SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ASO1-b0027e1c/inputs/seq.fa: 2 curr_seq: _GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU_ curr_seq: _AGAGGAUGACUCAUUGUAGU_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGUACCAAGUUUUGGGAAGUGAUCAGUGAUGAGCACGGCAUCGACCAGGCCGGAGGCUACGUGGGCGACUCAGCGCUGCAGCUGGAGAGGAUCAGCGUCUACUACAAUGAGUCAUCCUCUAAGAAGUACGUACCCAGGGCUGCCCUGGUGGACUUGGAGCCCGGCACCAUGGACAGUGUGAGGUCUGGGCCUUUUGGGCAACUCUUCCGGCCUGACAACU chainId: B, chainSeq: AGAGGAUGACUCAUUGUAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 220 nucleotides chain B contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1210 n_atoms_counter: 1210 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 240.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 240.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -975.804386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.804386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.804386 (E_RNA) where: Base-Base interactions energy: -41.311 where: short stacking energy: -41.311 Base-Backbone interact. energy: -0.000 local terms energy: -934.493379 where: bonds (distance) C4'-P energy: -233.179 bonds (distance) P-C4' energy: -216.506 flat angles C4'-P-C4' energy: -176.214 flat angles P-C4'-P energy: -201.570 tors. eta vs tors. theta energy: -107.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1213.438863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.438863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.438863 (E_RNA) where: Base-Base interactions energy: -532.417 where: short stacking energy: -532.417 Base-Backbone interact. energy: -0.302 local terms energy: -680.719377 where: bonds (distance) C4'-P energy: -135.210 bonds (distance) P-C4' energy: -150.556 flat angles C4'-P-C4' energy: -152.017 flat angles P-C4'-P energy: -103.772 tors. eta vs tors. theta energy: -139.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1096.508478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.508478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.508478 (E_RNA) where: Base-Base interactions energy: -455.146 where: short stacking energy: -453.757 Base-Backbone interact. energy: -0.136 local terms energy: -641.225925 where: bonds (distance) C4'-P energy: -142.760 bonds (distance) P-C4' energy: -139.961 flat angles C4'-P-C4' energy: -154.778 flat angles P-C4'-P energy: -88.590 tors. eta vs tors. theta energy: -115.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1043.293018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.293018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.293018 (E_RNA) where: Base-Base interactions energy: -434.829 where: short stacking energy: -427.530 Base-Backbone interact. energy: -0.245 local terms energy: -608.218730 where: bonds (distance) C4'-P energy: -147.109 bonds (distance) P-C4' energy: -153.751 flat angles C4'-P-C4' energy: -129.585 flat angles P-C4'-P energy: -85.259 tors. eta vs tors. theta energy: -92.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -982.517195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.517195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.517195 (E_RNA) where: Base-Base interactions energy: -376.402 where: short stacking energy: -373.890 Base-Backbone interact. energy: -0.673 local terms energy: -605.441553 where: bonds (distance) C4'-P energy: -146.094 bonds (distance) P-C4' energy: -145.392 flat angles C4'-P-C4' energy: -143.057 flat angles P-C4'-P energy: -80.953 tors. eta vs tors. theta energy: -89.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -982.707117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.707117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.707117 (E_RNA) where: Base-Base interactions energy: -94.946 where: short stacking energy: -94.946 Base-Backbone interact. energy: -0.000 local terms energy: -887.760397 where: bonds (distance) C4'-P energy: -209.829 bonds (distance) P-C4' energy: -188.748 flat angles C4'-P-C4' energy: -178.219 flat angles P-C4'-P energy: -194.396 tors. eta vs tors. theta energy: -116.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -976.471985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.471985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.471985 (E_RNA) where: Base-Base interactions energy: -44.010 where: short stacking energy: -44.010 Base-Backbone interact. energy: -0.000 local terms energy: -932.461315 where: bonds (distance) C4'-P energy: -231.345 bonds (distance) P-C4' energy: -215.795 flat angles C4'-P-C4' energy: -175.977 flat angles P-C4'-P energy: -201.205 tors. eta vs tors. theta energy: -108.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -989.481310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.481310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.481310 (E_RNA) where: Base-Base interactions energy: -153.103 where: short stacking energy: -153.103 Base-Backbone interact. energy: -0.000 local terms energy: -836.378047 where: bonds (distance) C4'-P energy: -178.754 bonds (distance) P-C4' energy: -171.657 flat angles C4'-P-C4' energy: -180.277 flat angles P-C4'-P energy: -185.871 tors. eta vs tors. theta energy: -119.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -984.477980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.477980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.477980 (E_RNA) where: Base-Base interactions energy: -156.349 where: short stacking energy: -156.349 Base-Backbone interact. energy: -0.000 local terms energy: -828.129068 where: bonds (distance) C4'-P energy: -174.931 bonds (distance) P-C4' energy: -171.486 flat angles C4'-P-C4' energy: -184.504 flat angles P-C4'-P energy: -178.920 tors. eta vs tors. theta energy: -118.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -974.462504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.462504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.462504 (E_RNA) where: Base-Base interactions energy: -44.751 where: short stacking energy: -44.751 Base-Backbone interact. energy: -0.000 local terms energy: -929.711753 where: bonds (distance) C4'-P energy: -230.873 bonds (distance) P-C4' energy: -213.770 flat angles C4'-P-C4' energy: -176.003 flat angles P-C4'-P energy: -200.730 tors. eta vs tors. theta energy: -108.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -974.803074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.803074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.803074 (E_RNA) where: Base-Base interactions energy: -45.349 where: short stacking energy: -45.349 Base-Backbone interact. energy: -0.000 local terms energy: -929.454103 where: bonds (distance) C4'-P energy: -230.873 bonds (distance) P-C4' energy: -213.512 flat angles C4'-P-C4' energy: -176.003 flat angles P-C4'-P energy: -200.730 tors. eta vs tors. theta energy: -108.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1239.352756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.352756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.352756 (E_RNA) where: Base-Base interactions energy: -528.681 where: short stacking energy: -525.597 Base-Backbone interact. energy: -0.419 local terms energy: -710.252371 where: bonds (distance) C4'-P energy: -145.330 bonds (distance) P-C4' energy: -165.683 flat angles C4'-P-C4' energy: -166.221 flat angles P-C4'-P energy: -98.605 tors. eta vs tors. theta energy: -134.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1248.314725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.314725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.314725 (E_RNA) where: Base-Base interactions energy: -576.617 where: short stacking energy: -535.850 Base-Backbone interact. energy: -1.063 local terms energy: -670.819143 where: bonds (distance) C4'-P energy: -138.867 bonds (distance) P-C4' energy: -165.871 flat angles C4'-P-C4' energy: -155.026 flat angles P-C4'-P energy: -89.525 tors. eta vs tors. theta energy: -121.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.184 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1047.377569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.377569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.377569 (E_RNA) where: Base-Base interactions energy: -429.093 where: short stacking energy: -417.261 Base-Backbone interact. energy: -0.145 local terms energy: -618.139651 where: bonds (distance) C4'-P energy: -134.225 bonds (distance) P-C4' energy: -166.272 flat angles C4'-P-C4' energy: -138.260 flat angles P-C4'-P energy: -91.969 tors. eta vs tors. theta energy: -87.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1008.137468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.137468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.137468 (E_RNA) where: Base-Base interactions energy: -453.938 where: short stacking energy: -414.583 Base-Backbone interact. energy: 6.056 local terms energy: -560.254887 where: bonds (distance) C4'-P energy: -136.604 bonds (distance) P-C4' energy: -148.906 flat angles C4'-P-C4' energy: -133.136 flat angles P-C4'-P energy: -78.309 tors. eta vs tors. theta energy: -63.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -893.741989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.741989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.741989 (E_RNA) where: Base-Base interactions energy: -345.614 where: short stacking energy: -332.287 Base-Backbone interact. energy: 1.413 local terms energy: -549.540829 where: bonds (distance) C4'-P energy: -123.103 bonds (distance) P-C4' energy: -153.434 flat angles C4'-P-C4' energy: -118.929 flat angles P-C4'-P energy: -92.918 tors. eta vs tors. theta energy: -61.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -823.098956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.098956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.098956 (E_RNA) where: Base-Base interactions energy: -297.017 where: short stacking energy: -277.502 Base-Backbone interact. energy: 2.210 local terms energy: -528.291998 where: bonds (distance) C4'-P energy: -131.483 bonds (distance) P-C4' energy: -142.295 flat angles C4'-P-C4' energy: -133.744 flat angles P-C4'-P energy: -77.498 tors. eta vs tors. theta energy: -43.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -762.874683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.874683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.874683 (E_RNA) where: Base-Base interactions energy: -290.907 where: short stacking energy: -262.834 Base-Backbone interact. energy: 0.451 local terms energy: -472.418372 where: bonds (distance) C4'-P energy: -123.165 bonds (distance) P-C4' energy: -139.307 flat angles C4'-P-C4' energy: -122.127 flat angles P-C4'-P energy: -64.968 tors. eta vs tors. theta energy: -22.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -695.898138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.898138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.898138 (E_RNA) where: Base-Base interactions energy: -243.462 where: short stacking energy: -223.068 Base-Backbone interact. energy: -0.444 local terms energy: -452.089902 where: bonds (distance) C4'-P energy: -110.025 bonds (distance) P-C4' energy: -131.402 flat angles C4'-P-C4' energy: -114.675 flat angles P-C4'-P energy: -75.777 tors. eta vs tors. theta energy: -20.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.098 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -660.257138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.257138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.257138 (E_RNA) where: Base-Base interactions energy: -240.031 where: short stacking energy: -231.562 Base-Backbone interact. energy: 0.234 local terms energy: -420.459782 where: bonds (distance) C4'-P energy: -114.318 bonds (distance) P-C4' energy: -134.025 flat angles C4'-P-C4' energy: -103.261 flat angles P-C4'-P energy: -68.096 tors. eta vs tors. theta energy: -0.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -556.762273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.762273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.762273 (E_RNA) where: Base-Base interactions energy: -205.975 where: short stacking energy: -172.879 Base-Backbone interact. energy: -1.767 local terms energy: -349.020716 where: bonds (distance) C4'-P energy: -134.668 bonds (distance) P-C4' energy: -103.404 flat angles C4'-P-C4' energy: -84.270 flat angles P-C4'-P energy: -38.977 tors. eta vs tors. theta energy: 12.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1275.538041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.538041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.538041 (E_RNA) where: Base-Base interactions energy: -549.887 where: short stacking energy: -524.235 Base-Backbone interact. energy: -1.793 local terms energy: -723.857990 where: bonds (distance) C4'-P energy: -156.988 bonds (distance) P-C4' energy: -171.828 flat angles C4'-P-C4' energy: -167.693 flat angles P-C4'-P energy: -99.820 tors. eta vs tors. theta energy: -127.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1208.219399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.219399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.219399 (E_RNA) where: Base-Base interactions energy: -548.948 where: short stacking energy: -510.739 Base-Backbone interact. energy: 0.715 local terms energy: -659.986702 where: bonds (distance) C4'-P energy: -129.339 bonds (distance) P-C4' energy: -152.586 flat angles C4'-P-C4' energy: -158.084 flat angles P-C4'-P energy: -89.329 tors. eta vs tors. theta energy: -130.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1056.783485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.783485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.783485 (E_RNA) where: Base-Base interactions energy: -474.307 where: short stacking energy: -396.428 Base-Backbone interact. energy: -0.656 local terms energy: -581.820210 where: bonds (distance) C4'-P energy: -134.337 bonds (distance) P-C4' energy: -145.007 flat angles C4'-P-C4' energy: -129.303 flat angles P-C4'-P energy: -94.293 tors. eta vs tors. theta energy: -78.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1073.234336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.234336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.234336 (E_RNA) where: Base-Base interactions energy: -493.288 where: short stacking energy: -454.191 Base-Backbone interact. energy: -1.466 local terms energy: -578.481079 where: bonds (distance) C4'-P energy: -123.699 bonds (distance) P-C4' energy: -130.014 flat angles C4'-P-C4' energy: -144.161 flat angles P-C4'-P energy: -92.621 tors. eta vs tors. theta energy: -87.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -960.110295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.110295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.110295 (E_RNA) where: Base-Base interactions energy: -427.681 where: short stacking energy: -373.535 Base-Backbone interact. energy: -0.835 local terms energy: -531.593722 where: bonds (distance) C4'-P energy: -116.950 bonds (distance) P-C4' energy: -132.617 flat angles C4'-P-C4' energy: -132.309 flat angles P-C4'-P energy: -80.857 tors. eta vs tors. theta energy: -68.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -863.868362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.868362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.868362 (E_RNA) where: Base-Base interactions energy: -371.916 where: short stacking energy: -339.507 Base-Backbone interact. energy: -1.662 local terms energy: -490.290031 where: bonds (distance) C4'-P energy: -112.716 bonds (distance) P-C4' energy: -132.490 flat angles C4'-P-C4' energy: -121.832 flat angles P-C4'-P energy: -58.739 tors. eta vs tors. theta energy: -64.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -777.453796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.453796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.453796 (E_RNA) where: Base-Base interactions energy: -294.271 where: short stacking energy: -282.982 Base-Backbone interact. energy: 8.849 local terms energy: -492.032233 where: bonds (distance) C4'-P energy: -116.202 bonds (distance) P-C4' energy: -134.696 flat angles C4'-P-C4' energy: -116.800 flat angles P-C4'-P energy: -78.211 tors. eta vs tors. theta energy: -46.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -665.791749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.791749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -665.791749 (E_RNA) where: Base-Base interactions energy: -269.567 where: short stacking energy: -208.523 Base-Backbone interact. energy: 1.595 local terms energy: -397.819745 where: bonds (distance) C4'-P energy: -108.752 bonds (distance) P-C4' energy: -127.439 flat angles C4'-P-C4' energy: -110.057 flat angles P-C4'-P energy: -69.150 tors. eta vs tors. theta energy: 17.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -662.876480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.876480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.876480 (E_RNA) where: Base-Base interactions energy: -253.343 where: short stacking energy: -198.648 Base-Backbone interact. energy: -0.454 local terms energy: -409.079788 where: bonds (distance) C4'-P energy: -130.001 bonds (distance) P-C4' energy: -141.440 flat angles C4'-P-C4' energy: -92.229 flat angles P-C4'-P energy: -49.782 tors. eta vs tors. theta energy: 4.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -567.125007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.125007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.125007 (E_RNA) where: Base-Base interactions energy: -202.841 where: short stacking energy: -181.070 Base-Backbone interact. energy: -1.533 local terms energy: -362.751105 where: bonds (distance) C4'-P energy: -109.158 bonds (distance) P-C4' energy: -106.638 flat angles C4'-P-C4' energy: -99.156 flat angles P-C4'-P energy: -53.783 tors. eta vs tors. theta energy: 5.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1347.439330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.439330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.439330 (E_RNA) where: Base-Base interactions energy: -633.287 where: short stacking energy: -594.238 Base-Backbone interact. energy: 0.866 local terms energy: -715.018374 where: bonds (distance) C4'-P energy: -151.490 bonds (distance) P-C4' energy: -147.640 flat angles C4'-P-C4' energy: -161.281 flat angles P-C4'-P energy: -95.025 tors. eta vs tors. theta energy: -159.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1268.779236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.779236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.779236 (E_RNA) where: Base-Base interactions energy: -600.443 where: short stacking energy: -486.050 Base-Backbone interact. energy: -1.926 local terms energy: -666.410142 where: bonds (distance) C4'-P energy: -146.702 bonds (distance) P-C4' energy: -145.242 flat angles C4'-P-C4' energy: -159.635 flat angles P-C4'-P energy: -101.063 tors. eta vs tors. theta energy: -113.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1163.853493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.853493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.853493 (E_RNA) where: Base-Base interactions energy: -564.355 where: short stacking energy: -448.105 Base-Backbone interact. energy: -0.172 local terms energy: -599.963076 where: bonds (distance) C4'-P energy: -137.807 bonds (distance) P-C4' energy: -149.627 flat angles C4'-P-C4' energy: -136.063 flat angles P-C4'-P energy: -84.117 tors. eta vs tors. theta energy: -92.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.636 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1041.611980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.611980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.611980 (E_RNA) where: Base-Base interactions energy: -470.544 where: short stacking energy: -391.422 Base-Backbone interact. energy: -1.234 local terms energy: -569.833563 where: bonds (distance) C4'-P energy: -116.272 bonds (distance) P-C4' energy: -141.787 flat angles C4'-P-C4' energy: -148.190 flat angles P-C4'-P energy: -84.095 tors. eta vs tors. theta energy: -79.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -956.597586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.597586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.597586 (E_RNA) where: Base-Base interactions energy: -376.378 where: short stacking energy: -331.241 Base-Backbone interact. energy: 0.175 local terms energy: -580.394686 where: bonds (distance) C4'-P energy: -151.455 bonds (distance) P-C4' energy: -146.989 flat angles C4'-P-C4' energy: -131.251 flat angles P-C4'-P energy: -90.289 tors. eta vs tors. theta energy: -60.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -850.807648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.807648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.807648 (E_RNA) where: Base-Base interactions energy: -381.547 where: short stacking energy: -328.356 Base-Backbone interact. energy: -0.821 local terms energy: -468.439311 where: bonds (distance) C4'-P energy: -106.738 bonds (distance) P-C4' energy: -126.568 flat angles C4'-P-C4' energy: -115.183 flat angles P-C4'-P energy: -84.788 tors. eta vs tors. theta energy: -35.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -869.979564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.979564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.979564 (E_RNA) where: Base-Base interactions energy: -390.572 where: short stacking energy: -264.461 Base-Backbone interact. energy: -1.806 local terms energy: -477.601368 where: bonds (distance) C4'-P energy: -124.324 bonds (distance) P-C4' energy: -125.002 flat angles C4'-P-C4' energy: -135.436 flat angles P-C4'-P energy: -62.885 tors. eta vs tors. theta energy: -29.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -690.467563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.467563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.467563 (E_RNA) where: Base-Base interactions energy: -282.572 where: short stacking energy: -222.486 Base-Backbone interact. energy: 1.054 local terms energy: -410.647496 where: bonds (distance) C4'-P energy: -124.766 bonds (distance) P-C4' energy: -145.206 flat angles C4'-P-C4' energy: -102.947 flat angles P-C4'-P energy: -56.280 tors. eta vs tors. theta energy: 18.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.698 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -639.138962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.138962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.138962 (E_RNA) where: Base-Base interactions energy: -249.986 where: short stacking energy: -200.776 Base-Backbone interact. energy: -2.119 local terms energy: -387.033464 where: bonds (distance) C4'-P energy: -105.670 bonds (distance) P-C4' energy: -119.950 flat angles C4'-P-C4' energy: -95.196 flat angles P-C4'-P energy: -72.854 tors. eta vs tors. theta energy: 6.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -592.894076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.894076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.894076 (E_RNA) where: Base-Base interactions energy: -212.071 where: short stacking energy: -183.683 Base-Backbone interact. energy: -0.111 local terms energy: -380.712099 where: bonds (distance) C4'-P energy: -117.875 bonds (distance) P-C4' energy: -115.710 flat angles C4'-P-C4' energy: -101.585 flat angles P-C4'-P energy: -57.593 tors. eta vs tors. theta energy: 12.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1345.157011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.157011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.157011 (E_RNA) where: Base-Base interactions energy: -625.280 where: short stacking energy: -573.685 Base-Backbone interact. energy: -1.605 local terms energy: -718.272259 where: bonds (distance) C4'-P energy: -134.426 bonds (distance) P-C4' energy: -161.369 flat angles C4'-P-C4' energy: -164.637 flat angles P-C4'-P energy: -103.836 tors. eta vs tors. theta energy: -154.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1339.089410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.089410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.089410 (E_RNA) where: Base-Base interactions energy: -693.847 where: short stacking energy: -510.981 Base-Backbone interact. energy: -0.031 local terms energy: -645.210838 where: bonds (distance) C4'-P energy: -137.871 bonds (distance) P-C4' energy: -152.811 flat angles C4'-P-C4' energy: -139.821 flat angles P-C4'-P energy: -96.351 tors. eta vs tors. theta energy: -118.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1153.315349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.315349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.315349 (E_RNA) where: Base-Base interactions energy: -572.843 where: short stacking energy: -447.604 Base-Backbone interact. energy: 3.629 local terms energy: -584.101046 where: bonds (distance) C4'-P energy: -131.728 bonds (distance) P-C4' energy: -142.345 flat angles C4'-P-C4' energy: -139.791 flat angles P-C4'-P energy: -86.836 tors. eta vs tors. theta energy: -83.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1111.047873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.047873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.047873 (E_RNA) where: Base-Base interactions energy: -538.121 where: short stacking energy: -405.452 Base-Backbone interact. energy: 0.732 local terms energy: -573.658980 where: bonds (distance) C4'-P energy: -145.302 bonds (distance) P-C4' energy: -143.214 flat angles C4'-P-C4' energy: -135.759 flat angles P-C4'-P energy: -63.448 tors. eta vs tors. theta energy: -85.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -992.281092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.281092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.281092 (E_RNA) where: Base-Base interactions energy: -446.110 where: short stacking energy: -379.574 Base-Backbone interact. energy: -2.592 local terms energy: -543.578820 where: bonds (distance) C4'-P energy: -136.178 bonds (distance) P-C4' energy: -138.540 flat angles C4'-P-C4' energy: -129.070 flat angles P-C4'-P energy: -72.399 tors. eta vs tors. theta energy: -67.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -912.328659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.328659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.328659 (E_RNA) where: Base-Base interactions energy: -397.665 where: short stacking energy: -301.577 Base-Backbone interact. energy: -2.936 local terms energy: -511.727104 where: bonds (distance) C4'-P energy: -123.101 bonds (distance) P-C4' energy: -150.661 flat angles C4'-P-C4' energy: -138.828 flat angles P-C4'-P energy: -63.504 tors. eta vs tors. theta energy: -35.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -811.281578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.281578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.281578 (E_RNA) where: Base-Base interactions energy: -347.455 where: short stacking energy: -259.820 Base-Backbone interact. energy: -0.640 local terms energy: -463.186617 where: bonds (distance) C4'-P energy: -140.434 bonds (distance) P-C4' energy: -119.469 flat angles C4'-P-C4' energy: -105.722 flat angles P-C4'-P energy: -84.395 tors. eta vs tors. theta energy: -13.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -769.499739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.499739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.499739 (E_RNA) where: Base-Base interactions energy: -342.883 where: short stacking energy: -250.895 Base-Backbone interact. energy: -4.364 local terms energy: -422.253461 where: bonds (distance) C4'-P energy: -123.128 bonds (distance) P-C4' energy: -128.398 flat angles C4'-P-C4' energy: -99.436 flat angles P-C4'-P energy: -60.430 tors. eta vs tors. theta energy: -10.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -621.076075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.076075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.076075 (E_RNA) where: Base-Base interactions energy: -205.219 where: short stacking energy: -160.439 Base-Backbone interact. energy: 1.110 local terms energy: -416.967261 where: bonds (distance) C4'-P energy: -120.994 bonds (distance) P-C4' energy: -138.496 flat angles C4'-P-C4' energy: -108.938 flat angles P-C4'-P energy: -77.457 tors. eta vs tors. theta energy: 28.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -692.721119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.721119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.721119 (E_RNA) where: Base-Base interactions energy: -240.419 where: short stacking energy: -178.486 Base-Backbone interact. energy: 6.322 local terms energy: -458.623663 where: bonds (distance) C4'-P energy: -131.576 bonds (distance) P-C4' energy: -136.279 flat angles C4'-P-C4' energy: -124.952 flat angles P-C4'-P energy: -70.872 tors. eta vs tors. theta energy: 5.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1372.548107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.548107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.548107 (E_RNA) where: Base-Base interactions energy: -680.988 where: short stacking energy: -576.719 Base-Backbone interact. energy: -2.505 local terms energy: -689.055210 where: bonds (distance) C4'-P energy: -160.452 bonds (distance) P-C4' energy: -144.696 flat angles C4'-P-C4' energy: -161.058 flat angles P-C4'-P energy: -84.943 tors. eta vs tors. theta energy: -137.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1380.996062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.996062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.996062 (E_RNA) where: Base-Base interactions energy: -705.921 where: short stacking energy: -488.549 Base-Backbone interact. energy: -2.912 local terms energy: -672.162921 where: bonds (distance) C4'-P energy: -140.255 bonds (distance) P-C4' energy: -160.650 flat angles C4'-P-C4' energy: -160.076 flat angles P-C4'-P energy: -97.337 tors. eta vs tors. theta energy: -113.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1141.090589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.090589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.090589 (E_RNA) where: Base-Base interactions energy: -550.122 where: short stacking energy: -449.971 Base-Backbone interact. energy: 0.269 local terms energy: -591.237796 where: bonds (distance) C4'-P energy: -131.009 bonds (distance) P-C4' energy: -142.252 flat angles C4'-P-C4' energy: -140.500 flat angles P-C4'-P energy: -75.660 tors. eta vs tors. theta energy: -101.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1143.630953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.630953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.630953 (E_RNA) where: Base-Base interactions energy: -553.507 where: short stacking energy: -440.679 Base-Backbone interact. energy: -0.387 local terms energy: -589.736793 where: bonds (distance) C4'-P energy: -148.755 bonds (distance) P-C4' energy: -144.911 flat angles C4'-P-C4' energy: -145.811 flat angles P-C4'-P energy: -74.727 tors. eta vs tors. theta energy: -75.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -963.827249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.827249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.827249 (E_RNA) where: Base-Base interactions energy: -441.576 where: short stacking energy: -350.010 Base-Backbone interact. energy: 0.739 local terms energy: -522.990210 where: bonds (distance) C4'-P energy: -133.947 bonds (distance) P-C4' energy: -139.556 flat angles C4'-P-C4' energy: -130.176 flat angles P-C4'-P energy: -73.263 tors. eta vs tors. theta energy: -46.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1015.535522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.535522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.535522 (E_RNA) where: Base-Base interactions energy: -481.163 where: short stacking energy: -304.424 Base-Backbone interact. energy: 0.823 local terms energy: -535.194957 where: bonds (distance) C4'-P energy: -139.110 bonds (distance) P-C4' energy: -144.047 flat angles C4'-P-C4' energy: -108.472 flat angles P-C4'-P energy: -88.999 tors. eta vs tors. theta energy: -54.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -786.639458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.639458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.639458 (E_RNA) where: Base-Base interactions energy: -335.697 where: short stacking energy: -279.783 Base-Backbone interact. energy: -1.911 local terms energy: -449.031494 where: bonds (distance) C4'-P energy: -101.518 bonds (distance) P-C4' energy: -135.722 flat angles C4'-P-C4' energy: -120.690 flat angles P-C4'-P energy: -73.683 tors. eta vs tors. theta energy: -17.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -744.943499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.943499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.943499 (E_RNA) where: Base-Base interactions energy: -325.345 where: short stacking energy: -246.200 Base-Backbone interact. energy: 2.290 local terms energy: -421.888303 where: bonds (distance) C4'-P energy: -119.876 bonds (distance) P-C4' energy: -126.076 flat angles C4'-P-C4' energy: -96.607 flat angles P-C4'-P energy: -74.576 tors. eta vs tors. theta energy: -4.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -680.808175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.808175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.808175 (E_RNA) where: Base-Base interactions energy: -284.935 where: short stacking energy: -203.441 Base-Backbone interact. energy: -2.057 local terms energy: -393.816878 where: bonds (distance) C4'-P energy: -103.399 bonds (distance) P-C4' energy: -136.602 flat angles C4'-P-C4' energy: -110.124 flat angles P-C4'-P energy: -63.862 tors. eta vs tors. theta energy: 20.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -648.520685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.520685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.520685 (E_RNA) where: Base-Base interactions energy: -271.790 where: short stacking energy: -196.035 Base-Backbone interact. energy: 2.336 local terms energy: -379.066490 where: bonds (distance) C4'-P energy: -113.566 bonds (distance) P-C4' energy: -104.218 flat angles C4'-P-C4' energy: -109.343 flat angles P-C4'-P energy: -66.576 tors. eta vs tors. theta energy: 14.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1535.735678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.735678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.735678 (E_RNA) where: Base-Base interactions energy: -840.468 where: short stacking energy: -605.220 Base-Backbone interact. energy: 0.390 local terms energy: -695.657127 where: bonds (distance) C4'-P energy: -147.997 bonds (distance) P-C4' energy: -149.571 flat angles C4'-P-C4' energy: -155.044 flat angles P-C4'-P energy: -89.221 tors. eta vs tors. theta energy: -153.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1356.021936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.021936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.021936 (E_RNA) where: Base-Base interactions energy: -679.961 where: short stacking energy: -522.015 Base-Backbone interact. energy: 1.482 local terms energy: -677.543132 where: bonds (distance) C4'-P energy: -153.153 bonds (distance) P-C4' energy: -146.487 flat angles C4'-P-C4' energy: -157.667 flat angles P-C4'-P energy: -91.840 tors. eta vs tors. theta energy: -128.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1250.025232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.025232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.025232 (E_RNA) where: Base-Base interactions energy: -636.679 where: short stacking energy: -417.886 Base-Backbone interact. energy: -4.075 local terms energy: -609.271345 where: bonds (distance) C4'-P energy: -143.349 bonds (distance) P-C4' energy: -136.452 flat angles C4'-P-C4' energy: -151.845 flat angles P-C4'-P energy: -88.243 tors. eta vs tors. theta energy: -89.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1155.837599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.837599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.837599 (E_RNA) where: Base-Base interactions energy: -574.689 where: short stacking energy: -430.681 Base-Backbone interact. energy: 1.584 local terms energy: -582.732755 where: bonds (distance) C4'-P energy: -128.002 bonds (distance) P-C4' energy: -132.767 flat angles C4'-P-C4' energy: -149.493 flat angles P-C4'-P energy: -85.207 tors. eta vs tors. theta energy: -87.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1135.172097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.172097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.172097 (E_RNA) where: Base-Base interactions energy: -584.681 where: short stacking energy: -381.342 Base-Backbone interact. energy: 1.241 local terms energy: -551.731608 where: bonds (distance) C4'-P energy: -139.983 bonds (distance) P-C4' energy: -125.332 flat angles C4'-P-C4' energy: -131.952 flat angles P-C4'-P energy: -77.788 tors. eta vs tors. theta energy: -76.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -893.611553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.611553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.611553 (E_RNA) where: Base-Base interactions energy: -415.724 where: short stacking energy: -309.054 Base-Backbone interact. energy: 2.649 local terms energy: -480.536381 where: bonds (distance) C4'-P energy: -115.687 bonds (distance) P-C4' energy: -134.512 flat angles C4'-P-C4' energy: -125.330 flat angles P-C4'-P energy: -63.342 tors. eta vs tors. theta energy: -41.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -742.866636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.866636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.866636 (E_RNA) where: Base-Base interactions energy: -302.871 where: short stacking energy: -209.810 Base-Backbone interact. energy: 2.246 local terms energy: -442.241728 where: bonds (distance) C4'-P energy: -124.018 bonds (distance) P-C4' energy: -118.579 flat angles C4'-P-C4' energy: -127.165 flat angles P-C4'-P energy: -86.179 tors. eta vs tors. theta energy: 13.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -770.907450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.907450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.907450 (E_RNA) where: Base-Base interactions energy: -304.945 where: short stacking energy: -235.958 Base-Backbone interact. energy: 2.662 local terms energy: -468.624040 where: bonds (distance) C4'-P energy: -144.526 bonds (distance) P-C4' energy: -135.024 flat angles C4'-P-C4' energy: -115.052 flat angles P-C4'-P energy: -66.482 tors. eta vs tors. theta energy: -7.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -642.284194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.284194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.284194 (E_RNA) where: Base-Base interactions energy: -221.400 where: short stacking energy: -169.236 Base-Backbone interact. energy: -1.213 local terms energy: -419.671658 where: bonds (distance) C4'-P energy: -125.305 bonds (distance) P-C4' energy: -127.332 flat angles C4'-P-C4' energy: -114.370 flat angles P-C4'-P energy: -68.534 tors. eta vs tors. theta energy: 15.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -663.978428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.978428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.978428 (E_RNA) where: Base-Base interactions energy: -292.405 where: short stacking energy: -186.342 Base-Backbone interact. energy: 1.591 local terms energy: -373.165285 where: bonds (distance) C4'-P energy: -107.203 bonds (distance) P-C4' energy: -121.180 flat angles C4'-P-C4' energy: -105.211 flat angles P-C4'-P energy: -72.180 tors. eta vs tors. theta energy: 32.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1565.886198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.886198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.886198 (E_RNA) where: Base-Base interactions energy: -853.179 where: short stacking energy: -589.999 Base-Backbone interact. energy: -2.813 local terms energy: -709.894120 where: bonds (distance) C4'-P energy: -150.534 bonds (distance) P-C4' energy: -145.865 flat angles C4'-P-C4' energy: -161.659 flat angles P-C4'-P energy: -101.524 tors. eta vs tors. theta energy: -150.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1393.681721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.681721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.681721 (E_RNA) where: Base-Base interactions energy: -733.245 where: short stacking energy: -532.419 Base-Backbone interact. energy: -0.613 local terms energy: -660.101887 where: bonds (distance) C4'-P energy: -150.675 bonds (distance) P-C4' energy: -143.927 flat angles C4'-P-C4' energy: -154.466 flat angles P-C4'-P energy: -89.945 tors. eta vs tors. theta energy: -121.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.278 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1264.708383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.708383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.708383 (E_RNA) where: Base-Base interactions energy: -657.079 where: short stacking energy: -449.697 Base-Backbone interact. energy: -2.000 local terms energy: -605.630118 where: bonds (distance) C4'-P energy: -136.003 bonds (distance) P-C4' energy: -148.003 flat angles C4'-P-C4' energy: -133.602 flat angles P-C4'-P energy: -91.798 tors. eta vs tors. theta energy: -96.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1143.170434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.170434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.170434 (E_RNA) where: Base-Base interactions energy: -570.731 where: short stacking energy: -454.991 Base-Backbone interact. energy: -0.615 local terms energy: -571.824737 where: bonds (distance) C4'-P energy: -123.407 bonds (distance) P-C4' energy: -130.675 flat angles C4'-P-C4' energy: -140.651 flat angles P-C4'-P energy: -95.636 tors. eta vs tors. theta energy: -81.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1103.327941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.327941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.327941 (E_RNA) where: Base-Base interactions energy: -578.907 where: short stacking energy: -376.167 Base-Backbone interact. energy: 0.708 local terms energy: -525.128811 where: bonds (distance) C4'-P energy: -119.098 bonds (distance) P-C4' energy: -126.121 flat angles C4'-P-C4' energy: -129.696 flat angles P-C4'-P energy: -101.038 tors. eta vs tors. theta energy: -49.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -874.642222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.642222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.642222 (E_RNA) where: Base-Base interactions energy: -364.830 where: short stacking energy: -280.501 Base-Backbone interact. energy: -2.431 local terms energy: -507.381236 where: bonds (distance) C4'-P energy: -138.739 bonds (distance) P-C4' energy: -140.289 flat angles C4'-P-C4' energy: -113.348 flat angles P-C4'-P energy: -89.872 tors. eta vs tors. theta energy: -25.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -789.247871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.247871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.247871 (E_RNA) where: Base-Base interactions energy: -295.931 where: short stacking energy: -257.061 Base-Backbone interact. energy: -1.637 local terms energy: -491.679524 where: bonds (distance) C4'-P energy: -144.056 bonds (distance) P-C4' energy: -115.473 flat angles C4'-P-C4' energy: -124.934 flat angles P-C4'-P energy: -76.419 tors. eta vs tors. theta energy: -30.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -710.038358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.038358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.038358 (E_RNA) where: Base-Base interactions energy: -276.855 where: short stacking energy: -211.433 Base-Backbone interact. energy: 3.408 local terms energy: -436.592059 where: bonds (distance) C4'-P energy: -117.639 bonds (distance) P-C4' energy: -116.371 flat angles C4'-P-C4' energy: -126.405 flat angles P-C4'-P energy: -76.186 tors. eta vs tors. theta energy: 0.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -716.097373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.097373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.097373 (E_RNA) where: Base-Base interactions energy: -325.218 where: short stacking energy: -205.844 Base-Backbone interact. energy: -0.100 local terms energy: -390.779921 where: bonds (distance) C4'-P energy: -95.595 bonds (distance) P-C4' energy: -135.496 flat angles C4'-P-C4' energy: -102.768 flat angles P-C4'-P energy: -64.710 tors. eta vs tors. theta energy: 7.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -725.276165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.276165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.276165 (E_RNA) where: Base-Base interactions energy: -380.040 where: short stacking energy: -239.988 Base-Backbone interact. energy: 10.393 local terms energy: -355.629537 where: bonds (distance) C4'-P energy: -89.609 bonds (distance) P-C4' energy: -129.413 flat angles C4'-P-C4' energy: -119.157 flat angles P-C4'-P energy: -34.342 tors. eta vs tors. theta energy: 16.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1558.457687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.457687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.457687 (E_RNA) where: Base-Base interactions energy: -862.852 where: short stacking energy: -570.801 Base-Backbone interact. energy: 1.027 local terms energy: -696.633063 where: bonds (distance) C4'-P energy: -156.928 bonds (distance) P-C4' energy: -146.252 flat angles C4'-P-C4' energy: -163.695 flat angles P-C4'-P energy: -94.819 tors. eta vs tors. theta energy: -134.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1373.971261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.971261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.971261 (E_RNA) where: Base-Base interactions energy: -722.996 where: short stacking energy: -521.672 Base-Backbone interact. energy: -0.321 local terms energy: -650.654832 where: bonds (distance) C4'-P energy: -158.670 bonds (distance) P-C4' energy: -147.095 flat angles C4'-P-C4' energy: -144.097 flat angles P-C4'-P energy: -79.296 tors. eta vs tors. theta energy: -121.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1357.607398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.607398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.607398 (E_RNA) where: Base-Base interactions energy: -752.101 where: short stacking energy: -452.271 Base-Backbone interact. energy: -1.674 local terms energy: -603.832399 where: bonds (distance) C4'-P energy: -144.449 bonds (distance) P-C4' energy: -144.841 flat angles C4'-P-C4' energy: -128.350 flat angles P-C4'-P energy: -95.339 tors. eta vs tors. theta energy: -90.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1067.066908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.066908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.066908 (E_RNA) where: Base-Base interactions energy: -497.415 where: short stacking energy: -381.222 Base-Backbone interact. energy: -1.382 local terms energy: -568.270254 where: bonds (distance) C4'-P energy: -130.546 bonds (distance) P-C4' energy: -147.177 flat angles C4'-P-C4' energy: -129.723 flat angles P-C4'-P energy: -84.977 tors. eta vs tors. theta energy: -75.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1137.767990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.767990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.767990 (E_RNA) where: Base-Base interactions energy: -567.425 where: short stacking energy: -351.423 Base-Backbone interact. energy: -1.331 local terms energy: -569.011595 where: bonds (distance) C4'-P energy: -132.486 bonds (distance) P-C4' energy: -152.446 flat angles C4'-P-C4' energy: -126.313 flat angles P-C4'-P energy: -92.670 tors. eta vs tors. theta energy: -65.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -861.907767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.907767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.907767 (E_RNA) where: Base-Base interactions energy: -369.557 where: short stacking energy: -282.364 Base-Backbone interact. energy: 3.110 local terms energy: -495.460738 where: bonds (distance) C4'-P energy: -125.471 bonds (distance) P-C4' energy: -146.345 flat angles C4'-P-C4' energy: -121.602 flat angles P-C4'-P energy: -77.177 tors. eta vs tors. theta energy: -24.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -820.880737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.880737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.880737 (E_RNA) where: Base-Base interactions energy: -357.861 where: short stacking energy: -284.209 Base-Backbone interact. energy: -2.177 local terms energy: -460.842682 where: bonds (distance) C4'-P energy: -119.306 bonds (distance) P-C4' energy: -128.412 flat angles C4'-P-C4' energy: -120.908 flat angles P-C4'-P energy: -72.413 tors. eta vs tors. theta energy: -19.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -761.158359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.158359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.158359 (E_RNA) where: Base-Base interactions energy: -339.725 where: short stacking energy: -240.592 Base-Backbone interact. energy: 1.166 local terms energy: -422.598632 where: bonds (distance) C4'-P energy: -132.663 bonds (distance) P-C4' energy: -130.661 flat angles C4'-P-C4' energy: -125.505 flat angles P-C4'-P energy: -42.536 tors. eta vs tors. theta energy: 8.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -762.031375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.031375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.031375 (E_RNA) where: Base-Base interactions energy: -344.979 where: short stacking energy: -205.947 Base-Backbone interact. energy: 1.044 local terms energy: -418.096307 where: bonds (distance) C4'-P energy: -129.195 bonds (distance) P-C4' energy: -107.113 flat angles C4'-P-C4' energy: -113.505 flat angles P-C4'-P energy: -70.857 tors. eta vs tors. theta energy: 2.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -708.686207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.686207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.686207 (E_RNA) where: Base-Base interactions energy: -307.216 where: short stacking energy: -209.808 Base-Backbone interact. energy: -0.762 local terms energy: -400.708309 where: bonds (distance) C4'-P energy: -135.490 bonds (distance) P-C4' energy: -110.706 flat angles C4'-P-C4' energy: -107.863 flat angles P-C4'-P energy: -55.128 tors. eta vs tors. theta energy: 8.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1625.399159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.399159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.399159 (E_RNA) where: Base-Base interactions energy: -939.494 where: short stacking energy: -591.592 Base-Backbone interact. energy: -0.056 local terms energy: -685.849613 where: bonds (distance) C4'-P energy: -130.720 bonds (distance) P-C4' energy: -142.713 flat angles C4'-P-C4' energy: -170.055 flat angles P-C4'-P energy: -100.835 tors. eta vs tors. theta energy: -141.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1475.699647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.699647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.699647 (E_RNA) where: Base-Base interactions energy: -824.180 where: short stacking energy: -504.428 Base-Backbone interact. energy: -2.622 local terms energy: -648.897109 where: bonds (distance) C4'-P energy: -152.048 bonds (distance) P-C4' energy: -149.017 flat angles C4'-P-C4' energy: -142.885 flat angles P-C4'-P energy: -90.507 tors. eta vs tors. theta energy: -114.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1265.640495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.640495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.640495 (E_RNA) where: Base-Base interactions energy: -653.921 where: short stacking energy: -442.190 Base-Backbone interact. energy: -0.955 local terms energy: -610.764313 where: bonds (distance) C4'-P energy: -146.449 bonds (distance) P-C4' energy: -162.201 flat angles C4'-P-C4' energy: -134.336 flat angles P-C4'-P energy: -71.928 tors. eta vs tors. theta energy: -95.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1213.782045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.782045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.782045 (E_RNA) where: Base-Base interactions energy: -637.990 where: short stacking energy: -404.064 Base-Backbone interact. energy: 2.346 local terms energy: -578.138014 where: bonds (distance) C4'-P energy: -145.127 bonds (distance) P-C4' energy: -149.724 flat angles C4'-P-C4' energy: -146.985 flat angles P-C4'-P energy: -76.164 tors. eta vs tors. theta energy: -60.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1059.421274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.421274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.421274 (E_RNA) where: Base-Base interactions energy: -550.658 where: short stacking energy: -353.460 Base-Backbone interact. energy: -2.254 local terms energy: -506.509346 where: bonds (distance) C4'-P energy: -132.498 bonds (distance) P-C4' energy: -142.627 flat angles C4'-P-C4' energy: -129.894 flat angles P-C4'-P energy: -57.720 tors. eta vs tors. theta energy: -43.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1007.938486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.938486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.938486 (E_RNA) where: Base-Base interactions energy: -518.119 where: short stacking energy: -337.084 Base-Backbone interact. energy: 1.671 local terms energy: -491.490131 where: bonds (distance) C4'-P energy: -125.959 bonds (distance) P-C4' energy: -135.929 flat angles C4'-P-C4' energy: -120.667 flat angles P-C4'-P energy: -66.840 tors. eta vs tors. theta energy: -42.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -845.597525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.597525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.597525 (E_RNA) where: Base-Base interactions energy: -401.900 where: short stacking energy: -275.276 Base-Backbone interact. energy: -3.055 local terms energy: -440.642146 where: bonds (distance) C4'-P energy: -128.005 bonds (distance) P-C4' energy: -111.947 flat angles C4'-P-C4' energy: -107.287 flat angles P-C4'-P energy: -73.136 tors. eta vs tors. theta energy: -20.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -836.569185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.569185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.569185 (E_RNA) where: Base-Base interactions energy: -375.965 where: short stacking energy: -252.089 Base-Backbone interact. energy: -0.359 local terms energy: -460.244812 where: bonds (distance) C4'-P energy: -135.397 bonds (distance) P-C4' energy: -129.376 flat angles C4'-P-C4' energy: -124.520 flat angles P-C4'-P energy: -66.800 tors. eta vs tors. theta energy: -4.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -717.233528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.233528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.233528 (E_RNA) where: Base-Base interactions energy: -327.437 where: short stacking energy: -228.901 Base-Backbone interact. energy: -0.694 local terms energy: -389.102989 where: bonds (distance) C4'-P energy: -123.724 bonds (distance) P-C4' energy: -128.751 flat angles C4'-P-C4' energy: -88.357 flat angles P-C4'-P energy: -60.064 tors. eta vs tors. theta energy: 11.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -664.216265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.216265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.216265 (E_RNA) where: Base-Base interactions energy: -279.814 where: short stacking energy: -207.566 Base-Backbone interact. energy: 1.887 local terms energy: -386.289163 where: bonds (distance) C4'-P energy: -114.304 bonds (distance) P-C4' energy: -105.212 flat angles C4'-P-C4' energy: -105.773 flat angles P-C4'-P energy: -70.128 tors. eta vs tors. theta energy: 9.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1654.475137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.475137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.475137 (E_RNA) where: Base-Base interactions energy: -947.218 where: short stacking energy: -590.078 Base-Backbone interact. energy: 0.845 local terms energy: -708.102554 where: bonds (distance) C4'-P energy: -138.162 bonds (distance) P-C4' energy: -160.290 flat angles C4'-P-C4' energy: -153.944 flat angles P-C4'-P energy: -114.378 tors. eta vs tors. theta energy: -141.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1555.054254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.054254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.054254 (E_RNA) where: Base-Base interactions energy: -903.318 where: short stacking energy: -532.982 Base-Backbone interact. energy: -4.280 local terms energy: -647.457003 where: bonds (distance) C4'-P energy: -150.571 bonds (distance) P-C4' energy: -124.019 flat angles C4'-P-C4' energy: -167.973 flat angles P-C4'-P energy: -85.485 tors. eta vs tors. theta energy: -119.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1343.816762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.816762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.816762 (E_RNA) where: Base-Base interactions energy: -708.132 where: short stacking energy: -462.890 Base-Backbone interact. energy: 0.212 local terms energy: -635.897189 where: bonds (distance) C4'-P energy: -133.690 bonds (distance) P-C4' energy: -137.983 flat angles C4'-P-C4' energy: -146.423 flat angles P-C4'-P energy: -113.765 tors. eta vs tors. theta energy: -104.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1278.662596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.662596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.662596 (E_RNA) where: Base-Base interactions energy: -696.374 where: short stacking energy: -442.897 Base-Backbone interact. energy: -0.274 local terms energy: -582.015023 where: bonds (distance) C4'-P energy: -132.150 bonds (distance) P-C4' energy: -127.467 flat angles C4'-P-C4' energy: -154.185 flat angles P-C4'-P energy: -85.468 tors. eta vs tors. theta energy: -82.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1307.812604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.812604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.812604 (E_RNA) where: Base-Base interactions energy: -767.722 where: short stacking energy: -433.776 Base-Backbone interact. energy: 10.561 local terms energy: -550.651515 where: bonds (distance) C4'-P energy: -109.842 bonds (distance) P-C4' energy: -151.502 flat angles C4'-P-C4' energy: -140.330 flat angles P-C4'-P energy: -81.953 tors. eta vs tors. theta energy: -67.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -984.849966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.849966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.849966 (E_RNA) where: Base-Base interactions energy: -477.855 where: short stacking energy: -341.003 Base-Backbone interact. energy: 4.164 local terms energy: -511.158230 where: bonds (distance) C4'-P energy: -132.701 bonds (distance) P-C4' energy: -138.292 flat angles C4'-P-C4' energy: -125.531 flat angles P-C4'-P energy: -72.312 tors. eta vs tors. theta energy: -42.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -921.297994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.297994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.297994 (E_RNA) where: Base-Base interactions energy: -477.182 where: short stacking energy: -289.229 Base-Backbone interact. energy: -2.667 local terms energy: -441.448403 where: bonds (distance) C4'-P energy: -122.223 bonds (distance) P-C4' energy: -129.321 flat angles C4'-P-C4' energy: -115.355 flat angles P-C4'-P energy: -63.034 tors. eta vs tors. theta energy: -11.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -754.726261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.726261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.726261 (E_RNA) where: Base-Base interactions energy: -334.060 where: short stacking energy: -223.974 Base-Backbone interact. energy: -0.944 local terms energy: -419.722403 where: bonds (distance) C4'-P energy: -129.457 bonds (distance) P-C4' energy: -132.704 flat angles C4'-P-C4' energy: -103.487 flat angles P-C4'-P energy: -54.330 tors. eta vs tors. theta energy: 0.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -821.437588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.437588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.437588 (E_RNA) where: Base-Base interactions energy: -410.187 where: short stacking energy: -241.874 Base-Backbone interact. energy: 0.741 local terms energy: -411.991026 where: bonds (distance) C4'-P energy: -126.822 bonds (distance) P-C4' energy: -124.976 flat angles C4'-P-C4' energy: -120.518 flat angles P-C4'-P energy: -44.721 tors. eta vs tors. theta energy: 5.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -637.447504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.447504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.447504 (E_RNA) where: Base-Base interactions energy: -292.175 where: short stacking energy: -202.823 Base-Backbone interact. energy: -3.318 local terms energy: -341.953836 where: bonds (distance) C4'-P energy: -91.278 bonds (distance) P-C4' energy: -149.336 flat angles C4'-P-C4' energy: -79.661 flat angles P-C4'-P energy: -60.295 tors. eta vs tors. theta energy: 38.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1651.723952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.723952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.723952 (E_RNA) where: Base-Base interactions energy: -989.153 where: short stacking energy: -565.722 Base-Backbone interact. energy: -2.770 local terms energy: -659.800224 where: bonds (distance) C4'-P energy: -144.959 bonds (distance) P-C4' energy: -150.195 flat angles C4'-P-C4' energy: -150.146 flat angles P-C4'-P energy: -89.022 tors. eta vs tors. theta energy: -125.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1572.640025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.640025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.640025 (E_RNA) where: Base-Base interactions energy: -913.166 where: short stacking energy: -547.101 Base-Backbone interact. energy: 0.054 local terms energy: -659.528406 where: bonds (distance) C4'-P energy: -146.248 bonds (distance) P-C4' energy: -153.588 flat angles C4'-P-C4' energy: -147.642 flat angles P-C4'-P energy: -93.037 tors. eta vs tors. theta energy: -119.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1363.367749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.367749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.367749 (E_RNA) where: Base-Base interactions energy: -728.711 where: short stacking energy: -476.028 Base-Backbone interact. energy: -3.422 local terms energy: -631.235588 where: bonds (distance) C4'-P energy: -137.606 bonds (distance) P-C4' energy: -144.369 flat angles C4'-P-C4' energy: -157.727 flat angles P-C4'-P energy: -82.748 tors. eta vs tors. theta energy: -108.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1432.947449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.947449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.947449 (E_RNA) where: Base-Base interactions energy: -841.931 where: short stacking energy: -490.553 Base-Backbone interact. energy: 0.546 local terms energy: -591.562773 where: bonds (distance) C4'-P energy: -126.727 bonds (distance) P-C4' energy: -138.415 flat angles C4'-P-C4' energy: -149.994 flat angles P-C4'-P energy: -71.121 tors. eta vs tors. theta energy: -105.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1377.454712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.454712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.454712 (E_RNA) where: Base-Base interactions energy: -801.859 where: short stacking energy: -412.812 Base-Backbone interact. energy: -0.344 local terms energy: -575.251869 where: bonds (distance) C4'-P energy: -131.605 bonds (distance) P-C4' energy: -143.323 flat angles C4'-P-C4' energy: -137.909 flat angles P-C4'-P energy: -79.796 tors. eta vs tors. theta energy: -82.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1055.884252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.884252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.884252 (E_RNA) where: Base-Base interactions energy: -569.666 where: short stacking energy: -350.217 Base-Backbone interact. energy: 0.651 local terms energy: -486.869252 where: bonds (distance) C4'-P energy: -127.609 bonds (distance) P-C4' energy: -131.638 flat angles C4'-P-C4' energy: -114.142 flat angles P-C4'-P energy: -75.654 tors. eta vs tors. theta energy: -37.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -958.187072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.187072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.187072 (E_RNA) where: Base-Base interactions energy: -493.855 where: short stacking energy: -321.364 Base-Backbone interact. energy: 1.405 local terms energy: -465.737104 where: bonds (distance) C4'-P energy: -115.814 bonds (distance) P-C4' energy: -132.217 flat angles C4'-P-C4' energy: -113.063 flat angles P-C4'-P energy: -70.181 tors. eta vs tors. theta energy: -34.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -998.936252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.936252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.936252 (E_RNA) where: Base-Base interactions energy: -581.197 where: short stacking energy: -329.305 Base-Backbone interact. energy: 5.139 local terms energy: -422.877443 where: bonds (distance) C4'-P energy: -110.214 bonds (distance) P-C4' energy: -107.815 flat angles C4'-P-C4' energy: -109.276 flat angles P-C4'-P energy: -76.397 tors. eta vs tors. theta energy: -19.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -712.068543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.068543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.068543 (E_RNA) where: Base-Base interactions energy: -323.751 where: short stacking energy: -247.368 Base-Backbone interact. energy: 0.667 local terms energy: -388.985207 where: bonds (distance) C4'-P energy: -115.849 bonds (distance) P-C4' energy: -107.622 flat angles C4'-P-C4' energy: -97.557 flat angles P-C4'-P energy: -72.320 tors. eta vs tors. theta energy: 4.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -595.482323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.482323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.482323 (E_RNA) where: Base-Base interactions energy: -221.365 where: short stacking energy: -153.689 Base-Backbone interact. energy: 6.751 local terms energy: -380.867959 where: bonds (distance) C4'-P energy: -93.940 bonds (distance) P-C4' energy: -123.528 flat angles C4'-P-C4' energy: -124.445 flat angles P-C4'-P energy: -57.964 tors. eta vs tors. theta energy: 19.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1706.691347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.691347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.691347 (E_RNA) where: Base-Base interactions energy: -1038.997 where: short stacking energy: -572.915 Base-Backbone interact. energy: -2.254 local terms energy: -665.440623 where: bonds (distance) C4'-P energy: -141.317 bonds (distance) P-C4' energy: -156.318 flat angles C4'-P-C4' energy: -147.443 flat angles P-C4'-P energy: -89.103 tors. eta vs tors. theta energy: -131.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1646.498526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.498526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.498526 (E_RNA) where: Base-Base interactions energy: -970.148 where: short stacking energy: -561.534 Base-Backbone interact. energy: -1.213 local terms energy: -675.137748 where: bonds (distance) C4'-P energy: -137.212 bonds (distance) P-C4' energy: -156.837 flat angles C4'-P-C4' energy: -144.978 flat angles P-C4'-P energy: -96.593 tors. eta vs tors. theta energy: -139.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1419.820632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.820632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.820632 (E_RNA) where: Base-Base interactions energy: -781.429 where: short stacking energy: -485.648 Base-Backbone interact. energy: -3.024 local terms energy: -635.368096 where: bonds (distance) C4'-P energy: -143.527 bonds (distance) P-C4' energy: -142.486 flat angles C4'-P-C4' energy: -149.424 flat angles P-C4'-P energy: -92.679 tors. eta vs tors. theta energy: -107.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1458.615558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.615558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.615558 (E_RNA) where: Base-Base interactions energy: -857.970 where: short stacking energy: -435.376 Base-Backbone interact. energy: -0.258 local terms energy: -600.387308 where: bonds (distance) C4'-P energy: -153.786 bonds (distance) P-C4' energy: -128.897 flat angles C4'-P-C4' energy: -132.245 flat angles P-C4'-P energy: -84.306 tors. eta vs tors. theta energy: -101.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1471.265939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.265939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.265939 (E_RNA) where: Base-Base interactions energy: -881.750 where: short stacking energy: -478.040 Base-Backbone interact. energy: -3.013 local terms energy: -586.503440 where: bonds (distance) C4'-P energy: -128.059 bonds (distance) P-C4' energy: -126.708 flat angles C4'-P-C4' energy: -138.107 flat angles P-C4'-P energy: -84.781 tors. eta vs tors. theta energy: -108.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1011.602524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.602524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.602524 (E_RNA) where: Base-Base interactions energy: -550.541 where: short stacking energy: -335.548 Base-Backbone interact. energy: -1.972 local terms energy: -459.089178 where: bonds (distance) C4'-P energy: -116.800 bonds (distance) P-C4' energy: -121.234 flat angles C4'-P-C4' energy: -131.648 flat angles P-C4'-P energy: -71.602 tors. eta vs tors. theta energy: -17.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -998.261067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.261067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.261067 (E_RNA) where: Base-Base interactions energy: -538.116 where: short stacking energy: -327.525 Base-Backbone interact. energy: -2.454 local terms energy: -457.690364 where: bonds (distance) C4'-P energy: -104.781 bonds (distance) P-C4' energy: -124.750 flat angles C4'-P-C4' energy: -117.311 flat angles P-C4'-P energy: -66.199 tors. eta vs tors. theta energy: -44.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -995.215923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.215923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.215923 (E_RNA) where: Base-Base interactions energy: -511.122 where: short stacking energy: -292.054 Base-Backbone interact. energy: -0.925 local terms energy: -483.168519 where: bonds (distance) C4'-P energy: -122.785 bonds (distance) P-C4' energy: -140.206 flat angles C4'-P-C4' energy: -120.426 flat angles P-C4'-P energy: -76.794 tors. eta vs tors. theta energy: -22.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -655.216929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.216929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.216929 (E_RNA) where: Base-Base interactions energy: -236.528 where: short stacking energy: -211.802 Base-Backbone interact. energy: -1.804 local terms energy: -416.884850 where: bonds (distance) C4'-P energy: -99.323 bonds (distance) P-C4' energy: -150.056 flat angles C4'-P-C4' energy: -89.692 flat angles P-C4'-P energy: -80.346 tors. eta vs tors. theta energy: 2.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -635.495148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.495148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.495148 (E_RNA) where: Base-Base interactions energy: -238.314 where: short stacking energy: -163.470 Base-Backbone interact. energy: 1.378 local terms energy: -398.558595 where: bonds (distance) C4'-P energy: -103.131 bonds (distance) P-C4' energy: -141.269 flat angles C4'-P-C4' energy: -109.065 flat angles P-C4'-P energy: -74.442 tors. eta vs tors. theta energy: 29.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1757.760653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1757.760653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.760653 (E_RNA) where: Base-Base interactions energy: -1071.075 where: short stacking energy: -570.156 Base-Backbone interact. energy: -0.175 local terms energy: -686.510884 where: bonds (distance) C4'-P energy: -140.155 bonds (distance) P-C4' energy: -154.275 flat angles C4'-P-C4' energy: -150.441 flat angles P-C4'-P energy: -100.045 tors. eta vs tors. theta energy: -141.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1640.202507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.202507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.202507 (E_RNA) where: Base-Base interactions energy: -960.900 where: short stacking energy: -570.425 Base-Backbone interact. energy: -1.049 local terms energy: -678.252877 where: bonds (distance) C4'-P energy: -135.107 bonds (distance) P-C4' energy: -159.844 flat angles C4'-P-C4' energy: -155.145 flat angles P-C4'-P energy: -93.109 tors. eta vs tors. theta energy: -135.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1403.982559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.982559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.982559 (E_RNA) where: Base-Base interactions energy: -751.326 where: short stacking energy: -456.099 Base-Backbone interact. energy: -0.891 local terms energy: -651.765112 where: bonds (distance) C4'-P energy: -153.779 bonds (distance) P-C4' energy: -145.604 flat angles C4'-P-C4' energy: -158.831 flat angles P-C4'-P energy: -89.433 tors. eta vs tors. theta energy: -104.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1643.642048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.642048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.642048 (E_RNA) where: Base-Base interactions energy: -1020.070 where: short stacking energy: -525.040 Base-Backbone interact. energy: 0.890 local terms energy: -624.462102 where: bonds (distance) C4'-P energy: -105.066 bonds (distance) P-C4' energy: -144.746 flat angles C4'-P-C4' energy: -141.178 flat angles P-C4'-P energy: -86.101 tors. eta vs tors. theta energy: -147.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1409.030998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.030998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.030998 (E_RNA) where: Base-Base interactions energy: -802.797 where: short stacking energy: -431.338 Base-Backbone interact. energy: -1.123 local terms energy: -605.110431 where: bonds (distance) C4'-P energy: -140.827 bonds (distance) P-C4' energy: -147.161 flat angles C4'-P-C4' energy: -142.981 flat angles P-C4'-P energy: -81.977 tors. eta vs tors. theta energy: -92.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1038.968906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.968906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.968906 (E_RNA) where: Base-Base interactions energy: -548.830 where: short stacking energy: -345.047 Base-Backbone interact. energy: -3.726 local terms energy: -486.412681 where: bonds (distance) C4'-P energy: -131.076 bonds (distance) P-C4' energy: -127.528 flat angles C4'-P-C4' energy: -107.938 flat angles P-C4'-P energy: -62.871 tors. eta vs tors. theta energy: -56.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -993.360435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.360435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.360435 (E_RNA) where: Base-Base interactions energy: -536.775 where: short stacking energy: -317.735 Base-Backbone interact. energy: 0.151 local terms energy: -456.736177 where: bonds (distance) C4'-P energy: -131.628 bonds (distance) P-C4' energy: -129.597 flat angles C4'-P-C4' energy: -120.943 flat angles P-C4'-P energy: -51.947 tors. eta vs tors. theta energy: -22.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -991.752162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.752162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.752162 (E_RNA) where: Base-Base interactions energy: -514.511 where: short stacking energy: -286.925 Base-Backbone interact. energy: 0.601 local terms energy: -477.841597 where: bonds (distance) C4'-P energy: -120.475 bonds (distance) P-C4' energy: -136.649 flat angles C4'-P-C4' energy: -121.314 flat angles P-C4'-P energy: -73.594 tors. eta vs tors. theta energy: -25.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -651.203056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.203056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.203056 (E_RNA) where: Base-Base interactions energy: -262.950 where: short stacking energy: -220.793 Base-Backbone interact. energy: 3.045 local terms energy: -391.298501 where: bonds (distance) C4'-P energy: -119.311 bonds (distance) P-C4' energy: -116.004 flat angles C4'-P-C4' energy: -96.754 flat angles P-C4'-P energy: -64.210 tors. eta vs tors. theta energy: 4.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -783.650265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.650265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.650265 (E_RNA) where: Base-Base interactions energy: -362.062 where: short stacking energy: -211.638 Base-Backbone interact. energy: 0.331 local terms energy: -421.919106 where: bonds (distance) C4'-P energy: -124.180 bonds (distance) P-C4' energy: -129.822 flat angles C4'-P-C4' energy: -123.232 flat angles P-C4'-P energy: -38.978 tors. eta vs tors. theta energy: -5.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1782.958069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1782.958069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.958069 (E_RNA) where: Base-Base interactions energy: -1063.235 where: short stacking energy: -588.877 Base-Backbone interact. energy: -2.522 local terms energy: -717.200708 where: bonds (distance) C4'-P energy: -152.125 bonds (distance) P-C4' energy: -161.009 flat angles C4'-P-C4' energy: -152.560 flat angles P-C4'-P energy: -94.184 tors. eta vs tors. theta energy: -157.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1682.934990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.934990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.934990 (E_RNA) where: Base-Base interactions energy: -981.723 where: short stacking energy: -592.403 Base-Backbone interact. energy: -3.129 local terms energy: -698.083543 where: bonds (distance) C4'-P energy: -150.603 bonds (distance) P-C4' energy: -151.565 flat angles C4'-P-C4' energy: -160.363 flat angles P-C4'-P energy: -87.788 tors. eta vs tors. theta energy: -147.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1809.439759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.439759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.439759 (E_RNA) where: Base-Base interactions energy: -1121.781 where: short stacking energy: -567.408 Base-Backbone interact. energy: -2.469 local terms energy: -685.190568 where: bonds (distance) C4'-P energy: -148.032 bonds (distance) P-C4' energy: -149.818 flat angles C4'-P-C4' energy: -147.801 flat angles P-C4'-P energy: -98.376 tors. eta vs tors. theta energy: -141.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1281.116922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.116922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.116922 (E_RNA) where: Base-Base interactions energy: -702.371 where: short stacking energy: -442.554 Base-Backbone interact. energy: -1.277 local terms energy: -577.469035 where: bonds (distance) C4'-P energy: -143.170 bonds (distance) P-C4' energy: -132.742 flat angles C4'-P-C4' energy: -122.255 flat angles P-C4'-P energy: -83.895 tors. eta vs tors. theta energy: -95.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1402.326850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.326850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.326850 (E_RNA) where: Base-Base interactions energy: -827.853 where: short stacking energy: -437.454 Base-Backbone interact. energy: 1.124 local terms energy: -575.597492 where: bonds (distance) C4'-P energy: -116.524 bonds (distance) P-C4' energy: -140.564 flat angles C4'-P-C4' energy: -136.548 flat angles P-C4'-P energy: -92.014 tors. eta vs tors. theta energy: -89.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1056.641778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.641778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.641778 (E_RNA) where: Base-Base interactions energy: -568.038 where: short stacking energy: -326.250 Base-Backbone interact. energy: 2.508 local terms energy: -491.111097 where: bonds (distance) C4'-P energy: -127.081 bonds (distance) P-C4' energy: -133.697 flat angles C4'-P-C4' energy: -100.669 flat angles P-C4'-P energy: -96.098 tors. eta vs tors. theta energy: -33.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1111.115494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.115494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.115494 (E_RNA) where: Base-Base interactions energy: -609.155 where: short stacking energy: -287.886 Base-Backbone interact. energy: -3.074 local terms energy: -498.887123 where: bonds (distance) C4'-P energy: -109.892 bonds (distance) P-C4' energy: -139.829 flat angles C4'-P-C4' energy: -143.613 flat angles P-C4'-P energy: -75.532 tors. eta vs tors. theta energy: -30.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -842.948077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.948077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.948077 (E_RNA) where: Base-Base interactions energy: -392.556 where: short stacking energy: -237.039 Base-Backbone interact. energy: 1.098 local terms energy: -451.490287 where: bonds (distance) C4'-P energy: -126.423 bonds (distance) P-C4' energy: -138.752 flat angles C4'-P-C4' energy: -112.979 flat angles P-C4'-P energy: -54.904 tors. eta vs tors. theta energy: -18.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -786.333151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.333151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.333151 (E_RNA) where: Base-Base interactions energy: -362.077 where: short stacking energy: -227.078 Base-Backbone interact. energy: 1.310 local terms energy: -425.565358 where: bonds (distance) C4'-P energy: -119.818 bonds (distance) P-C4' energy: -121.932 flat angles C4'-P-C4' energy: -101.959 flat angles P-C4'-P energy: -72.132 tors. eta vs tors. theta energy: -9.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -575.190609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.190609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.190609 (E_RNA) where: Base-Base interactions energy: -229.954 where: short stacking energy: -189.615 Base-Backbone interact. energy: 0.623 local terms energy: -345.859766 where: bonds (distance) C4'-P energy: -98.604 bonds (distance) P-C4' energy: -123.174 flat angles C4'-P-C4' energy: -93.776 flat angles P-C4'-P energy: -56.921 tors. eta vs tors. theta energy: 26.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1845.444692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.444692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.444692 (E_RNA) where: Base-Base interactions energy: -1129.752 where: short stacking energy: -640.461 Base-Backbone interact. energy: -2.630 local terms energy: -713.062286 where: bonds (distance) C4'-P energy: -147.988 bonds (distance) P-C4' energy: -145.401 flat angles C4'-P-C4' energy: -157.469 flat angles P-C4'-P energy: -97.725 tors. eta vs tors. theta energy: -164.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1920.993884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1920.993884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1920.993884 (E_RNA) where: Base-Base interactions energy: -1211.813 where: short stacking energy: -624.232 Base-Backbone interact. energy: 1.155 local terms energy: -710.336352 where: bonds (distance) C4'-P energy: -137.709 bonds (distance) P-C4' energy: -151.272 flat angles C4'-P-C4' energy: -152.014 flat angles P-C4'-P energy: -90.948 tors. eta vs tors. theta energy: -178.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1581.400846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.400846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.400846 (E_RNA) where: Base-Base interactions energy: -932.278 where: short stacking energy: -540.420 Base-Backbone interact. energy: -1.636 local terms energy: -647.486936 where: bonds (distance) C4'-P energy: -142.593 bonds (distance) P-C4' energy: -137.926 flat angles C4'-P-C4' energy: -151.695 flat angles P-C4'-P energy: -85.870 tors. eta vs tors. theta energy: -129.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1368.200330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.200330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.200330 (E_RNA) where: Base-Base interactions energy: -762.809 where: short stacking energy: -406.819 Base-Backbone interact. energy: -0.845 local terms energy: -604.546205 where: bonds (distance) C4'-P energy: -138.615 bonds (distance) P-C4' energy: -148.110 flat angles C4'-P-C4' energy: -152.874 flat angles P-C4'-P energy: -99.214 tors. eta vs tors. theta energy: -65.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1215.035003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.035003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.035003 (E_RNA) where: Base-Base interactions energy: -647.990 where: short stacking energy: -396.978 Base-Backbone interact. energy: -1.515 local terms energy: -565.529969 where: bonds (distance) C4'-P energy: -121.653 bonds (distance) P-C4' energy: -136.770 flat angles C4'-P-C4' energy: -131.387 flat angles P-C4'-P energy: -87.372 tors. eta vs tors. theta energy: -88.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1106.667742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.667742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.667742 (E_RNA) where: Base-Base interactions energy: -589.575 where: short stacking energy: -346.909 Base-Backbone interact. energy: -0.109 local terms energy: -516.983734 where: bonds (distance) C4'-P energy: -133.795 bonds (distance) P-C4' energy: -137.431 flat angles C4'-P-C4' energy: -121.219 flat angles P-C4'-P energy: -80.474 tors. eta vs tors. theta energy: -44.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1104.651790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.651790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.651790 (E_RNA) where: Base-Base interactions energy: -597.947 where: short stacking energy: -329.912 Base-Backbone interact. energy: -0.821 local terms energy: -505.883517 where: bonds (distance) C4'-P energy: -126.670 bonds (distance) P-C4' energy: -145.931 flat angles C4'-P-C4' energy: -106.344 flat angles P-C4'-P energy: -84.210 tors. eta vs tors. theta energy: -42.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -879.807881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.807881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.807881 (E_RNA) where: Base-Base interactions energy: -439.253 where: short stacking energy: -297.349 Base-Backbone interact. energy: 3.600 local terms energy: -444.155087 where: bonds (distance) C4'-P energy: -119.040 bonds (distance) P-C4' energy: -135.113 flat angles C4'-P-C4' energy: -116.173 flat angles P-C4'-P energy: -53.360 tors. eta vs tors. theta energy: -20.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -782.025489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.025489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.025489 (E_RNA) where: Base-Base interactions energy: -335.907 where: short stacking energy: -210.081 Base-Backbone interact. energy: -2.835 local terms energy: -443.283936 where: bonds (distance) C4'-P energy: -120.799 bonds (distance) P-C4' energy: -128.234 flat angles C4'-P-C4' energy: -117.499 flat angles P-C4'-P energy: -71.478 tors. eta vs tors. theta energy: -5.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -599.762456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.762456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.762456 (E_RNA) where: Base-Base interactions energy: -233.643 where: short stacking energy: -180.151 Base-Backbone interact. energy: 5.549 local terms energy: -371.668711 where: bonds (distance) C4'-P energy: -114.475 bonds (distance) P-C4' energy: -118.587 flat angles C4'-P-C4' energy: -106.351 flat angles P-C4'-P energy: -68.592 tors. eta vs tors. theta energy: 36.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1876.000858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1876.000858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1876.000858 (E_RNA) where: Base-Base interactions energy: -1135.324 where: short stacking energy: -640.217 Base-Backbone interact. energy: -0.685 local terms energy: -739.991832 where: bonds (distance) C4'-P energy: -148.311 bonds (distance) P-C4' energy: -147.914 flat angles C4'-P-C4' energy: -169.557 flat angles P-C4'-P energy: -106.869 tors. eta vs tors. theta energy: -167.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1958.980232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1958.980232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.980232 (E_RNA) where: Base-Base interactions energy: -1251.006 where: short stacking energy: -616.613 Base-Backbone interact. energy: 4.352 local terms energy: -712.326273 where: bonds (distance) C4'-P energy: -148.599 bonds (distance) P-C4' energy: -160.831 flat angles C4'-P-C4' energy: -147.910 flat angles P-C4'-P energy: -93.974 tors. eta vs tors. theta energy: -161.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1556.659334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.659334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.659334 (E_RNA) where: Base-Base interactions energy: -881.517 where: short stacking energy: -507.581 Base-Backbone interact. energy: 1.164 local terms energy: -676.306180 where: bonds (distance) C4'-P energy: -136.318 bonds (distance) P-C4' energy: -154.060 flat angles C4'-P-C4' energy: -141.838 flat angles P-C4'-P energy: -99.984 tors. eta vs tors. theta energy: -144.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1343.758113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.758113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.758113 (E_RNA) where: Base-Base interactions energy: -754.740 where: short stacking energy: -409.881 Base-Backbone interact. energy: -3.975 local terms energy: -585.042287 where: bonds (distance) C4'-P energy: -144.477 bonds (distance) P-C4' energy: -136.919 flat angles C4'-P-C4' energy: -151.333 flat angles P-C4'-P energy: -75.826 tors. eta vs tors. theta energy: -76.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1165.282396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.282396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.282396 (E_RNA) where: Base-Base interactions energy: -594.952 where: short stacking energy: -399.194 Base-Backbone interact. energy: -1.553 local terms energy: -570.086887 where: bonds (distance) C4'-P energy: -130.192 bonds (distance) P-C4' energy: -135.617 flat angles C4'-P-C4' energy: -139.277 flat angles P-C4'-P energy: -90.717 tors. eta vs tors. theta energy: -74.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.310 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1129.612195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.612195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.612195 (E_RNA) where: Base-Base interactions energy: -611.863 where: short stacking energy: -393.920 Base-Backbone interact. energy: -1.265 local terms energy: -516.484309 where: bonds (distance) C4'-P energy: -133.717 bonds (distance) P-C4' energy: -110.469 flat angles C4'-P-C4' energy: -128.423 flat angles P-C4'-P energy: -70.388 tors. eta vs tors. theta energy: -73.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1106.272038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.272038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.272038 (E_RNA) where: Base-Base interactions energy: -619.179 where: short stacking energy: -335.829 Base-Backbone interact. energy: 2.114 local terms energy: -489.206906 where: bonds (distance) C4'-P energy: -115.990 bonds (distance) P-C4' energy: -132.667 flat angles C4'-P-C4' energy: -137.709 flat angles P-C4'-P energy: -65.149 tors. eta vs tors. theta energy: -37.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -930.880015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.880015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.880015 (E_RNA) where: Base-Base interactions energy: -480.049 where: short stacking energy: -287.792 Base-Backbone interact. energy: 0.712 local terms energy: -451.543230 where: bonds (distance) C4'-P energy: -120.080 bonds (distance) P-C4' energy: -133.226 flat angles C4'-P-C4' energy: -100.490 flat angles P-C4'-P energy: -70.933 tors. eta vs tors. theta energy: -26.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -833.223251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.223251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.223251 (E_RNA) where: Base-Base interactions energy: -396.092 where: short stacking energy: -252.901 Base-Backbone interact. energy: 3.835 local terms energy: -440.966107 where: bonds (distance) C4'-P energy: -121.036 bonds (distance) P-C4' energy: -133.230 flat angles C4'-P-C4' energy: -101.233 flat angles P-C4'-P energy: -70.949 tors. eta vs tors. theta energy: -14.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -582.113685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.113685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.113685 (E_RNA) where: Base-Base interactions energy: -194.167 where: short stacking energy: -146.059 Base-Backbone interact. energy: -1.502 local terms energy: -387.326046 where: bonds (distance) C4'-P energy: -105.070 bonds (distance) P-C4' energy: -133.909 flat angles C4'-P-C4' energy: -112.443 flat angles P-C4'-P energy: -61.035 tors. eta vs tors. theta energy: 25.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.881 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1851.204149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1851.204149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1851.204149 (E_RNA) where: Base-Base interactions energy: -1118.635 where: short stacking energy: -631.126 Base-Backbone interact. energy: -2.559 local terms energy: -730.009818 where: bonds (distance) C4'-P energy: -148.066 bonds (distance) P-C4' energy: -151.419 flat angles C4'-P-C4' energy: -163.381 flat angles P-C4'-P energy: -85.885 tors. eta vs tors. theta energy: -181.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2011.718015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2011.718015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.718015 (E_RNA) where: Base-Base interactions energy: -1329.263 where: short stacking energy: -620.211 Base-Backbone interact. energy: -3.951 local terms energy: -678.504422 where: bonds (distance) C4'-P energy: -143.954 bonds (distance) P-C4' energy: -139.450 flat angles C4'-P-C4' energy: -154.513 flat angles P-C4'-P energy: -75.414 tors. eta vs tors. theta energy: -165.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1564.775695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.775695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.775695 (E_RNA) where: Base-Base interactions energy: -901.420 where: short stacking energy: -506.666 Base-Backbone interact. energy: 3.813 local terms energy: -667.168933 where: bonds (distance) C4'-P energy: -142.808 bonds (distance) P-C4' energy: -155.269 flat angles C4'-P-C4' energy: -156.364 flat angles P-C4'-P energy: -80.881 tors. eta vs tors. theta energy: -131.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1506.895291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.895291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.895291 (E_RNA) where: Base-Base interactions energy: -907.672 where: short stacking energy: -489.820 Base-Backbone interact. energy: -1.044 local terms energy: -598.179605 where: bonds (distance) C4'-P energy: -126.317 bonds (distance) P-C4' energy: -123.664 flat angles C4'-P-C4' energy: -148.847 flat angles P-C4'-P energy: -93.984 tors. eta vs tors. theta energy: -105.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1200.539542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.539542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.539542 (E_RNA) where: Base-Base interactions energy: -626.695 where: short stacking energy: -406.651 Base-Backbone interact. energy: -0.193 local terms energy: -573.652097 where: bonds (distance) C4'-P energy: -121.377 bonds (distance) P-C4' energy: -141.788 flat angles C4'-P-C4' energy: -141.021 flat angles P-C4'-P energy: -83.196 tors. eta vs tors. theta energy: -86.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1188.258505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.258505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.258505 (E_RNA) where: Base-Base interactions energy: -620.803 where: short stacking energy: -387.505 Base-Backbone interact. energy: 6.569 local terms energy: -574.024098 where: bonds (distance) C4'-P energy: -130.017 bonds (distance) P-C4' energy: -146.854 flat angles C4'-P-C4' energy: -143.245 flat angles P-C4'-P energy: -86.407 tors. eta vs tors. theta energy: -67.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1149.134816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.134816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.134816 (E_RNA) where: Base-Base interactions energy: -628.893 where: short stacking energy: -350.553 Base-Backbone interact. energy: 5.207 local terms energy: -525.449080 where: bonds (distance) C4'-P energy: -137.863 bonds (distance) P-C4' energy: -124.657 flat angles C4'-P-C4' energy: -137.150 flat angles P-C4'-P energy: -59.110 tors. eta vs tors. theta energy: -66.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -899.724283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.724283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.724283 (E_RNA) where: Base-Base interactions energy: -457.424 where: short stacking energy: -249.651 Base-Backbone interact. energy: 2.042 local terms energy: -444.342901 where: bonds (distance) C4'-P energy: -107.865 bonds (distance) P-C4' energy: -134.832 flat angles C4'-P-C4' energy: -124.230 flat angles P-C4'-P energy: -63.956 tors. eta vs tors. theta energy: -13.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -872.838837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.838837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.838837 (E_RNA) where: Base-Base interactions energy: -439.369 where: short stacking energy: -248.528 Base-Backbone interact. energy: -0.480 local terms energy: -432.989435 where: bonds (distance) C4'-P energy: -98.118 bonds (distance) P-C4' energy: -148.731 flat angles C4'-P-C4' energy: -110.822 flat angles P-C4'-P energy: -60.032 tors. eta vs tors. theta energy: -15.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -575.191342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.191342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.191342 (E_RNA) where: Base-Base interactions energy: -204.928 where: short stacking energy: -172.113 Base-Backbone interact. energy: -4.359 local terms energy: -365.904099 where: bonds (distance) C4'-P energy: -97.643 bonds (distance) P-C4' energy: -100.293 flat angles C4'-P-C4' energy: -123.954 flat angles P-C4'-P energy: -56.802 tors. eta vs tors. theta energy: 12.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2117.997496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2117.997496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2117.997496 (E_RNA) where: Base-Base interactions energy: -1362.752 where: short stacking energy: -640.164 Base-Backbone interact. energy: 1.512 local terms energy: -756.758407 where: bonds (distance) C4'-P energy: -157.232 bonds (distance) P-C4' energy: -158.791 flat angles C4'-P-C4' energy: -162.100 flat angles P-C4'-P energy: -102.008 tors. eta vs tors. theta energy: -176.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1777.852152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1777.852152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.852152 (E_RNA) where: Base-Base interactions energy: -1062.657 where: short stacking energy: -589.668 Base-Backbone interact. energy: -1.702 local terms energy: -713.493000 where: bonds (distance) C4'-P energy: -143.407 bonds (distance) P-C4' energy: -143.387 flat angles C4'-P-C4' energy: -161.727 flat angles P-C4'-P energy: -92.359 tors. eta vs tors. theta energy: -172.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1590.774339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.774339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.774339 (E_RNA) where: Base-Base interactions energy: -968.539 where: short stacking energy: -490.815 Base-Backbone interact. energy: 0.348 local terms energy: -622.583261 where: bonds (distance) C4'-P energy: -131.816 bonds (distance) P-C4' energy: -127.105 flat angles C4'-P-C4' energy: -150.650 flat angles P-C4'-P energy: -91.845 tors. eta vs tors. theta energy: -121.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1458.335634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.335634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.335634 (E_RNA) where: Base-Base interactions energy: -862.842 where: short stacking energy: -445.830 Base-Backbone interact. energy: -3.592 local terms energy: -591.901667 where: bonds (distance) C4'-P energy: -123.005 bonds (distance) P-C4' energy: -150.166 flat angles C4'-P-C4' energy: -137.506 flat angles P-C4'-P energy: -82.474 tors. eta vs tors. theta energy: -98.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1153.602117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.602117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.602117 (E_RNA) where: Base-Base interactions energy: -611.493 where: short stacking energy: -406.171 Base-Backbone interact. energy: -0.198 local terms energy: -541.911260 where: bonds (distance) C4'-P energy: -117.336 bonds (distance) P-C4' energy: -121.542 flat angles C4'-P-C4' energy: -148.814 flat angles P-C4'-P energy: -77.800 tors. eta vs tors. theta energy: -76.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1209.176893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.176893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.176893 (E_RNA) where: Base-Base interactions energy: -669.077 where: short stacking energy: -382.386 Base-Backbone interact. energy: 0.659 local terms energy: -540.758452 where: bonds (distance) C4'-P energy: -137.587 bonds (distance) P-C4' energy: -109.326 flat angles C4'-P-C4' energy: -149.466 flat angles P-C4'-P energy: -72.456 tors. eta vs tors. theta energy: -71.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1113.317393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1113.317393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1113.317393 (E_RNA) where: Base-Base interactions energy: -629.277 where: short stacking energy: -317.421 Base-Backbone interact. energy: -1.090 local terms energy: -482.950590 where: bonds (distance) C4'-P energy: -131.999 bonds (distance) P-C4' energy: -132.774 flat angles C4'-P-C4' energy: -118.424 flat angles P-C4'-P energy: -58.680 tors. eta vs tors. theta energy: -41.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -899.778823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.778823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.778823 (E_RNA) where: Base-Base interactions energy: -454.463 where: short stacking energy: -243.281 Base-Backbone interact. energy: 0.673 local terms energy: -445.988277 where: bonds (distance) C4'-P energy: -140.909 bonds (distance) P-C4' energy: -116.736 flat angles C4'-P-C4' energy: -97.749 flat angles P-C4'-P energy: -74.402 tors. eta vs tors. theta energy: -16.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -932.715936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.715936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.715936 (E_RNA) where: Base-Base interactions energy: -521.781 where: short stacking energy: -251.012 Base-Backbone interact. energy: 0.504 local terms energy: -411.439104 where: bonds (distance) C4'-P energy: -113.806 bonds (distance) P-C4' energy: -122.552 flat angles C4'-P-C4' energy: -107.075 flat angles P-C4'-P energy: -61.349 tors. eta vs tors. theta energy: -6.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -627.557592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.557592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.557592 (E_RNA) where: Base-Base interactions energy: -227.163 where: short stacking energy: -171.787 Base-Backbone interact. energy: -4.933 local terms energy: -395.461178 where: bonds (distance) C4'-P energy: -117.325 bonds (distance) P-C4' energy: -134.490 flat angles C4'-P-C4' energy: -105.363 flat angles P-C4'-P energy: -61.367 tors. eta vs tors. theta energy: 23.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2107.511172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2107.511172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2107.511172 (E_RNA) where: Base-Base interactions energy: -1343.576 where: short stacking energy: -630.370 Base-Backbone interact. energy: -3.022 local terms energy: -760.913305 where: bonds (distance) C4'-P energy: -158.104 bonds (distance) P-C4' energy: -165.507 flat angles C4'-P-C4' energy: -158.400 flat angles P-C4'-P energy: -113.808 tors. eta vs tors. theta energy: -165.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1838.583069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1838.583069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.583069 (E_RNA) where: Base-Base interactions energy: -1144.800 where: short stacking energy: -628.452 Base-Backbone interact. energy: -0.187 local terms energy: -693.595629 where: bonds (distance) C4'-P energy: -145.590 bonds (distance) P-C4' energy: -128.059 flat angles C4'-P-C4' energy: -161.917 flat angles P-C4'-P energy: -90.208 tors. eta vs tors. theta energy: -167.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1646.951263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.951263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.951263 (E_RNA) where: Base-Base interactions energy: -1034.518 where: short stacking energy: -516.527 Base-Backbone interact. energy: -1.562 local terms energy: -610.870640 where: bonds (distance) C4'-P energy: -130.645 bonds (distance) P-C4' energy: -134.311 flat angles C4'-P-C4' energy: -152.428 flat angles P-C4'-P energy: -96.845 tors. eta vs tors. theta energy: -96.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1463.667063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.667063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.667063 (E_RNA) where: Base-Base interactions energy: -867.538 where: short stacking energy: -469.262 Base-Backbone interact. energy: 0.970 local terms energy: -597.099127 where: bonds (distance) C4'-P energy: -130.431 bonds (distance) P-C4' energy: -137.515 flat angles C4'-P-C4' energy: -139.080 flat angles P-C4'-P energy: -89.685 tors. eta vs tors. theta energy: -100.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1175.526466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.526466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.526466 (E_RNA) where: Base-Base interactions energy: -655.675 where: short stacking energy: -387.654 Base-Backbone interact. energy: -2.087 local terms energy: -517.764085 where: bonds (distance) C4'-P energy: -108.754 bonds (distance) P-C4' energy: -131.549 flat angles C4'-P-C4' energy: -117.982 flat angles P-C4'-P energy: -83.255 tors. eta vs tors. theta energy: -76.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1226.715284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.715284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.715284 (E_RNA) where: Base-Base interactions energy: -747.436 where: short stacking energy: -360.984 Base-Backbone interact. energy: 6.896 local terms energy: -486.175439 where: bonds (distance) C4'-P energy: -110.196 bonds (distance) P-C4' energy: -117.997 flat angles C4'-P-C4' energy: -121.239 flat angles P-C4'-P energy: -76.003 tors. eta vs tors. theta energy: -60.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1197.406518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.406518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.406518 (E_RNA) where: Base-Base interactions energy: -705.134 where: short stacking energy: -341.292 Base-Backbone interact. energy: 2.358 local terms energy: -494.630811 where: bonds (distance) C4'-P energy: -115.233 bonds (distance) P-C4' energy: -128.450 flat angles C4'-P-C4' energy: -128.347 flat angles P-C4'-P energy: -66.396 tors. eta vs tors. theta energy: -56.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -998.033398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.033398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.033398 (E_RNA) where: Base-Base interactions energy: -553.505 where: short stacking energy: -310.822 Base-Backbone interact. energy: -0.036 local terms energy: -444.491590 where: bonds (distance) C4'-P energy: -117.139 bonds (distance) P-C4' energy: -115.702 flat angles C4'-P-C4' energy: -106.240 flat angles P-C4'-P energy: -68.788 tors. eta vs tors. theta energy: -36.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -843.989535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.989535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.989535 (E_RNA) where: Base-Base interactions energy: -433.463 where: short stacking energy: -246.413 Base-Backbone interact. energy: -3.836 local terms energy: -406.690714 where: bonds (distance) C4'-P energy: -115.453 bonds (distance) P-C4' energy: -139.137 flat angles C4'-P-C4' energy: -102.256 flat angles P-C4'-P energy: -54.037 tors. eta vs tors. theta energy: 4.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -590.062182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.062182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.062182 (E_RNA) where: Base-Base interactions energy: -208.950 where: short stacking energy: -170.837 Base-Backbone interact. energy: -0.367 local terms energy: -380.746028 where: bonds (distance) C4'-P energy: -121.492 bonds (distance) P-C4' energy: -120.458 flat angles C4'-P-C4' energy: -99.847 flat angles P-C4'-P energy: -57.755 tors. eta vs tors. theta energy: 18.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2132.095765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2132.095765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2132.095765 (E_RNA) where: Base-Base interactions energy: -1394.807 where: short stacking energy: -634.845 Base-Backbone interact. energy: -1.534 local terms energy: -735.755332 where: bonds (distance) C4'-P energy: -129.511 bonds (distance) P-C4' energy: -159.874 flat angles C4'-P-C4' energy: -168.256 flat angles P-C4'-P energy: -96.410 tors. eta vs tors. theta energy: -181.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1809.214686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.214686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.214686 (E_RNA) where: Base-Base interactions energy: -1108.474 where: short stacking energy: -587.091 Base-Backbone interact. energy: -0.896 local terms energy: -699.844283 where: bonds (distance) C4'-P energy: -137.383 bonds (distance) P-C4' energy: -140.091 flat angles C4'-P-C4' energy: -157.698 flat angles P-C4'-P energy: -117.241 tors. eta vs tors. theta energy: -147.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1651.964218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.964218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.964218 (E_RNA) where: Base-Base interactions energy: -1007.752 where: short stacking energy: -557.419 Base-Backbone interact. energy: 0.528 local terms energy: -644.740439 where: bonds (distance) C4'-P energy: -123.515 bonds (distance) P-C4' energy: -147.517 flat angles C4'-P-C4' energy: -148.749 flat angles P-C4'-P energy: -89.126 tors. eta vs tors. theta energy: -135.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1433.710711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.710711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.710711 (E_RNA) where: Base-Base interactions energy: -832.673 where: short stacking energy: -480.730 Base-Backbone interact. energy: -3.224 local terms energy: -597.813709 where: bonds (distance) C4'-P energy: -117.858 bonds (distance) P-C4' energy: -138.643 flat angles C4'-P-C4' energy: -139.347 flat angles P-C4'-P energy: -90.418 tors. eta vs tors. theta energy: -111.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1346.883302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.883302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.883302 (E_RNA) where: Base-Base interactions energy: -785.206 where: short stacking energy: -389.719 Base-Backbone interact. energy: -4.279 local terms energy: -557.397682 where: bonds (distance) C4'-P energy: -130.338 bonds (distance) P-C4' energy: -146.303 flat angles C4'-P-C4' energy: -146.427 flat angles P-C4'-P energy: -63.997 tors. eta vs tors. theta energy: -70.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1187.388728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.388728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.388728 (E_RNA) where: Base-Base interactions energy: -673.543 where: short stacking energy: -384.152 Base-Backbone interact. energy: -0.098 local terms energy: -513.748344 where: bonds (distance) C4'-P energy: -132.591 bonds (distance) P-C4' energy: -142.592 flat angles C4'-P-C4' energy: -110.297 flat angles P-C4'-P energy: -81.495 tors. eta vs tors. theta energy: -46.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1196.118172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.118172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.118172 (E_RNA) where: Base-Base interactions energy: -701.683 where: short stacking energy: -347.618 Base-Backbone interact. energy: 1.959 local terms energy: -496.394716 where: bonds (distance) C4'-P energy: -96.779 bonds (distance) P-C4' energy: -126.340 flat angles C4'-P-C4' energy: -127.843 flat angles P-C4'-P energy: -82.208 tors. eta vs tors. theta energy: -63.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1010.966543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.966543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.966543 (E_RNA) where: Base-Base interactions energy: -562.500 where: short stacking energy: -322.402 Base-Backbone interact. energy: 0.236 local terms energy: -448.702763 where: bonds (distance) C4'-P energy: -131.937 bonds (distance) P-C4' energy: -110.997 flat angles C4'-P-C4' energy: -114.274 flat angles P-C4'-P energy: -70.117 tors. eta vs tors. theta energy: -21.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -874.894268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.894268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.894268 (E_RNA) where: Base-Base interactions energy: -457.257 where: short stacking energy: -269.469 Base-Backbone interact. energy: -1.619 local terms energy: -416.018282 where: bonds (distance) C4'-P energy: -97.366 bonds (distance) P-C4' energy: -113.632 flat angles C4'-P-C4' energy: -118.784 flat angles P-C4'-P energy: -70.198 tors. eta vs tors. theta energy: -16.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -596.366864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.366864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.366864 (E_RNA) where: Base-Base interactions energy: -217.946 where: short stacking energy: -133.056 Base-Backbone interact. energy: 2.673 local terms energy: -381.094389 where: bonds (distance) C4'-P energy: -116.324 bonds (distance) P-C4' energy: -142.152 flat angles C4'-P-C4' energy: -86.050 flat angles P-C4'-P energy: -65.346 tors. eta vs tors. theta energy: 28.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2174.261496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2174.261496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.261496 (E_RNA) where: Base-Base interactions energy: -1421.229 where: short stacking energy: -661.470 Base-Backbone interact. energy: -2.408 local terms energy: -750.624273 where: bonds (distance) C4'-P energy: -148.097 bonds (distance) P-C4' energy: -158.176 flat angles C4'-P-C4' energy: -162.347 flat angles P-C4'-P energy: -101.092 tors. eta vs tors. theta energy: -180.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1800.962634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.962634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.962634 (E_RNA) where: Base-Base interactions energy: -1119.161 where: short stacking energy: -576.155 Base-Backbone interact. energy: -2.461 local terms energy: -679.340710 where: bonds (distance) C4'-P energy: -130.073 bonds (distance) P-C4' energy: -148.578 flat angles C4'-P-C4' energy: -160.099 flat angles P-C4'-P energy: -84.001 tors. eta vs tors. theta energy: -156.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1655.923190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.923190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.923190 (E_RNA) where: Base-Base interactions energy: -1051.363 where: short stacking energy: -517.568 Base-Backbone interact. energy: -0.085 local terms energy: -604.475316 where: bonds (distance) C4'-P energy: -144.342 bonds (distance) P-C4' energy: -128.842 flat angles C4'-P-C4' energy: -129.789 flat angles P-C4'-P energy: -94.422 tors. eta vs tors. theta energy: -107.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1463.125069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.125069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.125069 (E_RNA) where: Base-Base interactions energy: -850.525 where: short stacking energy: -483.666 Base-Backbone interact. energy: -2.777 local terms energy: -609.822694 where: bonds (distance) C4'-P energy: -129.480 bonds (distance) P-C4' energy: -137.410 flat angles C4'-P-C4' energy: -143.534 flat angles P-C4'-P energy: -83.723 tors. eta vs tors. theta energy: -115.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1393.962050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.962050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.962050 (E_RNA) where: Base-Base interactions energy: -810.286 where: short stacking energy: -471.171 Base-Backbone interact. energy: 2.931 local terms energy: -586.607178 where: bonds (distance) C4'-P energy: -132.901 bonds (distance) P-C4' energy: -129.383 flat angles C4'-P-C4' energy: -148.878 flat angles P-C4'-P energy: -78.551 tors. eta vs tors. theta energy: -96.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1363.282269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.282269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.282269 (E_RNA) where: Base-Base interactions energy: -821.696 where: short stacking energy: -389.414 Base-Backbone interact. energy: 2.249 local terms energy: -543.835179 where: bonds (distance) C4'-P energy: -125.061 bonds (distance) P-C4' energy: -138.094 flat angles C4'-P-C4' energy: -137.333 flat angles P-C4'-P energy: -64.647 tors. eta vs tors. theta energy: -78.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1153.304328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.304328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.304328 (E_RNA) where: Base-Base interactions energy: -665.038 where: short stacking energy: -390.686 Base-Backbone interact. energy: 1.832 local terms energy: -490.097623 where: bonds (distance) C4'-P energy: -108.692 bonds (distance) P-C4' energy: -124.759 flat angles C4'-P-C4' energy: -133.539 flat angles P-C4'-P energy: -77.692 tors. eta vs tors. theta energy: -45.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1052.962941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.962941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.962941 (E_RNA) where: Base-Base interactions energy: -578.452 where: short stacking energy: -307.418 Base-Backbone interact. energy: -3.476 local terms energy: -471.035190 where: bonds (distance) C4'-P energy: -118.598 bonds (distance) P-C4' energy: -129.896 flat angles C4'-P-C4' energy: -107.721 flat angles P-C4'-P energy: -75.030 tors. eta vs tors. theta energy: -39.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -810.270345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.270345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.270345 (E_RNA) where: Base-Base interactions energy: -411.964 where: short stacking energy: -242.760 Base-Backbone interact. energy: -1.946 local terms energy: -396.360526 where: bonds (distance) C4'-P energy: -119.445 bonds (distance) P-C4' energy: -133.639 flat angles C4'-P-C4' energy: -99.581 flat angles P-C4'-P energy: -47.612 tors. eta vs tors. theta energy: 3.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -608.461876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.461876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.461876 (E_RNA) where: Base-Base interactions energy: -219.794 where: short stacking energy: -155.671 Base-Backbone interact. energy: -4.002 local terms energy: -384.665279 where: bonds (distance) C4'-P energy: -110.785 bonds (distance) P-C4' energy: -140.233 flat angles C4'-P-C4' energy: -93.877 flat angles P-C4'-P energy: -51.364 tors. eta vs tors. theta energy: 11.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2163.327411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2163.327411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2163.327411 (E_RNA) where: Base-Base interactions energy: -1389.508 where: short stacking energy: -702.915 Base-Backbone interact. energy: -2.676 local terms energy: -771.144202 where: bonds (distance) C4'-P energy: -149.665 bonds (distance) P-C4' energy: -143.959 flat angles C4'-P-C4' energy: -165.455 flat angles P-C4'-P energy: -104.528 tors. eta vs tors. theta energy: -207.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1863.536113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1863.536113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1863.536113 (E_RNA) where: Base-Base interactions energy: -1180.337 where: short stacking energy: -608.009 Base-Backbone interact. energy: -5.351 local terms energy: -677.848783 where: bonds (distance) C4'-P energy: -132.780 bonds (distance) P-C4' energy: -142.874 flat angles C4'-P-C4' energy: -149.191 flat angles P-C4'-P energy: -105.611 tors. eta vs tors. theta energy: -147.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1694.921734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.921734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.921734 (E_RNA) where: Base-Base interactions energy: -1086.652 where: short stacking energy: -533.103 Base-Backbone interact. energy: -4.054 local terms energy: -604.215743 where: bonds (distance) C4'-P energy: -130.421 bonds (distance) P-C4' energy: -147.517 flat angles C4'-P-C4' energy: -142.537 flat angles P-C4'-P energy: -78.164 tors. eta vs tors. theta energy: -105.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1504.943695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.943695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.943695 (E_RNA) where: Base-Base interactions energy: -906.641 where: short stacking energy: -496.561 Base-Backbone interact. energy: -2.261 local terms energy: -596.041419 where: bonds (distance) C4'-P energy: -124.696 bonds (distance) P-C4' energy: -128.994 flat angles C4'-P-C4' energy: -150.777 flat angles P-C4'-P energy: -86.874 tors. eta vs tors. theta energy: -104.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1453.912143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.912143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.912143 (E_RNA) where: Base-Base interactions energy: -887.071 where: short stacking energy: -414.709 Base-Backbone interact. energy: -2.833 local terms energy: -564.008552 where: bonds (distance) C4'-P energy: -124.573 bonds (distance) P-C4' energy: -133.109 flat angles C4'-P-C4' energy: -131.465 flat angles P-C4'-P energy: -91.648 tors. eta vs tors. theta energy: -83.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1298.739909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.739909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.739909 (E_RNA) where: Base-Base interactions energy: -792.014 where: short stacking energy: -400.940 Base-Backbone interact. energy: 4.259 local terms energy: -510.984697 where: bonds (distance) C4'-P energy: -126.870 bonds (distance) P-C4' energy: -126.616 flat angles C4'-P-C4' energy: -127.354 flat angles P-C4'-P energy: -75.016 tors. eta vs tors. theta energy: -55.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1181.341802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.341802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.341802 (E_RNA) where: Base-Base interactions energy: -680.932 where: short stacking energy: -373.819 Base-Backbone interact. energy: -1.818 local terms energy: -498.591747 where: bonds (distance) C4'-P energy: -109.343 bonds (distance) P-C4' energy: -136.764 flat angles C4'-P-C4' energy: -117.287 flat angles P-C4'-P energy: -72.684 tors. eta vs tors. theta energy: -62.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1111.983249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.983249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.983249 (E_RNA) where: Base-Base interactions energy: -627.966 where: short stacking energy: -350.105 Base-Backbone interact. energy: 1.628 local terms energy: -485.645825 where: bonds (distance) C4'-P energy: -126.457 bonds (distance) P-C4' energy: -128.218 flat angles C4'-P-C4' energy: -129.087 flat angles P-C4'-P energy: -69.186 tors. eta vs tors. theta energy: -32.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -814.000966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.000966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.000966 (E_RNA) where: Base-Base interactions energy: -377.162 where: short stacking energy: -217.376 Base-Backbone interact. energy: -4.365 local terms energy: -433.293727 where: bonds (distance) C4'-P energy: -119.533 bonds (distance) P-C4' energy: -121.097 flat angles C4'-P-C4' energy: -129.247 flat angles P-C4'-P energy: -66.093 tors. eta vs tors. theta energy: 2.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.820 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -597.221438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.221438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.221438 (E_RNA) where: Base-Base interactions energy: -255.033 where: short stacking energy: -151.246 Base-Backbone interact. energy: 3.634 local terms energy: -345.822227 where: bonds (distance) C4'-P energy: -110.406 bonds (distance) P-C4' energy: -125.633 flat angles C4'-P-C4' energy: -95.675 flat angles P-C4'-P energy: -43.166 tors. eta vs tors. theta energy: 29.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2139.627584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2139.627584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2139.627584 (E_RNA) where: Base-Base interactions energy: -1422.854 where: short stacking energy: -628.673 Base-Backbone interact. energy: 0.409 local terms energy: -717.182241 where: bonds (distance) C4'-P energy: -141.510 bonds (distance) P-C4' energy: -146.219 flat angles C4'-P-C4' energy: -157.657 flat angles P-C4'-P energy: -100.209 tors. eta vs tors. theta energy: -171.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1883.661732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.661732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.661732 (E_RNA) where: Base-Base interactions energy: -1175.288 where: short stacking energy: -597.583 Base-Backbone interact. energy: 0.204 local terms energy: -708.577095 where: bonds (distance) C4'-P energy: -150.291 bonds (distance) P-C4' energy: -161.435 flat angles C4'-P-C4' energy: -166.123 flat angles P-C4'-P energy: -93.768 tors. eta vs tors. theta energy: -136.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1721.448524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.448524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.448524 (E_RNA) where: Base-Base interactions energy: -1104.994 where: short stacking energy: -512.891 Base-Backbone interact. energy: -0.478 local terms energy: -615.975994 where: bonds (distance) C4'-P energy: -117.062 bonds (distance) P-C4' energy: -137.104 flat angles C4'-P-C4' energy: -154.805 flat angles P-C4'-P energy: -93.374 tors. eta vs tors. theta energy: -113.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1596.376658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.376658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.376658 (E_RNA) where: Base-Base interactions energy: -986.204 where: short stacking energy: -488.044 Base-Backbone interact. energy: -2.900 local terms energy: -607.272767 where: bonds (distance) C4'-P energy: -146.549 bonds (distance) P-C4' energy: -155.864 flat angles C4'-P-C4' energy: -135.904 flat angles P-C4'-P energy: -70.182 tors. eta vs tors. theta energy: -98.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1377.479851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.479851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.479851 (E_RNA) where: Base-Base interactions energy: -797.702 where: short stacking energy: -397.498 Base-Backbone interact. energy: -3.851 local terms energy: -575.926551 where: bonds (distance) C4'-P energy: -143.584 bonds (distance) P-C4' energy: -137.214 flat angles C4'-P-C4' energy: -133.865 flat angles P-C4'-P energy: -94.363 tors. eta vs tors. theta energy: -66.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1348.475659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.475659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.475659 (E_RNA) where: Base-Base interactions energy: -819.434 where: short stacking energy: -370.844 Base-Backbone interact. energy: -0.856 local terms energy: -528.185538 where: bonds (distance) C4'-P energy: -122.410 bonds (distance) P-C4' energy: -122.951 flat angles C4'-P-C4' energy: -134.827 flat angles P-C4'-P energy: -85.782 tors. eta vs tors. theta energy: -62.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1251.163276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.163276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.163276 (E_RNA) where: Base-Base interactions energy: -739.414 where: short stacking energy: -396.989 Base-Backbone interact. energy: 0.759 local terms energy: -512.508851 where: bonds (distance) C4'-P energy: -112.865 bonds (distance) P-C4' energy: -128.797 flat angles C4'-P-C4' energy: -113.025 flat angles P-C4'-P energy: -88.125 tors. eta vs tors. theta energy: -69.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1104.154406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.154406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.154406 (E_RNA) where: Base-Base interactions energy: -661.517 where: short stacking energy: -340.269 Base-Backbone interact. energy: -3.418 local terms energy: -439.218655 where: bonds (distance) C4'-P energy: -108.662 bonds (distance) P-C4' energy: -123.350 flat angles C4'-P-C4' energy: -104.492 flat angles P-C4'-P energy: -68.721 tors. eta vs tors. theta energy: -33.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -766.455027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.455027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.455027 (E_RNA) where: Base-Base interactions energy: -357.370 where: short stacking energy: -223.449 Base-Backbone interact. energy: -2.940 local terms energy: -406.145241 where: bonds (distance) C4'-P energy: -130.716 bonds (distance) P-C4' energy: -116.791 flat angles C4'-P-C4' energy: -109.594 flat angles P-C4'-P energy: -60.591 tors. eta vs tors. theta energy: 11.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -671.973871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.973871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.973871 (E_RNA) where: Base-Base interactions energy: -294.129 where: short stacking energy: -171.691 Base-Backbone interact. energy: 1.229 local terms energy: -379.073414 where: bonds (distance) C4'-P energy: -99.093 bonds (distance) P-C4' energy: -129.254 flat angles C4'-P-C4' energy: -123.969 flat angles P-C4'-P energy: -37.320 tors. eta vs tors. theta energy: 10.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2182.445584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2182.445584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.445584 (E_RNA) where: Base-Base interactions energy: -1432.086 where: short stacking energy: -668.985 Base-Backbone interact. energy: -1.696 local terms energy: -748.663995 where: bonds (distance) C4'-P energy: -154.231 bonds (distance) P-C4' energy: -160.849 flat angles C4'-P-C4' energy: -163.381 flat angles P-C4'-P energy: -97.670 tors. eta vs tors. theta energy: -172.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1877.184995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1877.184995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1877.184995 (E_RNA) where: Base-Base interactions energy: -1200.022 where: short stacking energy: -611.403 Base-Backbone interact. energy: 0.239 local terms energy: -677.402368 where: bonds (distance) C4'-P energy: -149.003 bonds (distance) P-C4' energy: -135.046 flat angles C4'-P-C4' energy: -148.284 flat angles P-C4'-P energy: -102.823 tors. eta vs tors. theta energy: -142.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1704.382810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.382810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.382810 (E_RNA) where: Base-Base interactions energy: -1071.197 where: short stacking energy: -520.779 Base-Backbone interact. energy: -2.391 local terms energy: -630.794901 where: bonds (distance) C4'-P energy: -123.207 bonds (distance) P-C4' energy: -147.953 flat angles C4'-P-C4' energy: -154.162 flat angles P-C4'-P energy: -92.903 tors. eta vs tors. theta energy: -112.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1652.211279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.211279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.211279 (E_RNA) where: Base-Base interactions energy: -1066.624 where: short stacking energy: -463.966 Base-Backbone interact. energy: -1.184 local terms energy: -584.403923 where: bonds (distance) C4'-P energy: -121.675 bonds (distance) P-C4' energy: -149.587 flat angles C4'-P-C4' energy: -143.563 flat angles P-C4'-P energy: -83.899 tors. eta vs tors. theta energy: -85.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1360.674544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.674544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.674544 (E_RNA) where: Base-Base interactions energy: -791.309 where: short stacking energy: -455.268 Base-Backbone interact. energy: -1.597 local terms energy: -567.768135 where: bonds (distance) C4'-P energy: -119.420 bonds (distance) P-C4' energy: -125.248 flat angles C4'-P-C4' energy: -132.520 flat angles P-C4'-P energy: -90.388 tors. eta vs tors. theta energy: -100.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1311.722068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.722068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.722068 (E_RNA) where: Base-Base interactions energy: -758.233 where: short stacking energy: -412.682 Base-Backbone interact. energy: -2.968 local terms energy: -550.521379 where: bonds (distance) C4'-P energy: -120.656 bonds (distance) P-C4' energy: -144.062 flat angles C4'-P-C4' energy: -128.076 flat angles P-C4'-P energy: -87.979 tors. eta vs tors. theta energy: -69.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1295.127998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.127998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.127998 (E_RNA) where: Base-Base interactions energy: -765.609 where: short stacking energy: -410.209 Base-Backbone interact. energy: -1.642 local terms energy: -529.195404 where: bonds (distance) C4'-P energy: -113.899 bonds (distance) P-C4' energy: -122.482 flat angles C4'-P-C4' energy: -132.252 flat angles P-C4'-P energy: -79.302 tors. eta vs tors. theta energy: -81.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.319 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1073.276996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.276996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.276996 (E_RNA) where: Base-Base interactions energy: -596.992 where: short stacking energy: -296.860 Base-Backbone interact. energy: 0.992 local terms energy: -477.277042 where: bonds (distance) C4'-P energy: -144.185 bonds (distance) P-C4' energy: -133.575 flat angles C4'-P-C4' energy: -101.557 flat angles P-C4'-P energy: -65.729 tors. eta vs tors. theta energy: -32.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -704.055419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.055419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.055419 (E_RNA) where: Base-Base interactions energy: -298.627 where: short stacking energy: -217.327 Base-Backbone interact. energy: -0.728 local terms energy: -404.700398 where: bonds (distance) C4'-P energy: -124.275 bonds (distance) P-C4' energy: -125.473 flat angles C4'-P-C4' energy: -102.365 flat angles P-C4'-P energy: -68.783 tors. eta vs tors. theta energy: 16.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -633.147664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.147664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.147664 (E_RNA) where: Base-Base interactions energy: -260.871 where: short stacking energy: -188.509 Base-Backbone interact. energy: -2.473 local terms energy: -369.803328 where: bonds (distance) C4'-P energy: -116.574 bonds (distance) P-C4' energy: -128.399 flat angles C4'-P-C4' energy: -90.189 flat angles P-C4'-P energy: -49.981 tors. eta vs tors. theta energy: 15.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2172.843355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2172.843355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2172.843355 (E_RNA) where: Base-Base interactions energy: -1424.607 where: short stacking energy: -664.470 Base-Backbone interact. energy: -1.434 local terms energy: -746.802616 where: bonds (distance) C4'-P energy: -143.772 bonds (distance) P-C4' energy: -149.164 flat angles C4'-P-C4' energy: -162.111 flat angles P-C4'-P energy: -95.706 tors. eta vs tors. theta energy: -196.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1909.816704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.816704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.816704 (E_RNA) where: Base-Base interactions energy: -1207.295 where: short stacking energy: -617.357 Base-Backbone interact. energy: -5.739 local terms energy: -696.783243 where: bonds (distance) C4'-P energy: -138.768 bonds (distance) P-C4' energy: -149.678 flat angles C4'-P-C4' energy: -168.919 flat angles P-C4'-P energy: -86.880 tors. eta vs tors. theta energy: -152.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1770.798937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.798937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.798937 (E_RNA) where: Base-Base interactions energy: -1138.813 where: short stacking energy: -523.287 Base-Backbone interact. energy: -2.168 local terms energy: -629.818112 where: bonds (distance) C4'-P energy: -143.079 bonds (distance) P-C4' energy: -140.538 flat angles C4'-P-C4' energy: -142.670 flat angles P-C4'-P energy: -83.544 tors. eta vs tors. theta energy: -119.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1733.365641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.365641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.365641 (E_RNA) where: Base-Base interactions energy: -1116.974 where: short stacking energy: -480.992 Base-Backbone interact. energy: -0.909 local terms energy: -615.482972 where: bonds (distance) C4'-P energy: -128.928 bonds (distance) P-C4' energy: -139.308 flat angles C4'-P-C4' energy: -155.343 flat angles P-C4'-P energy: -96.575 tors. eta vs tors. theta energy: -95.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1488.472509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.472509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.472509 (E_RNA) where: Base-Base interactions energy: -914.224 where: short stacking energy: -443.753 Base-Backbone interact. energy: -1.861 local terms energy: -572.386979 where: bonds (distance) C4'-P energy: -139.091 bonds (distance) P-C4' energy: -127.397 flat angles C4'-P-C4' energy: -141.817 flat angles P-C4'-P energy: -81.586 tors. eta vs tors. theta energy: -82.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1358.777390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.777390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.777390 (E_RNA) where: Base-Base interactions energy: -801.439 where: short stacking energy: -407.453 Base-Backbone interact. energy: -1.041 local terms energy: -556.296886 where: bonds (distance) C4'-P energy: -129.731 bonds (distance) P-C4' energy: -142.111 flat angles C4'-P-C4' energy: -137.256 flat angles P-C4'-P energy: -85.265 tors. eta vs tors. theta energy: -61.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1232.994030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.994030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.994030 (E_RNA) where: Base-Base interactions energy: -737.095 where: short stacking energy: -385.994 Base-Backbone interact. energy: 0.601 local terms energy: -496.500252 where: bonds (distance) C4'-P energy: -125.235 bonds (distance) P-C4' energy: -139.837 flat angles C4'-P-C4' energy: -109.038 flat angles P-C4'-P energy: -58.161 tors. eta vs tors. theta energy: -64.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1038.548920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.548920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.548920 (E_RNA) where: Base-Base interactions energy: -591.308 where: short stacking energy: -312.731 Base-Backbone interact. energy: -1.392 local terms energy: -445.848478 where: bonds (distance) C4'-P energy: -112.841 bonds (distance) P-C4' energy: -122.219 flat angles C4'-P-C4' energy: -106.360 flat angles P-C4'-P energy: -61.968 tors. eta vs tors. theta energy: -42.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -773.151574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.151574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -773.151574 (E_RNA) where: Base-Base interactions energy: -357.462 where: short stacking energy: -236.148 Base-Backbone interact. energy: -3.394 local terms energy: -412.295552 where: bonds (distance) C4'-P energy: -130.777 bonds (distance) P-C4' energy: -128.416 flat angles C4'-P-C4' energy: -72.603 flat angles P-C4'-P energy: -54.022 tors. eta vs tors. theta energy: -26.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -634.662987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.662987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.662987 (E_RNA) where: Base-Base interactions energy: -213.445 where: short stacking energy: -169.886 Base-Backbone interact. energy: -0.786 local terms energy: -420.431633 where: bonds (distance) C4'-P energy: -130.868 bonds (distance) P-C4' energy: -122.774 flat angles C4'-P-C4' energy: -118.315 flat angles P-C4'-P energy: -74.612 tors. eta vs tors. theta energy: 26.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2234.610302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2234.610302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2234.610302 (E_RNA) where: Base-Base interactions energy: -1492.724 where: short stacking energy: -672.343 Base-Backbone interact. energy: -1.337 local terms energy: -740.549530 where: bonds (distance) C4'-P energy: -157.471 bonds (distance) P-C4' energy: -139.691 flat angles C4'-P-C4' energy: -164.519 flat angles P-C4'-P energy: -105.233 tors. eta vs tors. theta energy: -173.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1901.837383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1901.837383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1901.837383 (E_RNA) where: Base-Base interactions energy: -1177.870 where: short stacking energy: -605.081 Base-Backbone interact. energy: -4.587 local terms energy: -719.379509 where: bonds (distance) C4'-P energy: -159.545 bonds (distance) P-C4' energy: -138.967 flat angles C4'-P-C4' energy: -154.629 flat angles P-C4'-P energy: -114.990 tors. eta vs tors. theta energy: -151.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1786.125815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1786.125815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.125815 (E_RNA) where: Base-Base interactions energy: -1152.460 where: short stacking energy: -551.087 Base-Backbone interact. energy: -5.561 local terms energy: -628.105656 where: bonds (distance) C4'-P energy: -133.072 bonds (distance) P-C4' energy: -161.256 flat angles C4'-P-C4' energy: -135.411 flat angles P-C4'-P energy: -81.066 tors. eta vs tors. theta energy: -117.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1712.892473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1712.892473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.892473 (E_RNA) where: Base-Base interactions energy: -1106.489 where: short stacking energy: -507.732 Base-Backbone interact. energy: 3.420 local terms energy: -609.823598 where: bonds (distance) C4'-P energy: -130.954 bonds (distance) P-C4' energy: -148.520 flat angles C4'-P-C4' energy: -128.457 flat angles P-C4'-P energy: -82.550 tors. eta vs tors. theta energy: -119.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1441.715744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.715744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.715744 (E_RNA) where: Base-Base interactions energy: -878.085 where: short stacking energy: -443.852 Base-Backbone interact. energy: -0.913 local terms energy: -562.717383 where: bonds (distance) C4'-P energy: -133.997 bonds (distance) P-C4' energy: -134.986 flat angles C4'-P-C4' energy: -110.019 flat angles P-C4'-P energy: -99.553 tors. eta vs tors. theta energy: -84.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1505.584487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.584487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.584487 (E_RNA) where: Base-Base interactions energy: -969.206 where: short stacking energy: -451.680 Base-Backbone interact. energy: 1.062 local terms energy: -537.439836 where: bonds (distance) C4'-P energy: -117.446 bonds (distance) P-C4' energy: -133.660 flat angles C4'-P-C4' energy: -136.585 flat angles P-C4'-P energy: -62.264 tors. eta vs tors. theta energy: -87.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1220.207274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.207274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.207274 (E_RNA) where: Base-Base interactions energy: -723.261 where: short stacking energy: -381.289 Base-Backbone interact. energy: -1.632 local terms energy: -495.315079 where: bonds (distance) C4'-P energy: -102.904 bonds (distance) P-C4' energy: -126.055 flat angles C4'-P-C4' energy: -130.313 flat angles P-C4'-P energy: -65.017 tors. eta vs tors. theta energy: -71.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1031.309789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.309789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.309789 (E_RNA) where: Base-Base interactions energy: -575.393 where: short stacking energy: -313.673 Base-Backbone interact. energy: -2.447 local terms energy: -453.469490 where: bonds (distance) C4'-P energy: -128.512 bonds (distance) P-C4' energy: -116.769 flat angles C4'-P-C4' energy: -119.002 flat angles P-C4'-P energy: -63.643 tors. eta vs tors. theta energy: -25.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -864.037034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.037034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.037034 (E_RNA) where: Base-Base interactions energy: -449.193 where: short stacking energy: -233.776 Base-Backbone interact. energy: -2.163 local terms energy: -412.680370 where: bonds (distance) C4'-P energy: -113.616 bonds (distance) P-C4' energy: -132.309 flat angles C4'-P-C4' energy: -100.632 flat angles P-C4'-P energy: -71.760 tors. eta vs tors. theta energy: 5.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -731.984987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.984987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.984987 (E_RNA) where: Base-Base interactions energy: -349.457 where: short stacking energy: -219.147 Base-Backbone interact. energy: -2.498 local terms energy: -380.029868 where: bonds (distance) C4'-P energy: -107.981 bonds (distance) P-C4' energy: -118.805 flat angles C4'-P-C4' energy: -108.144 flat angles P-C4'-P energy: -47.355 tors. eta vs tors. theta energy: 2.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2234.536127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2234.536127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2234.536127 (E_RNA) where: Base-Base interactions energy: -1482.426 where: short stacking energy: -663.955 Base-Backbone interact. energy: -1.442 local terms energy: -750.667627 where: bonds (distance) C4'-P energy: -157.580 bonds (distance) P-C4' energy: -150.903 flat angles C4'-P-C4' energy: -158.182 flat angles P-C4'-P energy: -97.584 tors. eta vs tors. theta energy: -186.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1900.876807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1900.876807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1900.876807 (E_RNA) where: Base-Base interactions energy: -1216.299 where: short stacking energy: -566.508 Base-Backbone interact. energy: -3.602 local terms energy: -680.976237 where: bonds (distance) C4'-P energy: -149.315 bonds (distance) P-C4' energy: -144.308 flat angles C4'-P-C4' energy: -153.008 flat angles P-C4'-P energy: -93.574 tors. eta vs tors. theta energy: -140.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1787.779222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.779222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.779222 (E_RNA) where: Base-Base interactions energy: -1149.118 where: short stacking energy: -516.245 Base-Backbone interact. energy: 0.925 local terms energy: -639.586272 where: bonds (distance) C4'-P energy: -145.815 bonds (distance) P-C4' energy: -148.824 flat angles C4'-P-C4' energy: -139.805 flat angles P-C4'-P energy: -91.603 tors. eta vs tors. theta energy: -113.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1815.267876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1815.267876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1815.267876 (E_RNA) where: Base-Base interactions energy: -1203.764 where: short stacking energy: -539.130 Base-Backbone interact. energy: -0.833 local terms energy: -610.670353 where: bonds (distance) C4'-P energy: -128.938 bonds (distance) P-C4' energy: -122.670 flat angles C4'-P-C4' energy: -153.331 flat angles P-C4'-P energy: -83.373 tors. eta vs tors. theta energy: -122.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1470.747894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.747894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.747894 (E_RNA) where: Base-Base interactions energy: -906.189 where: short stacking energy: -425.939 Base-Backbone interact. energy: 2.606 local terms energy: -567.165594 where: bonds (distance) C4'-P energy: -127.612 bonds (distance) P-C4' energy: -137.728 flat angles C4'-P-C4' energy: -139.414 flat angles P-C4'-P energy: -72.938 tors. eta vs tors. theta energy: -89.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1535.036747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.036747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.036747 (E_RNA) where: Base-Base interactions energy: -996.156 where: short stacking energy: -448.750 Base-Backbone interact. energy: 1.421 local terms energy: -540.302486 where: bonds (distance) C4'-P energy: -121.936 bonds (distance) P-C4' energy: -115.386 flat angles C4'-P-C4' energy: -142.647 flat angles P-C4'-P energy: -72.148 tors. eta vs tors. theta energy: -88.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1228.762451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.762451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.762451 (E_RNA) where: Base-Base interactions energy: -718.011 where: short stacking energy: -371.226 Base-Backbone interact. energy: -1.542 local terms energy: -509.209229 where: bonds (distance) C4'-P energy: -104.198 bonds (distance) P-C4' energy: -126.224 flat angles C4'-P-C4' energy: -131.566 flat angles P-C4'-P energy: -66.025 tors. eta vs tors. theta energy: -81.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1006.755791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.755791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.755791 (E_RNA) where: Base-Base interactions energy: -533.133 where: short stacking energy: -280.353 Base-Backbone interact. energy: -3.743 local terms energy: -469.879644 where: bonds (distance) C4'-P energy: -128.909 bonds (distance) P-C4' energy: -128.431 flat angles C4'-P-C4' energy: -114.091 flat angles P-C4'-P energy: -75.208 tors. eta vs tors. theta energy: -23.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -814.061136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.061136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.061136 (E_RNA) where: Base-Base interactions energy: -376.414 where: short stacking energy: -237.526 Base-Backbone interact. energy: 0.093 local terms energy: -437.740566 where: bonds (distance) C4'-P energy: -126.059 bonds (distance) P-C4' energy: -141.357 flat angles C4'-P-C4' energy: -114.831 flat angles P-C4'-P energy: -61.327 tors. eta vs tors. theta energy: 5.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -705.708569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.708569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.708569 (E_RNA) where: Base-Base interactions energy: -326.432 where: short stacking energy: -187.783 Base-Backbone interact. energy: -3.293 local terms energy: -375.983911 where: bonds (distance) C4'-P energy: -128.581 bonds (distance) P-C4' energy: -123.530 flat angles C4'-P-C4' energy: -89.764 flat angles P-C4'-P energy: -46.692 tors. eta vs tors. theta energy: 12.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2242.698436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2242.698436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2242.698436 (E_RNA) where: Base-Base interactions energy: -1467.802 where: short stacking energy: -671.635 Base-Backbone interact. energy: -2.121 local terms energy: -772.775676 where: bonds (distance) C4'-P energy: -153.752 bonds (distance) P-C4' energy: -144.519 flat angles C4'-P-C4' energy: -162.864 flat angles P-C4'-P energy: -111.192 tors. eta vs tors. theta energy: -200.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1925.541412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1925.541412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1925.541412 (E_RNA) where: Base-Base interactions energy: -1229.305 where: short stacking energy: -620.304 Base-Backbone interact. energy: -2.112 local terms energy: -694.124173 where: bonds (distance) C4'-P energy: -137.220 bonds (distance) P-C4' energy: -153.893 flat angles C4'-P-C4' energy: -149.878 flat angles P-C4'-P energy: -98.029 tors. eta vs tors. theta energy: -155.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1895.180282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.180282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.180282 (E_RNA) where: Base-Base interactions energy: -1209.947 where: short stacking energy: -596.539 Base-Backbone interact. energy: -0.807 local terms energy: -684.425913 where: bonds (distance) C4'-P energy: -134.261 bonds (distance) P-C4' energy: -143.881 flat angles C4'-P-C4' energy: -157.076 flat angles P-C4'-P energy: -101.982 tors. eta vs tors. theta energy: -147.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1755.974729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1755.974729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.974729 (E_RNA) where: Base-Base interactions energy: -1127.713 where: short stacking energy: -538.457 Base-Backbone interact. energy: -1.929 local terms energy: -626.333443 where: bonds (distance) C4'-P energy: -127.938 bonds (distance) P-C4' energy: -148.500 flat angles C4'-P-C4' energy: -131.493 flat angles P-C4'-P energy: -95.664 tors. eta vs tors. theta energy: -122.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1615.591562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.591562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.591562 (E_RNA) where: Base-Base interactions energy: -1010.923 where: short stacking energy: -473.958 Base-Backbone interact. energy: -0.211 local terms energy: -605.486367 where: bonds (distance) C4'-P energy: -139.232 bonds (distance) P-C4' energy: -128.381 flat angles C4'-P-C4' energy: -149.262 flat angles P-C4'-P energy: -86.374 tors. eta vs tors. theta energy: -102.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.029 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1455.024263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.024263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.024263 (E_RNA) where: Base-Base interactions energy: -870.716 where: short stacking energy: -415.393 Base-Backbone interact. energy: -1.808 local terms energy: -582.500871 where: bonds (distance) C4'-P energy: -125.169 bonds (distance) P-C4' energy: -140.268 flat angles C4'-P-C4' energy: -140.706 flat angles P-C4'-P energy: -71.336 tors. eta vs tors. theta energy: -105.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1216.579584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.579584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.579584 (E_RNA) where: Base-Base interactions energy: -714.584 where: short stacking energy: -380.836 Base-Backbone interact. energy: -1.268 local terms energy: -500.727147 where: bonds (distance) C4'-P energy: -113.785 bonds (distance) P-C4' energy: -148.033 flat angles C4'-P-C4' energy: -121.678 flat angles P-C4'-P energy: -62.646 tors. eta vs tors. theta energy: -54.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1106.808734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.808734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.808734 (E_RNA) where: Base-Base interactions energy: -644.441 where: short stacking energy: -345.259 Base-Backbone interact. energy: -2.344 local terms energy: -460.024282 where: bonds (distance) C4'-P energy: -133.928 bonds (distance) P-C4' energy: -114.861 flat angles C4'-P-C4' energy: -106.888 flat angles P-C4'-P energy: -75.060 tors. eta vs tors. theta energy: -29.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -838.617842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.617842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.617842 (E_RNA) where: Base-Base interactions energy: -396.908 where: short stacking energy: -250.276 Base-Backbone interact. energy: -1.941 local terms energy: -439.768762 where: bonds (distance) C4'-P energy: -127.559 bonds (distance) P-C4' energy: -119.332 flat angles C4'-P-C4' energy: -121.243 flat angles P-C4'-P energy: -61.010 tors. eta vs tors. theta energy: -10.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -709.311338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.311338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.311338 (E_RNA) where: Base-Base interactions energy: -355.175 where: short stacking energy: -213.569 Base-Backbone interact. energy: 0.800 local terms energy: -354.936067 where: bonds (distance) C4'-P energy: -93.409 bonds (distance) P-C4' energy: -124.598 flat angles C4'-P-C4' energy: -77.845 flat angles P-C4'-P energy: -64.433 tors. eta vs tors. theta energy: 5.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2261.929682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2261.929682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.929682 (E_RNA) where: Base-Base interactions energy: -1515.878 where: short stacking energy: -691.879 Base-Backbone interact. energy: -2.536 local terms energy: -743.515164 where: bonds (distance) C4'-P energy: -139.935 bonds (distance) P-C4' energy: -139.336 flat angles C4'-P-C4' energy: -166.519 flat angles P-C4'-P energy: -92.522 tors. eta vs tors. theta energy: -205.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1878.164540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1878.164540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1878.164540 (E_RNA) where: Base-Base interactions energy: -1186.433 where: short stacking energy: -597.112 Base-Backbone interact. energy: -4.144 local terms energy: -687.587406 where: bonds (distance) C4'-P energy: -137.821 bonds (distance) P-C4' energy: -133.881 flat angles C4'-P-C4' energy: -160.764 flat angles P-C4'-P energy: -106.605 tors. eta vs tors. theta energy: -148.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1896.256357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1896.256357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1896.256357 (E_RNA) where: Base-Base interactions energy: -1233.205 where: short stacking energy: -594.865 Base-Backbone interact. energy: -3.652 local terms energy: -659.399303 where: bonds (distance) C4'-P energy: -130.820 bonds (distance) P-C4' energy: -142.268 flat angles C4'-P-C4' energy: -146.570 flat angles P-C4'-P energy: -103.382 tors. eta vs tors. theta energy: -136.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1804.954038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1804.954038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1804.954038 (E_RNA) where: Base-Base interactions energy: -1185.300 where: short stacking energy: -512.019 Base-Backbone interact. energy: -1.448 local terms energy: -618.205662 where: bonds (distance) C4'-P energy: -123.924 bonds (distance) P-C4' energy: -133.865 flat angles C4'-P-C4' energy: -140.413 flat angles P-C4'-P energy: -94.979 tors. eta vs tors. theta energy: -125.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1680.168353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.168353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.168353 (E_RNA) where: Base-Base interactions energy: -1078.257 where: short stacking energy: -520.182 Base-Backbone interact. energy: 1.485 local terms energy: -603.397120 where: bonds (distance) C4'-P energy: -132.530 bonds (distance) P-C4' energy: -152.246 flat angles C4'-P-C4' energy: -132.289 flat angles P-C4'-P energy: -73.616 tors. eta vs tors. theta energy: -112.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1409.667234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.667234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.667234 (E_RNA) where: Base-Base interactions energy: -859.813 where: short stacking energy: -421.038 Base-Backbone interact. energy: 0.018 local terms energy: -549.872476 where: bonds (distance) C4'-P energy: -134.024 bonds (distance) P-C4' energy: -138.119 flat angles C4'-P-C4' energy: -108.779 flat angles P-C4'-P energy: -73.061 tors. eta vs tors. theta energy: -95.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1218.407131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.407131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.407131 (E_RNA) where: Base-Base interactions energy: -681.736 where: short stacking energy: -380.559 Base-Backbone interact. energy: 1.854 local terms energy: -538.525886 where: bonds (distance) C4'-P energy: -111.712 bonds (distance) P-C4' energy: -139.309 flat angles C4'-P-C4' energy: -127.164 flat angles P-C4'-P energy: -86.810 tors. eta vs tors. theta energy: -73.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1152.143754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.143754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.143754 (E_RNA) where: Base-Base interactions energy: -682.053 where: short stacking energy: -349.232 Base-Backbone interact. energy: -0.924 local terms energy: -469.167051 where: bonds (distance) C4'-P energy: -117.847 bonds (distance) P-C4' energy: -127.698 flat angles C4'-P-C4' energy: -121.671 flat angles P-C4'-P energy: -71.340 tors. eta vs tors. theta energy: -30.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -849.856120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.856120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.856120 (E_RNA) where: Base-Base interactions energy: -421.922 where: short stacking energy: -269.537 Base-Backbone interact. energy: -1.014 local terms energy: -426.919879 where: bonds (distance) C4'-P energy: -136.236 bonds (distance) P-C4' energy: -129.233 flat angles C4'-P-C4' energy: -95.462 flat angles P-C4'-P energy: -52.044 tors. eta vs tors. theta energy: -13.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -770.286514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.286514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.286514 (E_RNA) where: Base-Base interactions energy: -380.973 where: short stacking energy: -231.104 Base-Backbone interact. energy: -3.424 local terms energy: -385.889337 where: bonds (distance) C4'-P energy: -106.418 bonds (distance) P-C4' energy: -118.623 flat angles C4'-P-C4' energy: -109.778 flat angles P-C4'-P energy: -62.929 tors. eta vs tors. theta energy: 11.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2258.719258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2258.719258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2258.719258 (E_RNA) where: Base-Base interactions energy: -1522.432 where: short stacking energy: -701.196 Base-Backbone interact. energy: -2.720 local terms energy: -733.567271 where: bonds (distance) C4'-P energy: -136.351 bonds (distance) P-C4' energy: -143.483 flat angles C4'-P-C4' energy: -157.708 flat angles P-C4'-P energy: -104.872 tors. eta vs tors. theta energy: -191.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1883.058613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.058613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.058613 (E_RNA) where: Base-Base interactions energy: -1199.589 where: short stacking energy: -629.181 Base-Backbone interact. energy: -2.969 local terms energy: -680.499648 where: bonds (distance) C4'-P energy: -129.886 bonds (distance) P-C4' energy: -150.049 flat angles C4'-P-C4' energy: -141.661 flat angles P-C4'-P energy: -95.905 tors. eta vs tors. theta energy: -162.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1886.778112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1886.778112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1886.778112 (E_RNA) where: Base-Base interactions energy: -1227.113 where: short stacking energy: -570.286 Base-Backbone interact. energy: -1.025 local terms energy: -658.640361 where: bonds (distance) C4'-P energy: -137.167 bonds (distance) P-C4' energy: -139.176 flat angles C4'-P-C4' energy: -153.536 flat angles P-C4'-P energy: -92.928 tors. eta vs tors. theta energy: -135.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1793.136286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1793.136286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1793.136286 (E_RNA) where: Base-Base interactions energy: -1179.054 where: short stacking energy: -522.791 Base-Backbone interact. energy: -2.697 local terms energy: -611.385503 where: bonds (distance) C4'-P energy: -134.318 bonds (distance) P-C4' energy: -140.110 flat angles C4'-P-C4' energy: -137.579 flat angles P-C4'-P energy: -88.217 tors. eta vs tors. theta energy: -111.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1703.675113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.675113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.675113 (E_RNA) where: Base-Base interactions energy: -1088.325 where: short stacking energy: -509.204 Base-Backbone interact. energy: -3.450 local terms energy: -611.900949 where: bonds (distance) C4'-P energy: -137.965 bonds (distance) P-C4' energy: -125.418 flat angles C4'-P-C4' energy: -144.711 flat angles P-C4'-P energy: -83.347 tors. eta vs tors. theta energy: -120.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1352.747409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.747409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.747409 (E_RNA) where: Base-Base interactions energy: -808.914 where: short stacking energy: -399.646 Base-Backbone interact. energy: -1.952 local terms energy: -541.881367 where: bonds (distance) C4'-P energy: -124.772 bonds (distance) P-C4' energy: -132.156 flat angles C4'-P-C4' energy: -141.353 flat angles P-C4'-P energy: -74.644 tors. eta vs tors. theta energy: -68.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1251.859330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.859330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.859330 (E_RNA) where: Base-Base interactions energy: -743.688 where: short stacking energy: -382.750 Base-Backbone interact. energy: 1.696 local terms energy: -509.867548 where: bonds (distance) C4'-P energy: -123.033 bonds (distance) P-C4' energy: -125.652 flat angles C4'-P-C4' energy: -128.094 flat angles P-C4'-P energy: -74.596 tors. eta vs tors. theta energy: -58.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1111.587791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.587791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.587791 (E_RNA) where: Base-Base interactions energy: -646.522 where: short stacking energy: -309.397 Base-Backbone interact. energy: 1.845 local terms energy: -466.911612 where: bonds (distance) C4'-P energy: -121.142 bonds (distance) P-C4' energy: -126.288 flat angles C4'-P-C4' energy: -126.930 flat angles P-C4'-P energy: -64.746 tors. eta vs tors. theta energy: -27.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -812.359213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.359213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.359213 (E_RNA) where: Base-Base interactions energy: -397.932 where: short stacking energy: -253.938 Base-Backbone interact. energy: 5.393 local terms energy: -419.820337 where: bonds (distance) C4'-P energy: -97.978 bonds (distance) P-C4' energy: -130.156 flat angles C4'-P-C4' energy: -114.022 flat angles P-C4'-P energy: -54.966 tors. eta vs tors. theta energy: -22.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -724.531888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.531888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.531888 (E_RNA) where: Base-Base interactions energy: -316.167 where: short stacking energy: -204.073 Base-Backbone interact. energy: -0.523 local terms energy: -407.842635 where: bonds (distance) C4'-P energy: -108.541 bonds (distance) P-C4' energy: -123.429 flat angles C4'-P-C4' energy: -98.690 flat angles P-C4'-P energy: -64.987 tors. eta vs tors. theta energy: -12.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2240.657668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2240.657668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.657668 (E_RNA) where: Base-Base interactions energy: -1475.459 where: short stacking energy: -667.799 Base-Backbone interact. energy: -4.057 local terms energy: -761.142372 where: bonds (distance) C4'-P energy: -145.066 bonds (distance) P-C4' energy: -160.695 flat angles C4'-P-C4' energy: -152.791 flat angles P-C4'-P energy: -118.227 tors. eta vs tors. theta energy: -184.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1960.636551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1960.636551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1960.636551 (E_RNA) where: Base-Base interactions energy: -1294.984 where: short stacking energy: -607.377 Base-Backbone interact. energy: -3.236 local terms energy: -662.416435 where: bonds (distance) C4'-P energy: -138.445 bonds (distance) P-C4' energy: -133.573 flat angles C4'-P-C4' energy: -154.378 flat angles P-C4'-P energy: -87.471 tors. eta vs tors. theta energy: -148.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1816.822349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1816.822349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1816.822349 (E_RNA) where: Base-Base interactions energy: -1148.193 where: short stacking energy: -562.025 Base-Backbone interact. energy: -0.530 local terms energy: -668.099879 where: bonds (distance) C4'-P energy: -125.844 bonds (distance) P-C4' energy: -145.926 flat angles C4'-P-C4' energy: -152.210 flat angles P-C4'-P energy: -94.678 tors. eta vs tors. theta energy: -149.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1832.798900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1832.798900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1832.798900 (E_RNA) where: Base-Base interactions energy: -1198.881 where: short stacking energy: -534.660 Base-Backbone interact. energy: -3.826 local terms energy: -630.091820 where: bonds (distance) C4'-P energy: -137.317 bonds (distance) P-C4' energy: -144.275 flat angles C4'-P-C4' energy: -145.707 flat angles P-C4'-P energy: -71.939 tors. eta vs tors. theta energy: -130.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1711.844166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1711.844166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.844166 (E_RNA) where: Base-Base interactions energy: -1102.076 where: short stacking energy: -488.488 Base-Backbone interact. energy: 1.168 local terms energy: -610.935854 where: bonds (distance) C4'-P energy: -132.791 bonds (distance) P-C4' energy: -153.648 flat angles C4'-P-C4' energy: -137.667 flat angles P-C4'-P energy: -79.489 tors. eta vs tors. theta energy: -107.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1295.012802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.012802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.012802 (E_RNA) where: Base-Base interactions energy: -743.873 where: short stacking energy: -401.236 Base-Backbone interact. energy: -2.495 local terms energy: -548.644900 where: bonds (distance) C4'-P energy: -123.723 bonds (distance) P-C4' energy: -129.238 flat angles C4'-P-C4' energy: -142.695 flat angles P-C4'-P energy: -83.925 tors. eta vs tors. theta energy: -69.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1323.817949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.817949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.817949 (E_RNA) where: Base-Base interactions energy: -778.830 where: short stacking energy: -415.221 Base-Backbone interact. energy: 9.804 local terms energy: -554.791203 where: bonds (distance) C4'-P energy: -121.030 bonds (distance) P-C4' energy: -136.542 flat angles C4'-P-C4' energy: -133.080 flat angles P-C4'-P energy: -77.268 tors. eta vs tors. theta energy: -86.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1162.762241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.762241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.762241 (E_RNA) where: Base-Base interactions energy: -689.941 where: short stacking energy: -366.206 Base-Backbone interact. energy: -0.102 local terms energy: -472.719527 where: bonds (distance) C4'-P energy: -103.076 bonds (distance) P-C4' energy: -121.154 flat angles C4'-P-C4' energy: -127.772 flat angles P-C4'-P energy: -69.902 tors. eta vs tors. theta energy: -50.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -831.758084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.758084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.758084 (E_RNA) where: Base-Base interactions energy: -471.800 where: short stacking energy: -245.042 Base-Backbone interact. energy: -1.167 local terms energy: -358.791201 where: bonds (distance) C4'-P energy: -120.236 bonds (distance) P-C4' energy: -104.043 flat angles C4'-P-C4' energy: -90.873 flat angles P-C4'-P energy: -54.987 tors. eta vs tors. theta energy: 11.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -702.741902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.741902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.741902 (E_RNA) where: Base-Base interactions energy: -310.028 where: short stacking energy: -176.999 Base-Backbone interact. energy: -3.855 local terms energy: -388.859037 where: bonds (distance) C4'-P energy: -117.578 bonds (distance) P-C4' energy: -138.929 flat angles C4'-P-C4' energy: -89.886 flat angles P-C4'-P energy: -50.441 tors. eta vs tors. theta energy: 7.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2266.634664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2266.634664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2266.634664 (E_RNA) where: Base-Base interactions energy: -1489.329 where: short stacking energy: -698.878 Base-Backbone interact. energy: 0.565 local terms energy: -777.871149 where: bonds (distance) C4'-P energy: -134.239 bonds (distance) P-C4' energy: -157.583 flat angles C4'-P-C4' energy: -167.448 flat angles P-C4'-P energy: -112.726 tors. eta vs tors. theta energy: -205.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2029.778738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.778738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.778738 (E_RNA) where: Base-Base interactions energy: -1336.162 where: short stacking energy: -658.686 Base-Backbone interact. energy: 0.900 local terms energy: -694.516492 where: bonds (distance) C4'-P energy: -131.064 bonds (distance) P-C4' energy: -133.555 flat angles C4'-P-C4' energy: -156.546 flat angles P-C4'-P energy: -102.100 tors. eta vs tors. theta energy: -171.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1921.566871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1921.566871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1921.566871 (E_RNA) where: Base-Base interactions energy: -1269.087 where: short stacking energy: -605.669 Base-Backbone interact. energy: -5.149 local terms energy: -647.331373 where: bonds (distance) C4'-P energy: -118.023 bonds (distance) P-C4' energy: -153.657 flat angles C4'-P-C4' energy: -146.234 flat angles P-C4'-P energy: -92.554 tors. eta vs tors. theta energy: -136.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1744.373068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1744.373068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1744.373068 (E_RNA) where: Base-Base interactions energy: -1119.245 where: short stacking energy: -543.404 Base-Backbone interact. energy: -4.460 local terms energy: -620.668041 where: bonds (distance) C4'-P energy: -124.911 bonds (distance) P-C4' energy: -127.346 flat angles C4'-P-C4' energy: -141.747 flat angles P-C4'-P energy: -99.029 tors. eta vs tors. theta energy: -127.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1733.828880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.828880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.828880 (E_RNA) where: Base-Base interactions energy: -1106.462 where: short stacking energy: -525.094 Base-Backbone interact. energy: -0.702 local terms energy: -626.664431 where: bonds (distance) C4'-P energy: -121.735 bonds (distance) P-C4' energy: -119.476 flat angles C4'-P-C4' energy: -143.416 flat angles P-C4'-P energy: -104.316 tors. eta vs tors. theta energy: -137.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1344.355502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.355502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.355502 (E_RNA) where: Base-Base interactions energy: -801.697 where: short stacking energy: -433.559 Base-Backbone interact. energy: -3.388 local terms energy: -539.271239 where: bonds (distance) C4'-P energy: -132.253 bonds (distance) P-C4' energy: -123.733 flat angles C4'-P-C4' energy: -110.120 flat angles P-C4'-P energy: -92.113 tors. eta vs tors. theta energy: -81.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1312.436084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.436084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.436084 (E_RNA) where: Base-Base interactions energy: -738.652 where: short stacking energy: -379.444 Base-Backbone interact. energy: -1.947 local terms energy: -571.836693 where: bonds (distance) C4'-P energy: -140.693 bonds (distance) P-C4' energy: -136.325 flat angles C4'-P-C4' energy: -135.367 flat angles P-C4'-P energy: -76.649 tors. eta vs tors. theta energy: -82.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1164.389886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.389886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.389886 (E_RNA) where: Base-Base interactions energy: -714.049 where: short stacking energy: -354.595 Base-Backbone interact. energy: 2.245 local terms energy: -452.586825 where: bonds (distance) C4'-P energy: -116.781 bonds (distance) P-C4' energy: -118.263 flat angles C4'-P-C4' energy: -118.789 flat angles P-C4'-P energy: -69.324 tors. eta vs tors. theta energy: -29.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -812.964670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.964670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.964670 (E_RNA) where: Base-Base interactions energy: -401.978 where: short stacking energy: -233.090 Base-Backbone interact. energy: 2.999 local terms energy: -413.986198 where: bonds (distance) C4'-P energy: -131.267 bonds (distance) P-C4' energy: -104.805 flat angles C4'-P-C4' energy: -105.871 flat angles P-C4'-P energy: -56.346 tors. eta vs tors. theta energy: -15.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -747.223826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.223826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.223826 (E_RNA) where: Base-Base interactions energy: -363.443 where: short stacking energy: -217.162 Base-Backbone interact. energy: 1.875 local terms energy: -386.170467 where: bonds (distance) C4'-P energy: -112.458 bonds (distance) P-C4' energy: -126.772 flat angles C4'-P-C4' energy: -95.701 flat angles P-C4'-P energy: -59.812 tors. eta vs tors. theta energy: 8.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.516 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2256.143887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2256.143887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.143887 (E_RNA) where: Base-Base interactions energy: -1484.581 where: short stacking energy: -698.633 Base-Backbone interact. energy: -4.354 local terms energy: -767.208952 where: bonds (distance) C4'-P energy: -141.141 bonds (distance) P-C4' energy: -143.695 flat angles C4'-P-C4' energy: -173.718 flat angles P-C4'-P energy: -113.518 tors. eta vs tors. theta energy: -195.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2061.475794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2061.475794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2061.475794 (E_RNA) where: Base-Base interactions energy: -1373.671 where: short stacking energy: -672.144 Base-Backbone interact. energy: -2.531 local terms energy: -685.273448 where: bonds (distance) C4'-P energy: -132.005 bonds (distance) P-C4' energy: -147.959 flat angles C4'-P-C4' energy: -146.890 flat angles P-C4'-P energy: -96.179 tors. eta vs tors. theta energy: -162.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1888.620004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1888.620004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1888.620004 (E_RNA) where: Base-Base interactions energy: -1232.076 where: short stacking energy: -540.545 Base-Backbone interact. energy: -2.403 local terms energy: -654.141775 where: bonds (distance) C4'-P energy: -144.954 bonds (distance) P-C4' energy: -133.429 flat angles C4'-P-C4' energy: -140.888 flat angles P-C4'-P energy: -107.166 tors. eta vs tors. theta energy: -127.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1744.535398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1744.535398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1744.535398 (E_RNA) where: Base-Base interactions energy: -1092.304 where: short stacking energy: -496.885 Base-Backbone interact. energy: -3.364 local terms energy: -648.867345 where: bonds (distance) C4'-P energy: -139.587 bonds (distance) P-C4' energy: -136.855 flat angles C4'-P-C4' energy: -147.850 flat angles P-C4'-P energy: -100.762 tors. eta vs tors. theta energy: -123.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1728.553130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.553130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.553130 (E_RNA) where: Base-Base interactions energy: -1122.139 where: short stacking energy: -500.434 Base-Backbone interact. energy: -3.269 local terms energy: -603.145116 where: bonds (distance) C4'-P energy: -128.045 bonds (distance) P-C4' energy: -130.075 flat angles C4'-P-C4' energy: -150.955 flat angles P-C4'-P energy: -79.917 tors. eta vs tors. theta energy: -114.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1339.899129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.899129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.899129 (E_RNA) where: Base-Base interactions energy: -771.843 where: short stacking energy: -425.595 Base-Backbone interact. energy: -1.148 local terms energy: -566.907550 where: bonds (distance) C4'-P energy: -127.564 bonds (distance) P-C4' energy: -140.740 flat angles C4'-P-C4' energy: -139.431 flat angles P-C4'-P energy: -83.825 tors. eta vs tors. theta energy: -75.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1254.026641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.026641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.026641 (E_RNA) where: Base-Base interactions energy: -731.809 where: short stacking energy: -394.595 Base-Backbone interact. energy: 1.640 local terms energy: -523.858342 where: bonds (distance) C4'-P energy: -128.503 bonds (distance) P-C4' energy: -113.755 flat angles C4'-P-C4' energy: -133.407 flat angles P-C4'-P energy: -77.330 tors. eta vs tors. theta energy: -70.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1175.826910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.826910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.826910 (E_RNA) where: Base-Base interactions energy: -727.536 where: short stacking energy: -340.298 Base-Backbone interact. energy: 1.722 local terms energy: -450.013011 where: bonds (distance) C4'-P energy: -107.392 bonds (distance) P-C4' energy: -123.626 flat angles C4'-P-C4' energy: -115.697 flat angles P-C4'-P energy: -68.781 tors. eta vs tors. theta energy: -34.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -869.490752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.490752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.490752 (E_RNA) where: Base-Base interactions energy: -445.049 where: short stacking energy: -277.014 Base-Backbone interact. energy: 4.308 local terms energy: -428.749727 where: bonds (distance) C4'-P energy: -121.398 bonds (distance) P-C4' energy: -117.675 flat angles C4'-P-C4' energy: -114.878 flat angles P-C4'-P energy: -64.540 tors. eta vs tors. theta energy: -10.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -776.139910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.139910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.139910 (E_RNA) where: Base-Base interactions energy: -383.272 where: short stacking energy: -235.329 Base-Backbone interact. energy: 4.251 local terms energy: -397.118768 where: bonds (distance) C4'-P energy: -117.764 bonds (distance) P-C4' energy: -130.283 flat angles C4'-P-C4' energy: -87.361 flat angles P-C4'-P energy: -52.859 tors. eta vs tors. theta energy: -8.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2290.600877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2290.600877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2290.600877 (E_RNA) where: Base-Base interactions energy: -1510.320 where: short stacking energy: -710.304 Base-Backbone interact. energy: -3.075 local terms energy: -777.205425 where: bonds (distance) C4'-P energy: -144.193 bonds (distance) P-C4' energy: -159.983 flat angles C4'-P-C4' energy: -162.176 flat angles P-C4'-P energy: -104.887 tors. eta vs tors. theta energy: -205.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2020.079263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2020.079263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2020.079263 (E_RNA) where: Base-Base interactions energy: -1340.381 where: short stacking energy: -618.670 Base-Backbone interact. energy: -1.670 local terms energy: -678.029033 where: bonds (distance) C4'-P energy: -143.881 bonds (distance) P-C4' energy: -138.271 flat angles C4'-P-C4' energy: -164.162 flat angles P-C4'-P energy: -98.654 tors. eta vs tors. theta energy: -133.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1958.056804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1958.056804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.056804 (E_RNA) where: Base-Base interactions energy: -1316.339 where: short stacking energy: -578.074 Base-Backbone interact. energy: -2.713 local terms energy: -639.005350 where: bonds (distance) C4'-P energy: -120.147 bonds (distance) P-C4' energy: -145.268 flat angles C4'-P-C4' energy: -141.771 flat angles P-C4'-P energy: -99.339 tors. eta vs tors. theta energy: -132.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1772.111474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1772.111474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.111474 (E_RNA) where: Base-Base interactions energy: -1118.501 where: short stacking energy: -530.335 Base-Backbone interact. energy: -1.778 local terms energy: -651.832566 where: bonds (distance) C4'-P energy: -140.589 bonds (distance) P-C4' energy: -130.077 flat angles C4'-P-C4' energy: -152.368 flat angles P-C4'-P energy: -95.824 tors. eta vs tors. theta energy: -132.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1740.712421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.712421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.712421 (E_RNA) where: Base-Base interactions energy: -1101.222 where: short stacking energy: -528.679 Base-Backbone interact. energy: -0.163 local terms energy: -639.328097 where: bonds (distance) C4'-P energy: -141.291 bonds (distance) P-C4' energy: -135.141 flat angles C4'-P-C4' energy: -145.117 flat angles P-C4'-P energy: -84.566 tors. eta vs tors. theta energy: -133.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1376.925223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.925223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.925223 (E_RNA) where: Base-Base interactions energy: -852.053 where: short stacking energy: -421.841 Base-Backbone interact. energy: -4.187 local terms energy: -520.684658 where: bonds (distance) C4'-P energy: -134.606 bonds (distance) P-C4' energy: -130.614 flat angles C4'-P-C4' energy: -133.033 flat angles P-C4'-P energy: -58.708 tors. eta vs tors. theta energy: -63.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1295.673788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.673788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.673788 (E_RNA) where: Base-Base interactions energy: -746.818 where: short stacking energy: -377.881 Base-Backbone interact. energy: 0.291 local terms energy: -549.146384 where: bonds (distance) C4'-P energy: -132.471 bonds (distance) P-C4' energy: -143.242 flat angles C4'-P-C4' energy: -128.681 flat angles P-C4'-P energy: -73.308 tors. eta vs tors. theta energy: -71.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1218.529676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.529676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.529676 (E_RNA) where: Base-Base interactions energy: -715.447 where: short stacking energy: -355.523 Base-Backbone interact. energy: -2.787 local terms energy: -500.295459 where: bonds (distance) C4'-P energy: -110.551 bonds (distance) P-C4' energy: -140.261 flat angles C4'-P-C4' energy: -127.548 flat angles P-C4'-P energy: -74.689 tors. eta vs tors. theta energy: -47.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -840.868578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.868578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.868578 (E_RNA) where: Base-Base interactions energy: -429.750 where: short stacking energy: -220.551 Base-Backbone interact. energy: 1.376 local terms energy: -412.495186 where: bonds (distance) C4'-P energy: -136.500 bonds (distance) P-C4' energy: -117.031 flat angles C4'-P-C4' energy: -108.710 flat angles P-C4'-P energy: -55.069 tors. eta vs tors. theta energy: 4.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -751.523252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.523252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.523252 (E_RNA) where: Base-Base interactions energy: -344.184 where: short stacking energy: -195.814 Base-Backbone interact. energy: 2.658 local terms energy: -409.996551 where: bonds (distance) C4'-P energy: -124.475 bonds (distance) P-C4' energy: -122.480 flat angles C4'-P-C4' energy: -103.714 flat angles P-C4'-P energy: -81.085 tors. eta vs tors. theta energy: 21.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2282.547108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2282.547108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.547108 (E_RNA) where: Base-Base interactions energy: -1526.426 where: short stacking energy: -700.837 Base-Backbone interact. energy: 5.285 local terms energy: -761.405477 where: bonds (distance) C4'-P energy: -142.165 bonds (distance) P-C4' energy: -150.904 flat angles C4'-P-C4' energy: -162.633 flat angles P-C4'-P energy: -122.025 tors. eta vs tors. theta energy: -183.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2055.265416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.265416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.265416 (E_RNA) where: Base-Base interactions energy: -1388.724 where: short stacking energy: -619.915 Base-Backbone interact. energy: -2.038 local terms energy: -664.503854 where: bonds (distance) C4'-P energy: -135.699 bonds (distance) P-C4' energy: -136.323 flat angles C4'-P-C4' energy: -162.108 flat angles P-C4'-P energy: -80.149 tors. eta vs tors. theta energy: -150.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1890.874066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1890.874066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1890.874066 (E_RNA) where: Base-Base interactions energy: -1253.127 where: short stacking energy: -554.178 Base-Backbone interact. energy: -2.009 local terms energy: -635.737257 where: bonds (distance) C4'-P energy: -120.830 bonds (distance) P-C4' energy: -143.131 flat angles C4'-P-C4' energy: -146.136 flat angles P-C4'-P energy: -90.131 tors. eta vs tors. theta energy: -135.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1766.912836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1766.912836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.912836 (E_RNA) where: Base-Base interactions energy: -1119.053 where: short stacking energy: -548.369 Base-Backbone interact. energy: -1.928 local terms energy: -645.931971 where: bonds (distance) C4'-P energy: -125.718 bonds (distance) P-C4' energy: -139.474 flat angles C4'-P-C4' energy: -161.406 flat angles P-C4'-P energy: -79.848 tors. eta vs tors. theta energy: -139.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1761.912189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1761.912189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1761.912189 (E_RNA) where: Base-Base interactions energy: -1155.611 where: short stacking energy: -557.581 Base-Backbone interact. energy: 10.558 local terms energy: -616.858652 where: bonds (distance) C4'-P energy: -123.445 bonds (distance) P-C4' energy: -148.544 flat angles C4'-P-C4' energy: -133.767 flat angles P-C4'-P energy: -67.409 tors. eta vs tors. theta energy: -143.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1339.310514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.310514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.310514 (E_RNA) where: Base-Base interactions energy: -821.873 where: short stacking energy: -411.857 Base-Backbone interact. energy: 0.408 local terms energy: -517.845479 where: bonds (distance) C4'-P energy: -126.394 bonds (distance) P-C4' energy: -140.051 flat angles C4'-P-C4' energy: -125.066 flat angles P-C4'-P energy: -67.342 tors. eta vs tors. theta energy: -58.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1282.450282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.450282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.450282 (E_RNA) where: Base-Base interactions energy: -796.155 where: short stacking energy: -404.514 Base-Backbone interact. energy: -4.014 local terms energy: -482.281360 where: bonds (distance) C4'-P energy: -109.310 bonds (distance) P-C4' energy: -104.153 flat angles C4'-P-C4' energy: -121.320 flat angles P-C4'-P energy: -79.956 tors. eta vs tors. theta energy: -67.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1162.397493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.397493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.397493 (E_RNA) where: Base-Base interactions energy: -696.370 where: short stacking energy: -349.728 Base-Backbone interact. energy: -4.105 local terms energy: -461.922719 where: bonds (distance) C4'-P energy: -138.867 bonds (distance) P-C4' energy: -126.010 flat angles C4'-P-C4' energy: -109.826 flat angles P-C4'-P energy: -55.756 tors. eta vs tors. theta energy: -31.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -900.507449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.507449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.507449 (E_RNA) where: Base-Base interactions energy: -468.460 where: short stacking energy: -262.866 Base-Backbone interact. energy: 4.732 local terms energy: -436.779221 where: bonds (distance) C4'-P energy: -116.406 bonds (distance) P-C4' energy: -125.133 flat angles C4'-P-C4' energy: -113.417 flat angles P-C4'-P energy: -57.332 tors. eta vs tors. theta energy: -24.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -811.152422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.152422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.152422 (E_RNA) where: Base-Base interactions energy: -417.108 where: short stacking energy: -244.697 Base-Backbone interact. energy: -2.588 local terms energy: -391.456400 where: bonds (distance) C4'-P energy: -111.665 bonds (distance) P-C4' energy: -128.376 flat angles C4'-P-C4' energy: -102.508 flat angles P-C4'-P energy: -56.496 tors. eta vs tors. theta energy: 7.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2260.742260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.742260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.742260 (E_RNA) where: Base-Base interactions energy: -1499.103 where: short stacking energy: -674.727 Base-Backbone interact. energy: -0.140 local terms energy: -761.499500 where: bonds (distance) C4'-P energy: -152.331 bonds (distance) P-C4' energy: -157.358 flat angles C4'-P-C4' energy: -158.782 flat angles P-C4'-P energy: -112.207 tors. eta vs tors. theta energy: -180.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2075.685727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2075.685727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2075.685727 (E_RNA) where: Base-Base interactions energy: -1374.590 where: short stacking energy: -627.109 Base-Backbone interact. energy: -3.613 local terms energy: -697.483045 where: bonds (distance) C4'-P energy: -145.290 bonds (distance) P-C4' energy: -141.022 flat angles C4'-P-C4' energy: -151.753 flat angles P-C4'-P energy: -94.713 tors. eta vs tors. theta energy: -164.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1934.076266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.076266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.076266 (E_RNA) where: Base-Base interactions energy: -1300.186 where: short stacking energy: -549.817 Base-Backbone interact. energy: 1.231 local terms energy: -635.121203 where: bonds (distance) C4'-P energy: -127.812 bonds (distance) P-C4' energy: -132.860 flat angles C4'-P-C4' energy: -159.387 flat angles P-C4'-P energy: -93.996 tors. eta vs tors. theta energy: -121.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1774.498307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1774.498307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.498307 (E_RNA) where: Base-Base interactions energy: -1138.712 where: short stacking energy: -528.794 Base-Backbone interact. energy: -0.794 local terms energy: -634.991444 where: bonds (distance) C4'-P energy: -118.968 bonds (distance) P-C4' energy: -154.369 flat angles C4'-P-C4' energy: -139.720 flat angles P-C4'-P energy: -93.116 tors. eta vs tors. theta energy: -128.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1805.918867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1805.918867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1805.918867 (E_RNA) where: Base-Base interactions energy: -1177.407 where: short stacking energy: -552.714 Base-Backbone interact. energy: -2.169 local terms energy: -626.343310 where: bonds (distance) C4'-P energy: -130.134 bonds (distance) P-C4' energy: -135.140 flat angles C4'-P-C4' energy: -137.333 flat angles P-C4'-P energy: -96.603 tors. eta vs tors. theta energy: -127.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1394.528290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.528290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.528290 (E_RNA) where: Base-Base interactions energy: -880.435 where: short stacking energy: -435.864 Base-Backbone interact. energy: -1.864 local terms energy: -512.229120 where: bonds (distance) C4'-P energy: -118.661 bonds (distance) P-C4' energy: -124.939 flat angles C4'-P-C4' energy: -123.786 flat angles P-C4'-P energy: -70.717 tors. eta vs tors. theta energy: -74.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1322.758701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.758701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.758701 (E_RNA) where: Base-Base interactions energy: -803.470 where: short stacking energy: -383.601 Base-Backbone interact. energy: -1.881 local terms energy: -517.408067 where: bonds (distance) C4'-P energy: -111.018 bonds (distance) P-C4' energy: -131.653 flat angles C4'-P-C4' energy: -138.794 flat angles P-C4'-P energy: -75.980 tors. eta vs tors. theta energy: -59.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1232.165878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.165878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.165878 (E_RNA) where: Base-Base interactions energy: -719.484 where: short stacking energy: -367.214 Base-Backbone interact. energy: -3.923 local terms energy: -508.759280 where: bonds (distance) C4'-P energy: -110.365 bonds (distance) P-C4' energy: -140.479 flat angles C4'-P-C4' energy: -131.733 flat angles P-C4'-P energy: -71.689 tors. eta vs tors. theta energy: -54.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -849.144758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.144758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.144758 (E_RNA) where: Base-Base interactions energy: -426.141 where: short stacking energy: -248.263 Base-Backbone interact. energy: -2.574 local terms energy: -420.429507 where: bonds (distance) C4'-P energy: -110.683 bonds (distance) P-C4' energy: -119.914 flat angles C4'-P-C4' energy: -112.905 flat angles P-C4'-P energy: -71.081 tors. eta vs tors. theta energy: -5.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -818.033280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.033280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.033280 (E_RNA) where: Base-Base interactions energy: -401.994 where: short stacking energy: -218.552 Base-Backbone interact. energy: -2.102 local terms energy: -414.375633 where: bonds (distance) C4'-P energy: -107.218 bonds (distance) P-C4' energy: -116.381 flat angles C4'-P-C4' energy: -119.208 flat angles P-C4'-P energy: -65.445 tors. eta vs tors. theta energy: -6.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.438 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2275.269209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.269209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.269209 (E_RNA) where: Base-Base interactions energy: -1523.274 where: short stacking energy: -683.488 Base-Backbone interact. energy: -3.053 local terms energy: -748.942976 where: bonds (distance) C4'-P energy: -145.710 bonds (distance) P-C4' energy: -148.877 flat angles C4'-P-C4' energy: -160.026 flat angles P-C4'-P energy: -103.098 tors. eta vs tors. theta energy: -191.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2035.975449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2035.975449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2035.975449 (E_RNA) where: Base-Base interactions energy: -1319.071 where: short stacking energy: -607.035 Base-Backbone interact. energy: -1.500 local terms energy: -715.403678 where: bonds (distance) C4'-P energy: -136.491 bonds (distance) P-C4' energy: -155.027 flat angles C4'-P-C4' energy: -156.893 flat angles P-C4'-P energy: -106.729 tors. eta vs tors. theta energy: -160.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1971.219840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.219840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.219840 (E_RNA) where: Base-Base interactions energy: -1331.915 where: short stacking energy: -559.625 Base-Backbone interact. energy: 0.081 local terms energy: -639.385897 where: bonds (distance) C4'-P energy: -131.403 bonds (distance) P-C4' energy: -139.341 flat angles C4'-P-C4' energy: -150.217 flat angles P-C4'-P energy: -87.534 tors. eta vs tors. theta energy: -130.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1899.986707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.986707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.986707 (E_RNA) where: Base-Base interactions energy: -1253.250 where: short stacking energy: -591.643 Base-Backbone interact. energy: 0.108 local terms energy: -646.844830 where: bonds (distance) C4'-P energy: -129.355 bonds (distance) P-C4' energy: -147.279 flat angles C4'-P-C4' energy: -139.222 flat angles P-C4'-P energy: -91.987 tors. eta vs tors. theta energy: -139.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1715.256764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.256764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1715.256764 (E_RNA) where: Base-Base interactions energy: -1082.988 where: short stacking energy: -518.369 Base-Backbone interact. energy: 3.230 local terms energy: -635.498782 where: bonds (distance) C4'-P energy: -135.440 bonds (distance) P-C4' energy: -136.406 flat angles C4'-P-C4' energy: -134.986 flat angles P-C4'-P energy: -97.895 tors. eta vs tors. theta energy: -130.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1474.929162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.929162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.929162 (E_RNA) where: Base-Base interactions energy: -917.588 where: short stacking energy: -450.944 Base-Backbone interact. energy: -2.667 local terms energy: -554.673545 where: bonds (distance) C4'-P energy: -128.061 bonds (distance) P-C4' energy: -139.359 flat angles C4'-P-C4' energy: -136.893 flat angles P-C4'-P energy: -69.746 tors. eta vs tors. theta energy: -80.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1342.925701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.925701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.925701 (E_RNA) where: Base-Base interactions energy: -802.053 where: short stacking energy: -380.091 Base-Backbone interact. energy: -0.603 local terms energy: -540.268883 where: bonds (distance) C4'-P energy: -122.664 bonds (distance) P-C4' energy: -133.837 flat angles C4'-P-C4' energy: -127.794 flat angles P-C4'-P energy: -85.193 tors. eta vs tors. theta energy: -70.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1220.958012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.958012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.958012 (E_RNA) where: Base-Base interactions energy: -734.329 where: short stacking energy: -356.680 Base-Backbone interact. energy: -0.058 local terms energy: -486.571176 where: bonds (distance) C4'-P energy: -134.645 bonds (distance) P-C4' energy: -128.933 flat angles C4'-P-C4' energy: -123.987 flat angles P-C4'-P energy: -59.321 tors. eta vs tors. theta energy: -39.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -853.820106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.820106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.820106 (E_RNA) where: Base-Base interactions energy: -457.142 where: short stacking energy: -259.359 Base-Backbone interact. energy: -1.392 local terms energy: -395.286374 where: bonds (distance) C4'-P energy: -110.615 bonds (distance) P-C4' energy: -111.046 flat angles C4'-P-C4' energy: -105.064 flat angles P-C4'-P energy: -66.521 tors. eta vs tors. theta energy: -2.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -778.345520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.345520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.345520 (E_RNA) where: Base-Base interactions energy: -402.973 where: short stacking energy: -238.022 Base-Backbone interact. energy: 2.101 local terms energy: -377.473449 where: bonds (distance) C4'-P energy: -112.597 bonds (distance) P-C4' energy: -105.844 flat angles C4'-P-C4' energy: -102.561 flat angles P-C4'-P energy: -53.409 tors. eta vs tors. theta energy: -3.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2283.047062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.047062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2283.047062 (E_RNA) where: Base-Base interactions energy: -1512.761 where: short stacking energy: -692.837 Base-Backbone interact. energy: 1.740 local terms energy: -772.025916 where: bonds (distance) C4'-P energy: -156.841 bonds (distance) P-C4' energy: -150.806 flat angles C4'-P-C4' energy: -157.142 flat angles P-C4'-P energy: -114.665 tors. eta vs tors. theta energy: -192.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2024.285623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.285623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.285623 (E_RNA) where: Base-Base interactions energy: -1328.554 where: short stacking energy: -617.237 Base-Backbone interact. energy: -3.348 local terms energy: -692.383079 where: bonds (distance) C4'-P energy: -133.053 bonds (distance) P-C4' energy: -143.902 flat angles C4'-P-C4' energy: -162.208 flat angles P-C4'-P energy: -87.605 tors. eta vs tors. theta energy: -165.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2015.107117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.107117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.107117 (E_RNA) where: Base-Base interactions energy: -1364.445 where: short stacking energy: -573.607 Base-Backbone interact. energy: -4.287 local terms energy: -646.374748 where: bonds (distance) C4'-P energy: -118.749 bonds (distance) P-C4' energy: -146.999 flat angles C4'-P-C4' energy: -154.995 flat angles P-C4'-P energy: -90.917 tors. eta vs tors. theta energy: -134.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1875.753707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.753707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.753707 (E_RNA) where: Base-Base interactions energy: -1247.567 where: short stacking energy: -562.939 Base-Backbone interact. energy: -2.589 local terms energy: -625.597812 where: bonds (distance) C4'-P energy: -118.650 bonds (distance) P-C4' energy: -152.174 flat angles C4'-P-C4' energy: -143.959 flat angles P-C4'-P energy: -75.986 tors. eta vs tors. theta energy: -134.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1656.221262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.221262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.221262 (E_RNA) where: Base-Base interactions energy: -1040.083 where: short stacking energy: -528.176 Base-Backbone interact. energy: -2.681 local terms energy: -613.456936 where: bonds (distance) C4'-P energy: -126.395 bonds (distance) P-C4' energy: -127.726 flat angles C4'-P-C4' energy: -149.220 flat angles P-C4'-P energy: -81.762 tors. eta vs tors. theta energy: -128.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1482.493868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.493868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.493868 (E_RNA) where: Base-Base interactions energy: -929.324 where: short stacking energy: -437.096 Base-Backbone interact. energy: -1.088 local terms energy: -552.081964 where: bonds (distance) C4'-P energy: -133.380 bonds (distance) P-C4' energy: -127.122 flat angles C4'-P-C4' energy: -128.768 flat angles P-C4'-P energy: -88.566 tors. eta vs tors. theta energy: -74.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1395.915167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.915167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.915167 (E_RNA) where: Base-Base interactions energy: -849.435 where: short stacking energy: -434.332 Base-Backbone interact. energy: -2.361 local terms energy: -544.118761 where: bonds (distance) C4'-P energy: -109.172 bonds (distance) P-C4' energy: -137.637 flat angles C4'-P-C4' energy: -131.842 flat angles P-C4'-P energy: -79.613 tors. eta vs tors. theta energy: -85.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1320.023293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.023293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.023293 (E_RNA) where: Base-Base interactions energy: -803.451 where: short stacking energy: -355.246 Base-Backbone interact. energy: 1.932 local terms energy: -518.504410 where: bonds (distance) C4'-P energy: -109.129 bonds (distance) P-C4' energy: -125.819 flat angles C4'-P-C4' energy: -134.950 flat angles P-C4'-P energy: -73.049 tors. eta vs tors. theta energy: -75.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -867.130347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.130347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.130347 (E_RNA) where: Base-Base interactions energy: -434.073 where: short stacking energy: -242.289 Base-Backbone interact. energy: 1.116 local terms energy: -434.174043 where: bonds (distance) C4'-P energy: -115.075 bonds (distance) P-C4' energy: -133.136 flat angles C4'-P-C4' energy: -109.161 flat angles P-C4'-P energy: -74.474 tors. eta vs tors. theta energy: -2.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -776.801826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.801826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.801826 (E_RNA) where: Base-Base interactions energy: -380.406 where: short stacking energy: -245.850 Base-Backbone interact. energy: -1.773 local terms energy: -394.622976 where: bonds (distance) C4'-P energy: -125.601 bonds (distance) P-C4' energy: -116.420 flat angles C4'-P-C4' energy: -98.447 flat angles P-C4'-P energy: -54.744 tors. eta vs tors. theta energy: 0.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2298.981398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2298.981398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2298.981398 (E_RNA) where: Base-Base interactions energy: -1530.632 where: short stacking energy: -703.267 Base-Backbone interact. energy: -1.023 local terms energy: -767.326286 where: bonds (distance) C4'-P energy: -144.512 bonds (distance) P-C4' energy: -148.601 flat angles C4'-P-C4' energy: -167.031 flat angles P-C4'-P energy: -119.326 tors. eta vs tors. theta energy: -187.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2051.743605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2051.743605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2051.743605 (E_RNA) where: Base-Base interactions energy: -1331.821 where: short stacking energy: -628.313 Base-Backbone interact. energy: -1.757 local terms energy: -718.166239 where: bonds (distance) C4'-P energy: -130.301 bonds (distance) P-C4' energy: -163.417 flat angles C4'-P-C4' energy: -159.583 flat angles P-C4'-P energy: -107.686 tors. eta vs tors. theta energy: -157.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2002.285652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2002.285652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2002.285652 (E_RNA) where: Base-Base interactions energy: -1343.466 where: short stacking energy: -599.206 Base-Backbone interact. energy: 2.421 local terms energy: -661.241318 where: bonds (distance) C4'-P energy: -149.076 bonds (distance) P-C4' energy: -127.094 flat angles C4'-P-C4' energy: -143.063 flat angles P-C4'-P energy: -96.720 tors. eta vs tors. theta energy: -145.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1927.598798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1927.598798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1927.598798 (E_RNA) where: Base-Base interactions energy: -1280.990 where: short stacking energy: -574.289 Base-Backbone interact. energy: 0.349 local terms energy: -646.958168 where: bonds (distance) C4'-P energy: -104.886 bonds (distance) P-C4' energy: -139.394 flat angles C4'-P-C4' energy: -141.219 flat angles P-C4'-P energy: -106.354 tors. eta vs tors. theta energy: -155.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1653.985740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.985740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.985740 (E_RNA) where: Base-Base interactions energy: -1030.560 where: short stacking energy: -475.773 Base-Backbone interact. energy: -2.467 local terms energy: -620.958533 where: bonds (distance) C4'-P energy: -142.879 bonds (distance) P-C4' energy: -135.139 flat angles C4'-P-C4' energy: -134.818 flat angles P-C4'-P energy: -80.994 tors. eta vs tors. theta energy: -127.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1464.301605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.301605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.301605 (E_RNA) where: Base-Base interactions energy: -900.429 where: short stacking energy: -455.388 Base-Backbone interact. energy: 0.578 local terms energy: -564.450687 where: bonds (distance) C4'-P energy: -106.451 bonds (distance) P-C4' energy: -130.748 flat angles C4'-P-C4' energy: -141.712 flat angles P-C4'-P energy: -94.245 tors. eta vs tors. theta energy: -91.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1280.000771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.000771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.000771 (E_RNA) where: Base-Base interactions energy: -762.754 where: short stacking energy: -363.274 Base-Backbone interact. energy: 3.965 local terms energy: -521.211652 where: bonds (distance) C4'-P energy: -121.016 bonds (distance) P-C4' energy: -137.596 flat angles C4'-P-C4' energy: -128.212 flat angles P-C4'-P energy: -89.014 tors. eta vs tors. theta energy: -45.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1152.220460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.220460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.220460 (E_RNA) where: Base-Base interactions energy: -677.626 where: short stacking energy: -342.424 Base-Backbone interact. energy: -1.329 local terms energy: -473.265131 where: bonds (distance) C4'-P energy: -112.257 bonds (distance) P-C4' energy: -123.844 flat angles C4'-P-C4' energy: -106.088 flat angles P-C4'-P energy: -84.679 tors. eta vs tors. theta energy: -46.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -961.614553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.614553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.614553 (E_RNA) where: Base-Base interactions energy: -527.535 where: short stacking energy: -304.398 Base-Backbone interact. energy: 2.170 local terms energy: -436.249094 where: bonds (distance) C4'-P energy: -109.425 bonds (distance) P-C4' energy: -121.874 flat angles C4'-P-C4' energy: -114.379 flat angles P-C4'-P energy: -73.140 tors. eta vs tors. theta energy: -17.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -772.821657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.821657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.821657 (E_RNA) where: Base-Base interactions energy: -418.565 where: short stacking energy: -219.557 Base-Backbone interact. energy: 10.260 local terms energy: -364.516883 where: bonds (distance) C4'-P energy: -99.957 bonds (distance) P-C4' energy: -119.520 flat angles C4'-P-C4' energy: -85.757 flat angles P-C4'-P energy: -63.683 tors. eta vs tors. theta energy: 4.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2324.378117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2324.378117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.378117 (E_RNA) where: Base-Base interactions energy: -1548.134 where: short stacking energy: -700.881 Base-Backbone interact. energy: -3.042 local terms energy: -773.202137 where: bonds (distance) C4'-P energy: -134.415 bonds (distance) P-C4' energy: -140.898 flat angles C4'-P-C4' energy: -174.657 flat angles P-C4'-P energy: -117.875 tors. eta vs tors. theta energy: -205.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2037.670144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.670144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.670144 (E_RNA) where: Base-Base interactions energy: -1344.749 where: short stacking energy: -636.744 Base-Backbone interact. energy: -5.103 local terms energy: -687.817496 where: bonds (distance) C4'-P energy: -151.297 bonds (distance) P-C4' energy: -142.283 flat angles C4'-P-C4' energy: -147.569 flat angles P-C4'-P energy: -96.561 tors. eta vs tors. theta energy: -150.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2034.496893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.496893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2034.496893 (E_RNA) where: Base-Base interactions energy: -1340.243 where: short stacking energy: -645.396 Base-Backbone interact. energy: 1.327 local terms energy: -695.580952 where: bonds (distance) C4'-P energy: -131.577 bonds (distance) P-C4' energy: -152.342 flat angles C4'-P-C4' energy: -150.686 flat angles P-C4'-P energy: -91.085 tors. eta vs tors. theta energy: -169.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1849.577816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1849.577816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1849.577816 (E_RNA) where: Base-Base interactions energy: -1221.727 where: short stacking energy: -528.182 Base-Backbone interact. energy: -0.621 local terms energy: -627.230128 where: bonds (distance) C4'-P energy: -127.072 bonds (distance) P-C4' energy: -143.023 flat angles C4'-P-C4' energy: -151.408 flat angles P-C4'-P energy: -92.713 tors. eta vs tors. theta energy: -113.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1680.205168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.205168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.205168 (E_RNA) where: Base-Base interactions energy: -1062.328 where: short stacking energy: -507.534 Base-Backbone interact. energy: -0.687 local terms energy: -617.190240 where: bonds (distance) C4'-P energy: -118.203 bonds (distance) P-C4' energy: -140.636 flat angles C4'-P-C4' energy: -136.616 flat angles P-C4'-P energy: -94.916 tors. eta vs tors. theta energy: -126.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1535.151419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.151419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.151419 (E_RNA) where: Base-Base interactions energy: -962.343 where: short stacking energy: -448.827 Base-Backbone interact. energy: 0.709 local terms energy: -573.517434 where: bonds (distance) C4'-P energy: -123.313 bonds (distance) P-C4' energy: -139.637 flat angles C4'-P-C4' energy: -123.870 flat angles P-C4'-P energy: -88.124 tors. eta vs tors. theta energy: -98.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1293.601178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.601178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.601178 (E_RNA) where: Base-Base interactions energy: -791.690 where: short stacking energy: -399.942 Base-Backbone interact. energy: -0.693 local terms energy: -501.218592 where: bonds (distance) C4'-P energy: -115.251 bonds (distance) P-C4' energy: -126.486 flat angles C4'-P-C4' energy: -118.448 flat angles P-C4'-P energy: -84.242 tors. eta vs tors. theta energy: -56.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1232.959767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.959767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.959767 (E_RNA) where: Base-Base interactions energy: -737.924 where: short stacking energy: -394.132 Base-Backbone interact. energy: 10.309 local terms energy: -505.344206 where: bonds (distance) C4'-P energy: -112.817 bonds (distance) P-C4' energy: -133.975 flat angles C4'-P-C4' energy: -120.369 flat angles P-C4'-P energy: -72.921 tors. eta vs tors. theta energy: -65.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -916.339145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.339145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.339145 (E_RNA) where: Base-Base interactions energy: -497.875 where: short stacking energy: -264.393 Base-Backbone interact. energy: 3.251 local terms energy: -421.716038 where: bonds (distance) C4'-P energy: -125.243 bonds (distance) P-C4' energy: -121.552 flat angles C4'-P-C4' energy: -117.145 flat angles P-C4'-P energy: -43.856 tors. eta vs tors. theta energy: -13.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -860.901775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.901775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.901775 (E_RNA) where: Base-Base interactions energy: -461.384 where: short stacking energy: -249.572 Base-Backbone interact. energy: 4.851 local terms energy: -404.368488 where: bonds (distance) C4'-P energy: -108.462 bonds (distance) P-C4' energy: -134.558 flat angles C4'-P-C4' energy: -86.228 flat angles P-C4'-P energy: -71.164 tors. eta vs tors. theta energy: -3.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2316.814199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.814199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2316.814199 (E_RNA) where: Base-Base interactions energy: -1544.515 where: short stacking energy: -728.363 Base-Backbone interact. energy: -0.708 local terms energy: -771.590958 where: bonds (distance) C4'-P energy: -137.038 bonds (distance) P-C4' energy: -144.316 flat angles C4'-P-C4' energy: -174.148 flat angles P-C4'-P energy: -105.594 tors. eta vs tors. theta energy: -210.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2183.389197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.389197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.389197 (E_RNA) where: Base-Base interactions energy: -1441.607 where: short stacking energy: -641.557 Base-Backbone interact. energy: -4.015 local terms energy: -737.766997 where: bonds (distance) C4'-P energy: -143.555 bonds (distance) P-C4' energy: -155.262 flat angles C4'-P-C4' energy: -162.066 flat angles P-C4'-P energy: -113.489 tors. eta vs tors. theta energy: -163.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2007.696261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2007.696261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2007.696261 (E_RNA) where: Base-Base interactions energy: -1334.236 where: short stacking energy: -612.503 Base-Backbone interact. energy: -1.699 local terms energy: -671.761432 where: bonds (distance) C4'-P energy: -122.035 bonds (distance) P-C4' energy: -149.329 flat angles C4'-P-C4' energy: -162.262 flat angles P-C4'-P energy: -97.850 tors. eta vs tors. theta energy: -140.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1914.607298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.607298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.607298 (E_RNA) where: Base-Base interactions energy: -1253.136 where: short stacking energy: -582.270 Base-Backbone interact. energy: -3.828 local terms energy: -657.642990 where: bonds (distance) C4'-P energy: -137.166 bonds (distance) P-C4' energy: -132.859 flat angles C4'-P-C4' energy: -141.742 flat angles P-C4'-P energy: -105.103 tors. eta vs tors. theta energy: -140.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1649.859725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.859725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.859725 (E_RNA) where: Base-Base interactions energy: -1025.810 where: short stacking energy: -481.831 Base-Backbone interact. energy: -3.422 local terms energy: -620.627785 where: bonds (distance) C4'-P energy: -132.257 bonds (distance) P-C4' energy: -133.406 flat angles C4'-P-C4' energy: -167.618 flat angles P-C4'-P energy: -80.758 tors. eta vs tors. theta energy: -106.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1535.454594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.454594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.454594 (E_RNA) where: Base-Base interactions energy: -973.218 where: short stacking energy: -443.074 Base-Backbone interact. energy: -1.924 local terms energy: -562.135955 where: bonds (distance) C4'-P energy: -132.775 bonds (distance) P-C4' energy: -138.491 flat angles C4'-P-C4' energy: -121.662 flat angles P-C4'-P energy: -77.432 tors. eta vs tors. theta energy: -91.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.823 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1329.460777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.460777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.460777 (E_RNA) where: Base-Base interactions energy: -814.258 where: short stacking energy: -396.361 Base-Backbone interact. energy: 0.219 local terms energy: -515.421228 where: bonds (distance) C4'-P energy: -110.657 bonds (distance) P-C4' energy: -127.917 flat angles C4'-P-C4' energy: -108.137 flat angles P-C4'-P energy: -75.783 tors. eta vs tors. theta energy: -92.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1159.232587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.232587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.232587 (E_RNA) where: Base-Base interactions energy: -671.276 where: short stacking energy: -325.354 Base-Backbone interact. energy: 2.044 local terms energy: -490.000552 where: bonds (distance) C4'-P energy: -140.698 bonds (distance) P-C4' energy: -110.670 flat angles C4'-P-C4' energy: -114.945 flat angles P-C4'-P energy: -73.995 tors. eta vs tors. theta energy: -49.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -926.654549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.654549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.654549 (E_RNA) where: Base-Base interactions energy: -473.801 where: short stacking energy: -252.469 Base-Backbone interact. energy: 0.902 local terms energy: -453.755499 where: bonds (distance) C4'-P energy: -119.726 bonds (distance) P-C4' energy: -135.974 flat angles C4'-P-C4' energy: -119.579 flat angles P-C4'-P energy: -55.503 tors. eta vs tors. theta energy: -22.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -831.313026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.313026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.313026 (E_RNA) where: Base-Base interactions energy: -412.876 where: short stacking energy: -215.864 Base-Backbone interact. energy: 2.931 local terms energy: -421.367622 where: bonds (distance) C4'-P energy: -121.672 bonds (distance) P-C4' energy: -144.053 flat angles C4'-P-C4' energy: -94.329 flat angles P-C4'-P energy: -69.759 tors. eta vs tors. theta energy: 8.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2294.342513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2294.342513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2294.342513 (E_RNA) where: Base-Base interactions energy: -1524.785 where: short stacking energy: -695.979 Base-Backbone interact. energy: -1.591 local terms energy: -767.966650 where: bonds (distance) C4'-P energy: -136.530 bonds (distance) P-C4' energy: -149.581 flat angles C4'-P-C4' energy: -170.135 flat angles P-C4'-P energy: -105.658 tors. eta vs tors. theta energy: -206.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2184.261415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2184.261415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2184.261415 (E_RNA) where: Base-Base interactions energy: -1457.744 where: short stacking energy: -633.263 Base-Backbone interact. energy: -3.159 local terms energy: -723.358191 where: bonds (distance) C4'-P energy: -138.676 bonds (distance) P-C4' energy: -157.030 flat angles C4'-P-C4' energy: -169.230 flat angles P-C4'-P energy: -89.976 tors. eta vs tors. theta energy: -168.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1999.066301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1999.066301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1999.066301 (E_RNA) where: Base-Base interactions energy: -1308.451 where: short stacking energy: -608.128 Base-Backbone interact. energy: -3.235 local terms energy: -687.379917 where: bonds (distance) C4'-P energy: -134.083 bonds (distance) P-C4' energy: -148.460 flat angles C4'-P-C4' energy: -141.117 flat angles P-C4'-P energy: -104.139 tors. eta vs tors. theta energy: -159.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1918.864159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.864159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.864159 (E_RNA) where: Base-Base interactions energy: -1251.932 where: short stacking energy: -569.879 Base-Backbone interact. energy: 0.770 local terms energy: -667.701802 where: bonds (distance) C4'-P energy: -141.874 bonds (distance) P-C4' energy: -150.652 flat angles C4'-P-C4' energy: -143.644 flat angles P-C4'-P energy: -93.354 tors. eta vs tors. theta energy: -138.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1758.188667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1758.188667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.188667 (E_RNA) where: Base-Base interactions energy: -1131.292 where: short stacking energy: -542.021 Base-Backbone interact. energy: -0.856 local terms energy: -626.040575 where: bonds (distance) C4'-P energy: -134.053 bonds (distance) P-C4' energy: -147.288 flat angles C4'-P-C4' energy: -135.013 flat angles P-C4'-P energy: -80.008 tors. eta vs tors. theta energy: -129.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1557.134109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.134109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.134109 (E_RNA) where: Base-Base interactions energy: -967.419 where: short stacking energy: -474.178 Base-Backbone interact. energy: -1.552 local terms energy: -588.162425 where: bonds (distance) C4'-P energy: -109.875 bonds (distance) P-C4' energy: -139.394 flat angles C4'-P-C4' energy: -141.103 flat angles P-C4'-P energy: -81.806 tors. eta vs tors. theta energy: -115.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1355.912101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.912101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.912101 (E_RNA) where: Base-Base interactions energy: -808.516 where: short stacking energy: -375.560 Base-Backbone interact. energy: -2.841 local terms energy: -544.555501 where: bonds (distance) C4'-P energy: -122.749 bonds (distance) P-C4' energy: -131.295 flat angles C4'-P-C4' energy: -146.333 flat angles P-C4'-P energy: -76.192 tors. eta vs tors. theta energy: -67.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1093.450763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.450763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.450763 (E_RNA) where: Base-Base interactions energy: -630.318 where: short stacking energy: -307.981 Base-Backbone interact. energy: 2.060 local terms energy: -465.193264 where: bonds (distance) C4'-P energy: -116.451 bonds (distance) P-C4' energy: -134.280 flat angles C4'-P-C4' energy: -118.673 flat angles P-C4'-P energy: -69.961 tors. eta vs tors. theta energy: -25.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -824.209951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.209951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.209951 (E_RNA) where: Base-Base interactions energy: -420.923 where: short stacking energy: -230.214 Base-Backbone interact. energy: -1.037 local terms energy: -402.249396 where: bonds (distance) C4'-P energy: -94.063 bonds (distance) P-C4' energy: -131.129 flat angles C4'-P-C4' energy: -114.076 flat angles P-C4'-P energy: -75.100 tors. eta vs tors. theta energy: 12.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -885.437897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.437897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.437897 (E_RNA) where: Base-Base interactions energy: -476.193 where: short stacking energy: -246.725 Base-Backbone interact. energy: 5.662 local terms energy: -414.907324 where: bonds (distance) C4'-P energy: -126.279 bonds (distance) P-C4' energy: -123.620 flat angles C4'-P-C4' energy: -105.798 flat angles P-C4'-P energy: -63.889 tors. eta vs tors. theta energy: 4.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2303.219918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2303.219918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2303.219918 (E_RNA) where: Base-Base interactions energy: -1527.335 where: short stacking energy: -712.483 Base-Backbone interact. energy: -1.897 local terms energy: -773.987665 where: bonds (distance) C4'-P energy: -159.569 bonds (distance) P-C4' energy: -144.601 flat angles C4'-P-C4' energy: -159.571 flat angles P-C4'-P energy: -98.159 tors. eta vs tors. theta energy: -212.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2189.510947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2189.510947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2189.510947 (E_RNA) where: Base-Base interactions energy: -1494.310 where: short stacking energy: -665.714 Base-Backbone interact. energy: -4.380 local terms energy: -690.820173 where: bonds (distance) C4'-P energy: -133.722 bonds (distance) P-C4' energy: -139.645 flat angles C4'-P-C4' energy: -156.930 flat angles P-C4'-P energy: -96.145 tors. eta vs tors. theta energy: -164.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1985.563285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1985.563285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1985.563285 (E_RNA) where: Base-Base interactions energy: -1320.124 where: short stacking energy: -601.276 Base-Backbone interact. energy: -0.184 local terms energy: -665.255260 where: bonds (distance) C4'-P energy: -115.276 bonds (distance) P-C4' energy: -160.380 flat angles C4'-P-C4' energy: -152.194 flat angles P-C4'-P energy: -88.090 tors. eta vs tors. theta energy: -149.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1904.931844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1904.931844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1904.931844 (E_RNA) where: Base-Base interactions energy: -1258.502 where: short stacking energy: -564.331 Base-Backbone interact. energy: 0.235 local terms energy: -646.664709 where: bonds (distance) C4'-P energy: -128.433 bonds (distance) P-C4' energy: -147.208 flat angles C4'-P-C4' energy: -148.505 flat angles P-C4'-P energy: -86.699 tors. eta vs tors. theta energy: -135.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1704.615070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.615070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.615070 (E_RNA) where: Base-Base interactions energy: -1082.819 where: short stacking energy: -509.030 Base-Backbone interact. energy: 0.525 local terms energy: -622.320943 where: bonds (distance) C4'-P energy: -132.853 bonds (distance) P-C4' energy: -139.816 flat angles C4'-P-C4' energy: -141.962 flat angles P-C4'-P energy: -87.898 tors. eta vs tors. theta energy: -119.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1606.353616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.353616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.353616 (E_RNA) where: Base-Base interactions energy: -1011.375 where: short stacking energy: -477.629 Base-Backbone interact. energy: 1.548 local terms energy: -596.818576 where: bonds (distance) C4'-P energy: -131.284 bonds (distance) P-C4' energy: -118.894 flat angles C4'-P-C4' energy: -126.205 flat angles P-C4'-P energy: -99.250 tors. eta vs tors. theta energy: -121.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.292 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1439.792742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.792742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.792742 (E_RNA) where: Base-Base interactions energy: -890.138 where: short stacking energy: -427.554 Base-Backbone interact. energy: -1.021 local terms energy: -548.633704 where: bonds (distance) C4'-P energy: -129.039 bonds (distance) P-C4' energy: -151.681 flat angles C4'-P-C4' energy: -130.335 flat angles P-C4'-P energy: -66.661 tors. eta vs tors. theta energy: -70.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1104.435553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.435553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.435553 (E_RNA) where: Base-Base interactions energy: -642.670 where: short stacking energy: -310.743 Base-Backbone interact. energy: -0.650 local terms energy: -461.115289 where: bonds (distance) C4'-P energy: -115.274 bonds (distance) P-C4' energy: -127.104 flat angles C4'-P-C4' energy: -112.621 flat angles P-C4'-P energy: -80.773 tors. eta vs tors. theta energy: -25.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -859.955693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.955693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.955693 (E_RNA) where: Base-Base interactions energy: -438.218 where: short stacking energy: -247.642 Base-Backbone interact. energy: -0.080 local terms energy: -421.657790 where: bonds (distance) C4'-P energy: -111.158 bonds (distance) P-C4' energy: -114.555 flat angles C4'-P-C4' energy: -113.291 flat angles P-C4'-P energy: -78.207 tors. eta vs tors. theta energy: -4.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -899.930870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.930870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.930870 (E_RNA) where: Base-Base interactions energy: -476.201 where: short stacking energy: -258.942 Base-Backbone interact. energy: 6.633 local terms energy: -430.362660 where: bonds (distance) C4'-P energy: -102.701 bonds (distance) P-C4' energy: -122.567 flat angles C4'-P-C4' energy: -105.321 flat angles P-C4'-P energy: -72.310 tors. eta vs tors. theta energy: -27.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2305.332161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2305.332161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2305.332161 (E_RNA) where: Base-Base interactions energy: -1532.176 where: short stacking energy: -709.366 Base-Backbone interact. energy: -1.268 local terms energy: -771.887722 where: bonds (distance) C4'-P energy: -149.301 bonds (distance) P-C4' energy: -147.885 flat angles C4'-P-C4' energy: -160.210 flat angles P-C4'-P energy: -103.059 tors. eta vs tors. theta energy: -211.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2165.507958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2165.507958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2165.507958 (E_RNA) where: Base-Base interactions energy: -1462.831 where: short stacking energy: -635.420 Base-Backbone interact. energy: -0.761 local terms energy: -701.916664 where: bonds (distance) C4'-P energy: -128.761 bonds (distance) P-C4' energy: -156.718 flat angles C4'-P-C4' energy: -146.517 flat angles P-C4'-P energy: -100.456 tors. eta vs tors. theta energy: -169.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1962.622887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.622887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.622887 (E_RNA) where: Base-Base interactions energy: -1283.293 where: short stacking energy: -587.068 Base-Backbone interact. energy: 0.013 local terms energy: -679.343081 where: bonds (distance) C4'-P energy: -146.263 bonds (distance) P-C4' energy: -147.973 flat angles C4'-P-C4' energy: -151.553 flat angles P-C4'-P energy: -97.365 tors. eta vs tors. theta energy: -136.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1938.627797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1938.627797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1938.627797 (E_RNA) where: Base-Base interactions energy: -1299.607 where: short stacking energy: -560.004 Base-Backbone interact. energy: -1.292 local terms energy: -637.729340 where: bonds (distance) C4'-P energy: -127.679 bonds (distance) P-C4' energy: -129.676 flat angles C4'-P-C4' energy: -133.035 flat angles P-C4'-P energy: -104.144 tors. eta vs tors. theta energy: -143.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1727.129635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.129635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.129635 (E_RNA) where: Base-Base interactions energy: -1113.822 where: short stacking energy: -517.794 Base-Backbone interact. energy: -1.615 local terms energy: -611.692007 where: bonds (distance) C4'-P energy: -121.517 bonds (distance) P-C4' energy: -134.735 flat angles C4'-P-C4' energy: -143.970 flat angles P-C4'-P energy: -79.173 tors. eta vs tors. theta energy: -132.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1649.218404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.218404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.218404 (E_RNA) where: Base-Base interactions energy: -1008.294 where: short stacking energy: -513.715 Base-Backbone interact. energy: -4.352 local terms energy: -636.572738 where: bonds (distance) C4'-P energy: -129.441 bonds (distance) P-C4' energy: -143.373 flat angles C4'-P-C4' energy: -143.382 flat angles P-C4'-P energy: -82.673 tors. eta vs tors. theta energy: -137.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1442.264814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.264814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.264814 (E_RNA) where: Base-Base interactions energy: -907.613 where: short stacking energy: -449.581 Base-Backbone interact. energy: -2.619 local terms energy: -532.032831 where: bonds (distance) C4'-P energy: -112.614 bonds (distance) P-C4' energy: -118.681 flat angles C4'-P-C4' energy: -128.361 flat angles P-C4'-P energy: -81.551 tors. eta vs tors. theta energy: -90.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1126.178233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.178233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.178233 (E_RNA) where: Base-Base interactions energy: -642.593 where: short stacking energy: -311.519 Base-Backbone interact. energy: -2.499 local terms energy: -481.086753 where: bonds (distance) C4'-P energy: -125.127 bonds (distance) P-C4' energy: -116.600 flat angles C4'-P-C4' energy: -137.346 flat angles P-C4'-P energy: -55.112 tors. eta vs tors. theta energy: -46.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -966.601203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.601203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.601203 (E_RNA) where: Base-Base interactions energy: -501.684 where: short stacking energy: -260.969 Base-Backbone interact. energy: -1.945 local terms energy: -462.971540 where: bonds (distance) C4'-P energy: -126.827 bonds (distance) P-C4' energy: -136.251 flat angles C4'-P-C4' energy: -133.824 flat angles P-C4'-P energy: -65.647 tors. eta vs tors. theta energy: -0.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -799.899191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.899191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.899191 (E_RNA) where: Base-Base interactions energy: -432.556 where: short stacking energy: -224.287 Base-Backbone interact. energy: 8.829 local terms energy: -376.172326 where: bonds (distance) C4'-P energy: -101.623 bonds (distance) P-C4' energy: -121.860 flat angles C4'-P-C4' energy: -112.856 flat angles P-C4'-P energy: -43.014 tors. eta vs tors. theta energy: 3.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2294.935286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2294.935286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2294.935286 (E_RNA) where: Base-Base interactions energy: -1516.906 where: short stacking energy: -689.917 Base-Backbone interact. energy: -2.986 local terms energy: -775.043605 where: bonds (distance) C4'-P energy: -147.757 bonds (distance) P-C4' energy: -144.168 flat angles C4'-P-C4' energy: -164.048 flat angles P-C4'-P energy: -113.443 tors. eta vs tors. theta energy: -205.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2217.345192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2217.345192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2217.345192 (E_RNA) where: Base-Base interactions energy: -1506.029 where: short stacking energy: -655.528 Base-Backbone interact. energy: -0.889 local terms energy: -710.426742 where: bonds (distance) C4'-P energy: -138.529 bonds (distance) P-C4' energy: -140.563 flat angles C4'-P-C4' energy: -154.859 flat angles P-C4'-P energy: -100.479 tors. eta vs tors. theta energy: -175.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1991.648857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1991.648857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1991.648857 (E_RNA) where: Base-Base interactions energy: -1310.028 where: short stacking energy: -592.315 Base-Backbone interact. energy: 2.183 local terms energy: -683.803797 where: bonds (distance) C4'-P energy: -138.646 bonds (distance) P-C4' energy: -149.618 flat angles C4'-P-C4' energy: -151.425 flat angles P-C4'-P energy: -94.924 tors. eta vs tors. theta energy: -149.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1954.279175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1954.279175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1954.279175 (E_RNA) where: Base-Base interactions energy: -1284.928 where: short stacking energy: -553.297 Base-Backbone interact. energy: 2.922 local terms energy: -672.273397 where: bonds (distance) C4'-P energy: -135.830 bonds (distance) P-C4' energy: -151.436 flat angles C4'-P-C4' energy: -154.079 flat angles P-C4'-P energy: -88.965 tors. eta vs tors. theta energy: -141.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1691.497717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.497717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.497717 (E_RNA) where: Base-Base interactions energy: -1056.072 where: short stacking energy: -510.631 Base-Backbone interact. energy: -6.535 local terms energy: -628.889971 where: bonds (distance) C4'-P energy: -128.701 bonds (distance) P-C4' energy: -129.485 flat angles C4'-P-C4' energy: -160.221 flat angles P-C4'-P energy: -84.663 tors. eta vs tors. theta energy: -125.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1617.683946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.683946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.683946 (E_RNA) where: Base-Base interactions energy: -1007.559 where: short stacking energy: -492.859 Base-Backbone interact. energy: 6.019 local terms energy: -616.143380 where: bonds (distance) C4'-P energy: -127.965 bonds (distance) P-C4' energy: -127.428 flat angles C4'-P-C4' energy: -152.002 flat angles P-C4'-P energy: -84.833 tors. eta vs tors. theta energy: -123.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1368.802857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.802857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.802857 (E_RNA) where: Base-Base interactions energy: -868.962 where: short stacking energy: -400.234 Base-Backbone interact. energy: -0.237 local terms energy: -499.603841 where: bonds (distance) C4'-P energy: -95.145 bonds (distance) P-C4' energy: -119.053 flat angles C4'-P-C4' energy: -140.213 flat angles P-C4'-P energy: -77.634 tors. eta vs tors. theta energy: -67.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1157.726686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.726686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.726686 (E_RNA) where: Base-Base interactions energy: -651.895 where: short stacking energy: -321.176 Base-Backbone interact. energy: -3.587 local terms energy: -502.244282 where: bonds (distance) C4'-P energy: -124.339 bonds (distance) P-C4' energy: -139.171 flat angles C4'-P-C4' energy: -130.585 flat angles P-C4'-P energy: -63.734 tors. eta vs tors. theta energy: -44.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -917.196564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.196564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.196564 (E_RNA) where: Base-Base interactions energy: -490.362 where: short stacking energy: -269.234 Base-Backbone interact. energy: 1.827 local terms energy: -428.661633 where: bonds (distance) C4'-P energy: -127.373 bonds (distance) P-C4' energy: -133.305 flat angles C4'-P-C4' energy: -113.514 flat angles P-C4'-P energy: -33.840 tors. eta vs tors. theta energy: -20.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -833.910756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.910756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.910756 (E_RNA) where: Base-Base interactions energy: -445.533 where: short stacking energy: -228.817 Base-Backbone interact. energy: 4.129 local terms energy: -392.506949 where: bonds (distance) C4'-P energy: -104.126 bonds (distance) P-C4' energy: -124.077 flat angles C4'-P-C4' energy: -96.025 flat angles P-C4'-P energy: -65.984 tors. eta vs tors. theta energy: -2.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2326.650096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.650096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.650096 (E_RNA) where: Base-Base interactions energy: -1566.761 where: short stacking energy: -719.424 Base-Backbone interact. energy: -3.543 local terms energy: -756.346294 where: bonds (distance) C4'-P energy: -137.587 bonds (distance) P-C4' energy: -152.474 flat angles C4'-P-C4' energy: -162.235 flat angles P-C4'-P energy: -97.596 tors. eta vs tors. theta energy: -206.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2205.919198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2205.919198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2205.919198 (E_RNA) where: Base-Base interactions energy: -1491.365 where: short stacking energy: -664.277 Base-Backbone interact. energy: -0.694 local terms energy: -713.860212 where: bonds (distance) C4'-P energy: -141.378 bonds (distance) P-C4' energy: -144.211 flat angles C4'-P-C4' energy: -162.574 flat angles P-C4'-P energy: -91.020 tors. eta vs tors. theta energy: -174.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2044.958045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2044.958045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2044.958045 (E_RNA) where: Base-Base interactions energy: -1379.929 where: short stacking energy: -627.351 Base-Backbone interact. energy: -1.383 local terms energy: -663.646149 where: bonds (distance) C4'-P energy: -124.380 bonds (distance) P-C4' energy: -127.759 flat angles C4'-P-C4' energy: -142.893 flat angles P-C4'-P energy: -111.866 tors. eta vs tors. theta energy: -156.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2001.777805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.777805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.777805 (E_RNA) where: Base-Base interactions energy: -1356.963 where: short stacking energy: -593.574 Base-Backbone interact. energy: -2.338 local terms energy: -642.476726 where: bonds (distance) C4'-P energy: -135.165 bonds (distance) P-C4' energy: -138.232 flat angles C4'-P-C4' energy: -146.555 flat angles P-C4'-P energy: -77.099 tors. eta vs tors. theta energy: -145.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1710.712217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.712217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.712217 (E_RNA) where: Base-Base interactions energy: -1094.447 where: short stacking energy: -516.605 Base-Backbone interact. energy: 3.028 local terms energy: -619.292966 where: bonds (distance) C4'-P energy: -130.371 bonds (distance) P-C4' energy: -134.695 flat angles C4'-P-C4' energy: -134.812 flat angles P-C4'-P energy: -85.829 tors. eta vs tors. theta energy: -133.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1644.427011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.427011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.427011 (E_RNA) where: Base-Base interactions energy: -1038.522 where: short stacking energy: -493.135 Base-Backbone interact. energy: -1.955 local terms energy: -603.950508 where: bonds (distance) C4'-P energy: -124.137 bonds (distance) P-C4' energy: -137.234 flat angles C4'-P-C4' energy: -145.735 flat angles P-C4'-P energy: -76.716 tors. eta vs tors. theta energy: -120.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1406.550380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.550380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.550380 (E_RNA) where: Base-Base interactions energy: -878.238 where: short stacking energy: -394.002 Base-Backbone interact. energy: 0.435 local terms energy: -528.747755 where: bonds (distance) C4'-P energy: -118.476 bonds (distance) P-C4' energy: -144.530 flat angles C4'-P-C4' energy: -121.583 flat angles P-C4'-P energy: -78.719 tors. eta vs tors. theta energy: -65.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1192.412665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.412665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.412665 (E_RNA) where: Base-Base interactions energy: -725.668 where: short stacking energy: -375.504 Base-Backbone interact. energy: -3.738 local terms energy: -463.007010 where: bonds (distance) C4'-P energy: -113.852 bonds (distance) P-C4' energy: -120.115 flat angles C4'-P-C4' energy: -107.077 flat angles P-C4'-P energy: -65.173 tors. eta vs tors. theta energy: -56.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -866.445931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.445931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.445931 (E_RNA) where: Base-Base interactions energy: -441.422 where: short stacking energy: -244.156 Base-Backbone interact. energy: 1.189 local terms energy: -426.213145 where: bonds (distance) C4'-P energy: -114.178 bonds (distance) P-C4' energy: -111.500 flat angles C4'-P-C4' energy: -125.605 flat angles P-C4'-P energy: -53.306 tors. eta vs tors. theta energy: -21.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -906.671125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.671125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.671125 (E_RNA) where: Base-Base interactions energy: -486.543 where: short stacking energy: -267.216 Base-Backbone interact. energy: 1.481 local terms energy: -422.925426 where: bonds (distance) C4'-P energy: -101.712 bonds (distance) P-C4' energy: -127.170 flat angles C4'-P-C4' energy: -113.875 flat angles P-C4'-P energy: -63.100 tors. eta vs tors. theta energy: -17.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.317 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2351.787039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2351.787039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2351.787039 (E_RNA) where: Base-Base interactions energy: -1573.528 where: short stacking energy: -728.066 Base-Backbone interact. energy: -5.158 local terms energy: -773.100917 where: bonds (distance) C4'-P energy: -144.339 bonds (distance) P-C4' energy: -144.538 flat angles C4'-P-C4' energy: -168.481 flat angles P-C4'-P energy: -107.156 tors. eta vs tors. theta energy: -208.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2250.319402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2250.319402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2250.319402 (E_RNA) where: Base-Base interactions energy: -1533.039 where: short stacking energy: -662.607 Base-Backbone interact. energy: -1.945 local terms energy: -715.335691 where: bonds (distance) C4'-P energy: -130.989 bonds (distance) P-C4' energy: -143.888 flat angles C4'-P-C4' energy: -156.669 flat angles P-C4'-P energy: -93.023 tors. eta vs tors. theta energy: -190.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2025.720515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2025.720515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2025.720515 (E_RNA) where: Base-Base interactions energy: -1362.441 where: short stacking energy: -622.684 Base-Backbone interact. energy: 8.043 local terms energy: -671.321796 where: bonds (distance) C4'-P energy: -113.325 bonds (distance) P-C4' energy: -146.100 flat angles C4'-P-C4' energy: -152.678 flat angles P-C4'-P energy: -103.763 tors. eta vs tors. theta energy: -155.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1990.234643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1990.234643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1990.234643 (E_RNA) where: Base-Base interactions energy: -1304.509 where: short stacking energy: -576.712 Base-Backbone interact. energy: 0.936 local terms energy: -686.661313 where: bonds (distance) C4'-P energy: -159.331 bonds (distance) P-C4' energy: -141.334 flat angles C4'-P-C4' energy: -146.102 flat angles P-C4'-P energy: -102.026 tors. eta vs tors. theta energy: -137.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1767.748471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1767.748471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1767.748471 (E_RNA) where: Base-Base interactions energy: -1108.855 where: short stacking energy: -532.213 Base-Backbone interact. energy: -4.625 local terms energy: -654.268332 where: bonds (distance) C4'-P energy: -124.632 bonds (distance) P-C4' energy: -145.417 flat angles C4'-P-C4' energy: -160.476 flat angles P-C4'-P energy: -88.603 tors. eta vs tors. theta energy: -135.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1707.936809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.936809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.936809 (E_RNA) where: Base-Base interactions energy: -1100.601 where: short stacking energy: -510.961 Base-Backbone interact. energy: 1.487 local terms energy: -608.823240 where: bonds (distance) C4'-P energy: -131.444 bonds (distance) P-C4' energy: -145.660 flat angles C4'-P-C4' energy: -136.851 flat angles P-C4'-P energy: -83.212 tors. eta vs tors. theta energy: -111.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1477.315963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.315963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.315963 (E_RNA) where: Base-Base interactions energy: -945.871 where: short stacking energy: -440.567 Base-Backbone interact. energy: -2.441 local terms energy: -529.004187 where: bonds (distance) C4'-P energy: -110.720 bonds (distance) P-C4' energy: -132.881 flat angles C4'-P-C4' energy: -130.964 flat angles P-C4'-P energy: -69.346 tors. eta vs tors. theta energy: -85.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1208.721342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.721342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.721342 (E_RNA) where: Base-Base interactions energy: -723.042 where: short stacking energy: -365.468 Base-Backbone interact. energy: -1.838 local terms energy: -483.841570 where: bonds (distance) C4'-P energy: -112.073 bonds (distance) P-C4' energy: -120.994 flat angles C4'-P-C4' energy: -123.022 flat angles P-C4'-P energy: -68.473 tors. eta vs tors. theta energy: -59.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -842.208205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.208205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.208205 (E_RNA) where: Base-Base interactions energy: -431.859 where: short stacking energy: -257.387 Base-Backbone interact. energy: 5.670 local terms energy: -416.019202 where: bonds (distance) C4'-P energy: -104.162 bonds (distance) P-C4' energy: -133.429 flat angles C4'-P-C4' energy: -112.177 flat angles P-C4'-P energy: -55.018 tors. eta vs tors. theta energy: -11.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -892.013252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.013252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.013252 (E_RNA) where: Base-Base interactions energy: -444.286 where: short stacking energy: -242.649 Base-Backbone interact. energy: 5.205 local terms energy: -453.627877 where: bonds (distance) C4'-P energy: -115.923 bonds (distance) P-C4' energy: -125.784 flat angles C4'-P-C4' energy: -101.374 flat angles P-C4'-P energy: -75.835 tors. eta vs tors. theta energy: -34.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.695 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2337.522472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2337.522472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.522472 (E_RNA) where: Base-Base interactions energy: -1557.363 where: short stacking energy: -728.226 Base-Backbone interact. energy: -3.228 local terms energy: -776.931798 where: bonds (distance) C4'-P energy: -142.532 bonds (distance) P-C4' energy: -146.734 flat angles C4'-P-C4' energy: -174.376 flat angles P-C4'-P energy: -104.534 tors. eta vs tors. theta energy: -208.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2193.262787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.262787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.262787 (E_RNA) where: Base-Base interactions energy: -1458.516 where: short stacking energy: -641.227 Base-Backbone interact. energy: -5.231 local terms energy: -729.515989 where: bonds (distance) C4'-P energy: -146.827 bonds (distance) P-C4' energy: -127.437 flat angles C4'-P-C4' energy: -165.853 flat angles P-C4'-P energy: -105.271 tors. eta vs tors. theta energy: -184.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2114.745509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2114.745509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2114.745509 (E_RNA) where: Base-Base interactions energy: -1435.008 where: short stacking energy: -642.495 Base-Backbone interact. energy: -2.290 local terms energy: -677.447604 where: bonds (distance) C4'-P energy: -141.808 bonds (distance) P-C4' energy: -143.690 flat angles C4'-P-C4' energy: -146.296 flat angles P-C4'-P energy: -81.138 tors. eta vs tors. theta energy: -164.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1922.397026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1922.397026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1922.397026 (E_RNA) where: Base-Base interactions energy: -1257.717 where: short stacking energy: -589.220 Base-Backbone interact. energy: -1.767 local terms energy: -662.912454 where: bonds (distance) C4'-P energy: -123.767 bonds (distance) P-C4' energy: -151.825 flat angles C4'-P-C4' energy: -140.452 flat angles P-C4'-P energy: -95.644 tors. eta vs tors. theta energy: -151.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1740.551744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.551744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.551744 (E_RNA) where: Base-Base interactions energy: -1094.847 where: short stacking energy: -521.655 Base-Backbone interact. energy: -2.434 local terms energy: -643.271282 where: bonds (distance) C4'-P energy: -129.900 bonds (distance) P-C4' energy: -141.794 flat angles C4'-P-C4' energy: -144.309 flat angles P-C4'-P energy: -95.462 tors. eta vs tors. theta energy: -131.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1646.354546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.354546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.354546 (E_RNA) where: Base-Base interactions energy: -1055.303 where: short stacking energy: -454.971 Base-Backbone interact. energy: 1.235 local terms energy: -592.286093 where: bonds (distance) C4'-P energy: -123.260 bonds (distance) P-C4' energy: -139.689 flat angles C4'-P-C4' energy: -144.107 flat angles P-C4'-P energy: -75.733 tors. eta vs tors. theta energy: -109.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1439.539049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.539049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.539049 (E_RNA) where: Base-Base interactions energy: -903.015 where: short stacking energy: -414.479 Base-Backbone interact. energy: -0.176 local terms energy: -536.347397 where: bonds (distance) C4'-P energy: -116.519 bonds (distance) P-C4' energy: -150.745 flat angles C4'-P-C4' energy: -137.519 flat angles P-C4'-P energy: -71.238 tors. eta vs tors. theta energy: -60.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1263.877620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.877620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.877620 (E_RNA) where: Base-Base interactions energy: -752.093 where: short stacking energy: -392.240 Base-Backbone interact. energy: 0.467 local terms energy: -512.251709 where: bonds (distance) C4'-P energy: -124.429 bonds (distance) P-C4' energy: -129.628 flat angles C4'-P-C4' energy: -122.866 flat angles P-C4'-P energy: -69.911 tors. eta vs tors. theta energy: -65.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -918.010241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.010241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.010241 (E_RNA) where: Base-Base interactions energy: -529.545 where: short stacking energy: -303.233 Base-Backbone interact. energy: 3.590 local terms energy: -392.054513 where: bonds (distance) C4'-P energy: -86.373 bonds (distance) P-C4' energy: -108.534 flat angles C4'-P-C4' energy: -124.180 flat angles P-C4'-P energy: -58.821 tors. eta vs tors. theta energy: -14.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -785.239630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.239630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.239630 (E_RNA) where: Base-Base interactions energy: -394.773 where: short stacking energy: -226.205 Base-Backbone interact. energy: 2.237 local terms energy: -392.703338 where: bonds (distance) C4'-P energy: -111.676 bonds (distance) P-C4' energy: -118.531 flat angles C4'-P-C4' energy: -94.151 flat angles P-C4'-P energy: -54.309 tors. eta vs tors. theta energy: -14.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2365.639838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2365.639838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2365.639838 (E_RNA) where: Base-Base interactions energy: -1578.490 where: short stacking energy: -742.796 Base-Backbone interact. energy: -1.195 local terms energy: -785.954550 where: bonds (distance) C4'-P energy: -144.603 bonds (distance) P-C4' energy: -154.067 flat angles C4'-P-C4' energy: -169.223 flat angles P-C4'-P energy: -94.023 tors. eta vs tors. theta energy: -224.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2220.513624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.513624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2220.513624 (E_RNA) where: Base-Base interactions energy: -1506.419 where: short stacking energy: -680.672 Base-Backbone interact. energy: -0.280 local terms energy: -713.815153 where: bonds (distance) C4'-P energy: -133.070 bonds (distance) P-C4' energy: -136.442 flat angles C4'-P-C4' energy: -158.002 flat angles P-C4'-P energy: -103.439 tors. eta vs tors. theta energy: -182.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2069.556220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2069.556220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2069.556220 (E_RNA) where: Base-Base interactions energy: -1395.411 where: short stacking energy: -612.393 Base-Backbone interact. energy: 0.348 local terms energy: -674.492832 where: bonds (distance) C4'-P energy: -129.375 bonds (distance) P-C4' energy: -150.133 flat angles C4'-P-C4' energy: -154.613 flat angles P-C4'-P energy: -81.915 tors. eta vs tors. theta energy: -158.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1928.927379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.927379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.927379 (E_RNA) where: Base-Base interactions energy: -1260.807 where: short stacking energy: -546.739 Base-Backbone interact. energy: -3.526 local terms energy: -664.594695 where: bonds (distance) C4'-P energy: -132.823 bonds (distance) P-C4' energy: -146.212 flat angles C4'-P-C4' energy: -156.267 flat angles P-C4'-P energy: -87.106 tors. eta vs tors. theta energy: -142.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1723.128093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.128093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1723.128093 (E_RNA) where: Base-Base interactions energy: -1137.782 where: short stacking energy: -537.781 Base-Backbone interact. energy: -1.441 local terms energy: -583.905030 where: bonds (distance) C4'-P energy: -121.656 bonds (distance) P-C4' energy: -127.268 flat angles C4'-P-C4' energy: -133.665 flat angles P-C4'-P energy: -76.699 tors. eta vs tors. theta energy: -124.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1675.651608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.651608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.651608 (E_RNA) where: Base-Base interactions energy: -1085.409 where: short stacking energy: -498.245 Base-Backbone interact. energy: 0.548 local terms energy: -590.791124 where: bonds (distance) C4'-P energy: -127.463 bonds (distance) P-C4' energy: -128.333 flat angles C4'-P-C4' energy: -125.576 flat angles P-C4'-P energy: -97.005 tors. eta vs tors. theta energy: -112.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1444.486511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.486511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.486511 (E_RNA) where: Base-Base interactions energy: -882.769 where: short stacking energy: -436.791 Base-Backbone interact. energy: -1.337 local terms energy: -560.379725 where: bonds (distance) C4'-P energy: -120.682 bonds (distance) P-C4' energy: -137.151 flat angles C4'-P-C4' energy: -129.296 flat angles P-C4'-P energy: -89.788 tors. eta vs tors. theta energy: -83.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1180.851636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.851636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.851636 (E_RNA) where: Base-Base interactions energy: -674.453 where: short stacking energy: -348.100 Base-Backbone interact. energy: 5.290 local terms energy: -511.688994 where: bonds (distance) C4'-P energy: -134.442 bonds (distance) P-C4' energy: -129.412 flat angles C4'-P-C4' energy: -129.211 flat angles P-C4'-P energy: -79.573 tors. eta vs tors. theta energy: -39.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -966.360529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.360529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.360529 (E_RNA) where: Base-Base interactions energy: -529.872 where: short stacking energy: -306.227 Base-Backbone interact. energy: 0.532 local terms energy: -437.020006 where: bonds (distance) C4'-P energy: -112.480 bonds (distance) P-C4' energy: -103.790 flat angles C4'-P-C4' energy: -111.381 flat angles P-C4'-P energy: -75.392 tors. eta vs tors. theta energy: -33.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -705.331739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.331739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.331739 (E_RNA) where: Base-Base interactions energy: -322.566 where: short stacking energy: -219.907 Base-Backbone interact. energy: 9.814 local terms energy: -392.579762 where: bonds (distance) C4'-P energy: -120.213 bonds (distance) P-C4' energy: -119.697 flat angles C4'-P-C4' energy: -118.180 flat angles P-C4'-P energy: -53.527 tors. eta vs tors. theta energy: 19.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2342.437223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2342.437223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2342.437223 (E_RNA) where: Base-Base interactions energy: -1566.739 where: short stacking energy: -716.888 Base-Backbone interact. energy: -1.656 local terms energy: -774.043016 where: bonds (distance) C4'-P energy: -147.931 bonds (distance) P-C4' energy: -150.809 flat angles C4'-P-C4' energy: -164.573 flat angles P-C4'-P energy: -102.415 tors. eta vs tors. theta energy: -208.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2165.201237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2165.201237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2165.201237 (E_RNA) where: Base-Base interactions energy: -1446.991 where: short stacking energy: -672.579 Base-Backbone interact. energy: -1.307 local terms energy: -716.903323 where: bonds (distance) C4'-P energy: -144.834 bonds (distance) P-C4' energy: -144.883 flat angles C4'-P-C4' energy: -158.828 flat angles P-C4'-P energy: -90.849 tors. eta vs tors. theta energy: -177.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2089.557162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.557162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.557162 (E_RNA) where: Base-Base interactions energy: -1385.920 where: short stacking energy: -586.471 Base-Backbone interact. energy: -5.738 local terms energy: -697.899061 where: bonds (distance) C4'-P energy: -149.790 bonds (distance) P-C4' energy: -144.263 flat angles C4'-P-C4' energy: -150.707 flat angles P-C4'-P energy: -107.956 tors. eta vs tors. theta energy: -145.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1876.705584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1876.705584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1876.705584 (E_RNA) where: Base-Base interactions energy: -1236.247 where: short stacking energy: -557.739 Base-Backbone interact. energy: 2.405 local terms energy: -642.863458 where: bonds (distance) C4'-P energy: -127.539 bonds (distance) P-C4' energy: -140.814 flat angles C4'-P-C4' energy: -149.236 flat angles P-C4'-P energy: -88.212 tors. eta vs tors. theta energy: -137.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1731.610689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.610689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.610689 (E_RNA) where: Base-Base interactions energy: -1127.485 where: short stacking energy: -517.167 Base-Backbone interact. energy: -2.225 local terms energy: -601.900850 where: bonds (distance) C4'-P energy: -121.643 bonds (distance) P-C4' energy: -133.987 flat angles C4'-P-C4' energy: -140.278 flat angles P-C4'-P energy: -92.185 tors. eta vs tors. theta energy: -113.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1647.726617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.726617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.726617 (E_RNA) where: Base-Base interactions energy: -1058.828 where: short stacking energy: -510.125 Base-Backbone interact. energy: -1.649 local terms energy: -587.249620 where: bonds (distance) C4'-P energy: -141.742 bonds (distance) P-C4' energy: -128.661 flat angles C4'-P-C4' energy: -128.345 flat angles P-C4'-P energy: -72.000 tors. eta vs tors. theta energy: -116.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1403.364278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.364278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.364278 (E_RNA) where: Base-Base interactions energy: -862.416 where: short stacking energy: -389.830 Base-Backbone interact. energy: 3.025 local terms energy: -543.973349 where: bonds (distance) C4'-P energy: -127.947 bonds (distance) P-C4' energy: -142.344 flat angles C4'-P-C4' energy: -123.663 flat angles P-C4'-P energy: -72.336 tors. eta vs tors. theta energy: -77.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1216.370877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.370877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.370877 (E_RNA) where: Base-Base interactions energy: -732.334 where: short stacking energy: -351.694 Base-Backbone interact. energy: 0.522 local terms energy: -484.558777 where: bonds (distance) C4'-P energy: -124.241 bonds (distance) P-C4' energy: -136.279 flat angles C4'-P-C4' energy: -110.458 flat angles P-C4'-P energy: -64.588 tors. eta vs tors. theta energy: -48.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -886.352492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.352492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.352492 (E_RNA) where: Base-Base interactions energy: -488.794 where: short stacking energy: -277.417 Base-Backbone interact. energy: 9.733 local terms energy: -407.291297 where: bonds (distance) C4'-P energy: -106.849 bonds (distance) P-C4' energy: -117.142 flat angles C4'-P-C4' energy: -118.664 flat angles P-C4'-P energy: -57.872 tors. eta vs tors. theta energy: -6.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -738.041185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.041185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.041185 (E_RNA) where: Base-Base interactions energy: -322.360 where: short stacking energy: -211.054 Base-Backbone interact. energy: 1.108 local terms energy: -416.788542 where: bonds (distance) C4'-P energy: -122.647 bonds (distance) P-C4' energy: -128.136 flat angles C4'-P-C4' energy: -104.793 flat angles P-C4'-P energy: -61.641 tors. eta vs tors. theta energy: 0.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2385.935339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2385.935339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2385.935339 (E_RNA) where: Base-Base interactions energy: -1606.463 where: short stacking energy: -742.265 Base-Backbone interact. energy: -0.670 local terms energy: -778.802590 where: bonds (distance) C4'-P energy: -147.578 bonds (distance) P-C4' energy: -150.595 flat angles C4'-P-C4' energy: -154.987 flat angles P-C4'-P energy: -110.375 tors. eta vs tors. theta energy: -215.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2212.683819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2212.683819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2212.683819 (E_RNA) where: Base-Base interactions energy: -1458.173 where: short stacking energy: -651.853 Base-Backbone interact. energy: -1.050 local terms energy: -753.460814 where: bonds (distance) C4'-P energy: -156.283 bonds (distance) P-C4' energy: -154.228 flat angles C4'-P-C4' energy: -166.671 flat angles P-C4'-P energy: -102.407 tors. eta vs tors. theta energy: -173.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2085.937383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2085.937383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2085.937383 (E_RNA) where: Base-Base interactions energy: -1420.086 where: short stacking energy: -592.653 Base-Backbone interact. energy: -0.274 local terms energy: -665.578047 where: bonds (distance) C4'-P energy: -130.144 bonds (distance) P-C4' energy: -137.897 flat angles C4'-P-C4' energy: -153.071 flat angles P-C4'-P energy: -88.361 tors. eta vs tors. theta energy: -156.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1931.719670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.719670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.719670 (E_RNA) where: Base-Base interactions energy: -1288.067 where: short stacking energy: -547.305 Base-Backbone interact. energy: 4.660 local terms energy: -648.312840 where: bonds (distance) C4'-P energy: -136.390 bonds (distance) P-C4' energy: -133.419 flat angles C4'-P-C4' energy: -146.777 flat angles P-C4'-P energy: -109.247 tors. eta vs tors. theta energy: -122.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1751.966666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.966666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.966666 (E_RNA) where: Base-Base interactions energy: -1113.620 where: short stacking energy: -524.872 Base-Backbone interact. energy: -3.309 local terms energy: -635.038629 where: bonds (distance) C4'-P energy: -124.950 bonds (distance) P-C4' energy: -145.480 flat angles C4'-P-C4' energy: -138.072 flat angles P-C4'-P energy: -103.174 tors. eta vs tors. theta energy: -123.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1636.732700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.732700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.732700 (E_RNA) where: Base-Base interactions energy: -1055.999 where: short stacking energy: -488.760 Base-Backbone interact. energy: 0.532 local terms energy: -581.265293 where: bonds (distance) C4'-P energy: -138.140 bonds (distance) P-C4' energy: -134.453 flat angles C4'-P-C4' energy: -140.516 flat angles P-C4'-P energy: -69.655 tors. eta vs tors. theta energy: -98.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1446.259293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.259293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.259293 (E_RNA) where: Base-Base interactions energy: -895.456 where: short stacking energy: -409.655 Base-Backbone interact. energy: 5.125 local terms energy: -555.927970 where: bonds (distance) C4'-P energy: -149.495 bonds (distance) P-C4' energy: -123.819 flat angles C4'-P-C4' energy: -129.374 flat angles P-C4'-P energy: -65.242 tors. eta vs tors. theta energy: -87.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1237.157488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.157488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.157488 (E_RNA) where: Base-Base interactions energy: -738.352 where: short stacking energy: -375.665 Base-Backbone interact. energy: -2.518 local terms energy: -496.287666 where: bonds (distance) C4'-P energy: -116.245 bonds (distance) P-C4' energy: -129.833 flat angles C4'-P-C4' energy: -103.211 flat angles P-C4'-P energy: -85.760 tors. eta vs tors. theta energy: -61.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -883.423062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.423062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.423062 (E_RNA) where: Base-Base interactions energy: -465.115 where: short stacking energy: -254.049 Base-Backbone interact. energy: 1.075 local terms energy: -419.383423 where: bonds (distance) C4'-P energy: -116.367 bonds (distance) P-C4' energy: -130.960 flat angles C4'-P-C4' energy: -101.881 flat angles P-C4'-P energy: -48.647 tors. eta vs tors. theta energy: -21.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -667.708205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.708205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.708205 (E_RNA) where: Base-Base interactions energy: -285.805 where: short stacking energy: -184.556 Base-Backbone interact. energy: 1.331 local terms energy: -383.234670 where: bonds (distance) C4'-P energy: -109.724 bonds (distance) P-C4' energy: -136.108 flat angles C4'-P-C4' energy: -83.387 flat angles P-C4'-P energy: -70.299 tors. eta vs tors. theta energy: 16.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2351.827020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2351.827020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2351.827020 (E_RNA) where: Base-Base interactions energy: -1547.953 where: short stacking energy: -735.880 Base-Backbone interact. energy: -0.607 local terms energy: -803.266919 where: bonds (distance) C4'-P energy: -151.673 bonds (distance) P-C4' energy: -160.653 flat angles C4'-P-C4' energy: -171.231 flat angles P-C4'-P energy: -101.924 tors. eta vs tors. theta energy: -217.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2190.422022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2190.422022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2190.422022 (E_RNA) where: Base-Base interactions energy: -1454.708 where: short stacking energy: -688.255 Base-Backbone interact. energy: -2.363 local terms energy: -733.350646 where: bonds (distance) C4'-P energy: -133.678 bonds (distance) P-C4' energy: -140.308 flat angles C4'-P-C4' energy: -166.018 flat angles P-C4'-P energy: -102.731 tors. eta vs tors. theta energy: -190.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2106.212856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.212856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.212856 (E_RNA) where: Base-Base interactions energy: -1433.827 where: short stacking energy: -605.428 Base-Backbone interact. energy: -4.802 local terms energy: -667.583765 where: bonds (distance) C4'-P energy: -127.566 bonds (distance) P-C4' energy: -137.339 flat angles C4'-P-C4' energy: -158.579 flat angles P-C4'-P energy: -98.233 tors. eta vs tors. theta energy: -145.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1914.605514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.605514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.605514 (E_RNA) where: Base-Base interactions energy: -1301.521 where: short stacking energy: -588.490 Base-Backbone interact. energy: 5.668 local terms energy: -618.752848 where: bonds (distance) C4'-P energy: -137.297 bonds (distance) P-C4' energy: -141.369 flat angles C4'-P-C4' energy: -122.435 flat angles P-C4'-P energy: -83.362 tors. eta vs tors. theta energy: -134.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1737.545110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.545110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.545110 (E_RNA) where: Base-Base interactions energy: -1121.606 where: short stacking energy: -538.429 Base-Backbone interact. energy: -2.413 local terms energy: -613.525787 where: bonds (distance) C4'-P energy: -122.414 bonds (distance) P-C4' energy: -136.225 flat angles C4'-P-C4' energy: -141.999 flat angles P-C4'-P energy: -93.611 tors. eta vs tors. theta energy: -119.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1662.955753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.955753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.955753 (E_RNA) where: Base-Base interactions energy: -1077.705 where: short stacking energy: -507.682 Base-Backbone interact. energy: 3.837 local terms energy: -589.088143 where: bonds (distance) C4'-P energy: -127.345 bonds (distance) P-C4' energy: -132.872 flat angles C4'-P-C4' energy: -130.116 flat angles P-C4'-P energy: -83.605 tors. eta vs tors. theta energy: -115.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1455.925600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.925600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.925600 (E_RNA) where: Base-Base interactions energy: -933.572 where: short stacking energy: -445.342 Base-Backbone interact. energy: -2.681 local terms energy: -519.673355 where: bonds (distance) C4'-P energy: -123.357 bonds (distance) P-C4' energy: -118.888 flat angles C4'-P-C4' energy: -124.526 flat angles P-C4'-P energy: -78.654 tors. eta vs tors. theta energy: -74.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1165.502233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.502233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.502233 (E_RNA) where: Base-Base interactions energy: -687.467 where: short stacking energy: -368.317 Base-Backbone interact. energy: 3.128 local terms energy: -481.163782 where: bonds (distance) C4'-P energy: -114.623 bonds (distance) P-C4' energy: -111.399 flat angles C4'-P-C4' energy: -130.648 flat angles P-C4'-P energy: -56.725 tors. eta vs tors. theta energy: -67.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -876.135936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.135936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.135936 (E_RNA) where: Base-Base interactions energy: -451.503 where: short stacking energy: -251.594 Base-Backbone interact. energy: 1.292 local terms energy: -425.924835 where: bonds (distance) C4'-P energy: -113.991 bonds (distance) P-C4' energy: -117.234 flat angles C4'-P-C4' energy: -113.005 flat angles P-C4'-P energy: -65.237 tors. eta vs tors. theta energy: -16.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -659.402579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.402579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.402579 (E_RNA) where: Base-Base interactions energy: -275.507 where: short stacking energy: -192.198 Base-Backbone interact. energy: 4.993 local terms energy: -388.889117 where: bonds (distance) C4'-P energy: -116.229 bonds (distance) P-C4' energy: -123.388 flat angles C4'-P-C4' energy: -101.087 flat angles P-C4'-P energy: -57.613 tors. eta vs tors. theta energy: 9.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2360.255195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2360.255195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2360.255195 (E_RNA) where: Base-Base interactions energy: -1597.165 where: short stacking energy: -728.441 Base-Backbone interact. energy: -3.888 local terms energy: -759.201938 where: bonds (distance) C4'-P energy: -152.299 bonds (distance) P-C4' energy: -126.974 flat angles C4'-P-C4' energy: -164.014 flat angles P-C4'-P energy: -102.998 tors. eta vs tors. theta energy: -212.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2237.195776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2237.195776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.195776 (E_RNA) where: Base-Base interactions energy: -1525.287 where: short stacking energy: -691.957 Base-Backbone interact. energy: -0.706 local terms energy: -711.202746 where: bonds (distance) C4'-P energy: -133.306 bonds (distance) P-C4' energy: -132.192 flat angles C4'-P-C4' energy: -147.405 flat angles P-C4'-P energy: -100.259 tors. eta vs tors. theta energy: -198.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2126.062162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2126.062162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2126.062162 (E_RNA) where: Base-Base interactions energy: -1459.405 where: short stacking energy: -648.854 Base-Backbone interact. energy: -4.524 local terms energy: -662.133142 where: bonds (distance) C4'-P energy: -145.442 bonds (distance) P-C4' energy: -129.035 flat angles C4'-P-C4' energy: -145.995 flat angles P-C4'-P energy: -85.933 tors. eta vs tors. theta energy: -155.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1971.087108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.087108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.087108 (E_RNA) where: Base-Base interactions energy: -1320.911 where: short stacking energy: -585.944 Base-Backbone interact. energy: -4.371 local terms energy: -645.805847 where: bonds (distance) C4'-P energy: -132.800 bonds (distance) P-C4' energy: -134.547 flat angles C4'-P-C4' energy: -153.016 flat angles P-C4'-P energy: -89.319 tors. eta vs tors. theta energy: -136.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1758.948290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1758.948290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.948290 (E_RNA) where: Base-Base interactions energy: -1128.311 where: short stacking energy: -552.315 Base-Backbone interact. energy: -0.354 local terms energy: -630.283335 where: bonds (distance) C4'-P energy: -125.917 bonds (distance) P-C4' energy: -137.768 flat angles C4'-P-C4' energy: -150.651 flat angles P-C4'-P energy: -75.463 tors. eta vs tors. theta energy: -140.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1691.977131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.977131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.977131 (E_RNA) where: Base-Base interactions energy: -1108.987 where: short stacking energy: -479.604 Base-Backbone interact. energy: 0.704 local terms energy: -583.694292 where: bonds (distance) C4'-P energy: -135.981 bonds (distance) P-C4' energy: -128.052 flat angles C4'-P-C4' energy: -131.132 flat angles P-C4'-P energy: -84.804 tors. eta vs tors. theta energy: -103.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1483.854986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.854986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.854986 (E_RNA) where: Base-Base interactions energy: -912.707 where: short stacking energy: -391.615 Base-Backbone interact. energy: -1.763 local terms energy: -569.384542 where: bonds (distance) C4'-P energy: -132.612 bonds (distance) P-C4' energy: -139.977 flat angles C4'-P-C4' energy: -136.528 flat angles P-C4'-P energy: -93.726 tors. eta vs tors. theta energy: -66.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1260.067661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.067661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.067661 (E_RNA) where: Base-Base interactions energy: -791.602 where: short stacking energy: -390.309 Base-Backbone interact. energy: -1.888 local terms energy: -466.578167 where: bonds (distance) C4'-P energy: -95.001 bonds (distance) P-C4' energy: -122.990 flat angles C4'-P-C4' energy: -115.872 flat angles P-C4'-P energy: -64.338 tors. eta vs tors. theta energy: -68.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -938.264885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.264885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.264885 (E_RNA) where: Base-Base interactions energy: -509.863 where: short stacking energy: -296.362 Base-Backbone interact. energy: 2.060 local terms energy: -430.461973 where: bonds (distance) C4'-P energy: -124.672 bonds (distance) P-C4' energy: -100.325 flat angles C4'-P-C4' energy: -110.564 flat angles P-C4'-P energy: -80.376 tors. eta vs tors. theta energy: -14.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -653.336945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.336945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.336945 (E_RNA) where: Base-Base interactions energy: -260.911 where: short stacking energy: -161.822 Base-Backbone interact. energy: -1.245 local terms energy: -391.180555 where: bonds (distance) C4'-P energy: -114.790 bonds (distance) P-C4' energy: -135.165 flat angles C4'-P-C4' energy: -104.137 flat angles P-C4'-P energy: -62.245 tors. eta vs tors. theta energy: 25.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2362.520527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2362.520527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2362.520527 (E_RNA) where: Base-Base interactions energy: -1568.706 where: short stacking energy: -703.832 Base-Backbone interact. energy: -0.429 local terms energy: -793.385510 where: bonds (distance) C4'-P energy: -142.597 bonds (distance) P-C4' energy: -152.086 flat angles C4'-P-C4' energy: -173.576 flat angles P-C4'-P energy: -119.519 tors. eta vs tors. theta energy: -205.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2193.932192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.932192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.932192 (E_RNA) where: Base-Base interactions energy: -1467.372 where: short stacking energy: -670.951 Base-Backbone interact. energy: -3.765 local terms energy: -722.795374 where: bonds (distance) C4'-P energy: -133.896 bonds (distance) P-C4' energy: -153.895 flat angles C4'-P-C4' energy: -155.207 flat angles P-C4'-P energy: -100.855 tors. eta vs tors. theta energy: -178.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2089.345269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.345269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.345269 (E_RNA) where: Base-Base interactions energy: -1415.202 where: short stacking energy: -600.823 Base-Backbone interact. energy: -2.882 local terms energy: -671.260955 where: bonds (distance) C4'-P energy: -130.988 bonds (distance) P-C4' energy: -144.373 flat angles C4'-P-C4' energy: -163.215 flat angles P-C4'-P energy: -91.979 tors. eta vs tors. theta energy: -140.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1922.753108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1922.753108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1922.753108 (E_RNA) where: Base-Base interactions energy: -1264.558 where: short stacking energy: -556.190 Base-Backbone interact. energy: -2.075 local terms energy: -656.119423 where: bonds (distance) C4'-P energy: -125.191 bonds (distance) P-C4' energy: -146.959 flat angles C4'-P-C4' energy: -142.553 flat angles P-C4'-P energy: -104.026 tors. eta vs tors. theta energy: -137.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1792.716036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1792.716036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.716036 (E_RNA) where: Base-Base interactions energy: -1170.648 where: short stacking energy: -564.211 Base-Backbone interact. energy: -2.003 local terms energy: -620.064527 where: bonds (distance) C4'-P energy: -136.567 bonds (distance) P-C4' energy: -119.924 flat angles C4'-P-C4' energy: -148.769 flat angles P-C4'-P energy: -79.112 tors. eta vs tors. theta energy: -135.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1660.415022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.415022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.415022 (E_RNA) where: Base-Base interactions energy: -1087.752 where: short stacking energy: -500.758 Base-Backbone interact. energy: 0.057 local terms energy: -572.719456 where: bonds (distance) C4'-P energy: -122.681 bonds (distance) P-C4' energy: -129.990 flat angles C4'-P-C4' energy: -121.393 flat angles P-C4'-P energy: -95.997 tors. eta vs tors. theta energy: -102.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1513.526268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1513.526268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.526268 (E_RNA) where: Base-Base interactions energy: -997.035 where: short stacking energy: -461.118 Base-Backbone interact. energy: 0.108 local terms energy: -516.598879 where: bonds (distance) C4'-P energy: -108.913 bonds (distance) P-C4' energy: -116.404 flat angles C4'-P-C4' energy: -128.104 flat angles P-C4'-P energy: -72.259 tors. eta vs tors. theta energy: -90.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1262.903212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.903212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.903212 (E_RNA) where: Base-Base interactions energy: -766.727 where: short stacking energy: -385.014 Base-Backbone interact. energy: 1.946 local terms energy: -498.122019 where: bonds (distance) C4'-P energy: -113.776 bonds (distance) P-C4' energy: -127.189 flat angles C4'-P-C4' energy: -123.525 flat angles P-C4'-P energy: -66.720 tors. eta vs tors. theta energy: -66.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -868.939569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.939569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.939569 (E_RNA) where: Base-Base interactions energy: -480.429 where: short stacking energy: -295.857 Base-Backbone interact. energy: 2.017 local terms energy: -390.527697 where: bonds (distance) C4'-P energy: -96.292 bonds (distance) P-C4' energy: -102.605 flat angles C4'-P-C4' energy: -116.162 flat angles P-C4'-P energy: -73.130 tors. eta vs tors. theta energy: -2.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -645.467796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.467796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.467796 (E_RNA) where: Base-Base interactions energy: -251.807 where: short stacking energy: -174.925 Base-Backbone interact. energy: 3.149 local terms energy: -396.810196 where: bonds (distance) C4'-P energy: -123.852 bonds (distance) P-C4' energy: -131.019 flat angles C4'-P-C4' energy: -100.499 flat angles P-C4'-P energy: -49.720 tors. eta vs tors. theta energy: 8.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2355.898396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.898396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.898396 (E_RNA) where: Base-Base interactions energy: -1598.816 where: short stacking energy: -717.780 Base-Backbone interact. energy: 0.673 local terms energy: -757.755088 where: bonds (distance) C4'-P energy: -139.352 bonds (distance) P-C4' energy: -144.709 flat angles C4'-P-C4' energy: -162.227 flat angles P-C4'-P energy: -105.443 tors. eta vs tors. theta energy: -206.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2198.323813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2198.323813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2198.323813 (E_RNA) where: Base-Base interactions energy: -1457.941 where: short stacking energy: -643.600 Base-Backbone interact. energy: -1.935 local terms energy: -738.448335 where: bonds (distance) C4'-P energy: -146.566 bonds (distance) P-C4' energy: -138.404 flat angles C4'-P-C4' energy: -170.967 flat angles P-C4'-P energy: -100.224 tors. eta vs tors. theta energy: -182.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2110.559643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.559643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.559643 (E_RNA) where: Base-Base interactions energy: -1408.883 where: short stacking energy: -654.257 Base-Backbone interact. energy: -1.897 local terms energy: -699.779905 where: bonds (distance) C4'-P energy: -128.667 bonds (distance) P-C4' energy: -150.555 flat angles C4'-P-C4' energy: -159.665 flat angles P-C4'-P energy: -98.821 tors. eta vs tors. theta energy: -162.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1976.948972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1976.948972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1976.948972 (E_RNA) where: Base-Base interactions energy: -1330.942 where: short stacking energy: -587.824 Base-Backbone interact. energy: 1.177 local terms energy: -647.183421 where: bonds (distance) C4'-P energy: -122.089 bonds (distance) P-C4' energy: -141.054 flat angles C4'-P-C4' energy: -144.154 flat angles P-C4'-P energy: -97.617 tors. eta vs tors. theta energy: -142.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1821.188964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1821.188964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1821.188964 (E_RNA) where: Base-Base interactions energy: -1166.820 where: short stacking energy: -558.850 Base-Backbone interact. energy: -1.161 local terms energy: -653.207708 where: bonds (distance) C4'-P energy: -152.864 bonds (distance) P-C4' energy: -128.406 flat angles C4'-P-C4' energy: -134.502 flat angles P-C4'-P energy: -87.233 tors. eta vs tors. theta energy: -150.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1648.735484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.735484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.735484 (E_RNA) where: Base-Base interactions energy: -1045.169 where: short stacking energy: -502.158 Base-Backbone interact. energy: 0.205 local terms energy: -603.771599 where: bonds (distance) C4'-P energy: -120.203 bonds (distance) P-C4' energy: -143.722 flat angles C4'-P-C4' energy: -127.637 flat angles P-C4'-P energy: -101.394 tors. eta vs tors. theta energy: -110.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1578.876331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.876331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.876331 (E_RNA) where: Base-Base interactions energy: -1004.033 where: short stacking energy: -452.270 Base-Backbone interact. energy: -0.699 local terms energy: -574.144610 where: bonds (distance) C4'-P energy: -127.243 bonds (distance) P-C4' energy: -134.206 flat angles C4'-P-C4' energy: -140.097 flat angles P-C4'-P energy: -80.227 tors. eta vs tors. theta energy: -92.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1286.872340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.872340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.872340 (E_RNA) where: Base-Base interactions energy: -791.868 where: short stacking energy: -397.867 Base-Backbone interact. energy: -0.857 local terms energy: -494.147593 where: bonds (distance) C4'-P energy: -114.165 bonds (distance) P-C4' energy: -108.916 flat angles C4'-P-C4' energy: -127.914 flat angles P-C4'-P energy: -66.845 tors. eta vs tors. theta energy: -76.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -928.562060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.562060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.562060 (E_RNA) where: Base-Base interactions energy: -482.960 where: short stacking energy: -267.466 Base-Backbone interact. energy: -4.325 local terms energy: -441.277454 where: bonds (distance) C4'-P energy: -121.348 bonds (distance) P-C4' energy: -129.295 flat angles C4'-P-C4' energy: -105.421 flat angles P-C4'-P energy: -70.084 tors. eta vs tors. theta energy: -15.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -638.102381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.102381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.102381 (E_RNA) where: Base-Base interactions energy: -254.017 where: short stacking energy: -184.922 Base-Backbone interact. energy: 2.878 local terms energy: -386.963322 where: bonds (distance) C4'-P energy: -116.918 bonds (distance) P-C4' energy: -133.260 flat angles C4'-P-C4' energy: -92.625 flat angles P-C4'-P energy: -68.087 tors. eta vs tors. theta energy: 23.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2326.103319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.103319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.103319 (E_RNA) where: Base-Base interactions energy: -1563.547 where: short stacking energy: -732.061 Base-Backbone interact. energy: -2.055 local terms energy: -760.500862 where: bonds (distance) C4'-P energy: -142.084 bonds (distance) P-C4' energy: -137.056 flat angles C4'-P-C4' energy: -157.613 flat angles P-C4'-P energy: -113.315 tors. eta vs tors. theta energy: -210.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2220.980670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.980670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2220.980670 (E_RNA) where: Base-Base interactions energy: -1494.408 where: short stacking energy: -673.796 Base-Backbone interact. energy: -1.172 local terms energy: -725.401106 where: bonds (distance) C4'-P energy: -141.561 bonds (distance) P-C4' energy: -136.719 flat angles C4'-P-C4' energy: -159.517 flat angles P-C4'-P energy: -102.788 tors. eta vs tors. theta energy: -184.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2070.274348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2070.274348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2070.274348 (E_RNA) where: Base-Base interactions energy: -1381.220 where: short stacking energy: -589.036 Base-Backbone interact. energy: 0.266 local terms energy: -689.320783 where: bonds (distance) C4'-P energy: -143.038 bonds (distance) P-C4' energy: -146.571 flat angles C4'-P-C4' energy: -145.947 flat angles P-C4'-P energy: -103.298 tors. eta vs tors. theta energy: -150.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1938.674097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1938.674097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1938.674097 (E_RNA) where: Base-Base interactions energy: -1287.851 where: short stacking energy: -594.792 Base-Backbone interact. energy: 0.071 local terms energy: -650.893534 where: bonds (distance) C4'-P energy: -130.446 bonds (distance) P-C4' energy: -150.787 flat angles C4'-P-C4' energy: -146.093 flat angles P-C4'-P energy: -94.382 tors. eta vs tors. theta energy: -129.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1847.436905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1847.436905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1847.436905 (E_RNA) where: Base-Base interactions energy: -1223.925 where: short stacking energy: -570.457 Base-Backbone interact. energy: -3.322 local terms energy: -620.189407 where: bonds (distance) C4'-P energy: -115.344 bonds (distance) P-C4' energy: -109.578 flat angles C4'-P-C4' energy: -152.928 flat angles P-C4'-P energy: -107.050 tors. eta vs tors. theta energy: -135.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1658.241642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.241642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.241642 (E_RNA) where: Base-Base interactions energy: -1077.736 where: short stacking energy: -496.509 Base-Backbone interact. energy: -2.003 local terms energy: -578.502576 where: bonds (distance) C4'-P energy: -129.920 bonds (distance) P-C4' energy: -122.661 flat angles C4'-P-C4' energy: -140.721 flat angles P-C4'-P energy: -82.068 tors. eta vs tors. theta energy: -103.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1688.509715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.509715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.509715 (E_RNA) where: Base-Base interactions energy: -1084.561 where: short stacking energy: -494.179 Base-Backbone interact. energy: -3.076 local terms energy: -600.873017 where: bonds (distance) C4'-P energy: -131.480 bonds (distance) P-C4' energy: -124.788 flat angles C4'-P-C4' energy: -155.602 flat angles P-C4'-P energy: -77.159 tors. eta vs tors. theta energy: -111.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1301.840450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.840450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.840450 (E_RNA) where: Base-Base interactions energy: -814.777 where: short stacking energy: -381.938 Base-Backbone interact. energy: 4.605 local terms energy: -491.668851 where: bonds (distance) C4'-P energy: -111.657 bonds (distance) P-C4' energy: -137.573 flat angles C4'-P-C4' energy: -113.078 flat angles P-C4'-P energy: -68.979 tors. eta vs tors. theta energy: -60.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -944.524758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.524758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.524758 (E_RNA) where: Base-Base interactions energy: -520.720 where: short stacking energy: -238.597 Base-Backbone interact. energy: 5.993 local terms energy: -429.798211 where: bonds (distance) C4'-P energy: -123.349 bonds (distance) P-C4' energy: -137.297 flat angles C4'-P-C4' energy: -85.503 flat angles P-C4'-P energy: -76.251 tors. eta vs tors. theta energy: -7.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -686.923304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.923304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.923304 (E_RNA) where: Base-Base interactions energy: -314.754 where: short stacking energy: -208.763 Base-Backbone interact. energy: 1.966 local terms energy: -374.134736 where: bonds (distance) C4'-P energy: -116.614 bonds (distance) P-C4' energy: -130.339 flat angles C4'-P-C4' energy: -74.651 flat angles P-C4'-P energy: -72.269 tors. eta vs tors. theta energy: 19.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2379.874503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.874503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.874503 (E_RNA) where: Base-Base interactions energy: -1586.533 where: short stacking energy: -733.795 Base-Backbone interact. energy: -4.718 local terms energy: -788.623964 where: bonds (distance) C4'-P energy: -156.786 bonds (distance) P-C4' energy: -137.685 flat angles C4'-P-C4' energy: -175.795 flat angles P-C4'-P energy: -114.626 tors. eta vs tors. theta energy: -203.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2252.887613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2252.887613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2252.887613 (E_RNA) where: Base-Base interactions energy: -1510.815 where: short stacking energy: -680.070 Base-Backbone interact. energy: -2.784 local terms energy: -739.288896 where: bonds (distance) C4'-P energy: -143.156 bonds (distance) P-C4' energy: -152.341 flat angles C4'-P-C4' energy: -147.499 flat angles P-C4'-P energy: -99.455 tors. eta vs tors. theta energy: -196.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2066.807609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2066.807609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2066.807609 (E_RNA) where: Base-Base interactions energy: -1379.522 where: short stacking energy: -598.630 Base-Backbone interact. energy: 2.312 local terms energy: -689.597619 where: bonds (distance) C4'-P energy: -125.322 bonds (distance) P-C4' energy: -151.700 flat angles C4'-P-C4' energy: -156.862 flat angles P-C4'-P energy: -110.198 tors. eta vs tors. theta energy: -145.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1975.531783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1975.531783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1975.531783 (E_RNA) where: Base-Base interactions energy: -1333.318 where: short stacking energy: -625.868 Base-Backbone interact. energy: -2.348 local terms energy: -639.866068 where: bonds (distance) C4'-P energy: -136.095 bonds (distance) P-C4' energy: -125.021 flat angles C4'-P-C4' energy: -145.235 flat angles P-C4'-P energy: -83.740 tors. eta vs tors. theta energy: -149.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1880.925694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1880.925694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1880.925694 (E_RNA) where: Base-Base interactions energy: -1269.479 where: short stacking energy: -599.979 Base-Backbone interact. energy: -3.830 local terms energy: -607.616682 where: bonds (distance) C4'-P energy: -104.778 bonds (distance) P-C4' energy: -120.728 flat angles C4'-P-C4' energy: -144.989 flat angles P-C4'-P energy: -84.491 tors. eta vs tors. theta energy: -152.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1826.057194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1826.057194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1826.057194 (E_RNA) where: Base-Base interactions energy: -1207.989 where: short stacking energy: -549.190 Base-Backbone interact. energy: 4.416 local terms energy: -622.483579 where: bonds (distance) C4'-P energy: -132.249 bonds (distance) P-C4' energy: -137.764 flat angles C4'-P-C4' energy: -141.966 flat angles P-C4'-P energy: -68.041 tors. eta vs tors. theta energy: -142.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1594.000410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.000410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.000410 (E_RNA) where: Base-Base interactions energy: -1044.215 where: short stacking energy: -466.134 Base-Backbone interact. energy: 8.232 local terms energy: -558.017943 where: bonds (distance) C4'-P energy: -129.723 bonds (distance) P-C4' energy: -120.825 flat angles C4'-P-C4' energy: -129.933 flat angles P-C4'-P energy: -90.619 tors. eta vs tors. theta energy: -86.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1342.716475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.716475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.716475 (E_RNA) where: Base-Base interactions energy: -830.311 where: short stacking energy: -398.731 Base-Backbone interact. energy: -0.846 local terms energy: -511.559425 where: bonds (distance) C4'-P energy: -143.417 bonds (distance) P-C4' energy: -119.516 flat angles C4'-P-C4' energy: -112.851 flat angles P-C4'-P energy: -82.205 tors. eta vs tors. theta energy: -53.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -999.595339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.595339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.595339 (E_RNA) where: Base-Base interactions energy: -555.756 where: short stacking energy: -274.994 Base-Backbone interact. energy: -3.967 local terms energy: -439.871389 where: bonds (distance) C4'-P energy: -115.207 bonds (distance) P-C4' energy: -136.827 flat angles C4'-P-C4' energy: -105.015 flat angles P-C4'-P energy: -60.382 tors. eta vs tors. theta energy: -22.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -662.690737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.690737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.690737 (E_RNA) where: Base-Base interactions energy: -299.597 where: short stacking energy: -210.914 Base-Backbone interact. energy: -1.807 local terms energy: -361.286738 where: bonds (distance) C4'-P energy: -122.251 bonds (distance) P-C4' energy: -100.869 flat angles C4'-P-C4' energy: -108.482 flat angles P-C4'-P energy: -33.478 tors. eta vs tors. theta energy: 3.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -2376.013288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2376.013288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2376.013288 (E_RNA) where: Base-Base interactions energy: -1596.344 where: short stacking energy: -728.415 Base-Backbone interact. energy: -3.455 local terms energy: -776.214502 where: bonds (distance) C4'-P energy: -136.523 bonds (distance) P-C4' energy: -160.762 flat angles C4'-P-C4' energy: -160.633 flat angles P-C4'-P energy: -111.197 tors. eta vs tors. theta energy: -207.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2236.189091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.189091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.189091 (E_RNA) where: Base-Base interactions energy: -1519.861 where: short stacking energy: -684.741 Base-Backbone interact. energy: -1.085 local terms energy: -715.242997 where: bonds (distance) C4'-P energy: -131.467 bonds (distance) P-C4' energy: -147.795 flat angles C4'-P-C4' energy: -160.419 flat angles P-C4'-P energy: -91.134 tors. eta vs tors. theta energy: -184.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2101.768991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.768991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.768991 (E_RNA) where: Base-Base interactions energy: -1437.198 where: short stacking energy: -636.620 Base-Backbone interact. energy: 1.320 local terms energy: -665.891407 where: bonds (distance) C4'-P energy: -119.663 bonds (distance) P-C4' energy: -145.456 flat angles C4'-P-C4' energy: -155.908 flat angles P-C4'-P energy: -85.196 tors. eta vs tors. theta energy: -159.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1924.528696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1924.528696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1924.528696 (E_RNA) where: Base-Base interactions energy: -1290.440 where: short stacking energy: -576.630 Base-Backbone interact. energy: 5.603 local terms energy: -639.691505 where: bonds (distance) C4'-P energy: -147.551 bonds (distance) P-C4' energy: -127.792 flat angles C4'-P-C4' energy: -149.569 flat angles P-C4'-P energy: -82.152 tors. eta vs tors. theta energy: -132.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1895.255378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.255378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.255378 (E_RNA) where: Base-Base interactions energy: -1243.912 where: short stacking energy: -569.639 Base-Backbone interact. energy: -1.115 local terms energy: -650.228253 where: bonds (distance) C4'-P energy: -142.715 bonds (distance) P-C4' energy: -134.773 flat angles C4'-P-C4' energy: -134.887 flat angles P-C4'-P energy: -85.585 tors. eta vs tors. theta energy: -152.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1797.203432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.203432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.203432 (E_RNA) where: Base-Base interactions energy: -1176.407 where: short stacking energy: -560.365 Base-Backbone interact. energy: -1.600 local terms energy: -619.196218 where: bonds (distance) C4'-P energy: -118.936 bonds (distance) P-C4' energy: -118.800 flat angles C4'-P-C4' energy: -140.732 flat angles P-C4'-P energy: -94.303 tors. eta vs tors. theta energy: -146.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1509.073745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.073745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.073745 (E_RNA) where: Base-Base interactions energy: -963.387 where: short stacking energy: -424.286 Base-Backbone interact. energy: 9.291 local terms energy: -554.977726 where: bonds (distance) C4'-P energy: -139.409 bonds (distance) P-C4' energy: -128.923 flat angles C4'-P-C4' energy: -123.544 flat angles P-C4'-P energy: -86.034 tors. eta vs tors. theta energy: -77.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1341.045257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.045257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1341.045257 (E_RNA) where: Base-Base interactions energy: -829.366 where: short stacking energy: -398.767 Base-Backbone interact. energy: 4.016 local terms energy: -515.695667 where: bonds (distance) C4'-P energy: -118.061 bonds (distance) P-C4' energy: -127.683 flat angles C4'-P-C4' energy: -126.348 flat angles P-C4'-P energy: -72.265 tors. eta vs tors. theta energy: -71.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -967.135392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.135392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.135392 (E_RNA) where: Base-Base interactions energy: -568.331 where: short stacking energy: -295.416 Base-Backbone interact. energy: 0.930 local terms energy: -399.734493 where: bonds (distance) C4'-P energy: -93.637 bonds (distance) P-C4' energy: -120.506 flat angles C4'-P-C4' energy: -121.131 flat angles P-C4'-P energy: -54.996 tors. eta vs tors. theta energy: -9.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -695.249171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.249171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.249171 (E_RNA) where: Base-Base interactions energy: -318.328 where: short stacking energy: -206.897 Base-Backbone interact. energy: 5.558 local terms energy: -382.479118 where: bonds (distance) C4'-P energy: -118.562 bonds (distance) P-C4' energy: -126.083 flat angles C4'-P-C4' energy: -114.186 flat angles P-C4'-P energy: -33.334 tors. eta vs tors. theta energy: 9.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -2339.685142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2339.685142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2339.685142 (E_RNA) where: Base-Base interactions energy: -1588.525 where: short stacking energy: -737.940 Base-Backbone interact. energy: -0.600 local terms energy: -750.559738 where: bonds (distance) C4'-P energy: -145.001 bonds (distance) P-C4' energy: -147.883 flat angles C4'-P-C4' energy: -159.843 flat angles P-C4'-P energy: -97.945 tors. eta vs tors. theta energy: -199.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2251.503223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.503223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.503223 (E_RNA) where: Base-Base interactions energy: -1524.767 where: short stacking energy: -660.712 Base-Backbone interact. energy: -2.536 local terms energy: -724.199747 where: bonds (distance) C4'-P energy: -141.911 bonds (distance) P-C4' energy: -143.612 flat angles C4'-P-C4' energy: -156.417 flat angles P-C4'-P energy: -101.730 tors. eta vs tors. theta energy: -180.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2116.837897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.837897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.837897 (E_RNA) where: Base-Base interactions energy: -1420.937 where: short stacking energy: -635.551 Base-Backbone interact. energy: 0.991 local terms energy: -696.891056 where: bonds (distance) C4'-P energy: -136.483 bonds (distance) P-C4' energy: -141.332 flat angles C4'-P-C4' energy: -151.257 flat angles P-C4'-P energy: -96.076 tors. eta vs tors. theta energy: -171.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1983.351261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.351261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1983.351261 (E_RNA) where: Base-Base interactions energy: -1295.548 where: short stacking energy: -608.236 Base-Backbone interact. energy: -4.249 local terms energy: -683.553753 where: bonds (distance) C4'-P energy: -112.781 bonds (distance) P-C4' energy: -152.958 flat angles C4'-P-C4' energy: -142.957 flat angles P-C4'-P energy: -100.033 tors. eta vs tors. theta energy: -174.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1916.018479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1916.018479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1916.018479 (E_RNA) where: Base-Base interactions energy: -1260.493 where: short stacking energy: -581.850 Base-Backbone interact. energy: -3.399 local terms energy: -652.126048 where: bonds (distance) C4'-P energy: -136.943 bonds (distance) P-C4' energy: -122.843 flat angles C4'-P-C4' energy: -150.445 flat angles P-C4'-P energy: -86.040 tors. eta vs tors. theta energy: -155.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1787.992633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.992633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.992633 (E_RNA) where: Base-Base interactions energy: -1172.738 where: short stacking energy: -532.426 Base-Backbone interact. energy: -1.560 local terms energy: -613.694502 where: bonds (distance) C4'-P energy: -131.610 bonds (distance) P-C4' energy: -125.330 flat angles C4'-P-C4' energy: -130.801 flat angles P-C4'-P energy: -77.847 tors. eta vs tors. theta energy: -148.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1537.093426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.093426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.093426 (E_RNA) where: Base-Base interactions energy: -1001.968 where: short stacking energy: -433.685 Base-Backbone interact. energy: -2.488 local terms energy: -532.637396 where: bonds (distance) C4'-P energy: -122.774 bonds (distance) P-C4' energy: -135.687 flat angles C4'-P-C4' energy: -113.961 flat angles P-C4'-P energy: -72.635 tors. eta vs tors. theta energy: -87.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1296.744327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.744327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.744327 (E_RNA) where: Base-Base interactions energy: -787.045 where: short stacking energy: -376.671 Base-Backbone interact. energy: 5.009 local terms energy: -514.708566 where: bonds (distance) C4'-P energy: -133.765 bonds (distance) P-C4' energy: -116.584 flat angles C4'-P-C4' energy: -125.532 flat angles P-C4'-P energy: -76.613 tors. eta vs tors. theta energy: -62.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1020.843841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.843841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.843841 (E_RNA) where: Base-Base interactions energy: -591.783 where: short stacking energy: -309.070 Base-Backbone interact. energy: 2.500 local terms energy: -431.560137 where: bonds (distance) C4'-P energy: -119.151 bonds (distance) P-C4' energy: -124.916 flat angles C4'-P-C4' energy: -99.613 flat angles P-C4'-P energy: -66.497 tors. eta vs tors. theta energy: -21.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -660.171999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.171999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.171999 (E_RNA) where: Base-Base interactions energy: -281.114 where: short stacking energy: -201.137 Base-Backbone interact. energy: 4.384 local terms energy: -383.441755 where: bonds (distance) C4'-P energy: -115.489 bonds (distance) P-C4' energy: -114.457 flat angles C4'-P-C4' energy: -104.650 flat angles P-C4'-P energy: -46.219 tors. eta vs tors. theta energy: -2.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -2321.636415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2321.636415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2321.636415 (E_RNA) where: Base-Base interactions energy: -1564.970 where: short stacking energy: -710.562 Base-Backbone interact. energy: -2.376 local terms energy: -754.290721 where: bonds (distance) C4'-P energy: -150.347 bonds (distance) P-C4' energy: -148.348 flat angles C4'-P-C4' energy: -162.868 flat angles P-C4'-P energy: -95.951 tors. eta vs tors. theta energy: -196.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2283.358268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.358268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2283.358268 (E_RNA) where: Base-Base interactions energy: -1543.170 where: short stacking energy: -703.771 Base-Backbone interact. energy: -0.922 local terms energy: -739.266247 where: bonds (distance) C4'-P energy: -144.785 bonds (distance) P-C4' energy: -139.259 flat angles C4'-P-C4' energy: -156.025 flat angles P-C4'-P energy: -108.045 tors. eta vs tors. theta energy: -191.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2147.214377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2147.214377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2147.214377 (E_RNA) where: Base-Base interactions energy: -1429.803 where: short stacking energy: -643.574 Base-Backbone interact. energy: 1.422 local terms energy: -718.834002 where: bonds (distance) C4'-P energy: -145.169 bonds (distance) P-C4' energy: -144.122 flat angles C4'-P-C4' energy: -163.564 flat angles P-C4'-P energy: -101.416 tors. eta vs tors. theta energy: -164.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2083.776546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2083.776546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2083.776546 (E_RNA) where: Base-Base interactions energy: -1375.835 where: short stacking energy: -628.133 Base-Backbone interact. energy: 1.016 local terms energy: -708.957050 where: bonds (distance) C4'-P energy: -137.711 bonds (distance) P-C4' energy: -151.748 flat angles C4'-P-C4' energy: -153.498 flat angles P-C4'-P energy: -95.449 tors. eta vs tors. theta energy: -170.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1896.702261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1896.702261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1896.702261 (E_RNA) where: Base-Base interactions energy: -1245.243 where: short stacking energy: -543.288 Base-Backbone interact. energy: -2.968 local terms energy: -648.490983 where: bonds (distance) C4'-P energy: -131.659 bonds (distance) P-C4' energy: -133.917 flat angles C4'-P-C4' energy: -153.334 flat angles P-C4'-P energy: -85.416 tors. eta vs tors. theta energy: -144.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1835.634502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1835.634502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1835.634502 (E_RNA) where: Base-Base interactions energy: -1185.874 where: short stacking energy: -547.428 Base-Backbone interact. energy: -3.704 local terms energy: -646.056183 where: bonds (distance) C4'-P energy: -119.707 bonds (distance) P-C4' energy: -149.115 flat angles C4'-P-C4' energy: -149.931 flat angles P-C4'-P energy: -84.924 tors. eta vs tors. theta energy: -142.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1551.900903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.900903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.900903 (E_RNA) where: Base-Base interactions energy: -1007.438 where: short stacking energy: -467.366 Base-Backbone interact. energy: -0.196 local terms energy: -544.267620 where: bonds (distance) C4'-P energy: -116.128 bonds (distance) P-C4' energy: -114.497 flat angles C4'-P-C4' energy: -131.818 flat angles P-C4'-P energy: -79.357 tors. eta vs tors. theta energy: -102.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1335.898133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.898133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.898133 (E_RNA) where: Base-Base interactions energy: -860.459 where: short stacking energy: -402.699 Base-Backbone interact. energy: -1.081 local terms energy: -474.358288 where: bonds (distance) C4'-P energy: -119.210 bonds (distance) P-C4' energy: -117.338 flat angles C4'-P-C4' energy: -110.467 flat angles P-C4'-P energy: -65.486 tors. eta vs tors. theta energy: -61.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1034.131446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.131446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.131446 (E_RNA) where: Base-Base interactions energy: -580.396 where: short stacking energy: -288.254 Base-Backbone interact. energy: 0.613 local terms energy: -454.348660 where: bonds (distance) C4'-P energy: -134.285 bonds (distance) P-C4' energy: -119.787 flat angles C4'-P-C4' energy: -107.269 flat angles P-C4'-P energy: -72.658 tors. eta vs tors. theta energy: -20.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -693.509215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.509215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.509215 (E_RNA) where: Base-Base interactions energy: -311.301 where: short stacking energy: -186.771 Base-Backbone interact. energy: 3.676 local terms energy: -385.884491 where: bonds (distance) C4'-P energy: -99.252 bonds (distance) P-C4' energy: -127.794 flat angles C4'-P-C4' energy: -101.089 flat angles P-C4'-P energy: -60.693 tors. eta vs tors. theta energy: 2.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2339.322431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2339.322431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2339.322431 (E_RNA) where: Base-Base interactions energy: -1569.895 where: short stacking energy: -728.857 Base-Backbone interact. energy: -1.369 local terms energy: -768.058137 where: bonds (distance) C4'-P energy: -148.589 bonds (distance) P-C4' energy: -147.979 flat angles C4'-P-C4' energy: -166.491 flat angles P-C4'-P energy: -96.119 tors. eta vs tors. theta energy: -208.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2210.503534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2210.503534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2210.503534 (E_RNA) where: Base-Base interactions energy: -1481.151 where: short stacking energy: -690.355 Base-Backbone interact. energy: -0.981 local terms energy: -728.371253 where: bonds (distance) C4'-P energy: -144.882 bonds (distance) P-C4' energy: -125.814 flat angles C4'-P-C4' energy: -165.704 flat angles P-C4'-P energy: -105.522 tors. eta vs tors. theta energy: -186.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2137.549132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2137.549132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2137.549132 (E_RNA) where: Base-Base interactions energy: -1467.152 where: short stacking energy: -617.340 Base-Backbone interact. energy: -0.081 local terms energy: -670.315950 where: bonds (distance) C4'-P energy: -135.039 bonds (distance) P-C4' energy: -140.733 flat angles C4'-P-C4' energy: -148.586 flat angles P-C4'-P energy: -89.521 tors. eta vs tors. theta energy: -156.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2032.767016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2032.767016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2032.767016 (E_RNA) where: Base-Base interactions energy: -1365.023 where: short stacking energy: -662.302 Base-Backbone interact. energy: -3.098 local terms energy: -664.646130 where: bonds (distance) C4'-P energy: -131.995 bonds (distance) P-C4' energy: -120.002 flat angles C4'-P-C4' energy: -150.269 flat angles P-C4'-P energy: -98.700 tors. eta vs tors. theta energy: -163.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1889.617388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1889.617388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1889.617388 (E_RNA) where: Base-Base interactions energy: -1283.595 where: short stacking energy: -577.141 Base-Backbone interact. energy: 0.604 local terms energy: -606.626013 where: bonds (distance) C4'-P energy: -118.952 bonds (distance) P-C4' energy: -135.014 flat angles C4'-P-C4' energy: -126.845 flat angles P-C4'-P energy: -70.775 tors. eta vs tors. theta energy: -155.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1806.393453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.393453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.393453 (E_RNA) where: Base-Base interactions energy: -1195.185 where: short stacking energy: -560.477 Base-Backbone interact. energy: 0.790 local terms energy: -611.998006 where: bonds (distance) C4'-P energy: -118.062 bonds (distance) P-C4' energy: -116.351 flat angles C4'-P-C4' energy: -143.974 flat angles P-C4'-P energy: -88.563 tors. eta vs tors. theta energy: -145.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1593.124127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.124127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.124127 (E_RNA) where: Base-Base interactions energy: -1054.262 where: short stacking energy: -457.346 Base-Backbone interact. energy: 0.096 local terms energy: -538.957694 where: bonds (distance) C4'-P energy: -121.421 bonds (distance) P-C4' energy: -121.364 flat angles C4'-P-C4' energy: -118.179 flat angles P-C4'-P energy: -74.835 tors. eta vs tors. theta energy: -103.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1330.300376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.300376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.300376 (E_RNA) where: Base-Base interactions energy: -791.548 where: short stacking energy: -392.254 Base-Backbone interact. energy: -1.675 local terms energy: -537.077884 where: bonds (distance) C4'-P energy: -123.216 bonds (distance) P-C4' energy: -128.840 flat angles C4'-P-C4' energy: -116.204 flat angles P-C4'-P energy: -86.853 tors. eta vs tors. theta energy: -81.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1031.132240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.132240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.132240 (E_RNA) where: Base-Base interactions energy: -568.568 where: short stacking energy: -301.557 Base-Backbone interact. energy: -0.917 local terms energy: -461.647416 where: bonds (distance) C4'-P energy: -116.417 bonds (distance) P-C4' energy: -121.419 flat angles C4'-P-C4' energy: -110.753 flat angles P-C4'-P energy: -69.985 tors. eta vs tors. theta energy: -43.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -723.365175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.365175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.365175 (E_RNA) where: Base-Base interactions energy: -324.818 where: short stacking energy: -206.444 Base-Backbone interact. energy: -3.862 local terms energy: -394.684814 where: bonds (distance) C4'-P energy: -109.957 bonds (distance) P-C4' energy: -126.383 flat angles C4'-P-C4' energy: -86.353 flat angles P-C4'-P energy: -75.845 tors. eta vs tors. theta energy: 3.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2327.874226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2327.874226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2327.874226 (E_RNA) where: Base-Base interactions energy: -1596.390 where: short stacking energy: -717.742 Base-Backbone interact. energy: -2.330 local terms energy: -729.154684 where: bonds (distance) C4'-P energy: -137.233 bonds (distance) P-C4' energy: -144.385 flat angles C4'-P-C4' energy: -164.764 flat angles P-C4'-P energy: -82.760 tors. eta vs tors. theta energy: -200.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2301.225270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.225270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.225270 (E_RNA) where: Base-Base interactions energy: -1541.748 where: short stacking energy: -715.789 Base-Backbone interact. energy: 0.450 local terms energy: -759.927760 where: bonds (distance) C4'-P energy: -160.401 bonds (distance) P-C4' energy: -127.306 flat angles C4'-P-C4' energy: -159.798 flat angles P-C4'-P energy: -102.298 tors. eta vs tors. theta energy: -210.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2188.450276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2188.450276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2188.450276 (E_RNA) where: Base-Base interactions energy: -1489.551 where: short stacking energy: -665.266 Base-Backbone interact. energy: 6.414 local terms energy: -705.313327 where: bonds (distance) C4'-P energy: -142.953 bonds (distance) P-C4' energy: -135.603 flat angles C4'-P-C4' energy: -160.650 flat angles P-C4'-P energy: -90.389 tors. eta vs tors. theta energy: -175.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1957.635807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1957.635807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.635807 (E_RNA) where: Base-Base interactions energy: -1262.654 where: short stacking energy: -605.863 Base-Backbone interact. energy: -1.553 local terms energy: -693.428478 where: bonds (distance) C4'-P energy: -127.002 bonds (distance) P-C4' energy: -146.275 flat angles C4'-P-C4' energy: -150.314 flat angles P-C4'-P energy: -93.874 tors. eta vs tors. theta energy: -175.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1884.472615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1884.472615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1884.472615 (E_RNA) where: Base-Base interactions energy: -1264.470 where: short stacking energy: -553.077 Base-Backbone interact. energy: 1.999 local terms energy: -622.001295 where: bonds (distance) C4'-P energy: -131.323 bonds (distance) P-C4' energy: -131.968 flat angles C4'-P-C4' energy: -141.634 flat angles P-C4'-P energy: -88.772 tors. eta vs tors. theta energy: -128.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1793.573950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1793.573950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1793.573950 (E_RNA) where: Base-Base interactions energy: -1163.579 where: short stacking energy: -534.680 Base-Backbone interact. energy: -0.727 local terms energy: -629.267502 where: bonds (distance) C4'-P energy: -122.582 bonds (distance) P-C4' energy: -132.230 flat angles C4'-P-C4' energy: -143.628 flat angles P-C4'-P energy: -104.136 tors. eta vs tors. theta energy: -126.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1566.297742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.297742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.297742 (E_RNA) where: Base-Base interactions energy: -1024.345 where: short stacking energy: -447.248 Base-Backbone interact. energy: -1.258 local terms energy: -540.694898 where: bonds (distance) C4'-P energy: -124.154 bonds (distance) P-C4' energy: -126.914 flat angles C4'-P-C4' energy: -131.963 flat angles P-C4'-P energy: -82.040 tors. eta vs tors. theta energy: -75.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1285.299813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.299813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.299813 (E_RNA) where: Base-Base interactions energy: -792.137 where: short stacking energy: -404.896 Base-Backbone interact. energy: 3.003 local terms energy: -496.166028 where: bonds (distance) C4'-P energy: -121.640 bonds (distance) P-C4' energy: -117.007 flat angles C4'-P-C4' energy: -123.378 flat angles P-C4'-P energy: -64.308 tors. eta vs tors. theta energy: -69.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1002.759013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.759013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.759013 (E_RNA) where: Base-Base interactions energy: -558.559 where: short stacking energy: -279.978 Base-Backbone interact. energy: -1.976 local terms energy: -442.223526 where: bonds (distance) C4'-P energy: -100.655 bonds (distance) P-C4' energy: -133.698 flat angles C4'-P-C4' energy: -117.492 flat angles P-C4'-P energy: -68.584 tors. eta vs tors. theta energy: -21.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -700.861111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.861111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.861111 (E_RNA) where: Base-Base interactions energy: -309.556 where: short stacking energy: -195.845 Base-Backbone interact. energy: 0.148 local terms energy: -391.453238 where: bonds (distance) C4'-P energy: -107.666 bonds (distance) P-C4' energy: -120.032 flat angles C4'-P-C4' energy: -104.056 flat angles P-C4'-P energy: -70.667 tors. eta vs tors. theta energy: 10.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -2322.708695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2322.708695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2322.708695 (E_RNA) where: Base-Base interactions energy: -1568.456 where: short stacking energy: -694.498 Base-Backbone interact. energy: -2.621 local terms energy: -751.631734 where: bonds (distance) C4'-P energy: -135.968 bonds (distance) P-C4' energy: -140.725 flat angles C4'-P-C4' energy: -164.516 flat angles P-C4'-P energy: -108.062 tors. eta vs tors. theta energy: -202.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2260.965097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.965097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.965097 (E_RNA) where: Base-Base interactions energy: -1502.820 where: short stacking energy: -699.435 Base-Backbone interact. energy: -0.872 local terms energy: -757.273588 where: bonds (distance) C4'-P energy: -140.865 bonds (distance) P-C4' energy: -150.394 flat angles C4'-P-C4' energy: -152.089 flat angles P-C4'-P energy: -100.363 tors. eta vs tors. theta energy: -213.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2161.370259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2161.370259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2161.370259 (E_RNA) where: Base-Base interactions energy: -1476.884 where: short stacking energy: -672.789 Base-Backbone interact. energy: 5.246 local terms energy: -689.731999 where: bonds (distance) C4'-P energy: -134.433 bonds (distance) P-C4' energy: -145.654 flat angles C4'-P-C4' energy: -131.693 flat angles P-C4'-P energy: -93.598 tors. eta vs tors. theta energy: -184.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1978.106123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1978.106123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1978.106123 (E_RNA) where: Base-Base interactions energy: -1272.095 where: short stacking energy: -604.257 Base-Backbone interact. energy: -4.424 local terms energy: -701.586566 where: bonds (distance) C4'-P energy: -130.761 bonds (distance) P-C4' energy: -148.100 flat angles C4'-P-C4' energy: -159.688 flat angles P-C4'-P energy: -92.628 tors. eta vs tors. theta energy: -170.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1864.231354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1864.231354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1864.231354 (E_RNA) where: Base-Base interactions energy: -1249.507 where: short stacking energy: -559.688 Base-Backbone interact. energy: 3.707 local terms energy: -618.431555 where: bonds (distance) C4'-P energy: -135.549 bonds (distance) P-C4' energy: -130.657 flat angles C4'-P-C4' energy: -132.777 flat angles P-C4'-P energy: -73.457 tors. eta vs tors. theta energy: -145.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1779.061510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1779.061510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1779.061510 (E_RNA) where: Base-Base interactions energy: -1145.436 where: short stacking energy: -525.695 Base-Backbone interact. energy: -1.876 local terms energy: -631.749324 where: bonds (distance) C4'-P energy: -129.753 bonds (distance) P-C4' energy: -146.851 flat angles C4'-P-C4' energy: -136.908 flat angles P-C4'-P energy: -84.785 tors. eta vs tors. theta energy: -133.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1541.487498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.487498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.487498 (E_RNA) where: Base-Base interactions energy: -1000.497 where: short stacking energy: -452.147 Base-Backbone interact. energy: -0.479 local terms energy: -540.512140 where: bonds (distance) C4'-P energy: -133.609 bonds (distance) P-C4' energy: -142.145 flat angles C4'-P-C4' energy: -112.364 flat angles P-C4'-P energy: -68.591 tors. eta vs tors. theta energy: -83.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1319.104577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.104577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.104577 (E_RNA) where: Base-Base interactions energy: -806.689 where: short stacking energy: -356.063 Base-Backbone interact. energy: 6.348 local terms energy: -519.205540 where: bonds (distance) C4'-P energy: -121.115 bonds (distance) P-C4' energy: -145.347 flat angles C4'-P-C4' energy: -114.312 flat angles P-C4'-P energy: -76.686 tors. eta vs tors. theta energy: -61.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.442 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1072.368613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.368613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.368613 (E_RNA) where: Base-Base interactions energy: -629.684 where: short stacking energy: -311.953 Base-Backbone interact. energy: -1.165 local terms energy: -441.519555 where: bonds (distance) C4'-P energy: -92.755 bonds (distance) P-C4' energy: -140.736 flat angles C4'-P-C4' energy: -108.786 flat angles P-C4'-P energy: -54.908 tors. eta vs tors. theta energy: -44.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -630.336339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.336339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.336339 (E_RNA) where: Base-Base interactions energy: -276.223 where: short stacking energy: -175.183 Base-Backbone interact. energy: 1.561 local terms energy: -355.674503 where: bonds (distance) C4'-P energy: -103.870 bonds (distance) P-C4' energy: -118.812 flat angles C4'-P-C4' energy: -95.763 flat angles P-C4'-P energy: -65.028 tors. eta vs tors. theta energy: 27.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -2344.942721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2344.942721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2344.942721 (E_RNA) where: Base-Base interactions energy: -1576.293 where: short stacking energy: -707.766 Base-Backbone interact. energy: -0.521 local terms energy: -768.129245 where: bonds (distance) C4'-P energy: -142.909 bonds (distance) P-C4' energy: -137.503 flat angles C4'-P-C4' energy: -184.009 flat angles P-C4'-P energy: -107.006 tors. eta vs tors. theta energy: -196.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2265.180175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2265.180175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2265.180175 (E_RNA) where: Base-Base interactions energy: -1509.548 where: short stacking energy: -719.305 Base-Backbone interact. energy: -1.991 local terms energy: -753.641355 where: bonds (distance) C4'-P energy: -132.022 bonds (distance) P-C4' energy: -127.862 flat angles C4'-P-C4' energy: -171.755 flat angles P-C4'-P energy: -107.679 tors. eta vs tors. theta energy: -214.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2199.978441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.978441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2199.978441 (E_RNA) where: Base-Base interactions energy: -1493.566 where: short stacking energy: -669.530 Base-Backbone interact. energy: -0.760 local terms energy: -705.651592 where: bonds (distance) C4'-P energy: -127.755 bonds (distance) P-C4' energy: -140.443 flat angles C4'-P-C4' energy: -160.552 flat angles P-C4'-P energy: -100.907 tors. eta vs tors. theta energy: -175.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1970.042127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.042127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1970.042127 (E_RNA) where: Base-Base interactions energy: -1256.931 where: short stacking energy: -614.067 Base-Backbone interact. energy: -3.736 local terms energy: -709.374784 where: bonds (distance) C4'-P energy: -147.598 bonds (distance) P-C4' energy: -133.568 flat angles C4'-P-C4' energy: -160.610 flat angles P-C4'-P energy: -97.350 tors. eta vs tors. theta energy: -170.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1870.854866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1870.854866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1870.854866 (E_RNA) where: Base-Base interactions energy: -1252.324 where: short stacking energy: -529.859 Base-Backbone interact. energy: 6.391 local terms energy: -624.921329 where: bonds (distance) C4'-P energy: -125.592 bonds (distance) P-C4' energy: -141.963 flat angles C4'-P-C4' energy: -138.101 flat angles P-C4'-P energy: -88.306 tors. eta vs tors. theta energy: -130.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1782.179089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1782.179089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.179089 (E_RNA) where: Base-Base interactions energy: -1152.240 where: short stacking energy: -543.253 Base-Backbone interact. energy: -1.212 local terms energy: -628.727477 where: bonds (distance) C4'-P energy: -140.429 bonds (distance) P-C4' energy: -153.248 flat angles C4'-P-C4' energy: -134.598 flat angles P-C4'-P energy: -75.020 tors. eta vs tors. theta energy: -125.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1549.909477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.909477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.909477 (E_RNA) where: Base-Base interactions energy: -1006.094 where: short stacking energy: -485.286 Base-Backbone interact. energy: 2.928 local terms energy: -546.743341 where: bonds (distance) C4'-P energy: -101.448 bonds (distance) P-C4' energy: -133.133 flat angles C4'-P-C4' energy: -139.649 flat angles P-C4'-P energy: -68.164 tors. eta vs tors. theta energy: -104.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1338.238814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.238814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.238814 (E_RNA) where: Base-Base interactions energy: -809.849 where: short stacking energy: -370.032 Base-Backbone interact. energy: -1.626 local terms energy: -526.763817 where: bonds (distance) C4'-P energy: -140.876 bonds (distance) P-C4' energy: -121.932 flat angles C4'-P-C4' energy: -120.743 flat angles P-C4'-P energy: -67.348 tors. eta vs tors. theta energy: -75.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1000.041020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.041020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.041020 (E_RNA) where: Base-Base interactions energy: -560.782 where: short stacking energy: -303.946 Base-Backbone interact. energy: 2.657 local terms energy: -441.915626 where: bonds (distance) C4'-P energy: -125.834 bonds (distance) P-C4' energy: -112.072 flat angles C4'-P-C4' energy: -117.218 flat angles P-C4'-P energy: -70.908 tors. eta vs tors. theta energy: -15.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -713.714025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.714025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.714025 (E_RNA) where: Base-Base interactions energy: -287.827 where: short stacking energy: -198.586 Base-Backbone interact. energy: 5.679 local terms energy: -431.565666 where: bonds (distance) C4'-P energy: -111.003 bonds (distance) P-C4' energy: -139.479 flat angles C4'-P-C4' energy: -123.622 flat angles P-C4'-P energy: -62.672 tors. eta vs tors. theta energy: 5.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -2357.942074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2357.942074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2357.942074 (E_RNA) where: Base-Base interactions energy: -1598.471 where: short stacking energy: -712.430 Base-Backbone interact. energy: -1.171 local terms energy: -758.300980 where: bonds (distance) C4'-P energy: -151.377 bonds (distance) P-C4' energy: -141.739 flat angles C4'-P-C4' energy: -160.692 flat angles P-C4'-P energy: -106.201 tors. eta vs tors. theta energy: -198.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2278.822485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2278.822485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2278.822485 (E_RNA) where: Base-Base interactions energy: -1521.940 where: short stacking energy: -718.585 Base-Backbone interact. energy: -2.771 local terms energy: -754.112058 where: bonds (distance) C4'-P energy: -134.042 bonds (distance) P-C4' energy: -141.632 flat angles C4'-P-C4' energy: -165.122 flat angles P-C4'-P energy: -111.517 tors. eta vs tors. theta energy: -201.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2180.737982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2180.737982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2180.737982 (E_RNA) where: Base-Base interactions energy: -1481.040 where: short stacking energy: -682.712 Base-Backbone interact. energy: 7.297 local terms energy: -706.995410 where: bonds (distance) C4'-P energy: -131.410 bonds (distance) P-C4' energy: -142.087 flat angles C4'-P-C4' energy: -163.386 flat angles P-C4'-P energy: -96.275 tors. eta vs tors. theta energy: -173.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1950.854449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1950.854449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1950.854449 (E_RNA) where: Base-Base interactions energy: -1268.500 where: short stacking energy: -588.489 Base-Backbone interact. energy: -3.536 local terms energy: -678.818138 where: bonds (distance) C4'-P energy: -135.056 bonds (distance) P-C4' energy: -133.327 flat angles C4'-P-C4' energy: -143.223 flat angles P-C4'-P energy: -102.140 tors. eta vs tors. theta energy: -165.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1915.174026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.174026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.174026 (E_RNA) where: Base-Base interactions energy: -1264.028 where: short stacking energy: -571.617 Base-Backbone interact. energy: -2.435 local terms energy: -648.710128 where: bonds (distance) C4'-P energy: -137.180 bonds (distance) P-C4' energy: -142.839 flat angles C4'-P-C4' energy: -142.637 flat angles P-C4'-P energy: -84.213 tors. eta vs tors. theta energy: -141.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1810.110358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1810.110358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1810.110358 (E_RNA) where: Base-Base interactions energy: -1174.768 where: short stacking energy: -561.641 Base-Backbone interact. energy: -3.320 local terms energy: -632.022195 where: bonds (distance) C4'-P energy: -121.676 bonds (distance) P-C4' energy: -131.948 flat angles C4'-P-C4' energy: -147.499 flat angles P-C4'-P energy: -83.020 tors. eta vs tors. theta energy: -147.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1528.688275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.688275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.688275 (E_RNA) where: Base-Base interactions energy: -986.165 where: short stacking energy: -420.516 Base-Backbone interact. energy: 5.956 local terms energy: -548.478670 where: bonds (distance) C4'-P energy: -133.960 bonds (distance) P-C4' energy: -135.132 flat angles C4'-P-C4' energy: -126.131 flat angles P-C4'-P energy: -80.712 tors. eta vs tors. theta energy: -72.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1306.759309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.759309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.759309 (E_RNA) where: Base-Base interactions energy: -843.304 where: short stacking energy: -398.488 Base-Backbone interact. energy: 7.953 local terms energy: -471.408653 where: bonds (distance) C4'-P energy: -112.301 bonds (distance) P-C4' energy: -110.857 flat angles C4'-P-C4' energy: -112.749 flat angles P-C4'-P energy: -65.720 tors. eta vs tors. theta energy: -69.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -999.256730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.256730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.256730 (E_RNA) where: Base-Base interactions energy: -562.253 where: short stacking energy: -297.729 Base-Backbone interact. energy: -3.328 local terms energy: -433.675065 where: bonds (distance) C4'-P energy: -122.812 bonds (distance) P-C4' energy: -125.595 flat angles C4'-P-C4' energy: -104.240 flat angles P-C4'-P energy: -61.890 tors. eta vs tors. theta energy: -19.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -702.263238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.263238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.263238 (E_RNA) where: Base-Base interactions energy: -317.518 where: short stacking energy: -183.426 Base-Backbone interact. energy: -1.602 local terms energy: -383.143824 where: bonds (distance) C4'-P energy: -112.618 bonds (distance) P-C4' energy: -126.806 flat angles C4'-P-C4' energy: -96.467 flat angles P-C4'-P energy: -64.683 tors. eta vs tors. theta energy: 17.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -2355.476117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.476117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.476117 (E_RNA) where: Base-Base interactions energy: -1603.294 where: short stacking energy: -716.350 Base-Backbone interact. energy: -0.646 local terms energy: -751.537079 where: bonds (distance) C4'-P energy: -139.636 bonds (distance) P-C4' energy: -145.535 flat angles C4'-P-C4' energy: -162.567 flat angles P-C4'-P energy: -112.977 tors. eta vs tors. theta energy: -190.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2259.754289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2259.754289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.754289 (E_RNA) where: Base-Base interactions energy: -1518.234 where: short stacking energy: -682.811 Base-Backbone interact. energy: -2.933 local terms energy: -738.587872 where: bonds (distance) C4'-P energy: -137.927 bonds (distance) P-C4' energy: -144.586 flat angles C4'-P-C4' energy: -165.578 flat angles P-C4'-P energy: -101.074 tors. eta vs tors. theta energy: -189.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2126.461566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2126.461566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2126.461566 (E_RNA) where: Base-Base interactions energy: -1436.395 where: short stacking energy: -644.835 Base-Backbone interact. energy: 0.402 local terms energy: -690.468294 where: bonds (distance) C4'-P energy: -144.199 bonds (distance) P-C4' energy: -135.829 flat angles C4'-P-C4' energy: -147.236 flat angles P-C4'-P energy: -101.620 tors. eta vs tors. theta energy: -161.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1955.087172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1955.087172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1955.087172 (E_RNA) where: Base-Base interactions energy: -1272.641 where: short stacking energy: -602.441 Base-Backbone interact. energy: -1.660 local terms energy: -680.786180 where: bonds (distance) C4'-P energy: -123.764 bonds (distance) P-C4' energy: -142.635 flat angles C4'-P-C4' energy: -149.709 flat angles P-C4'-P energy: -91.189 tors. eta vs tors. theta energy: -173.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1918.039125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.039125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.039125 (E_RNA) where: Base-Base interactions energy: -1310.263 where: short stacking energy: -576.677 Base-Backbone interact. energy: -2.131 local terms energy: -605.645481 where: bonds (distance) C4'-P energy: -115.690 bonds (distance) P-C4' energy: -134.656 flat angles C4'-P-C4' energy: -140.909 flat angles P-C4'-P energy: -79.063 tors. eta vs tors. theta energy: -135.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1829.704978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1829.704978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1829.704978 (E_RNA) where: Base-Base interactions energy: -1208.469 where: short stacking energy: -528.810 Base-Backbone interact. energy: -0.984 local terms energy: -620.252469 where: bonds (distance) C4'-P energy: -111.410 bonds (distance) P-C4' energy: -134.373 flat angles C4'-P-C4' energy: -136.875 flat angles P-C4'-P energy: -87.062 tors. eta vs tors. theta energy: -150.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1500.893825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.893825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.893825 (E_RNA) where: Base-Base interactions energy: -953.493 where: short stacking energy: -423.579 Base-Backbone interact. energy: 1.139 local terms energy: -548.539720 where: bonds (distance) C4'-P energy: -104.832 bonds (distance) P-C4' energy: -137.555 flat angles C4'-P-C4' energy: -127.565 flat angles P-C4'-P energy: -92.158 tors. eta vs tors. theta energy: -86.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1285.105404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.105404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.105404 (E_RNA) where: Base-Base interactions energy: -782.484 where: short stacking energy: -375.738 Base-Backbone interact. energy: 2.208 local terms energy: -506.531846 where: bonds (distance) C4'-P energy: -122.343 bonds (distance) P-C4' energy: -138.670 flat angles C4'-P-C4' energy: -111.559 flat angles P-C4'-P energy: -75.319 tors. eta vs tors. theta energy: -58.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.702 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1061.969052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.969052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.969052 (E_RNA) where: Base-Base interactions energy: -623.882 where: short stacking energy: -326.881 Base-Backbone interact. energy: 0.647 local terms energy: -438.733582 where: bonds (distance) C4'-P energy: -128.337 bonds (distance) P-C4' energy: -121.000 flat angles C4'-P-C4' energy: -108.015 flat angles P-C4'-P energy: -64.196 tors. eta vs tors. theta energy: -17.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -755.859080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.859080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.859080 (E_RNA) where: Base-Base interactions energy: -351.825 where: short stacking energy: -210.433 Base-Backbone interact. energy: -0.544 local terms energy: -403.489845 where: bonds (distance) C4'-P energy: -107.593 bonds (distance) P-C4' energy: -130.978 flat angles C4'-P-C4' energy: -117.558 flat angles P-C4'-P energy: -60.321 tors. eta vs tors. theta energy: 12.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -2337.099370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2337.099370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.099370 (E_RNA) where: Base-Base interactions energy: -1588.780 where: short stacking energy: -699.795 Base-Backbone interact. energy: -2.760 local terms energy: -745.559169 where: bonds (distance) C4'-P energy: -134.730 bonds (distance) P-C4' energy: -153.342 flat angles C4'-P-C4' energy: -156.533 flat angles P-C4'-P energy: -110.834 tors. eta vs tors. theta energy: -190.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2301.558032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.558032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.558032 (E_RNA) where: Base-Base interactions energy: -1543.184 where: short stacking energy: -711.969 Base-Backbone interact. energy: -1.053 local terms energy: -757.321846 where: bonds (distance) C4'-P energy: -126.769 bonds (distance) P-C4' energy: -164.621 flat angles C4'-P-C4' energy: -155.809 flat angles P-C4'-P energy: -104.414 tors. eta vs tors. theta energy: -205.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2114.408384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2114.408384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2114.408384 (E_RNA) where: Base-Base interactions energy: -1427.039 where: short stacking energy: -635.496 Base-Backbone interact. energy: -1.109 local terms energy: -686.260445 where: bonds (distance) C4'-P energy: -144.692 bonds (distance) P-C4' energy: -134.455 flat angles C4'-P-C4' energy: -142.732 flat angles P-C4'-P energy: -92.527 tors. eta vs tors. theta energy: -171.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1957.795555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1957.795555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1957.795555 (E_RNA) where: Base-Base interactions energy: -1291.426 where: short stacking energy: -609.059 Base-Backbone interact. energy: -3.705 local terms energy: -662.664165 where: bonds (distance) C4'-P energy: -130.778 bonds (distance) P-C4' energy: -120.550 flat angles C4'-P-C4' energy: -155.379 flat angles P-C4'-P energy: -94.686 tors. eta vs tors. theta energy: -161.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1881.324947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1881.324947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1881.324947 (E_RNA) where: Base-Base interactions energy: -1267.825 where: short stacking energy: -565.026 Base-Backbone interact. energy: -2.623 local terms energy: -610.978002 where: bonds (distance) C4'-P energy: -123.375 bonds (distance) P-C4' energy: -135.817 flat angles C4'-P-C4' energy: -141.434 flat angles P-C4'-P energy: -77.273 tors. eta vs tors. theta energy: -133.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.101 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1826.521694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1826.521694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1826.521694 (E_RNA) where: Base-Base interactions energy: -1210.350 where: short stacking energy: -530.522 Base-Backbone interact. energy: -2.776 local terms energy: -613.395871 where: bonds (distance) C4'-P energy: -120.297 bonds (distance) P-C4' energy: -123.390 flat angles C4'-P-C4' energy: -153.891 flat angles P-C4'-P energy: -76.660 tors. eta vs tors. theta energy: -139.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1561.605456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.605456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.605456 (E_RNA) where: Base-Base interactions energy: -990.578 where: short stacking energy: -456.655 Base-Backbone interact. energy: -0.215 local terms energy: -570.812750 where: bonds (distance) C4'-P energy: -133.135 bonds (distance) P-C4' energy: -124.968 flat angles C4'-P-C4' energy: -132.277 flat angles P-C4'-P energy: -83.684 tors. eta vs tors. theta energy: -96.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1274.912646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.912646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.912646 (E_RNA) where: Base-Base interactions energy: -776.959 where: short stacking energy: -377.051 Base-Backbone interact. energy: -2.056 local terms energy: -495.897290 where: bonds (distance) C4'-P energy: -116.368 bonds (distance) P-C4' energy: -115.583 flat angles C4'-P-C4' energy: -128.102 flat angles P-C4'-P energy: -78.856 tors. eta vs tors. theta energy: -56.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1073.099050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.099050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.099050 (E_RNA) where: Base-Base interactions energy: -595.080 where: short stacking energy: -301.066 Base-Backbone interact. energy: -2.414 local terms energy: -475.605570 where: bonds (distance) C4'-P energy: -134.623 bonds (distance) P-C4' energy: -129.323 flat angles C4'-P-C4' energy: -109.125 flat angles P-C4'-P energy: -69.565 tors. eta vs tors. theta energy: -32.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -800.830942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.830942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.830942 (E_RNA) where: Base-Base interactions energy: -385.948 where: short stacking energy: -208.096 Base-Backbone interact. energy: 1.673 local terms energy: -416.555347 where: bonds (distance) C4'-P energy: -114.749 bonds (distance) P-C4' energy: -137.717 flat angles C4'-P-C4' energy: -89.634 flat angles P-C4'-P energy: -79.948 tors. eta vs tors. theta energy: 5.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -2332.905104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2332.905104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2332.905104 (E_RNA) where: Base-Base interactions energy: -1564.995 where: short stacking energy: -715.872 Base-Backbone interact. energy: -3.061 local terms energy: -764.848794 where: bonds (distance) C4'-P energy: -145.342 bonds (distance) P-C4' energy: -152.632 flat angles C4'-P-C4' energy: -161.036 flat angles P-C4'-P energy: -102.251 tors. eta vs tors. theta energy: -203.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2295.821908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2295.821908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.821908 (E_RNA) where: Base-Base interactions energy: -1547.060 where: short stacking energy: -691.312 Base-Backbone interact. energy: -2.700 local terms energy: -746.062286 where: bonds (distance) C4'-P energy: -136.952 bonds (distance) P-C4' energy: -147.571 flat angles C4'-P-C4' energy: -157.811 flat angles P-C4'-P energy: -111.367 tors. eta vs tors. theta energy: -192.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2140.625022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2140.625022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2140.625022 (E_RNA) where: Base-Base interactions energy: -1401.874 where: short stacking energy: -636.585 Base-Backbone interact. energy: -1.182 local terms energy: -737.569503 where: bonds (distance) C4'-P energy: -144.443 bonds (distance) P-C4' energy: -145.620 flat angles C4'-P-C4' energy: -172.915 flat angles P-C4'-P energy: -96.580 tors. eta vs tors. theta energy: -178.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2037.242567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.242567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.242567 (E_RNA) where: Base-Base interactions energy: -1310.676 where: short stacking energy: -621.193 Base-Backbone interact. energy: -4.058 local terms energy: -722.508566 where: bonds (distance) C4'-P energy: -149.692 bonds (distance) P-C4' energy: -135.026 flat angles C4'-P-C4' energy: -166.990 flat angles P-C4'-P energy: -98.781 tors. eta vs tors. theta energy: -172.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1935.773808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.773808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.773808 (E_RNA) where: Base-Base interactions energy: -1288.007 where: short stacking energy: -583.324 Base-Backbone interact. energy: -3.280 local terms energy: -645.410953 where: bonds (distance) C4'-P energy: -124.844 bonds (distance) P-C4' energy: -136.952 flat angles C4'-P-C4' energy: -146.911 flat angles P-C4'-P energy: -87.699 tors. eta vs tors. theta energy: -149.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.924 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1818.126186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.126186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.126186 (E_RNA) where: Base-Base interactions energy: -1241.431 where: short stacking energy: -550.039 Base-Backbone interact. energy: 7.231 local terms energy: -583.927032 where: bonds (distance) C4'-P energy: -122.720 bonds (distance) P-C4' energy: -124.224 flat angles C4'-P-C4' energy: -127.892 flat angles P-C4'-P energy: -93.654 tors. eta vs tors. theta energy: -115.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1500.361648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.361648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.361648 (E_RNA) where: Base-Base interactions energy: -953.966 where: short stacking energy: -421.668 Base-Backbone interact. energy: 6.176 local terms energy: -552.571383 where: bonds (distance) C4'-P energy: -122.746 bonds (distance) P-C4' energy: -136.516 flat angles C4'-P-C4' energy: -120.856 flat angles P-C4'-P energy: -82.627 tors. eta vs tors. theta energy: -89.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1266.540600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.540600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.540600 (E_RNA) where: Base-Base interactions energy: -756.551 where: short stacking energy: -343.045 Base-Backbone interact. energy: 0.633 local terms energy: -510.623050 where: bonds (distance) C4'-P energy: -128.726 bonds (distance) P-C4' energy: -140.960 flat angles C4'-P-C4' energy: -106.917 flat angles P-C4'-P energy: -66.996 tors. eta vs tors. theta energy: -67.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1083.135794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.135794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.135794 (E_RNA) where: Base-Base interactions energy: -618.264 where: short stacking energy: -293.236 Base-Backbone interact. energy: -2.683 local terms energy: -462.188558 where: bonds (distance) C4'-P energy: -112.798 bonds (distance) P-C4' energy: -127.577 flat angles C4'-P-C4' energy: -110.887 flat angles P-C4'-P energy: -85.722 tors. eta vs tors. theta energy: -25.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -798.338702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.338702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.338702 (E_RNA) where: Base-Base interactions energy: -389.357 where: short stacking energy: -243.557 Base-Backbone interact. energy: -1.886 local terms energy: -407.095263 where: bonds (distance) C4'-P energy: -128.955 bonds (distance) P-C4' energy: -112.551 flat angles C4'-P-C4' energy: -91.191 flat angles P-C4'-P energy: -63.763 tors. eta vs tors. theta energy: -10.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)