4'-P energy: -101.297 bonds (distance) P-C4' energy: -108.604 flat angles C4'-P-C4' energy: -137.492 flat angles P-C4'-P energy: -89.187 tors. eta vs tors. theta energy: -181.446 Dist. restrs. and SS energy: 12.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1929.915278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.915278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.508270 (E_RNA) where: Base-Base interactions energy: -1380.260 where: short stacking energy: -560.778 Base-Backbone interact. energy: -1.613 local terms energy: -560.635186 where: bonds (distance) C4'-P energy: -82.782 bonds (distance) P-C4' energy: -116.534 flat angles C4'-P-C4' energy: -139.049 flat angles P-C4'-P energy: -67.424 tors. eta vs tors. theta energy: -154.847 Dist. restrs. and SS energy: 12.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2754.387732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.387732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.118309 (E_RNA) where: Base-Base interactions energy: -1927.987 where: short stacking energy: -835.363 Base-Backbone interact. energy: -1.791 local terms energy: -827.340905 where: bonds (distance) C4'-P energy: -135.357 bonds (distance) P-C4' energy: -153.909 flat angles C4'-P-C4' energy: -175.442 flat angles P-C4'-P energy: -115.857 tors. eta vs tors. theta energy: -246.775 Dist. restrs. and SS energy: 2.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2674.025884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2674.025884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2676.371256 (E_RNA) where: Base-Base interactions energy: -1872.406 where: short stacking energy: -763.897 Base-Backbone interact. energy: -0.735 local terms energy: -803.229403 where: bonds (distance) C4'-P energy: -135.048 bonds (distance) P-C4' energy: -150.687 flat angles C4'-P-C4' energy: -165.678 flat angles P-C4'-P energy: -122.861 tors. eta vs tors. theta energy: -228.955 Dist. restrs. and SS energy: 2.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2573.925496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2573.925496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2576.978823 (E_RNA) where: Base-Base interactions energy: -1821.022 where: short stacking energy: -774.756 Base-Backbone interact. energy: -1.619 local terms energy: -754.337185 where: bonds (distance) C4'-P energy: -115.890 bonds (distance) P-C4' energy: -135.421 flat angles C4'-P-C4' energy: -172.240 flat angles P-C4'-P energy: -106.507 tors. eta vs tors. theta energy: -224.279 Dist. restrs. and SS energy: 3.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2604.155537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2604.155537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2605.540175 (E_RNA) where: Base-Base interactions energy: -1797.483 where: short stacking energy: -800.858 Base-Backbone interact. energy: -0.291 local terms energy: -807.766650 where: bonds (distance) C4'-P energy: -149.813 bonds (distance) P-C4' energy: -145.506 flat angles C4'-P-C4' energy: -160.017 flat angles P-C4'-P energy: -110.374 tors. eta vs tors. theta energy: -242.057 Dist. restrs. and SS energy: 1.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -2411.316760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2411.316760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2417.979208 (E_RNA) where: Base-Base interactions energy: -1717.376 where: short stacking energy: -718.118 Base-Backbone interact. energy: -1.874 local terms energy: -698.730152 where: bonds (distance) C4'-P energy: -122.593 bonds (distance) P-C4' energy: -119.531 flat angles C4'-P-C4' energy: -154.543 flat angles P-C4'-P energy: -101.354 tors. eta vs tors. theta energy: -200.710 Dist. restrs. and SS energy: 6.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -2316.242780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.242780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2321.915176 (E_RNA) where: Base-Base interactions energy: -1634.549 where: short stacking energy: -702.000 Base-Backbone interact. energy: -2.189 local terms energy: -685.177438 where: bonds (distance) C4'-P energy: -133.084 bonds (distance) P-C4' energy: -136.046 flat angles C4'-P-C4' energy: -142.373 flat angles P-C4'-P energy: -96.590 tors. eta vs tors. theta energy: -177.085 Dist. restrs. and SS energy: 5.672 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -2236.877501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.877501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.989073 (E_RNA) where: Base-Base interactions energy: -1577.834 where: short stacking energy: -660.160 Base-Backbone interact. energy: 3.629 local terms energy: -667.784328 where: bonds (distance) C4'-P energy: -128.203 bonds (distance) P-C4' energy: -103.591 flat angles C4'-P-C4' energy: -148.692 flat angles P-C4'-P energy: -96.246 tors. eta vs tors. theta energy: -191.052 Dist. restrs. and SS energy: 5.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -2216.988781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.988781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2227.514003 (E_RNA) where: Base-Base interactions energy: -1596.199 where: short stacking energy: -669.892 Base-Backbone interact. energy: -0.115 local terms energy: -631.199570 where: bonds (distance) C4'-P energy: -127.096 bonds (distance) P-C4' energy: -108.953 flat angles C4'-P-C4' energy: -130.986 flat angles P-C4'-P energy: -85.609 tors. eta vs tors. theta energy: -178.555 Dist. restrs. and SS energy: 10.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -2052.215125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2052.215125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2067.396044 (E_RNA) where: Base-Base interactions energy: -1499.484 where: short stacking energy: -618.021 Base-Backbone interact. energy: 2.804 local terms energy: -570.715613 where: bonds (distance) C4'-P energy: -106.890 bonds (distance) P-C4' energy: -113.134 flat angles C4'-P-C4' energy: -118.379 flat angles P-C4'-P energy: -68.537 tors. eta vs tors. theta energy: -163.775 Dist. restrs. and SS energy: 15.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1927.279322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1927.279322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.067606 (E_RNA) where: Base-Base interactions energy: -1326.436 where: short stacking energy: -555.064 Base-Backbone interact. energy: -0.148 local terms energy: -618.483431 where: bonds (distance) C4'-P energy: -101.102 bonds (distance) P-C4' energy: -132.567 flat angles C4'-P-C4' energy: -125.042 flat angles P-C4'-P energy: -91.463 tors. eta vs tors. theta energy: -168.309 Dist. restrs. and SS energy: 17.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2740.078282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2740.078282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2742.896125 (E_RNA) where: Base-Base interactions energy: -1912.695 where: short stacking energy: -829.007 Base-Backbone interact. energy: -2.561 local terms energy: -827.640205 where: bonds (distance) C4'-P energy: -151.948 bonds (distance) P-C4' energy: -147.572 flat angles C4'-P-C4' energy: -174.930 flat angles P-C4'-P energy: -114.621 tors. eta vs tors. theta energy: -238.569 Dist. restrs. and SS energy: 2.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2687.322305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2687.322305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2690.072366 (E_RNA) where: Base-Base interactions energy: -1882.975 where: short stacking energy: -810.031 Base-Backbone interact. energy: 1.034 local terms energy: -808.131359 where: bonds (distance) C4'-P energy: -132.476 bonds (distance) P-C4' energy: -148.326 flat angles C4'-P-C4' energy: -170.987 flat angles P-C4'-P energy: -111.254 tors. eta vs tors. theta energy: -245.090 Dist. restrs. and SS energy: 2.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2534.971904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2534.971904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2537.500241 (E_RNA) where: Base-Base interactions energy: -1799.282 where: short stacking energy: -739.916 Base-Backbone interact. energy: -2.993 local terms energy: -735.225533 where: bonds (distance) C4'-P energy: -135.414 bonds (distance) P-C4' energy: -142.124 flat angles C4'-P-C4' energy: -158.130 flat angles P-C4'-P energy: -92.838 tors. eta vs tors. theta energy: -206.719 Dist. restrs. and SS energy: 2.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2588.223989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2588.223989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2591.338959 (E_RNA) where: Base-Base interactions energy: -1825.528 where: short stacking energy: -791.668 Base-Backbone interact. energy: -3.495 local terms energy: -762.315287 where: bonds (distance) C4'-P energy: -121.975 bonds (distance) P-C4' energy: -131.289 flat angles C4'-P-C4' energy: -173.206 flat angles P-C4'-P energy: -90.906 tors. eta vs tors. theta energy: -244.939 Dist. restrs. and SS energy: 3.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -2408.509312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2408.509312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2422.063776 (E_RNA) where: Base-Base interactions energy: -1698.133 where: short stacking energy: -732.488 Base-Backbone interact. energy: 1.450 local terms energy: -725.381664 where: bonds (distance) C4'-P energy: -130.562 bonds (distance) P-C4' energy: -153.246 flat angles C4'-P-C4' energy: -132.899 flat angles P-C4'-P energy: -95.935 tors. eta vs tors. theta energy: -212.740 Dist. restrs. and SS energy: 13.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -2379.921724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.921724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2392.542129 (E_RNA) where: Base-Base interactions energy: -1657.314 where: short stacking energy: -719.053 Base-Backbone interact. energy: -0.797 local terms energy: -734.431436 where: bonds (distance) C4'-P energy: -129.652 bonds (distance) P-C4' energy: -136.955 flat angles C4'-P-C4' energy: -158.307 flat angles P-C4'-P energy: -91.248 tors. eta vs tors. theta energy: -218.269 Dist. restrs. and SS energy: 12.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -2264.885632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2264.885632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2270.735695 (E_RNA) where: Base-Base interactions energy: -1619.123 where: short stacking energy: -669.431 Base-Backbone interact. energy: -1.005 local terms energy: -650.607514 where: bonds (distance) C4'-P energy: -123.526 bonds (distance) P-C4' energy: -112.290 flat angles C4'-P-C4' energy: -137.182 flat angles P-C4'-P energy: -90.112 tors. eta vs tors. theta energy: -187.497 Dist. restrs. and SS energy: 5.850 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -2219.135704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2219.135704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2225.000829 (E_RNA) where: Base-Base interactions energy: -1550.675 where: short stacking energy: -641.113 Base-Backbone interact. energy: -0.421 local terms energy: -673.904891 where: bonds (distance) C4'-P energy: -118.286 bonds (distance) P-C4' energy: -143.992 flat angles C4'-P-C4' energy: -127.519 flat angles P-C4'-P energy: -94.038 tors. eta vs tors. theta energy: -190.070 Dist. restrs. and SS energy: 5.865 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -2038.744759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2038.744759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.635454 (E_RNA) where: Base-Base interactions energy: -1467.747 where: short stacking energy: -592.625 Base-Backbone interact. energy: 1.326 local terms energy: -589.214561 where: bonds (distance) C4'-P energy: -97.553 bonds (distance) P-C4' energy: -113.699 flat angles C4'-P-C4' energy: -143.191 flat angles P-C4'-P energy: -68.779 tors. eta vs tors. theta energy: -165.993 Dist. restrs. and SS energy: 16.891 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1925.602157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1925.602157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1945.925001 (E_RNA) where: Base-Base interactions energy: -1354.383 where: short stacking energy: -579.315 Base-Backbone interact. energy: 4.024 local terms energy: -595.566064 where: bonds (distance) C4'-P energy: -110.973 bonds (distance) P-C4' energy: -109.226 flat angles C4'-P-C4' energy: -149.566 flat angles P-C4'-P energy: -64.884 tors. eta vs tors. theta energy: -160.918 Dist. restrs. and SS energy: 20.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2739.573192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2739.573192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2740.799311 (E_RNA) where: Base-Base interactions energy: -1903.954 where: short stacking energy: -826.622 Base-Backbone interact. energy: -2.313 local terms energy: -834.532802 where: bonds (distance) C4'-P energy: -149.434 bonds (distance) P-C4' energy: -157.784 flat angles C4'-P-C4' energy: -161.711 flat angles P-C4'-P energy: -120.403 tors. eta vs tors. theta energy: -245.201 Dist. restrs. and SS energy: 1.226 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2717.806209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2717.806209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2719.243935 (E_RNA) where: Base-Base interactions energy: -1893.428 where: short stacking energy: -808.002 Base-Backbone interact. energy: 2.590 local terms energy: -828.405974 where: bonds (distance) C4'-P energy: -139.253 bonds (distance) P-C4' energy: -161.455 flat angles C4'-P-C4' energy: -175.029 flat angles P-C4'-P energy: -110.019 tors. eta vs tors. theta energy: -242.650 Dist. restrs. and SS energy: 1.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2602.672877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2602.672877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2607.886420 (E_RNA) where: Base-Base interactions energy: -1822.975 where: short stacking energy: -749.932 Base-Backbone interact. energy: -2.184 local terms energy: -782.727755 where: bonds (distance) C4'-P energy: -146.361 bonds (distance) P-C4' energy: -152.796 flat angles C4'-P-C4' energy: -162.052 flat angles P-C4'-P energy: -103.062 tors. eta vs tors. theta energy: -218.456 Dist. restrs. and SS energy: 5.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2623.925564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2623.925564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2628.194523 (E_RNA) where: Base-Base interactions energy: -1846.294 where: short stacking energy: -790.354 Base-Backbone interact. energy: -2.332 local terms energy: -779.568450 where: bonds (distance) C4'-P energy: -126.850 bonds (distance) P-C4' energy: -155.960 flat angles C4'-P-C4' energy: -162.907 flat angles P-C4'-P energy: -99.710 tors. eta vs tors. theta energy: -234.142 Dist. restrs. and SS energy: 4.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2457.334437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2457.334437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2460.209274 (E_RNA) where: Base-Base interactions energy: -1753.174 where: short stacking energy: -733.164 Base-Backbone interact. energy: -0.535 local terms energy: -706.500495 where: bonds (distance) C4'-P energy: -124.216 bonds (distance) P-C4' energy: -135.098 flat angles C4'-P-C4' energy: -142.496 flat angles P-C4'-P energy: -87.075 tors. eta vs tors. theta energy: -217.616 Dist. restrs. and SS energy: 2.875 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -2334.884058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2334.884058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.157882 (E_RNA) where: Base-Base interactions energy: -1652.647 where: short stacking energy: -702.307 Base-Backbone interact. energy: -2.565 local terms energy: -684.945771 where: bonds (distance) C4'-P energy: -121.251 bonds (distance) P-C4' energy: -134.406 flat angles C4'-P-C4' energy: -148.466 flat angles P-C4'-P energy: -86.528 tors. eta vs tors. theta energy: -194.294 Dist. restrs. and SS energy: 5.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -2255.473396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2255.473396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.843346 (E_RNA) where: Base-Base interactions energy: -1614.322 where: short stacking energy: -659.530 Base-Backbone interact. energy: -1.440 local terms energy: -645.080906 where: bonds (distance) C4'-P energy: -104.794 bonds (distance) P-C4' energy: -123.540 flat angles C4'-P-C4' energy: -143.029 flat angles P-C4'-P energy: -93.449 tors. eta vs tors. theta energy: -180.268 Dist. restrs. and SS energy: 5.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -2227.876533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2227.876533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2234.438211 (E_RNA) where: Base-Base interactions energy: -1549.986 where: short stacking energy: -631.328 Base-Backbone interact. energy: -0.701 local terms energy: -683.751587 where: bonds (distance) C4'-P energy: -125.509 bonds (distance) P-C4' energy: -123.345 flat angles C4'-P-C4' energy: -152.377 flat angles P-C4'-P energy: -74.176 tors. eta vs tors. theta energy: -208.345 Dist. restrs. and SS energy: 6.562 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -2041.459142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.459142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.503656 (E_RNA) where: Base-Base interactions energy: -1429.655 where: short stacking energy: -606.215 Base-Backbone interact. energy: -0.940 local terms energy: -624.908398 where: bonds (distance) C4'-P energy: -121.031 bonds (distance) P-C4' energy: -123.942 flat angles C4'-P-C4' energy: -126.970 flat angles P-C4'-P energy: -85.561 tors. eta vs tors. theta energy: -167.405 Dist. restrs. and SS energy: 14.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1939.555788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1939.555788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1967.003713 (E_RNA) where: Base-Base interactions energy: -1377.523 where: short stacking energy: -570.501 Base-Backbone interact. energy: 5.797 local terms energy: -595.276953 where: bonds (distance) C4'-P energy: -104.123 bonds (distance) P-C4' energy: -117.573 flat angles C4'-P-C4' energy: -135.649 flat angles P-C4'-P energy: -78.901 tors. eta vs tors. theta energy: -159.031 Dist. restrs. and SS energy: 27.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2778.766067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2778.766067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2779.738851 (E_RNA) where: Base-Base interactions energy: -1913.848 where: short stacking energy: -808.239 Base-Backbone interact. energy: -0.987 local terms energy: -864.904281 where: bonds (distance) C4'-P energy: -148.951 bonds (distance) P-C4' energy: -161.331 flat angles C4'-P-C4' energy: -177.267 flat angles P-C4'-P energy: -131.446 tors. eta vs tors. theta energy: -245.909 Dist. restrs. and SS energy: 0.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2688.252404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2688.252404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2690.144651 (E_RNA) where: Base-Base interactions energy: -1886.542 where: short stacking energy: -814.247 Base-Backbone interact. energy: 0.044 local terms energy: -803.646208 where: bonds (distance) C4'-P energy: -135.788 bonds (distance) P-C4' energy: -151.060 flat angles C4'-P-C4' energy: -167.729 flat angles P-C4'-P energy: -110.455 tors. eta vs tors. theta energy: -238.613 Dist. restrs. and SS energy: 1.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2652.569386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2652.569386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2657.822142 (E_RNA) where: Base-Base interactions energy: -1878.251 where: short stacking energy: -793.849 Base-Backbone interact. energy: -1.681 local terms energy: -777.889704 where: bonds (distance) C4'-P energy: -140.166 bonds (distance) P-C4' energy: -126.257 flat angles C4'-P-C4' energy: -167.156 flat angles P-C4'-P energy: -114.640 tors. eta vs tors. theta energy: -229.671 Dist. restrs. and SS energy: 5.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2553.972107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2553.972107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2558.475153 (E_RNA) where: Base-Base interactions energy: -1800.622 where: short stacking energy: -746.197 Base-Backbone interact. energy: -3.591 local terms energy: -754.261929 where: bonds (distance) C4'-P energy: -132.343 bonds (distance) P-C4' energy: -123.641 flat angles C4'-P-C4' energy: -159.000 flat angles P-C4'-P energy: -121.200 tors. eta vs tors. theta energy: -218.078 Dist. restrs. and SS energy: 4.503 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2450.429217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2450.429217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2456.013556 (E_RNA) where: Base-Base interactions energy: -1746.749 where: short stacking energy: -730.020 Base-Backbone interact. energy: -1.867 local terms energy: -707.397022 where: bonds (distance) C4'-P energy: -109.026 bonds (distance) P-C4' energy: -129.658 flat angles C4'-P-C4' energy: -163.408 flat angles P-C4'-P energy: -101.165 tors. eta vs tors. theta energy: -204.140 Dist. restrs. and SS energy: 5.584 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -2332.600087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2332.600087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.844300 (E_RNA) where: Base-Base interactions energy: -1667.964 where: short stacking energy: -678.836 Base-Backbone interact. energy: -1.935 local terms energy: -667.945303 where: bonds (distance) C4'-P energy: -103.734 bonds (distance) P-C4' energy: -121.408 flat angles C4'-P-C4' energy: -142.633 flat angles P-C4'-P energy: -95.585 tors. eta vs tors. theta energy: -204.585 Dist. restrs. and SS energy: 5.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -2308.911795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2308.911795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2313.722301 (E_RNA) where: Base-Base interactions energy: -1623.038 where: short stacking energy: -665.977 Base-Backbone interact. energy: -2.159 local terms energy: -688.525621 where: bonds (distance) C4'-P energy: -133.868 bonds (distance) P-C4' energy: -111.723 flat angles C4'-P-C4' energy: -154.481 flat angles P-C4'-P energy: -93.989 tors. eta vs tors. theta energy: -194.464 Dist. restrs. and SS energy: 4.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -2167.550063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2167.550063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.017817 (E_RNA) where: Base-Base interactions energy: -1539.099 where: short stacking energy: -642.168 Base-Backbone interact. energy: -1.347 local terms energy: -635.572041 where: bonds (distance) C4'-P energy: -112.646 bonds (distance) P-C4' energy: -112.669 flat angles C4'-P-C4' energy: -138.532 flat angles P-C4'-P energy: -92.924 tors. eta vs tors. theta energy: -178.802 Dist. restrs. and SS energy: 8.468 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -2051.672989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2051.672989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2069.663452 (E_RNA) where: Base-Base interactions energy: -1481.834 where: short stacking energy: -594.134 Base-Backbone interact. energy: 2.053 local terms energy: -589.882698 where: bonds (distance) C4'-P energy: -105.376 bonds (distance) P-C4' energy: -100.471 flat angles C4'-P-C4' energy: -122.100 flat angles P-C4'-P energy: -90.498 tors. eta vs tors. theta energy: -171.437 Dist. restrs. and SS energy: 17.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1891.193975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.193975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.580099 (E_RNA) where: Base-Base interactions energy: -1335.342 where: short stacking energy: -546.071 Base-Backbone interact. energy: -0.366 local terms energy: -578.871335 where: bonds (distance) C4'-P energy: -105.450 bonds (distance) P-C4' energy: -114.357 flat angles C4'-P-C4' energy: -124.512 flat angles P-C4'-P energy: -76.527 tors. eta vs tors. theta energy: -158.025 Dist. restrs. and SS energy: 23.386 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2794.171605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2794.171605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2795.838792 (E_RNA) where: Base-Base interactions energy: -1939.662 where: short stacking energy: -844.026 Base-Backbone interact. energy: 0.880 local terms energy: -857.057205 where: bonds (distance) C4'-P energy: -150.629 bonds (distance) P-C4' energy: -160.319 flat angles C4'-P-C4' energy: -179.642 flat angles P-C4'-P energy: -114.983 tors. eta vs tors. theta energy: -251.484 Dist. restrs. and SS energy: 1.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2672.155279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2672.155279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2677.030451 (E_RNA) where: Base-Base interactions energy: -1878.822 where: short stacking energy: -809.758 Base-Backbone interact. energy: 2.568 local terms energy: -800.776712 where: bonds (distance) C4'-P energy: -140.089 bonds (distance) P-C4' energy: -151.543 flat angles C4'-P-C4' energy: -157.497 flat angles P-C4'-P energy: -111.801 tors. eta vs tors. theta energy: -239.847 Dist. restrs. and SS energy: 4.875 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2659.816053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2659.816053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2661.344306 (E_RNA) where: Base-Base interactions energy: -1891.671 where: short stacking energy: -795.529 Base-Backbone interact. energy: -3.219 local terms energy: -766.453885 where: bonds (distance) C4'-P energy: -126.807 bonds (distance) P-C4' energy: -147.035 flat angles C4'-P-C4' energy: -157.546 flat angles P-C4'-P energy: -101.854 tors. eta vs tors. theta energy: -233.212 Dist. restrs. and SS energy: 1.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2528.853725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2528.853725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2531.906084 (E_RNA) where: Base-Base interactions energy: -1803.885 where: short stacking energy: -738.738 Base-Backbone interact. energy: -1.001 local terms energy: -727.020074 where: bonds (distance) C4'-P energy: -135.557 bonds (distance) P-C4' energy: -125.016 flat angles C4'-P-C4' energy: -157.686 flat angles P-C4'-P energy: -99.021 tors. eta vs tors. theta energy: -209.740 Dist. restrs. and SS energy: 3.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2453.430256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2453.430256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2461.090465 (E_RNA) where: Base-Base interactions energy: -1706.349 where: short stacking energy: -702.417 Base-Backbone interact. energy: -2.409 local terms energy: -752.332522 where: bonds (distance) C4'-P energy: -133.565 bonds (distance) P-C4' energy: -141.680 flat angles C4'-P-C4' energy: -160.643 flat angles P-C4'-P energy: -105.127 tors. eta vs tors. theta energy: -211.318 Dist. restrs. and SS energy: 7.660 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -2402.007317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2402.007317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2408.868482 (E_RNA) where: Base-Base interactions energy: -1685.045 where: short stacking energy: -728.554 Base-Backbone interact. energy: -3.524 local terms energy: -720.298866 where: bonds (distance) C4'-P energy: -115.908 bonds (distance) P-C4' energy: -138.460 flat angles C4'-P-C4' energy: -158.497 flat angles P-C4'-P energy: -95.024 tors. eta vs tors. theta energy: -212.410 Dist. restrs. and SS energy: 6.861 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -2346.674952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2346.674952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.228182 (E_RNA) where: Base-Base interactions energy: -1646.170 where: short stacking energy: -716.035 Base-Backbone interact. energy: -0.940 local terms energy: -707.117476 where: bonds (distance) C4'-P energy: -125.797 bonds (distance) P-C4' energy: -124.770 flat angles C4'-P-C4' energy: -159.012 flat angles P-C4'-P energy: -86.319 tors. eta vs tors. theta energy: -211.220 Dist. restrs. and SS energy: 7.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -2165.314429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2165.314429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.502490 (E_RNA) where: Base-Base interactions energy: -1507.958 where: short stacking energy: -636.709 Base-Backbone interact. energy: -2.305 local terms energy: -665.239715 where: bonds (distance) C4'-P energy: -116.989 bonds (distance) P-C4' energy: -131.281 flat angles C4'-P-C4' energy: -148.447 flat angles P-C4'-P energy: -74.938 tors. eta vs tors. theta energy: -193.585 Dist. restrs. and SS energy: 10.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -2041.912989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.912989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2048.000381 (E_RNA) where: Base-Base interactions energy: -1442.828 where: short stacking energy: -606.178 Base-Backbone interact. energy: -0.542 local terms energy: -604.630579 where: bonds (distance) C4'-P energy: -110.523 bonds (distance) P-C4' energy: -107.449 flat angles C4'-P-C4' energy: -138.579 flat angles P-C4'-P energy: -90.119 tors. eta vs tors. theta energy: -157.961 Dist. restrs. and SS energy: 6.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1874.396931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1874.396931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1890.136698 (E_RNA) where: Base-Base interactions energy: -1372.275 where: short stacking energy: -554.603 Base-Backbone interact. energy: 8.137 local terms energy: -525.999507 where: bonds (distance) C4'-P energy: -85.604 bonds (distance) P-C4' energy: -111.444 flat angles C4'-P-C4' energy: -112.351 flat angles P-C4'-P energy: -74.372 tors. eta vs tors. theta energy: -142.229 Dist. restrs. and SS energy: 15.740 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2764.507032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2764.507032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2767.112239 (E_RNA) where: Base-Base interactions energy: -1940.441 where: short stacking energy: -841.528 Base-Backbone interact. energy: -3.265 local terms energy: -823.406804 where: bonds (distance) C4'-P energy: -153.740 bonds (distance) P-C4' energy: -141.158 flat angles C4'-P-C4' energy: -172.467 flat angles P-C4'-P energy: -111.062 tors. eta vs tors. theta energy: -244.980 Dist. restrs. and SS energy: 2.605 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2689.305478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2689.305478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2692.039916 (E_RNA) where: Base-Base interactions energy: -1878.675 where: short stacking energy: -811.291 Base-Backbone interact. energy: -1.760 local terms energy: -811.605297 where: bonds (distance) C4'-P energy: -136.570 bonds (distance) P-C4' energy: -152.457 flat angles C4'-P-C4' energy: -171.799 flat angles P-C4'-P energy: -117.133 tors. eta vs tors. theta energy: -233.646 Dist. restrs. and SS energy: 2.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2714.427497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2714.427497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2718.559168 (E_RNA) where: Base-Base interactions energy: -1930.286 where: short stacking energy: -818.347 Base-Backbone interact. energy: -3.847 local terms energy: -784.426607 where: bonds (distance) C4'-P energy: -142.399 bonds (distance) P-C4' energy: -131.281 flat angles C4'-P-C4' energy: -161.519 flat angles P-C4'-P energy: -113.225 tors. eta vs tors. theta energy: -236.003 Dist. restrs. and SS energy: 4.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2532.190852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2532.190852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.613221 (E_RNA) where: Base-Base interactions energy: -1769.340 where: short stacking energy: -735.187 Base-Backbone interact. energy: -3.586 local terms energy: -762.686658 where: bonds (distance) C4'-P energy: -147.375 bonds (distance) P-C4' energy: -147.126 flat angles C4'-P-C4' energy: -162.578 flat angles P-C4'-P energy: -96.876 tors. eta vs tors. theta energy: -208.733 Dist. restrs. and SS energy: 3.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2428.870860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.870860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2434.780778 (E_RNA) where: Base-Base interactions energy: -1709.653 where: short stacking energy: -732.256 Base-Backbone interact. energy: -1.155 local terms energy: -723.973022 where: bonds (distance) C4'-P energy: -124.146 bonds (distance) P-C4' energy: -136.401 flat angles C4'-P-C4' energy: -150.565 flat angles P-C4'-P energy: -95.909 tors. eta vs tors. theta energy: -216.953 Dist. restrs. and SS energy: 5.910 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -2372.152400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2372.152400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.067892 (E_RNA) where: Base-Base interactions energy: -1662.663 where: short stacking energy: -683.358 Base-Backbone interact. energy: 2.708 local terms energy: -719.112962 where: bonds (distance) C4'-P energy: -118.647 bonds (distance) P-C4' energy: -138.485 flat angles C4'-P-C4' energy: -162.393 flat angles P-C4'-P energy: -98.191 tors. eta vs tors. theta energy: -201.397 Dist. restrs. and SS energy: 6.915 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -2368.034694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2368.034694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.478453 (E_RNA) where: Base-Base interactions energy: -1685.819 where: short stacking energy: -702.307 Base-Backbone interact. energy: 0.813 local terms energy: -686.472538 where: bonds (distance) C4'-P energy: -111.021 bonds (distance) P-C4' energy: -112.839 flat angles C4'-P-C4' energy: -157.314 flat angles P-C4'-P energy: -98.516 tors. eta vs tors. theta energy: -206.781 Dist. restrs. and SS energy: 3.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -2210.599390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2210.599390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.937526 (E_RNA) where: Base-Base interactions energy: -1589.298 where: short stacking energy: -679.162 Base-Backbone interact. energy: -1.901 local terms energy: -624.738415 where: bonds (distance) C4'-P energy: -106.340 bonds (distance) P-C4' energy: -115.847 flat angles C4'-P-C4' energy: -135.120 flat angles P-C4'-P energy: -73.994 tors. eta vs tors. theta energy: -193.437 Dist. restrs. and SS energy: 5.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -2105.334468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2105.334468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2109.173714 (E_RNA) where: Base-Base interactions energy: -1507.198 where: short stacking energy: -591.476 Base-Backbone interact. energy: 0.134 local terms energy: -602.109895 where: bonds (distance) C4'-P energy: -96.362 bonds (distance) P-C4' energy: -126.050 flat angles C4'-P-C4' energy: -138.424 flat angles P-C4'-P energy: -75.505 tors. eta vs tors. theta energy: -165.769 Dist. restrs. and SS energy: 3.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1894.575079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1894.575079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.637331 (E_RNA) where: Base-Base interactions energy: -1312.970 where: short stacking energy: -533.135 Base-Backbone interact. energy: -1.627 local terms energy: -603.040238 where: bonds (distance) C4'-P energy: -116.262 bonds (distance) P-C4' energy: -122.979 flat angles C4'-P-C4' energy: -138.951 flat angles P-C4'-P energy: -77.534 tors. eta vs tors. theta energy: -147.315 Dist. restrs. and SS energy: 23.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)