SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 8 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.964 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.029 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.093 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.157 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.221 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt EntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.286 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1FQZ_HCV-941cb399/inputs/seq.fa: 1 curr_seq: _GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GUUUAAACCCGCUGAUCAGCCUCGACUGUGCCUUCUAGUUGCCAGCCAUCUGUUGUUUGCCCCUCCCCCGUGCCUUCCUUGACCCUGGAAGGUGCCACUCCCACUGUCCUUUCCUAAUAAAAUGAGGAAAUUGCAUCGCAUUGUCUGAGUAGGUGUCAUUCUAUUCUGGGGGGUGGGGUGGGGCAGGACAGCAAGGGGGAGGAUUGGGAAGACAAUAGCAGGCAUGCUGGGGAUGCGGUGGGCUCAUGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 249 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1250 n_atoms_counter: 1250 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 26 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 25 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2 : 24 , with interaction type: CG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2 : 19 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2 : 18 , with interaction type: UG_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2 : 17 , with interaction type: GC_WWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 23 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 22 , with interaction type: AA_HHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GU_SHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 21 , with interaction type: UA_WHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 20 , with interaction type: AG_HSt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2 : 15 , with interaction type: UG_WWt out arg RESULTS//1/1FQZ_HCV-941cb399_01 nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set Stiffness is set nucl1: 0, chain1: A, <---> nucl2: 26, chain2: A type of interaction: GC_WWc nucl1: 1, chain1: A, <---> nucl2: 25, chain2: A type of interaction: CG_WWc nucl1: 2, chain1: A, <---> nucl2: 24, chain2: A type of interaction: CG_WWc nucl1: 8, chain1: A, <---> nucl2: 19, chain2: A type of interaction: GC_WWc nucl1: 9, chain1: A, <---> nucl2: 18, chain2: A type of interaction: UG_WWc nucl1: 10, chain1: A, <---> nucl2: 17, chain2: A type of interaction: GC_WWc nucl1: 3, chain1: A, <---> nucl2: 23, chain2: A type of interaction: GA_SHt nucl1: 4, chain1: A, <---> nucl2: 22, chain2: A type of interaction: AA_HHt nucl1: 5, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GU_SHc nucl1: 6, chain1: A, <---> nucl2: 21, chain2: A type of interaction: UA_WHt nucl1: 7, chain1: A, <---> nucl2: 20, chain2: A type of interaction: AG_HSt nucl1: 11, chain1: A, <---> nucl2: 15, chain2: A type of interaction: UG_WWt Stiffness is set Stiffness is set StifEntireStructure::rnaStruct limitingSphereRadius : 249.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 8 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.964286 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.028571 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.092857 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.157143 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.221429 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.285714 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 13752.090506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 13752.090506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.783657 (E_RNA) where: Base-Base interactions energy: -29.725 where: short stacking energy: -29.725 Base-Backbone interact. energy: -0.000 local terms energy: -969.058541 where: bonds (distance) C4'-P energy: -241.923 bonds (distance) P-C4' energy: -223.663 flat angles C4'-P-C4' energy: -182.822 flat angles P-C4'-P energy: -209.129 tors. eta vs tors. theta energy: -111.522 Dist. restrs. and SS energy: 14750.874 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -566.955699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.955699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.835754 (E_RNA) where: Base-Base interactions energy: -444.520 where: short stacking energy: -418.877 Base-Backbone interact. energy: 17.232 local terms energy: -259.548144 where: bonds (distance) C4'-P energy: 156.425 bonds (distance) P-C4' energy: -148.922 flat angles C4'-P-C4' energy: -112.434 flat angles P-C4'-P energy: -61.508 tors. eta vs tors. theta energy: -93.110 Dist. restrs. and SS energy: 119.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.964286 Total energy: -524.257373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.257373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.299164 (E_RNA) where: Base-Base interactions energy: -354.434 where: short stacking energy: -324.303 Base-Backbone interact. energy: 3.562 local terms energy: -277.427013 where: bonds (distance) C4'-P energy: 111.209 bonds (distance) P-C4' energy: -145.013 flat angles C4'-P-C4' energy: -106.129 flat angles P-C4'-P energy: -61.316 tors. eta vs tors. theta energy: -76.177 Dist. restrs. and SS energy: 104.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.028571 Total energy: -375.776279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.776279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.656367 (E_RNA) where: Base-Base interactions energy: -325.914 where: short stacking energy: -296.314 Base-Backbone interact. energy: 18.944 local terms energy: -164.686324 where: bonds (distance) C4'-P energy: 163.324 bonds (distance) P-C4' energy: -137.333 flat angles C4'-P-C4' energy: -97.735 flat angles P-C4'-P energy: -32.863 tors. eta vs tors. theta energy: -60.080 Dist. restrs. and SS energy: 95.880 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.092857 Total energy: -322.890773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.890773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.509457 (E_RNA) where: Base-Base interactions energy: -308.356 where: short stacking energy: -267.250 Base-Backbone interact. energy: 32.322 local terms energy: -156.475307 where: bonds (distance) C4'-P energy: 141.199 bonds (distance) P-C4' energy: -140.242 flat angles C4'-P-C4' energy: -80.791 flat angles P-C4'-P energy: -47.610 tors. eta vs tors. theta energy: -29.033 Dist. restrs. and SS energy: 109.619 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.157143 Total energy: -308.116988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.116988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.430633 (E_RNA) where: Base-Base interactions energy: -247.882 where: short stacking energy: -223.693 Base-Backbone interact. energy: -0.478 local terms energy: -167.071302 where: bonds (distance) C4'-P energy: 130.470 bonds (distance) P-C4' energy: -129.521 flat angles C4'-P-C4' energy: -94.459 flat angles P-C4'-P energy: -28.381 tors. eta vs tors. theta energy: -45.180 Dist. restrs. and SS energy: 107.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.221429 Total energy: -277.564764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.564764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.148058 (E_RNA) where: Base-Base interactions energy: -234.973 where: short stacking energy: -213.507 Base-Backbone interact. energy: 4.572 local terms energy: -144.747458 where: bonds (distance) C4'-P energy: 130.648 bonds (distance) P-C4' energy: -126.794 flat angles C4'-P-C4' energy: -84.093 flat angles P-C4'-P energy: -39.423 tors. eta vs tors. theta energy: -25.085 Dist. restrs. and SS energy: 97.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.285714 Total energy: -247.488759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.488759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.125509 (E_RNA) where: Base-Base interactions energy: -263.172 where: short stacking energy: -228.815 Base-Backbone interact. energy: 11.821 local terms energy: -117.774844 where: bonds (distance) C4'-P energy: 126.808 bonds (distance) P-C4' energy: -130.101 flat angles C4'-P-C4' energy: -58.945 flat angles P-C4'-P energy: -22.680 tors. eta vs tors. theta energy: -32.856 Dist. restrs. and SS energy: 121.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -189.227551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.227551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.409855 (E_RNA) where: Base-Base interactions energy: -221.943 where: short stacking energy: -209.093 Base-Backbone interact. energy: 2.278 local terms energy: -70.744699 where: bonds (distance) C4'-P energy: 138.804 bonds (distance) P-C4' energy: -92.048 flat angles C4'-P-C4' energy: -71.391 flat angles P-C4'-P energy: -5.103 tors. eta vs tors. theta energy: -41.007 Dist. restrs. and SS energy: 101.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -720.983792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.983792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.086598 (E_RNA) where: Base-Base interactions energy: -449.302 where: short stacking energy: -389.133 Base-Backbone interact. energy: 12.886 local terms energy: -375.671118 where: bonds (distance) C4'-P energy: 63.664 bonds (distance) P-C4' energy: -150.095 flat angles C4'-P-C4' energy: -123.551 flat angles P-C4'-P energy: -79.571 tors. eta vs tors. theta energy: -86.117 Dist. restrs. and SS energy: 91.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.964286 Total energy: -722.203085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.203085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.042227 (E_RNA) where: Base-Base interactions energy: -416.152 where: short stacking energy: -389.777 Base-Backbone interact. energy: -1.560 local terms energy: -382.329887 where: bonds (distance) C4'-P energy: -3.119 bonds (distance) P-C4' energy: -148.332 flat angles C4'-P-C4' energy: -109.709 flat angles P-C4'-P energy: -51.161 tors. eta vs tors. theta energy: -70.009 Dist. restrs. and SS energy: 77.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.028571 Total energy: -611.455579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.455579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.950757 (E_RNA) where: Base-Base interactions energy: -342.404 where: short stacking energy: -326.018 Base-Backbone interact. energy: 1.986 local terms energy: -339.533519 where: bonds (distance) C4'-P energy: 43.050 bonds (distance) P-C4' energy: -149.281 flat angles C4'-P-C4' energy: -111.847 flat angles P-C4'-P energy: -47.457 tors. eta vs tors. theta energy: -73.999 Dist. restrs. and SS energy: 68.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.092857 Total energy: -617.921595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.921595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.415633 (E_RNA) where: Base-Base interactions energy: -378.559 where: short stacking energy: -354.051 Base-Backbone interact. energy: 7.478 local terms energy: -325.334934 where: bonds (distance) C4'-P energy: 7.224 bonds (distance) P-C4' energy: -119.083 flat angles C4'-P-C4' energy: -116.883 flat angles P-C4'-P energy: -26.901 tors. eta vs tors. theta energy: -69.692 Dist. restrs. and SS energy: 78.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.157143 Total energy: -424.901931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.901931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.321417 (E_RNA) where: Base-Base interactions energy: -307.914 where: short stacking energy: -278.993 Base-Backbone interact. energy: 18.493 local terms energy: -226.900107 where: bonds (distance) C4'-P energy: 89.947 bonds (distance) P-C4' energy: -134.779 flat angles C4'-P-C4' energy: -78.102 flat angles P-C4'-P energy: -49.255 tors. eta vs tors. theta energy: -54.712 Dist. restrs. and SS energy: 91.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.221429 Total energy: -502.447499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.447499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.710350 (E_RNA) where: Base-Base interactions energy: -306.851 where: short stacking energy: -268.419 Base-Backbone interact. energy: 5.331 local terms energy: -294.190434 where: bonds (distance) C4'-P energy: -25.988 bonds (distance) P-C4' energy: -110.987 flat angles C4'-P-C4' energy: -84.624 flat angles P-C4'-P energy: -22.883 tors. eta vs tors. theta energy: -49.709 Dist. restrs. and SS energy: 93.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.285714 Total energy: -452.827918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.827918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.957372 (E_RNA) where: Base-Base interactions energy: -246.097 where: short stacking energy: -227.800 Base-Backbone interact. energy: 7.067 local terms energy: -289.927332 where: bonds (distance) C4'-P energy: -35.808 bonds (distance) P-C4' energy: -134.763 flat angles C4'-P-C4' energy: -66.549 flat angles P-C4'-P energy: -15.207 tors. eta vs tors. theta energy: -37.600 Dist. restrs. and SS energy: 76.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -315.117530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.117530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.441689 (E_RNA) where: Base-Base interactions energy: -200.392 where: short stacking energy: -175.961 Base-Backbone interact. energy: 3.235 local terms energy: -198.284909 where: bonds (distance) C4'-P energy: 29.174 bonds (distance) P-C4' energy: -102.519 flat angles C4'-P-C4' energy: -68.689 flat angles P-C4'-P energy: -30.802 tors. eta vs tors. theta energy: -25.449 Dist. restrs. and SS energy: 80.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -871.936731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.936731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.753521 (E_RNA) where: Base-Base interactions energy: -428.663 where: short stacking energy: -390.889 Base-Backbone interact. energy: -0.233 local terms energy: -515.857367 where: bonds (distance) C4'-P energy: -89.215 bonds (distance) P-C4' energy: -149.860 flat angles C4'-P-C4' energy: -121.412 flat angles P-C4'-P energy: -67.435 tors. eta vs tors. theta energy: -87.935 Dist. restrs. and SS energy: 72.817 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.964286 Total energy: -788.947002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.947002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.597594 (E_RNA) where: Base-Base interactions energy: -424.600 where: short stacking energy: -380.890 Base-Backbone interact. energy: 6.765 local terms energy: -444.762450 where: bonds (distance) C4'-P energy: -45.142 bonds (distance) P-C4' energy: -133.787 flat angles C4'-P-C4' energy: -120.481 flat angles P-C4'-P energy: -61.896 tors. eta vs tors. theta energy: -83.457 Dist. restrs. and SS energy: 73.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.028571 Total energy: -732.943380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.943380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.588216 (E_RNA) where: Base-Base interactions energy: -339.830 where: short stacking energy: -322.171 Base-Backbone interact. energy: 0.687 local terms energy: -464.445882 where: bonds (distance) C4'-P energy: -85.182 bonds (distance) P-C4' energy: -137.952 flat angles C4'-P-C4' energy: -106.258 flat angles P-C4'-P energy: -61.707 tors. eta vs tors. theta energy: -73.347 Dist. restrs. and SS energy: 70.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.092857 Total energy: -696.421423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.421423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.998533 (E_RNA) where: Base-Base interactions energy: -298.602 where: short stacking energy: -281.918 Base-Backbone interact. energy: 4.043 local terms energy: -471.440023 where: bonds (distance) C4'-P energy: -93.732 bonds (distance) P-C4' energy: -133.381 flat angles C4'-P-C4' energy: -113.013 flat angles P-C4'-P energy: -68.661 tors. eta vs tors. theta energy: -62.653 Dist. restrs. and SS energy: 69.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.157143 Total energy: -696.994129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.994129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.447171 (E_RNA) where: Base-Base interactions energy: -309.246 where: short stacking energy: -278.302 Base-Backbone interact. energy: 9.510 local terms energy: -478.710691 where: bonds (distance) C4'-P energy: -130.533 bonds (distance) P-C4' energy: -139.174 flat angles C4'-P-C4' energy: -116.548 flat angles P-C4'-P energy: -44.480 tors. eta vs tors. theta energy: -47.975 Dist. restrs. and SS energy: 81.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.221429 Total energy: -543.349179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.349179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.415759 (E_RNA) where: Base-Base interactions energy: -301.158 where: short stacking energy: -269.248 Base-Backbone interact. energy: 19.365 local terms energy: -353.623290 where: bonds (distance) C4'-P energy: -56.497 bonds (distance) P-C4' energy: -123.182 flat angles C4'-P-C4' energy: -83.578 flat angles P-C4'-P energy: -43.787 tors. eta vs tors. theta energy: -46.578 Dist. restrs. and SS energy: 92.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.285714 Total energy: -536.143029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.143029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.672860 (E_RNA) where: Base-Base interactions energy: -186.976 where: short stacking energy: -175.629 Base-Backbone interact. energy: 2.819 local terms energy: -439.515656 where: bonds (distance) C4'-P energy: -139.215 bonds (distance) P-C4' energy: -142.278 flat angles C4'-P-C4' energy: -82.110 flat angles P-C4'-P energy: -47.942 tors. eta vs tors. theta energy: -27.970 Dist. restrs. and SS energy: 87.530 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -397.402501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.402501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.133011 (E_RNA) where: Base-Base interactions energy: -219.831 where: short stacking energy: -200.695 Base-Backbone interact. energy: 1.911 local terms energy: -247.213131 where: bonds (distance) C4'-P energy: -58.843 bonds (distance) P-C4' energy: -69.751 flat angles C4'-P-C4' energy: -74.482 flat angles P-C4'-P energy: -23.936 tors. eta vs tors. theta energy: -20.202 Dist. restrs. and SS energy: 67.731 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -973.151421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.151421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.575889 (E_RNA) where: Base-Base interactions energy: -438.335 where: short stacking energy: -419.582 Base-Backbone interact. energy: 0.412 local terms energy: -607.652800 where: bonds (distance) C4'-P energy: -162.617 bonds (distance) P-C4' energy: -142.232 flat angles C4'-P-C4' energy: -132.279 flat angles P-C4'-P energy: -77.220 tors. eta vs tors. theta energy: -93.306 Dist. restrs. and SS energy: 72.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.964286 Total energy: -926.901901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.901901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.968935 (E_RNA) where: Base-Base interactions energy: -441.316 where: short stacking energy: -428.682 Base-Backbone interact. energy: -0.014 local terms energy: -560.639666 where: bonds (distance) C4'-P energy: -119.975 bonds (distance) P-C4' energy: -150.320 flat angles C4'-P-C4' energy: -132.607 flat angles P-C4'-P energy: -64.645 tors. eta vs tors. theta energy: -93.092 Dist. restrs. and SS energy: 75.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.028571 Total energy: -847.465939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.465939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.876435 (E_RNA) where: Base-Base interactions energy: -389.064 where: short stacking energy: -343.882 Base-Backbone interact. energy: 3.852 local terms energy: -539.663875 where: bonds (distance) C4'-P energy: -134.317 bonds (distance) P-C4' energy: -134.558 flat angles C4'-P-C4' energy: -145.276 flat angles P-C4'-P energy: -54.069 tors. eta vs tors. theta energy: -71.444 Dist. restrs. and SS energy: 77.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.092857 Total energy: -837.806823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.806823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.734414 (E_RNA) where: Base-Base interactions energy: -354.270 where: short stacking energy: -320.909 Base-Backbone interact. energy: -0.076 local terms energy: -559.389166 where: bonds (distance) C4'-P energy: -137.855 bonds (distance) P-C4' energy: -144.366 flat angles C4'-P-C4' energy: -125.814 flat angles P-C4'-P energy: -77.492 tors. eta vs tors. theta energy: -73.862 Dist. restrs. and SS energy: 75.928 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 5 Temperature: 1.157143 Total energy: -735.984415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.984415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.174341 (E_RNA) where: Base-Base interactions energy: -321.257 where: short stacking energy: -305.710 Base-Backbone interact. energy: 9.931 local terms energy: -509.847552 where: bonds (distance) C4'-P energy: -141.383 bonds (distance) P-C4' energy: -139.452 flat angles C4'-P-C4' energy: -122.388 flat angles P-C4'-P energy: -53.885 tors. eta vs tors. theta energy: -52.739 Dist. restrs. and SS energy: 85.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.221429 Total energy: -666.448720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.448720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.946862 (E_RNA) where: Base-Base interactions energy: -289.201 where: short stacking energy: -272.763 Base-Backbone interact. energy: 0.274 local terms energy: -449.020294 where: bonds (distance) C4'-P energy: -140.598 bonds (distance) P-C4' energy: -123.498 flat angles C4'-P-C4' energy: -113.082 flat angles P-C4'-P energy: -30.248 tors. eta vs tors. theta energy: -41.594 Dist. restrs. and SS energy: 71.498 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.285714 Total energy: -529.514231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.514231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.240457 (E_RNA) where: Base-Base interactions energy: -252.386 where: short stacking energy: -224.332 Base-Backbone interact. energy: 10.753 local terms energy: -373.607574 where: bonds (distance) C4'-P energy: -104.727 bonds (distance) P-C4' energy: -137.720 flat angles C4'-P-C4' energy: -77.511 flat angles P-C4'-P energy: -17.069 tors. eta vs tors. theta energy: -36.579 Dist. restrs. and SS energy: 85.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -521.870117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.870117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.483864 (E_RNA) where: Base-Base interactions energy: -192.060 where: short stacking energy: -179.553 Base-Backbone interact. energy: -0.910 local terms energy: -400.513871 where: bonds (distance) C4'-P energy: -125.937 bonds (distance) P-C4' energy: -130.287 flat angles C4'-P-C4' energy: -93.597 flat angles P-C4'-P energy: -38.598 tors. eta vs tors. theta energy: -12.095 Dist. restrs. and SS energy: 71.614 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1006.226344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.226344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.679621 (E_RNA) where: Base-Base interactions energy: -461.377 where: short stacking energy: -427.939 Base-Backbone interact. energy: -0.907 local terms energy: -621.395119 where: bonds (distance) C4'-P energy: -150.873 bonds (distance) P-C4' energy: -164.273 flat angles C4'-P-C4' energy: -143.199 flat angles P-C4'-P energy: -66.085 tors. eta vs tors. theta energy: -96.965 Dist. restrs. and SS energy: 77.453 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.964286 Total energy: -913.575300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.575300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.921126 (E_RNA) where: Base-Base interactions energy: -410.363 where: short stacking energy: -389.036 Base-Backbone interact. energy: 5.304 local terms energy: -576.861520 where: bonds (distance) C4'-P energy: -144.568 bonds (distance) P-C4' energy: -154.703 flat angles C4'-P-C4' energy: -123.447 flat angles P-C4'-P energy: -71.256 tors. eta vs tors. theta energy: -82.887 Dist. restrs. and SS energy: 68.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 6 Temperature: 1.028571 Total energy: -893.360675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.360675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.518126 (E_RNA) where: Base-Base interactions energy: -369.934 where: short stacking energy: -335.852 Base-Backbone interact. energy: -0.254 local terms energy: -588.329860 where: bonds (distance) C4'-P energy: -145.436 bonds (distance) P-C4' energy: -150.811 flat angles C4'-P-C4' energy: -144.514 flat angles P-C4'-P energy: -70.503 tors. eta vs tors. theta energy: -77.067 Dist. restrs. and SS energy: 65.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.092857 Total energy: -858.292655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.292655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.508658 (E_RNA) where: Base-Base interactions energy: -342.644 where: short stacking energy: -331.779 Base-Backbone interact. energy: -3.303 local terms energy: -588.561158 where: bonds (distance) C4'-P energy: -153.147 bonds (distance) P-C4' energy: -135.866 flat angles C4'-P-C4' energy: -148.815 flat angles P-C4'-P energy: -64.566 tors. eta vs tors. theta energy: -86.167 Dist. restrs. and SS energy: 76.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 6 Temperature: 1.157143 Total energy: -768.266806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.266806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.345288 (E_RNA) where: Base-Base interactions energy: -283.655 where: short stacking energy: -252.757 Base-Backbone interact. energy: 2.124 local terms energy: -545.814487 where: bonds (distance) C4'-P energy: -151.395 bonds (distance) P-C4' energy: -152.278 flat angles C4'-P-C4' energy: -118.246 flat angles P-C4'-P energy: -75.374 tors. eta vs tors. theta energy: -48.521 Dist. restrs. and SS energy: 59.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.221429 Total energy: -706.359960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.359960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.515112 (E_RNA) where: Base-Base interactions energy: -284.137 where: short stacking energy: -256.990 Base-Backbone interact. energy: 2.564 local terms energy: -497.942144 where: bonds (distance) C4'-P energy: -126.958 bonds (distance) P-C4' energy: -134.938 flat angles C4'-P-C4' energy: -120.635 flat angles P-C4'-P energy: -66.480 tors. eta vs tors. theta energy: -48.932 Dist. restrs. and SS energy: 73.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.285714 Total energy: -624.437297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.437297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.280328 (E_RNA) where: Base-Base interactions energy: -262.589 where: short stacking energy: -216.404 Base-Backbone interact. energy: -0.678 local terms energy: -436.013669 where: bonds (distance) C4'-P energy: -126.249 bonds (distance) P-C4' energy: -137.906 flat angles C4'-P-C4' energy: -94.540 flat angles P-C4'-P energy: -52.214 tors. eta vs tors. theta energy: -25.103 Dist. restrs. and SS energy: 74.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -572.059908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.059908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.427186 (E_RNA) where: Base-Base interactions energy: -238.412 where: short stacking energy: -211.949 Base-Backbone interact. energy: 7.767 local terms energy: -420.782201 where: bonds (distance) C4'-P energy: -135.397 bonds (distance) P-C4' energy: -112.417 flat angles C4'-P-C4' energy: -92.418 flat angles P-C4'-P energy: -49.380 tors. eta vs tors. theta energy: -31.171 Dist. restrs. and SS energy: 79.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1014.372522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.372522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.077051 (E_RNA) where: Base-Base interactions energy: -453.730 where: short stacking energy: -416.946 Base-Backbone interact. energy: -0.020 local terms energy: -634.327307 where: bonds (distance) C4'-P energy: -150.860 bonds (distance) P-C4' energy: -172.655 flat angles C4'-P-C4' energy: -131.920 flat angles P-C4'-P energy: -77.250 tors. eta vs tors. theta energy: -101.643 Dist. restrs. and SS energy: 73.705 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.964286 Total energy: -1035.514746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.514746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.722842 (E_RNA) where: Base-Base interactions energy: -472.729 where: short stacking energy: -419.121 Base-Backbone interact. energy: 1.502 local terms energy: -634.495038 where: bonds (distance) C4'-P energy: -147.116 bonds (distance) P-C4' energy: -152.778 flat angles C4'-P-C4' energy: -150.537 flat angles P-C4'-P energy: -84.284 tors. eta vs tors. theta energy: -99.780 Dist. restrs. and SS energy: 70.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.028571 Total energy: -889.536858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.536858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.051581 (E_RNA) where: Base-Base interactions energy: -384.596 where: short stacking energy: -363.081 Base-Backbone interact. energy: 0.247 local terms energy: -572.702401 where: bonds (distance) C4'-P energy: -137.699 bonds (distance) P-C4' energy: -165.628 flat angles C4'-P-C4' energy: -118.020 flat angles P-C4'-P energy: -81.816 tors. eta vs tors. theta energy: -69.540 Dist. restrs. and SS energy: 67.515 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.092857 Total energy: -839.108296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.108296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.033037 (E_RNA) where: Base-Base interactions energy: -340.048 where: short stacking energy: -314.499 Base-Backbone interact. energy: 0.606 local terms energy: -563.591372 where: bonds (distance) C4'-P energy: -141.075 bonds (distance) P-C4' energy: -163.059 flat angles C4'-P-C4' energy: -128.711 flat angles P-C4'-P energy: -64.001 tors. eta vs tors. theta energy: -66.745 Dist. restrs. and SS energy: 63.925 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 7 Temperature: 1.157143 Total energy: -699.115347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.115347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.070102 (E_RNA) where: Base-Base interactions energy: -258.616 where: short stacking energy: -228.115 Base-Backbone interact. energy: 0.295 local terms energy: -501.749023 where: bonds (distance) C4'-P energy: -139.063 bonds (distance) P-C4' energy: -135.051 flat angles C4'-P-C4' energy: -117.465 flat angles P-C4'-P energy: -67.944 tors. eta vs tors. theta energy: -42.226 Dist. restrs. and SS energy: 60.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.221429 Total energy: -698.958278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.958278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.318256 (E_RNA) where: Base-Base interactions energy: -297.169 where: short stacking energy: -250.317 Base-Backbone interact. energy: 1.001 local terms energy: -469.150117 where: bonds (distance) C4'-P energy: -147.031 bonds (distance) P-C4' energy: -130.317 flat angles C4'-P-C4' energy: -106.055 flat angles P-C4'-P energy: -66.059 tors. eta vs tors. theta energy: -19.688 Dist. restrs. and SS energy: 66.360 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 7 Temperature: 1.285714 Total energy: -608.213609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.213609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.797538 (E_RNA) where: Base-Base interactions energy: -253.967 where: short stacking energy: -224.807 Base-Backbone interact. energy: 0.083 local terms energy: -433.913276 where: bonds (distance) C4'-P energy: -110.769 bonds (distance) P-C4' energy: -130.107 flat angles C4'-P-C4' energy: -110.218 flat angles P-C4'-P energy: -53.580 tors. eta vs tors. theta energy: -29.240 Dist. restrs. and SS energy: 79.584 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -519.444300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.444300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.070703 (E_RNA) where: Base-Base interactions energy: -252.193 where: short stacking energy: -215.712 Base-Backbone interact. energy: 3.908 local terms energy: -337.785697 where: bonds (distance) C4'-P energy: -105.569 bonds (distance) P-C4' energy: -112.728 flat angles C4'-P-C4' energy: -85.967 flat angles P-C4'-P energy: -32.399 tors. eta vs tors. theta energy: -1.123 Dist. restrs. and SS energy: 66.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1079.891919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.891919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.236998 (E_RNA) where: Base-Base interactions energy: -487.111 where: short stacking energy: -445.924 Base-Backbone interact. energy: 1.652 local terms energy: -661.777364 where: bonds (distance) C4'-P energy: -166.065 bonds (distance) P-C4' energy: -166.008 flat angles C4'-P-C4' energy: -159.277 flat angles P-C4'-P energy: -81.381 tors. eta vs tors. theta energy: -89.046 Dist. restrs. and SS energy: 67.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.964286 Total energy: -972.928052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.928052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.212175 (E_RNA) where: Base-Base interactions energy: -433.337 where: short stacking energy: -395.545 Base-Backbone interact. energy: 8.879 local terms energy: -614.754622 where: bonds (distance) C4'-P energy: -145.214 bonds (distance) P-C4' energy: -146.155 flat angles C4'-P-C4' energy: -137.239 flat angles P-C4'-P energy: -81.784 tors. eta vs tors. theta energy: -104.363 Dist. restrs. and SS energy: 66.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.028571 Total energy: -951.263957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.263957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.360616 (E_RNA) where: Base-Base interactions energy: -393.982 where: short stacking energy: -376.497 Base-Backbone interact. energy: -0.751 local terms energy: -621.627925 where: bonds (distance) C4'-P energy: -133.954 bonds (distance) P-C4' energy: -152.035 flat angles C4'-P-C4' energy: -153.793 flat angles P-C4'-P energy: -91.808 tors. eta vs tors. theta energy: -90.038 Dist. restrs. and SS energy: 65.097 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 8 Temperature: 1.092857 Total energy: -899.000443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.000443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.275685 (E_RNA) where: Base-Base interactions energy: -411.419 where: short stacking energy: -378.434 Base-Backbone interact. energy: -0.732 local terms energy: -557.124455 where: bonds (distance) C4'-P energy: -148.306 bonds (distance) P-C4' energy: -127.097 flat angles C4'-P-C4' energy: -123.551 flat angles P-C4'-P energy: -79.035 tors. eta vs tors. theta energy: -79.136 Dist. restrs. and SS energy: 70.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.157143 Total energy: -756.427433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.427433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.908623 (E_RNA) where: Base-Base interactions energy: -310.126 where: short stacking energy: -277.376 Base-Backbone interact. energy: -0.126 local terms energy: -516.656206 where: bonds (distance) C4'-P energy: -142.353 bonds (distance) P-C4' energy: -131.469 flat angles C4'-P-C4' energy: -122.403 flat angles P-C4'-P energy: -76.633 tors. eta vs tors. theta energy: -43.798 Dist. restrs. and SS energy: 70.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 8 Temperature: 1.221429 Total energy: -693.851427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.851427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.025340 (E_RNA) where: Base-Base interactions energy: -288.857 where: short stacking energy: -257.150 Base-Backbone interact. energy: 0.012 local terms energy: -456.180883 where: bonds (distance) C4'-P energy: -133.699 bonds (distance) P-C4' energy: -139.225 flat angles C4'-P-C4' energy: -100.842 flat angles P-C4'-P energy: -49.191 tors. eta vs tors. theta energy: -33.223 Dist. restrs. and SS energy: 51.174 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 8 Temperature: 1.285714 Total energy: -690.361540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.361540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.786819 (E_RNA) where: Base-Base interactions energy: -301.261 where: short stacking energy: -255.338 Base-Backbone interact. energy: 1.369 local terms energy: -462.894614 where: bonds (distance) C4'-P energy: -125.684 bonds (distance) P-C4' energy: -136.029 flat angles C4'-P-C4' energy: -115.869 flat angles P-C4'-P energy: -50.931 tors. eta vs tors. theta energy: -34.382 Dist. restrs. and SS energy: 72.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -532.404032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.404032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.165430 (E_RNA) where: Base-Base interactions energy: -223.757 where: short stacking energy: -201.172 Base-Backbone interact. energy: 5.205 local terms energy: -395.613226 where: bonds (distance) C4'-P energy: -132.582 bonds (distance) P-C4' energy: -114.401 flat angles C4'-P-C4' energy: -98.479 flat angles P-C4'-P energy: -44.961 tors. eta vs tors. theta energy: -5.190 Dist. restrs. and SS energy: 81.761 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1054.420513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.420513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.529634 (E_RNA) where: Base-Base interactions energy: -472.608 where: short stacking energy: -444.955 Base-Backbone interact. energy: -0.949 local terms energy: -652.972056 where: bonds (distance) C4'-P energy: -143.362 bonds (distance) P-C4' energy: -161.434 flat angles C4'-P-C4' energy: -159.602 flat angles P-C4'-P energy: -86.646 tors. eta vs tors. theta energy: -101.928 Dist. restrs. and SS energy: 72.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.964286 Total energy: -1040.593500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.593500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.986500 (E_RNA) where: Base-Base interactions energy: -465.717 where: short stacking energy: -424.461 Base-Backbone interact. energy: -0.333 local terms energy: -630.936172 where: bonds (distance) C4'-P energy: -148.685 bonds (distance) P-C4' energy: -166.823 flat angles C4'-P-C4' energy: -144.190 flat angles P-C4'-P energy: -90.469 tors. eta vs tors. theta energy: -80.770 Dist. restrs. and SS energy: 56.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.028571 Total energy: -958.098165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.098165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.286676 (E_RNA) where: Base-Base interactions energy: -415.035 where: short stacking energy: -387.921 Base-Backbone interact. energy: 8.843 local terms energy: -613.094568 where: bonds (distance) C4'-P energy: -153.568 bonds (distance) P-C4' energy: -142.946 flat angles C4'-P-C4' energy: -150.437 flat angles P-C4'-P energy: -78.606 tors. eta vs tors. theta energy: -87.537 Dist. restrs. and SS energy: 61.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.092857 Total energy: -893.155043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.155043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.391666 (E_RNA) where: Base-Base interactions energy: -397.060 where: short stacking energy: -366.643 Base-Backbone interact. energy: -1.592 local terms energy: -557.739332 where: bonds (distance) C4'-P energy: -140.340 bonds (distance) P-C4' energy: -149.511 flat angles C4'-P-C4' energy: -135.034 flat angles P-C4'-P energy: -56.952 tors. eta vs tors. theta energy: -75.902 Dist. restrs. and SS energy: 63.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 9 Temperature: 1.157143 Total energy: -751.276789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.276789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.340390 (E_RNA) where: Base-Base interactions energy: -311.729 where: short stacking energy: -273.938 Base-Backbone interact. energy: 1.881 local terms energy: -499.492953 where: bonds (distance) C4'-P energy: -138.529 bonds (distance) P-C4' energy: -145.045 flat angles C4'-P-C4' energy: -120.858 flat angles P-C4'-P energy: -53.216 tors. eta vs tors. theta energy: -41.845 Dist. restrs. and SS energy: 58.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.221429 Total energy: -681.155510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.155510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.494159 (E_RNA) where: Base-Base interactions energy: -306.507 where: short stacking energy: -265.575 Base-Backbone interact. energy: -1.787 local terms energy: -436.199921 where: bonds (distance) C4'-P energy: -127.581 bonds (distance) P-C4' energy: -120.997 flat angles C4'-P-C4' energy: -97.853 flat angles P-C4'-P energy: -59.554 tors. eta vs tors. theta energy: -30.215 Dist. restrs. and SS energy: 63.339 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 9 Temperature: 1.285714 Total energy: -674.919172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.919172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.336562 (E_RNA) where: Base-Base interactions energy: -279.772 where: short stacking energy: -237.701 Base-Backbone interact. energy: 5.085 local terms energy: -464.649677 where: bonds (distance) C4'-P energy: -126.625 bonds (distance) P-C4' energy: -131.098 flat angles C4'-P-C4' energy: -110.753 flat angles P-C4'-P energy: -52.449 tors. eta vs tors. theta energy: -43.724 Dist. restrs. and SS energy: 64.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -502.839232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.839232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.228604 (E_RNA) where: Base-Base interactions energy: -200.157 where: short stacking energy: -179.778 Base-Backbone interact. energy: 6.165 local terms energy: -386.236343 where: bonds (distance) C4'-P energy: -124.637 bonds (distance) P-C4' energy: -122.559 flat angles C4'-P-C4' energy: -98.633 flat angles P-C4'-P energy: -54.396 tors. eta vs tors. theta energy: 13.990 Dist. restrs. and SS energy: 77.389 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1088.834837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.834837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.050078 (E_RNA) where: Base-Base interactions energy: -500.706 where: short stacking energy: -451.918 Base-Backbone interact. energy: -0.894 local terms energy: -653.450009 where: bonds (distance) C4'-P energy: -136.581 bonds (distance) P-C4' energy: -159.904 flat angles C4'-P-C4' energy: -146.117 flat angles P-C4'-P energy: -105.996 tors. eta vs tors. theta energy: -104.852 Dist. restrs. and SS energy: 66.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.964286 Total energy: -1062.893929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.893929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.399818 (E_RNA) where: Base-Base interactions energy: -471.151 where: short stacking energy: -424.569 Base-Backbone interact. energy: -0.830 local terms energy: -652.418592 where: bonds (distance) C4'-P energy: -147.938 bonds (distance) P-C4' energy: -161.861 flat angles C4'-P-C4' energy: -157.297 flat angles P-C4'-P energy: -86.653 tors. eta vs tors. theta energy: -98.670 Dist. restrs. and SS energy: 61.506 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 10 Temperature: 1.028571 Total energy: -992.544455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.544455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.292657 (E_RNA) where: Base-Base interactions energy: -449.108 where: short stacking energy: -422.403 Base-Backbone interact. energy: 5.404 local terms energy: -609.589334 where: bonds (distance) C4'-P energy: -146.704 bonds (distance) P-C4' energy: -143.663 flat angles C4'-P-C4' energy: -152.231 flat angles P-C4'-P energy: -69.531 tors. eta vs tors. theta energy: -97.461 Dist. restrs. and SS energy: 60.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 10 Temperature: 1.092857 Total energy: -883.605387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.605387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.197759 (E_RNA) where: Base-Base interactions energy: -391.123 where: short stacking energy: -350.130 Base-Backbone interact. energy: -1.394 local terms energy: -556.680425 where: bonds (distance) C4'-P energy: -128.597 bonds (distance) P-C4' energy: -155.794 flat angles C4'-P-C4' energy: -127.447 flat angles P-C4'-P energy: -75.096 tors. eta vs tors. theta energy: -69.746 Dist. restrs. and SS energy: 65.592 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 10 Temperature: 1.157143 Total energy: -731.449534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.449534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.464276 (E_RNA) where: Base-Base interactions energy: -293.301 where: short stacking energy: -248.057 Base-Backbone interact. energy: 2.741 local terms energy: -507.904228 where: bonds (distance) C4'-P energy: -126.580 bonds (distance) P-C4' energy: -153.120 flat angles C4'-P-C4' energy: -132.029 flat angles P-C4'-P energy: -79.726 tors. eta vs tors. theta energy: -16.449 Dist. restrs. and SS energy: 67.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 10 Temperature: 1.221429 Total energy: -681.443103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.443103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.261698 (E_RNA) where: Base-Base interactions energy: -287.385 where: short stacking energy: -246.508 Base-Backbone interact. energy: -0.552 local terms energy: -466.325289 where: bonds (distance) C4'-P energy: -109.086 bonds (distance) P-C4' energy: -156.211 flat angles C4'-P-C4' energy: -113.152 flat angles P-C4'-P energy: -68.663 tors. eta vs tors. theta energy: -19.214 Dist. restrs. and SS energy: 72.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 10 Temperature: 1.285714 Total energy: -692.837950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.837950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.923024 (E_RNA) where: Base-Base interactions energy: -288.776 where: short stacking energy: -236.664 Base-Backbone interact. energy: -1.817 local terms energy: -480.330080 where: bonds (distance) C4'-P energy: -135.826 bonds (distance) P-C4' energy: -131.913 flat angles C4'-P-C4' energy: -111.314 flat angles P-C4'-P energy: -64.827 tors. eta vs tors. theta energy: -36.450 Dist. restrs. and SS energy: 78.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -504.391930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.391930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.763361 (E_RNA) where: Base-Base interactions energy: -203.958 where: short stacking energy: -172.877 Base-Backbone interact. energy: 4.286 local terms energy: -385.091542 where: bonds (distance) C4'-P energy: -117.170 bonds (distance) P-C4' energy: -121.556 flat angles C4'-P-C4' energy: -116.033 flat angles P-C4'-P energy: -45.169 tors. eta vs tors. theta energy: 14.837 Dist. restrs. and SS energy: 80.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1095.165586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.165586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.834403 (E_RNA) where: Base-Base interactions energy: -507.503 where: short stacking energy: -472.063 Base-Backbone interact. energy: 3.739 local terms energy: -654.070032 where: bonds (distance) C4'-P energy: -144.068 bonds (distance) P-C4' energy: -142.263 flat angles C4'-P-C4' energy: -161.603 flat angles P-C4'-P energy: -101.810 tors. eta vs tors. theta energy: -104.327 Dist. restrs. and SS energy: 62.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.964286 Total energy: -1055.040455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.040455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.093384 (E_RNA) where: Base-Base interactions energy: -476.567 where: short stacking energy: -431.836 Base-Backbone interact. energy: 0.400 local terms energy: -627.926391 where: bonds (distance) C4'-P energy: -128.074 bonds (distance) P-C4' energy: -163.013 flat angles C4'-P-C4' energy: -149.742 flat angles P-C4'-P energy: -85.800 tors. eta vs tors. theta energy: -101.297 Dist. restrs. and SS energy: 49.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.028571 Total energy: -940.859891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.859891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.191592 (E_RNA) where: Base-Base interactions energy: -376.698 where: short stacking energy: -350.841 Base-Backbone interact. energy: -1.452 local terms energy: -615.041249 where: bonds (distance) C4'-P energy: -147.544 bonds (distance) P-C4' energy: -162.465 flat angles C4'-P-C4' energy: -131.172 flat angles P-C4'-P energy: -93.061 tors. eta vs tors. theta energy: -80.798 Dist. restrs. and SS energy: 52.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.092857 Total energy: -863.464436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.464436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.360801 (E_RNA) where: Base-Base interactions energy: -376.748 where: short stacking energy: -346.013 Base-Backbone interact. energy: 3.311 local terms energy: -541.923296 where: bonds (distance) C4'-P energy: -160.013 bonds (distance) P-C4' energy: -130.479 flat angles C4'-P-C4' energy: -140.155 flat angles P-C4'-P energy: -58.448 tors. eta vs tors. theta energy: -52.828 Dist. restrs. and SS energy: 51.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 11 Temperature: 1.157143 Total energy: -733.221805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.221805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.649329 (E_RNA) where: Base-Base interactions energy: -309.800 where: short stacking energy: -261.667 Base-Backbone interact. energy: 0.879 local terms energy: -479.728529 where: bonds (distance) C4'-P energy: -126.197 bonds (distance) P-C4' energy: -133.986 flat angles C4'-P-C4' energy: -117.059 flat angles P-C4'-P energy: -75.400 tors. eta vs tors. theta energy: -27.086 Dist. restrs. and SS energy: 55.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 11 Temperature: 1.221429 Total energy: -665.843138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.843138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.785269 (E_RNA) where: Base-Base interactions energy: -302.524 where: short stacking energy: -243.962 Base-Backbone interact. energy: -1.230 local terms energy: -425.030925 where: bonds (distance) C4'-P energy: -121.925 bonds (distance) P-C4' energy: -109.857 flat angles C4'-P-C4' energy: -99.865 flat angles P-C4'-P energy: -86.026 tors. eta vs tors. theta energy: -7.358 Dist. restrs. and SS energy: 62.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 11 Temperature: 1.285714 Total energy: -585.339025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.339025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.393208 (E_RNA) where: Base-Base interactions energy: -248.756 where: short stacking energy: -217.770 Base-Backbone interact. energy: 0.347 local terms energy: -406.984293 where: bonds (distance) C4'-P energy: -124.569 bonds (distance) P-C4' energy: -123.537 flat angles C4'-P-C4' energy: -93.108 flat angles P-C4'-P energy: -57.251 tors. eta vs tors. theta energy: -8.519 Dist. restrs. and SS energy: 70.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -529.684159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.684159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.928258 (E_RNA) where: Base-Base interactions energy: -219.949 where: short stacking energy: -186.284 Base-Backbone interact. energy: 5.174 local terms energy: -406.153786 where: bonds (distance) C4'-P energy: -123.400 bonds (distance) P-C4' energy: -128.082 flat angles C4'-P-C4' energy: -98.388 flat angles P-C4'-P energy: -55.886 tors. eta vs tors. theta energy: -0.397 Dist. restrs. and SS energy: 91.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1134.702944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.702944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.696548 (E_RNA) where: Base-Base interactions energy: -536.611 where: short stacking energy: -496.245 Base-Backbone interact. energy: -0.311 local terms energy: -654.774929 where: bonds (distance) C4'-P energy: -158.558 bonds (distance) P-C4' energy: -145.750 flat angles C4'-P-C4' energy: -155.971 flat angles P-C4'-P energy: -82.537 tors. eta vs tors. theta energy: -111.959 Dist. restrs. and SS energy: 56.994 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.964286 Total energy: -1052.564112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.564112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.667019 (E_RNA) where: Base-Base interactions energy: -495.135 where: short stacking energy: -446.808 Base-Backbone interact. energy: -1.010 local terms energy: -608.522099 where: bonds (distance) C4'-P energy: -149.427 bonds (distance) P-C4' energy: -159.696 flat angles C4'-P-C4' energy: -133.356 flat angles P-C4'-P energy: -81.057 tors. eta vs tors. theta energy: -84.986 Dist. restrs. and SS energy: 52.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 12 Temperature: 1.028571 Total energy: -931.591790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.591790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.838667 (E_RNA) where: Base-Base interactions energy: -384.988 where: short stacking energy: -355.239 Base-Backbone interact. energy: 3.654 local terms energy: -600.504566 where: bonds (distance) C4'-P energy: -150.766 bonds (distance) P-C4' energy: -141.546 flat angles C4'-P-C4' energy: -148.546 flat angles P-C4'-P energy: -87.384 tors. eta vs tors. theta energy: -72.263 Dist. restrs. and SS energy: 50.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.092857 Total energy: -893.674017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.674017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.575866 (E_RNA) where: Base-Base interactions energy: -365.566 where: short stacking energy: -335.043 Base-Backbone interact. energy: 2.080 local terms energy: -574.090469 where: bonds (distance) C4'-P energy: -152.261 bonds (distance) P-C4' energy: -149.776 flat angles C4'-P-C4' energy: -127.274 flat angles P-C4'-P energy: -82.099 tors. eta vs tors. theta energy: -62.680 Dist. restrs. and SS energy: 43.902 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 12 Temperature: 1.157143 Total energy: -798.858064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.858064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.607223 (E_RNA) where: Base-Base interactions energy: -349.834 where: short stacking energy: -307.637 Base-Backbone interact. energy: 5.917 local terms energy: -509.690344 where: bonds (distance) C4'-P energy: -126.007 bonds (distance) P-C4' energy: -151.682 flat angles C4'-P-C4' energy: -105.854 flat angles P-C4'-P energy: -72.523 tors. eta vs tors. theta energy: -53.625 Dist. restrs. and SS energy: 54.749 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 12 Temperature: 1.221429 Total energy: -732.782501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.782501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.648106 (E_RNA) where: Base-Base interactions energy: -336.293 where: short stacking energy: -274.715 Base-Backbone interact. energy: 0.654 local terms energy: -481.009599 where: bonds (distance) C4'-P energy: -138.783 bonds (distance) P-C4' energy: -127.699 flat angles C4'-P-C4' energy: -117.771 flat angles P-C4'-P energy: -50.519 tors. eta vs tors. theta energy: -46.238 Dist. restrs. and SS energy: 83.866 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 12 Temperature: 1.285714 Total energy: -602.619081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.619081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.534992 (E_RNA) where: Base-Base interactions energy: -200.160 where: short stacking energy: -179.124 Base-Backbone interact. energy: 3.802 local terms energy: -472.176538 where: bonds (distance) C4'-P energy: -150.439 bonds (distance) P-C4' energy: -133.133 flat angles C4'-P-C4' energy: -103.650 flat angles P-C4'-P energy: -74.951 tors. eta vs tors. theta energy: -10.003 Dist. restrs. and SS energy: 65.916 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -526.752991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.752991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.822987 (E_RNA) where: Base-Base interactions energy: -188.742 where: short stacking energy: -163.880 Base-Backbone interact. energy: 1.461 local terms energy: -416.541625 where: bonds (distance) C4'-P energy: -111.116 bonds (distance) P-C4' energy: -166.561 flat angles C4'-P-C4' energy: -90.337 flat angles P-C4'-P energy: -50.367 tors. eta vs tors. theta energy: 1.840 Dist. restrs. and SS energy: 77.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1134.666429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.666429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.275139 (E_RNA) where: Base-Base interactions energy: -514.250 where: short stacking energy: -470.110 Base-Backbone interact. energy: -0.076 local terms energy: -679.948764 where: bonds (distance) C4'-P energy: -157.714 bonds (distance) P-C4' energy: -166.043 flat angles C4'-P-C4' energy: -167.421 flat angles P-C4'-P energy: -88.877 tors. eta vs tors. theta energy: -99.895 Dist. restrs. and SS energy: 59.609 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.964286 Total energy: -1065.739249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.739249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.554628 (E_RNA) where: Base-Base interactions energy: -481.486 where: short stacking energy: -432.503 Base-Backbone interact. energy: -0.599 local terms energy: -634.469696 where: bonds (distance) C4'-P energy: -144.127 bonds (distance) P-C4' energy: -157.256 flat angles C4'-P-C4' energy: -139.304 flat angles P-C4'-P energy: -89.276 tors. eta vs tors. theta energy: -104.506 Dist. restrs. and SS energy: 50.815 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 13 Temperature: 1.028571 Total energy: -950.600913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.600913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.553181 (E_RNA) where: Base-Base interactions energy: -435.638 where: short stacking energy: -384.301 Base-Backbone interact. energy: -0.708 local terms energy: -566.207913 where: bonds (distance) C4'-P energy: -145.124 bonds (distance) P-C4' energy: -143.407 flat angles C4'-P-C4' energy: -133.528 flat angles P-C4'-P energy: -77.258 tors. eta vs tors. theta energy: -66.891 Dist. restrs. and SS energy: 51.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.092857 Total energy: -868.552630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.552630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.716419 (E_RNA) where: Base-Base interactions energy: -374.070 where: short stacking energy: -339.449 Base-Backbone interact. energy: 2.801 local terms energy: -549.448196 where: bonds (distance) C4'-P energy: -141.983 bonds (distance) P-C4' energy: -148.476 flat angles C4'-P-C4' energy: -126.871 flat angles P-C4'-P energy: -66.137 tors. eta vs tors. theta energy: -65.981 Dist. restrs. and SS energy: 52.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 13 Temperature: 1.157143 Total energy: -772.511985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.511985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.395789 (E_RNA) where: Base-Base interactions energy: -319.785 where: short stacking energy: -287.022 Base-Backbone interact. energy: 2.051 local terms energy: -515.661367 where: bonds (distance) C4'-P energy: -131.556 bonds (distance) P-C4' energy: -161.064 flat angles C4'-P-C4' energy: -102.974 flat angles P-C4'-P energy: -68.746 tors. eta vs tors. theta energy: -51.321 Dist. restrs. and SS energy: 60.884 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.221429 Total energy: -692.482724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.482724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.449919 (E_RNA) where: Base-Base interactions energy: -300.785 where: short stacking energy: -222.389 Base-Backbone interact. energy: 4.042 local terms energy: -462.707213 where: bonds (distance) C4'-P energy: -128.763 bonds (distance) P-C4' energy: -135.907 flat angles C4'-P-C4' energy: -135.160 flat angles P-C4'-P energy: -57.265 tors. eta vs tors. theta energy: -5.612 Dist. restrs. and SS energy: 66.967 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 13 Temperature: 1.285714 Total energy: -594.771069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.771069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.381556 (E_RNA) where: Base-Base interactions energy: -211.027 where: short stacking energy: -174.133 Base-Backbone interact. energy: 6.985 local terms energy: -433.339613 where: bonds (distance) C4'-P energy: -129.352 bonds (distance) P-C4' energy: -149.615 flat angles C4'-P-C4' energy: -97.815 flat angles P-C4'-P energy: -58.903 tors. eta vs tors. theta energy: 2.345 Dist. restrs. and SS energy: 42.610 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -532.026164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.026164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.860709 (E_RNA) where: Base-Base interactions energy: -225.964 where: short stacking energy: -195.930 Base-Backbone interact. energy: 7.502 local terms energy: -392.399008 where: bonds (distance) C4'-P energy: -135.146 bonds (distance) P-C4' energy: -135.960 flat angles C4'-P-C4' energy: -81.825 flat angles P-C4'-P energy: -53.969 tors. eta vs tors. theta energy: 14.500 Dist. restrs. and SS energy: 78.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1151.396681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.396681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.496087 (E_RNA) where: Base-Base interactions energy: -546.135 where: short stacking energy: -507.991 Base-Backbone interact. energy: -1.124 local terms energy: -664.236596 where: bonds (distance) C4'-P energy: -140.189 bonds (distance) P-C4' energy: -160.298 flat angles C4'-P-C4' energy: -152.713 flat angles P-C4'-P energy: -91.091 tors. eta vs tors. theta energy: -119.945 Dist. restrs. and SS energy: 60.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.964286 Total energy: -1051.261177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.261177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.803005 (E_RNA) where: Base-Base interactions energy: -471.226 where: short stacking energy: -405.704 Base-Backbone interact. energy: -1.701 local terms energy: -627.875767 where: bonds (distance) C4'-P energy: -147.274 bonds (distance) P-C4' energy: -160.406 flat angles C4'-P-C4' energy: -130.654 flat angles P-C4'-P energy: -93.925 tors. eta vs tors. theta energy: -95.616 Dist. restrs. and SS energy: 49.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 14 Temperature: 1.028571 Total energy: -956.477231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.477231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.673578 (E_RNA) where: Base-Base interactions energy: -444.024 where: short stacking energy: -400.234 Base-Backbone interact. energy: -0.321 local terms energy: -571.328343 where: bonds (distance) C4'-P energy: -151.378 bonds (distance) P-C4' energy: -129.340 flat angles C4'-P-C4' energy: -135.846 flat angles P-C4'-P energy: -79.471 tors. eta vs tors. theta energy: -75.293 Dist. restrs. and SS energy: 59.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.092857 Total energy: -925.140541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.140541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.295796 (E_RNA) where: Base-Base interactions energy: -403.560 where: short stacking energy: -363.570 Base-Backbone interact. energy: 0.288 local terms energy: -573.023822 where: bonds (distance) C4'-P energy: -146.724 bonds (distance) P-C4' energy: -139.955 flat angles C4'-P-C4' energy: -141.046 flat angles P-C4'-P energy: -67.516 tors. eta vs tors. theta energy: -77.784 Dist. restrs. and SS energy: 51.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.157143 Total energy: -791.830028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.830028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.536459 (E_RNA) where: Base-Base interactions energy: -330.998 where: short stacking energy: -284.213 Base-Backbone interact. energy: 2.098 local terms energy: -515.635829 where: bonds (distance) C4'-P energy: -139.184 bonds (distance) P-C4' energy: -149.820 flat angles C4'-P-C4' energy: -118.707 flat angles P-C4'-P energy: -71.196 tors. eta vs tors. theta energy: -36.728 Dist. restrs. and SS energy: 52.706 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 14 Temperature: 1.221429 Total energy: -746.258931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.258931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.733270 (E_RNA) where: Base-Base interactions energy: -352.111 where: short stacking energy: -290.288 Base-Backbone interact. energy: -0.281 local terms energy: -474.341498 where: bonds (distance) C4'-P energy: -129.352 bonds (distance) P-C4' energy: -128.988 flat angles C4'-P-C4' energy: -118.596 flat angles P-C4'-P energy: -65.901 tors. eta vs tors. theta energy: -31.505 Dist. restrs. and SS energy: 80.474 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 14 Temperature: 1.285714 Total energy: -626.546057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.546057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.280012 (E_RNA) where: Base-Base interactions energy: -280.820 where: short stacking energy: -256.886 Base-Backbone interact. energy: 8.942 local terms energy: -415.402204 where: bonds (distance) C4'-P energy: -122.325 bonds (distance) P-C4' energy: -126.666 flat angles C4'-P-C4' energy: -96.560 flat angles P-C4'-P energy: -53.602 tors. eta vs tors. theta energy: -16.249 Dist. restrs. and SS energy: 60.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -579.473702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.473702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.656390 (E_RNA) where: Base-Base interactions energy: -246.684 where: short stacking energy: -215.011 Base-Backbone interact. energy: 4.002 local terms energy: -400.974195 where: bonds (distance) C4'-P energy: -115.860 bonds (distance) P-C4' energy: -133.126 flat angles C4'-P-C4' energy: -85.489 flat angles P-C4'-P energy: -53.239 tors. eta vs tors. theta energy: -13.260 Dist. restrs. and SS energy: 64.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1158.949179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.949179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.478327 (E_RNA) where: Base-Base interactions energy: -521.872 where: short stacking energy: -478.089 Base-Backbone interact. energy: 1.268 local terms energy: -692.874273 where: bonds (distance) C4'-P energy: -160.043 bonds (distance) P-C4' energy: -147.276 flat angles C4'-P-C4' energy: -168.228 flat angles P-C4'-P energy: -103.822 tors. eta vs tors. theta energy: -113.505 Dist. restrs. and SS energy: 54.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.964286 Total energy: -1085.823631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.823631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.235472 (E_RNA) where: Base-Base interactions energy: -532.389 where: short stacking energy: -457.524 Base-Backbone interact. energy: -0.782 local terms energy: -603.064739 where: bonds (distance) C4'-P energy: -137.092 bonds (distance) P-C4' energy: -138.041 flat angles C4'-P-C4' energy: -144.228 flat angles P-C4'-P energy: -81.367 tors. eta vs tors. theta energy: -102.337 Dist. restrs. and SS energy: 50.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 15 Temperature: 1.028571 Total energy: -979.008946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.008946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.896499 (E_RNA) where: Base-Base interactions energy: -440.021 where: short stacking energy: -408.951 Base-Backbone interact. energy: -2.492 local terms energy: -593.383729 where: bonds (distance) C4'-P energy: -137.265 bonds (distance) P-C4' energy: -157.895 flat angles C4'-P-C4' energy: -125.578 flat angles P-C4'-P energy: -83.828 tors. eta vs tors. theta energy: -88.818 Dist. restrs. and SS energy: 56.888 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.092857 Total energy: -872.793386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.793386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.736088 (E_RNA) where: Base-Base interactions energy: -397.747 where: short stacking energy: -357.339 Base-Backbone interact. energy: 3.388 local terms energy: -537.377650 where: bonds (distance) C4'-P energy: -128.974 bonds (distance) P-C4' energy: -142.816 flat angles C4'-P-C4' energy: -117.261 flat angles P-C4'-P energy: -85.914 tors. eta vs tors. theta energy: -62.412 Dist. restrs. and SS energy: 58.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 15 Temperature: 1.157143 Total energy: -851.604735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.604735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.763241 (E_RNA) where: Base-Base interactions energy: -370.359 where: short stacking energy: -333.811 Base-Backbone interact. energy: 7.612 local terms energy: -549.016348 where: bonds (distance) C4'-P energy: -133.222 bonds (distance) P-C4' energy: -144.935 flat angles C4'-P-C4' energy: -124.928 flat angles P-C4'-P energy: -86.984 tors. eta vs tors. theta energy: -58.948 Dist. restrs. and SS energy: 60.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.221429 Total energy: -766.600642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.600642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.029020 (E_RNA) where: Base-Base interactions energy: -345.107 where: short stacking energy: -271.889 Base-Backbone interact. energy: -0.203 local terms energy: -499.719275 where: bonds (distance) C4'-P energy: -121.154 bonds (distance) P-C4' energy: -148.113 flat angles C4'-P-C4' energy: -128.388 flat angles P-C4'-P energy: -75.346 tors. eta vs tors. theta energy: -26.719 Dist. restrs. and SS energy: 78.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 15 Temperature: 1.285714 Total energy: -600.520749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.520749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.551828 (E_RNA) where: Base-Base interactions energy: -243.291 where: short stacking energy: -199.400 Base-Backbone interact. energy: 5.913 local terms energy: -439.173429 where: bonds (distance) C4'-P energy: -129.774 bonds (distance) P-C4' energy: -131.735 flat angles C4'-P-C4' energy: -123.967 flat angles P-C4'-P energy: -57.468 tors. eta vs tors. theta energy: 3.771 Dist. restrs. and SS energy: 76.031 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -521.117992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.117992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.673471 (E_RNA) where: Base-Base interactions energy: -208.311 where: short stacking energy: -171.693 Base-Backbone interact. energy: 0.569 local terms energy: -403.931662 where: bonds (distance) C4'-P energy: -144.127 bonds (distance) P-C4' energy: -125.850 flat angles C4'-P-C4' energy: -102.130 flat angles P-C4'-P energy: -51.430 tors. eta vs tors. theta energy: 19.605 Dist. restrs. and SS energy: 90.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1224.103301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.103301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.846820 (E_RNA) where: Base-Base interactions energy: -559.161 where: short stacking energy: -522.331 Base-Backbone interact. energy: -0.637 local terms energy: -716.049186 where: bonds (distance) C4'-P energy: -158.072 bonds (distance) P-C4' energy: -159.122 flat angles C4'-P-C4' energy: -163.930 flat angles P-C4'-P energy: -100.285 tors. eta vs tors. theta energy: -134.640 Dist. restrs. and SS energy: 51.744 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.964286 Total energy: -1091.523339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.523339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.877627 (E_RNA) where: Base-Base interactions energy: -518.061 where: short stacking energy: -448.394 Base-Backbone interact. energy: -1.055 local terms energy: -617.762508 where: bonds (distance) C4'-P energy: -149.796 bonds (distance) P-C4' energy: -157.316 flat angles C4'-P-C4' energy: -135.543 flat angles P-C4'-P energy: -98.784 tors. eta vs tors. theta energy: -76.324 Dist. restrs. and SS energy: 45.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.028571 Total energy: -1007.011161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.011161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.563832 (E_RNA) where: Base-Base interactions energy: -462.962 where: short stacking energy: -414.731 Base-Backbone interact. energy: -1.187 local terms energy: -596.415161 where: bonds (distance) C4'-P energy: -121.213 bonds (distance) P-C4' energy: -148.579 flat angles C4'-P-C4' energy: -157.326 flat angles P-C4'-P energy: -80.104 tors. eta vs tors. theta energy: -89.194 Dist. restrs. and SS energy: 53.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.092857 Total energy: -847.578408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.578408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.196274 (E_RNA) where: Base-Base interactions energy: -361.475 where: short stacking energy: -309.144 Base-Backbone interact. energy: 4.489 local terms energy: -548.210708 where: bonds (distance) C4'-P energy: -135.687 bonds (distance) P-C4' energy: -138.151 flat angles C4'-P-C4' energy: -124.268 flat angles P-C4'-P energy: -90.207 tors. eta vs tors. theta energy: -59.899 Dist. restrs. and SS energy: 57.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 16 Temperature: 1.157143 Total energy: -798.081168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.081168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.955738 (E_RNA) where: Base-Base interactions energy: -348.119 where: short stacking energy: -293.832 Base-Backbone interact. energy: 1.975 local terms energy: -519.811629 where: bonds (distance) C4'-P energy: -127.482 bonds (distance) P-C4' energy: -136.415 flat angles C4'-P-C4' energy: -135.616 flat angles P-C4'-P energy: -77.885 tors. eta vs tors. theta energy: -42.414 Dist. restrs. and SS energy: 67.875 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.221429 Total energy: -701.587840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.587840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.166301 (E_RNA) where: Base-Base interactions energy: -330.634 where: short stacking energy: -268.596 Base-Backbone interact. energy: 3.944 local terms energy: -437.475805 where: bonds (distance) C4'-P energy: -135.387 bonds (distance) P-C4' energy: -126.864 flat angles C4'-P-C4' energy: -98.268 flat angles P-C4'-P energy: -72.174 tors. eta vs tors. theta energy: -4.782 Dist. restrs. and SS energy: 62.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 16 Temperature: 1.285714 Total energy: -562.945723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.945723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.011058 (E_RNA) where: Base-Base interactions energy: -237.898 where: short stacking energy: -199.513 Base-Backbone interact. energy: 3.734 local terms energy: -407.847014 where: bonds (distance) C4'-P energy: -117.788 bonds (distance) P-C4' energy: -148.199 flat angles C4'-P-C4' energy: -103.456 flat angles P-C4'-P energy: -44.488 tors. eta vs tors. theta energy: 6.084 Dist. restrs. and SS energy: 79.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -498.054281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.054281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.948086 (E_RNA) where: Base-Base interactions energy: -202.481 where: short stacking energy: -156.196 Base-Backbone interact. energy: 11.188 local terms energy: -369.655225 where: bonds (distance) C4'-P energy: -107.100 bonds (distance) P-C4' energy: -124.781 flat angles C4'-P-C4' energy: -95.311 flat angles P-C4'-P energy: -67.100 tors. eta vs tors. theta energy: 24.637 Dist. restrs. and SS energy: 62.894 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1190.273150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.273150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.513528 (E_RNA) where: Base-Base interactions energy: -575.158 where: short stacking energy: -531.933 Base-Backbone interact. energy: -0.918 local terms energy: -665.437482 where: bonds (distance) C4'-P energy: -147.623 bonds (distance) P-C4' energy: -161.928 flat angles C4'-P-C4' energy: -157.330 flat angles P-C4'-P energy: -74.639 tors. eta vs tors. theta energy: -123.918 Dist. restrs. and SS energy: 51.240 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.964286 Total energy: -1108.645543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.645543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.037881 (E_RNA) where: Base-Base interactions energy: -521.260 where: short stacking energy: -451.089 Base-Backbone interact. energy: -1.126 local terms energy: -637.652600 where: bonds (distance) C4'-P energy: -133.375 bonds (distance) P-C4' energy: -146.545 flat angles C4'-P-C4' energy: -150.644 flat angles P-C4'-P energy: -97.871 tors. eta vs tors. theta energy: -109.218 Dist. restrs. and SS energy: 51.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.028571 Total energy: -1005.330100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.330100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.200608 (E_RNA) where: Base-Base interactions energy: -455.976 where: short stacking energy: -404.950 Base-Backbone interact. energy: 0.293 local terms energy: -606.517067 where: bonds (distance) C4'-P energy: -150.420 bonds (distance) P-C4' energy: -150.505 flat angles C4'-P-C4' energy: -142.847 flat angles P-C4'-P energy: -79.665 tors. eta vs tors. theta energy: -83.080 Dist. restrs. and SS energy: 56.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 17 Temperature: 1.092857 Total energy: -840.535223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.535223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.353096 (E_RNA) where: Base-Base interactions energy: -382.930 where: short stacking energy: -354.298 Base-Backbone interact. energy: 4.901 local terms energy: -519.323810 where: bonds (distance) C4'-P energy: -125.634 bonds (distance) P-C4' energy: -139.748 flat angles C4'-P-C4' energy: -114.426 flat angles P-C4'-P energy: -69.270 tors. eta vs tors. theta energy: -70.246 Dist. restrs. and SS energy: 56.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 17 Temperature: 1.157143 Total energy: -813.204539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.204539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.737871 (E_RNA) where: Base-Base interactions energy: -385.573 where: short stacking energy: -329.632 Base-Backbone interact. energy: 2.457 local terms energy: -483.621818 where: bonds (distance) C4'-P energy: -139.602 bonds (distance) P-C4' energy: -120.246 flat angles C4'-P-C4' energy: -108.938 flat angles P-C4'-P energy: -80.860 tors. eta vs tors. theta energy: -33.976 Dist. restrs. and SS energy: 53.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 17 Temperature: 1.221429 Total energy: -708.878025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.878025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.297315 (E_RNA) where: Base-Base interactions energy: -325.990 where: short stacking energy: -268.750 Base-Backbone interact. energy: -0.110 local terms energy: -463.197853 where: bonds (distance) C4'-P energy: -122.435 bonds (distance) P-C4' energy: -145.497 flat angles C4'-P-C4' energy: -104.822 flat angles P-C4'-P energy: -65.667 tors. eta vs tors. theta energy: -24.777 Dist. restrs. and SS energy: 80.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 17 Temperature: 1.285714 Total energy: -585.128344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.128344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.844086 (E_RNA) where: Base-Base interactions energy: -215.095 where: short stacking energy: -168.783 Base-Backbone interact. energy: -4.152 local terms energy: -428.597427 where: bonds (distance) C4'-P energy: -126.112 bonds (distance) P-C4' energy: -133.006 flat angles C4'-P-C4' energy: -111.424 flat angles P-C4'-P energy: -57.866 tors. eta vs tors. theta energy: -0.188 Dist. restrs. and SS energy: 62.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -466.141960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.141960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.894392 (E_RNA) where: Base-Base interactions energy: -203.667 where: short stacking energy: -165.174 Base-Backbone interact. energy: 9.314 local terms energy: -342.541629 where: bonds (distance) C4'-P energy: -102.799 bonds (distance) P-C4' energy: -123.880 flat angles C4'-P-C4' energy: -89.718 flat angles P-C4'-P energy: -63.837 tors. eta vs tors. theta energy: 37.693 Dist. restrs. and SS energy: 70.752 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1209.986699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.986699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.765251 (E_RNA) where: Base-Base interactions energy: -589.238 where: short stacking energy: -545.222 Base-Backbone interact. energy: 0.551 local terms energy: -679.077344 where: bonds (distance) C4'-P energy: -150.785 bonds (distance) P-C4' energy: -157.912 flat angles C4'-P-C4' energy: -148.893 flat angles P-C4'-P energy: -89.650 tors. eta vs tors. theta energy: -131.837 Dist. restrs. and SS energy: 57.779 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.964286 Total energy: -1061.797227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.797227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.178765 (E_RNA) where: Base-Base interactions energy: -511.916 where: short stacking energy: -439.282 Base-Backbone interact. energy: 2.438 local terms energy: -597.700169 where: bonds (distance) C4'-P energy: -142.205 bonds (distance) P-C4' energy: -151.785 flat angles C4'-P-C4' energy: -144.977 flat angles P-C4'-P energy: -73.204 tors. eta vs tors. theta energy: -85.529 Dist. restrs. and SS energy: 45.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 18 Temperature: 1.028571 Total energy: -998.547120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.547120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.655701 (E_RNA) where: Base-Base interactions energy: -468.369 where: short stacking energy: -418.562 Base-Backbone interact. energy: -1.004 local terms energy: -586.282917 where: bonds (distance) C4'-P energy: -124.111 bonds (distance) P-C4' energy: -164.138 flat angles C4'-P-C4' energy: -143.353 flat angles P-C4'-P energy: -69.282 tors. eta vs tors. theta energy: -85.399 Dist. restrs. and SS energy: 57.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 18 Temperature: 1.092857 Total energy: -869.189264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.189264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.577334 (E_RNA) where: Base-Base interactions energy: -356.934 where: short stacking energy: -318.282 Base-Backbone interact. energy: 0.454 local terms energy: -565.097358 where: bonds (distance) C4'-P energy: -136.069 bonds (distance) P-C4' energy: -165.112 flat angles C4'-P-C4' energy: -131.864 flat angles P-C4'-P energy: -82.527 tors. eta vs tors. theta energy: -49.526 Dist. restrs. and SS energy: 52.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.157143 Total energy: -767.762487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.762487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.888122 (E_RNA) where: Base-Base interactions energy: -340.519 where: short stacking energy: -269.324 Base-Backbone interact. energy: 2.810 local terms energy: -505.178749 where: bonds (distance) C4'-P energy: -136.575 bonds (distance) P-C4' energy: -142.829 flat angles C4'-P-C4' energy: -117.121 flat angles P-C4'-P energy: -72.008 tors. eta vs tors. theta energy: -36.645 Dist. restrs. and SS energy: 75.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.221429 Total energy: -710.977866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.977866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.007413 (E_RNA) where: Base-Base interactions energy: -319.598 where: short stacking energy: -274.832 Base-Backbone interact. energy: 4.130 local terms energy: -452.539716 where: bonds (distance) C4'-P energy: -126.747 bonds (distance) P-C4' energy: -131.893 flat angles C4'-P-C4' energy: -117.053 flat angles P-C4'-P energy: -66.072 tors. eta vs tors. theta energy: -10.775 Dist. restrs. and SS energy: 57.030 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 18 Temperature: 1.285714 Total energy: -625.037888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.037888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.016271 (E_RNA) where: Base-Base interactions energy: -294.952 where: short stacking energy: -241.675 Base-Backbone interact. energy: -0.526 local terms energy: -399.538392 where: bonds (distance) C4'-P energy: -115.356 bonds (distance) P-C4' energy: -101.845 flat angles C4'-P-C4' energy: -119.140 flat angles P-C4'-P energy: -59.056 tors. eta vs tors. theta energy: -4.142 Dist. restrs. and SS energy: 69.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -519.625699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.625699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.904568 (E_RNA) where: Base-Base interactions energy: -233.215 where: short stacking energy: -169.364 Base-Backbone interact. energy: 3.165 local terms energy: -353.854246 where: bonds (distance) C4'-P energy: -98.154 bonds (distance) P-C4' energy: -143.741 flat angles C4'-P-C4' energy: -105.180 flat angles P-C4'-P energy: -46.238 tors. eta vs tors. theta energy: 39.458 Dist. restrs. and SS energy: 64.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1206.967752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.967752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.924649 (E_RNA) where: Base-Base interactions energy: -552.171 where: short stacking energy: -509.011 Base-Backbone interact. energy: -0.474 local terms energy: -704.279928 where: bonds (distance) C4'-P energy: -158.243 bonds (distance) P-C4' energy: -148.217 flat angles C4'-P-C4' energy: -163.167 flat angles P-C4'-P energy: -104.760 tors. eta vs tors. theta energy: -129.894 Dist. restrs. and SS energy: 49.957 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 19 Temperature: 0.964286 Total energy: -1124.029827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.029827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.248996 (E_RNA) where: Base-Base interactions energy: -543.285 where: short stacking energy: -470.104 Base-Backbone interact. energy: -0.131 local terms energy: -636.833025 where: bonds (distance) C4'-P energy: -153.465 bonds (distance) P-C4' energy: -144.108 flat angles C4'-P-C4' energy: -130.912 flat angles P-C4'-P energy: -101.993 tors. eta vs tors. theta energy: -106.355 Dist. restrs. and SS energy: 56.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.028571 Total energy: -973.568803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.568803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.488327 (E_RNA) where: Base-Base interactions energy: -458.336 where: short stacking energy: -414.303 Base-Backbone interact. energy: -1.082 local terms energy: -581.069888 where: bonds (distance) C4'-P energy: -130.657 bonds (distance) P-C4' energy: -160.185 flat angles C4'-P-C4' energy: -144.731 flat angles P-C4'-P energy: -78.912 tors. eta vs tors. theta energy: -66.585 Dist. restrs. and SS energy: 66.920 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 19 Temperature: 1.092857 Total energy: -877.821756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.821756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.085719 (E_RNA) where: Base-Base interactions energy: -383.256 where: short stacking energy: -329.405 Base-Backbone interact. energy: -1.608 local terms energy: -540.221803 where: bonds (distance) C4'-P energy: -145.297 bonds (distance) P-C4' energy: -145.495 flat angles C4'-P-C4' energy: -129.866 flat angles P-C4'-P energy: -63.339 tors. eta vs tors. theta energy: -56.224 Dist. restrs. and SS energy: 47.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.157143 Total energy: -813.017010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.017010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.850414 (E_RNA) where: Base-Base interactions energy: -374.998 where: short stacking energy: -311.800 Base-Backbone interact. energy: 0.099 local terms energy: -509.951499 where: bonds (distance) C4'-P energy: -121.594 bonds (distance) P-C4' energy: -151.957 flat angles C4'-P-C4' energy: -128.655 flat angles P-C4'-P energy: -78.021 tors. eta vs tors. theta energy: -29.723 Dist. restrs. and SS energy: 71.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.221429 Total energy: -722.382711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.382711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.925295 (E_RNA) where: Base-Base interactions energy: -340.806 where: short stacking energy: -266.825 Base-Backbone interact. energy: 2.628 local terms energy: -446.747966 where: bonds (distance) C4'-P energy: -128.471 bonds (distance) P-C4' energy: -122.625 flat angles C4'-P-C4' energy: -108.059 flat angles P-C4'-P energy: -52.250 tors. eta vs tors. theta energy: -35.343 Dist. restrs. and SS energy: 62.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 19 Temperature: 1.285714 Total energy: -620.662276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.662276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.532493 (E_RNA) where: Base-Base interactions energy: -253.935 where: short stacking energy: -203.187 Base-Backbone interact. energy: 7.402 local terms energy: -440.999540 where: bonds (distance) C4'-P energy: -123.920 bonds (distance) P-C4' energy: -122.763 flat angles C4'-P-C4' energy: -123.852 flat angles P-C4'-P energy: -65.922 tors. eta vs tors. theta energy: -4.543 Dist. restrs. and SS energy: 66.870 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -545.351125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.351125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.683831 (E_RNA) where: Base-Base interactions energy: -223.666 where: short stacking energy: -180.796 Base-Backbone interact. energy: 8.777 local terms energy: -387.794455 where: bonds (distance) C4'-P energy: -129.731 bonds (distance) P-C4' energy: -118.301 flat angles C4'-P-C4' energy: -96.357 flat angles P-C4'-P energy: -53.717 tors. eta vs tors. theta energy: 10.311 Dist. restrs. and SS energy: 57.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1190.750526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.750526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.303997 (E_RNA) where: Base-Base interactions energy: -553.596 where: short stacking energy: -519.921 Base-Backbone interact. energy: -0.431 local terms energy: -691.276971 where: bonds (distance) C4'-P energy: -157.102 bonds (distance) P-C4' energy: -160.709 flat angles C4'-P-C4' energy: -158.097 flat angles P-C4'-P energy: -89.511 tors. eta vs tors. theta energy: -125.857 Dist. restrs. and SS energy: 54.553 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 20 Temperature: 0.964286 Total energy: -1100.561235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.561235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.568356 (E_RNA) where: Base-Base interactions energy: -530.592 where: short stacking energy: -463.656 Base-Backbone interact. energy: -0.734 local terms energy: -624.242047 where: bonds (distance) C4'-P energy: -136.080 bonds (distance) P-C4' energy: -160.994 flat angles C4'-P-C4' energy: -134.054 flat angles P-C4'-P energy: -85.871 tors. eta vs tors. theta energy: -107.243 Dist. restrs. and SS energy: 55.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.028571 Total energy: -937.036930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.036930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.411963 (E_RNA) where: Base-Base interactions energy: -440.468 where: short stacking energy: -394.905 Base-Backbone interact. energy: 0.684 local terms energy: -547.628026 where: bonds (distance) C4'-P energy: -148.409 bonds (distance) P-C4' energy: -125.022 flat angles C4'-P-C4' energy: -139.148 flat angles P-C4'-P energy: -71.493 tors. eta vs tors. theta energy: -63.556 Dist. restrs. and SS energy: 50.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.092857 Total energy: -860.303906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.303906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.106068 (E_RNA) where: Base-Base interactions energy: -359.501 where: short stacking energy: -331.065 Base-Backbone interact. energy: 0.434 local terms energy: -549.039073 where: bonds (distance) C4'-P energy: -135.917 bonds (distance) P-C4' energy: -162.344 flat angles C4'-P-C4' energy: -125.875 flat angles P-C4'-P energy: -61.672 tors. eta vs tors. theta energy: -63.232 Dist. restrs. and SS energy: 47.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.157143 Total energy: -791.348073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.348073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.303215 (E_RNA) where: Base-Base interactions energy: -357.242 where: short stacking energy: -298.681 Base-Backbone interact. energy: 1.859 local terms energy: -499.919670 where: bonds (distance) C4'-P energy: -108.936 bonds (distance) P-C4' energy: -133.342 flat angles C4'-P-C4' energy: -118.563 flat angles P-C4'-P energy: -96.072 tors. eta vs tors. theta energy: -43.007 Dist. restrs. and SS energy: 63.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 20 Temperature: 1.221429 Total energy: -712.072205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.072205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.591008 (E_RNA) where: Base-Base interactions energy: -299.818 where: short stacking energy: -249.490 Base-Backbone interact. energy: 4.398 local terms energy: -476.170276 where: bonds (distance) C4'-P energy: -130.405 bonds (distance) P-C4' energy: -138.878 flat angles C4'-P-C4' energy: -114.916 flat angles P-C4'-P energy: -65.033 tors. eta vs tors. theta energy: -26.939 Dist. restrs. and SS energy: 59.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 20 Temperature: 1.285714 Total energy: -602.905207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.905207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.558641 (E_RNA) where: Base-Base interactions energy: -236.839 where: short stacking energy: -185.125 Base-Backbone interact. energy: 3.938 local terms energy: -431.657878 where: bonds (distance) C4'-P energy: -143.265 bonds (distance) P-C4' energy: -136.933 flat angles C4'-P-C4' energy: -102.585 flat angles P-C4'-P energy: -60.397 tors. eta vs tors. theta energy: 11.522 Dist. restrs. and SS energy: 61.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -550.865332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.865332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.538018 (E_RNA) where: Base-Base interactions energy: -229.775 where: short stacking energy: -207.695 Base-Backbone interact. energy: -0.579 local terms energy: -399.183296 where: bonds (distance) C4'-P energy: -112.591 bonds (distance) P-C4' energy: -127.751 flat angles C4'-P-C4' energy: -87.633 flat angles P-C4'-P energy: -58.952 tors. eta vs tors. theta energy: -12.257 Dist. restrs. and SS energy: 78.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1196.631846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.631846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.461938 (E_RNA) where: Base-Base interactions energy: -551.490 where: short stacking energy: -519.160 Base-Backbone interact. energy: 0.552 local terms energy: -701.523950 where: bonds (distance) C4'-P energy: -159.370 bonds (distance) P-C4' energy: -163.790 flat angles C4'-P-C4' energy: -158.275 flat angles P-C4'-P energy: -86.950 tors. eta vs tors. theta energy: -133.139 Dist. restrs. and SS energy: 55.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 21 Temperature: 0.964286 Total energy: -1074.710017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.710017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.911760 (E_RNA) where: Base-Base interactions energy: -490.042 where: short stacking energy: -424.630 Base-Backbone interact. energy: -1.781 local terms energy: -637.089066 where: bonds (distance) C4'-P energy: -156.447 bonds (distance) P-C4' energy: -155.496 flat angles C4'-P-C4' energy: -142.932 flat angles P-C4'-P energy: -81.692 tors. eta vs tors. theta energy: -100.522 Dist. restrs. and SS energy: 54.202 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.028571 Total energy: -964.657228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.657228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.878953 (E_RNA) where: Base-Base interactions energy: -418.389 where: short stacking energy: -371.257 Base-Backbone interact. energy: -2.170 local terms energy: -594.319155 where: bonds (distance) C4'-P energy: -125.295 bonds (distance) P-C4' energy: -147.684 flat angles C4'-P-C4' energy: -162.668 flat angles P-C4'-P energy: -91.407 tors. eta vs tors. theta energy: -67.266 Dist. restrs. and SS energy: 50.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 21 Temperature: 1.092857 Total energy: -901.252225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.252225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.016716 (E_RNA) where: Base-Base interactions energy: -414.186 where: short stacking energy: -351.598 Base-Backbone interact. energy: -1.763 local terms energy: -536.067806 where: bonds (distance) C4'-P energy: -141.457 bonds (distance) P-C4' energy: -152.855 flat angles C4'-P-C4' energy: -116.768 flat angles P-C4'-P energy: -62.859 tors. eta vs tors. theta energy: -62.129 Dist. restrs. and SS energy: 50.764 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 21 Temperature: 1.157143 Total energy: -794.329990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.329990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.525648 (E_RNA) where: Base-Base interactions energy: -325.297 where: short stacking energy: -270.886 Base-Backbone interact. energy: -2.092 local terms energy: -532.135939 where: bonds (distance) C4'-P energy: -139.503 bonds (distance) P-C4' energy: -150.859 flat angles C4'-P-C4' energy: -120.073 flat angles P-C4'-P energy: -100.550 tors. eta vs tors. theta energy: -21.152 Dist. restrs. and SS energy: 65.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 21 Temperature: 1.221429 Total energy: -742.884753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.884753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.462691 (E_RNA) where: Base-Base interactions energy: -308.900 where: short stacking energy: -245.091 Base-Backbone interact. energy: -2.505 local terms energy: -500.057140 where: bonds (distance) C4'-P energy: -133.044 bonds (distance) P-C4' energy: -135.417 flat angles C4'-P-C4' energy: -121.221 flat angles P-C4'-P energy: -89.047 tors. eta vs tors. theta energy: -21.328 Dist. restrs. and SS energy: 68.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 21 Temperature: 1.285714 Total energy: -612.480407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.480407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.486773 (E_RNA) where: Base-Base interactions energy: -254.590 where: short stacking energy: -195.143 Base-Backbone interact. energy: 3.089 local terms energy: -445.985517 where: bonds (distance) C4'-P energy: -120.218 bonds (distance) P-C4' energy: -120.067 flat angles C4'-P-C4' energy: -129.808 flat angles P-C4'-P energy: -74.588 tors. eta vs tors. theta energy: -1.304 Dist. restrs. and SS energy: 85.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -529.496392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.496392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.661077 (E_RNA) where: Base-Base interactions energy: -213.663 where: short stacking energy: -171.155 Base-Backbone interact. energy: 1.398 local terms energy: -367.395848 where: bonds (distance) C4'-P energy: -96.683 bonds (distance) P-C4' energy: -140.449 flat angles C4'-P-C4' energy: -97.932 flat angles P-C4'-P energy: -52.695 tors. eta vs tors. theta energy: 20.363 Dist. restrs. and SS energy: 50.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1247.807491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.807491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.062297 (E_RNA) where: Base-Base interactions energy: -615.863 where: short stacking energy: -568.442 Base-Backbone interact. energy: -0.349 local terms energy: -694.850312 where: bonds (distance) C4'-P energy: -157.214 bonds (distance) P-C4' energy: -160.579 flat angles C4'-P-C4' energy: -146.863 flat angles P-C4'-P energy: -90.865 tors. eta vs tors. theta energy: -139.330 Dist. restrs. and SS energy: 63.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.964286 Total energy: -1163.648811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.648811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.275940 (E_RNA) where: Base-Base interactions energy: -585.306 where: short stacking energy: -510.366 Base-Backbone interact. energy: -0.066 local terms energy: -633.903203 where: bonds (distance) C4'-P energy: -149.735 bonds (distance) P-C4' energy: -152.886 flat angles C4'-P-C4' energy: -123.755 flat angles P-C4'-P energy: -91.938 tors. eta vs tors. theta energy: -115.589 Dist. restrs. and SS energy: 55.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 22 Temperature: 1.028571 Total energy: -965.532838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.532838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.895960 (E_RNA) where: Base-Base interactions energy: -414.881 where: short stacking energy: -371.898 Base-Backbone interact. energy: -1.817 local terms energy: -605.198062 where: bonds (distance) C4'-P energy: -143.093 bonds (distance) P-C4' energy: -161.145 flat angles C4'-P-C4' energy: -149.795 flat angles P-C4'-P energy: -95.997 tors. eta vs tors. theta energy: -55.168 Dist. restrs. and SS energy: 56.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.092857 Total energy: -898.999557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.999557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.127934 (E_RNA) where: Base-Base interactions energy: -374.441 where: short stacking energy: -326.923 Base-Backbone interact. energy: 3.965 local terms energy: -574.651371 where: bonds (distance) C4'-P energy: -136.274 bonds (distance) P-C4' energy: -154.200 flat angles C4'-P-C4' energy: -144.903 flat angles P-C4'-P energy: -80.316 tors. eta vs tors. theta energy: -58.958 Dist. restrs. and SS energy: 46.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 22 Temperature: 1.157143 Total energy: -793.823249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.823249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.905397 (E_RNA) where: Base-Base interactions energy: -376.354 where: short stacking energy: -300.013 Base-Backbone interact. energy: -1.156 local terms energy: -490.396225 where: bonds (distance) C4'-P energy: -123.169 bonds (distance) P-C4' energy: -144.107 flat angles C4'-P-C4' energy: -127.698 flat angles P-C4'-P energy: -69.867 tors. eta vs tors. theta energy: -25.556 Dist. restrs. and SS energy: 74.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 22 Temperature: 1.221429 Total energy: -717.923460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.923460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.353513 (E_RNA) where: Base-Base interactions energy: -321.982 where: short stacking energy: -275.369 Base-Backbone interact. energy: 1.547 local terms energy: -461.917941 where: bonds (distance) C4'-P energy: -133.986 bonds (distance) P-C4' energy: -129.461 flat angles C4'-P-C4' energy: -103.486 flat angles P-C4'-P energy: -74.930 tors. eta vs tors. theta energy: -20.056 Dist. restrs. and SS energy: 64.430 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 22 Temperature: 1.285714 Total energy: -667.822290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.822290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.281836 (E_RNA) where: Base-Base interactions energy: -285.644 where: short stacking energy: -239.381 Base-Backbone interact. energy: 0.776 local terms energy: -442.414787 where: bonds (distance) C4'-P energy: -118.200 bonds (distance) P-C4' energy: -129.320 flat angles C4'-P-C4' energy: -110.385 flat angles P-C4'-P energy: -53.781 tors. eta vs tors. theta energy: -30.729 Dist. restrs. and SS energy: 59.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -545.962544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.962544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.311775 (E_RNA) where: Base-Base interactions energy: -234.617 where: short stacking energy: -196.414 Base-Backbone interact. energy: 0.843 local terms energy: -386.537650 where: bonds (distance) C4'-P energy: -119.404 bonds (distance) P-C4' energy: -116.378 flat angles C4'-P-C4' energy: -89.847 flat angles P-C4'-P energy: -59.822 tors. eta vs tors. theta energy: -1.086 Dist. restrs. and SS energy: 74.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1225.402857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.402857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.214131 (E_RNA) where: Base-Base interactions energy: -571.567 where: short stacking energy: -515.145 Base-Backbone interact. energy: 0.677 local terms energy: -696.323844 where: bonds (distance) C4'-P energy: -165.523 bonds (distance) P-C4' energy: -152.779 flat angles C4'-P-C4' energy: -148.605 flat angles P-C4'-P energy: -105.197 tors. eta vs tors. theta energy: -124.220 Dist. restrs. and SS energy: 41.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.964286 Total energy: -1158.045420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.045420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.014370 (E_RNA) where: Base-Base interactions energy: -531.628 where: short stacking energy: -473.698 Base-Backbone interact. energy: -0.727 local terms energy: -673.659505 where: bonds (distance) C4'-P energy: -148.010 bonds (distance) P-C4' energy: -161.584 flat angles C4'-P-C4' energy: -150.080 flat angles P-C4'-P energy: -105.896 tors. eta vs tors. theta energy: -108.090 Dist. restrs. and SS energy: 47.969 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.028571 Total energy: -964.588758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.588758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.130595 (E_RNA) where: Base-Base interactions energy: -435.941 where: short stacking energy: -374.179 Base-Backbone interact. energy: 0.754 local terms energy: -587.943077 where: bonds (distance) C4'-P energy: -155.581 bonds (distance) P-C4' energy: -132.831 flat angles C4'-P-C4' energy: -145.138 flat angles P-C4'-P energy: -92.598 tors. eta vs tors. theta energy: -61.795 Dist. restrs. and SS energy: 58.542 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.092857 Total energy: -902.586272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.586272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.621194 (E_RNA) where: Base-Base interactions energy: -403.837 where: short stacking energy: -347.552 Base-Backbone interact. energy: 2.781 local terms energy: -558.565424 where: bonds (distance) C4'-P energy: -142.388 bonds (distance) P-C4' energy: -137.557 flat angles C4'-P-C4' energy: -130.202 flat angles P-C4'-P energy: -86.311 tors. eta vs tors. theta energy: -62.106 Dist. restrs. and SS energy: 57.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 23 Temperature: 1.157143 Total energy: -787.749646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.749646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.464549 (E_RNA) where: Base-Base interactions energy: -384.036 where: short stacking energy: -290.552 Base-Backbone interact. energy: 6.481 local terms energy: -475.909162 where: bonds (distance) C4'-P energy: -132.113 bonds (distance) P-C4' energy: -138.243 flat angles C4'-P-C4' energy: -121.932 flat angles P-C4'-P energy: -63.597 tors. eta vs tors. theta energy: -20.024 Dist. restrs. and SS energy: 65.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 23 Temperature: 1.221429 Total energy: -700.810139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.810139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.756399 (E_RNA) where: Base-Base interactions energy: -308.843 where: short stacking energy: -239.670 Base-Backbone interact. energy: 0.286 local terms energy: -466.199477 where: bonds (distance) C4'-P energy: -114.859 bonds (distance) P-C4' energy: -128.778 flat angles C4'-P-C4' energy: -123.425 flat angles P-C4'-P energy: -73.295 tors. eta vs tors. theta energy: -25.843 Dist. restrs. and SS energy: 73.946 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.285714 Total energy: -556.894983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.894983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.750552 (E_RNA) where: Base-Base interactions energy: -241.104 where: short stacking energy: -196.988 Base-Backbone interact. energy: 2.251 local terms energy: -389.898274 where: bonds (distance) C4'-P energy: -105.542 bonds (distance) P-C4' energy: -121.981 flat angles C4'-P-C4' energy: -117.239 flat angles P-C4'-P energy: -49.968 tors. eta vs tors. theta energy: 4.831 Dist. restrs. and SS energy: 71.856 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -516.088362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.088362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.098737 (E_RNA) where: Base-Base interactions energy: -207.499 where: short stacking energy: -160.241 Base-Backbone interact. energy: 2.943 local terms energy: -370.541844 where: bonds (distance) C4'-P energy: -116.307 bonds (distance) P-C4' energy: -127.465 flat angles C4'-P-C4' energy: -80.580 flat angles P-C4'-P energy: -69.454 tors. eta vs tors. theta energy: 23.264 Dist. restrs. and SS energy: 59.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1233.102418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.102418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.438291 (E_RNA) where: Base-Base interactions energy: -586.864 where: short stacking energy: -531.981 Base-Backbone interact. energy: 1.029 local terms energy: -702.603198 where: bonds (distance) C4'-P energy: -156.601 bonds (distance) P-C4' energy: -169.470 flat angles C4'-P-C4' energy: -162.521 flat angles P-C4'-P energy: -91.701 tors. eta vs tors. theta energy: -122.310 Dist. restrs. and SS energy: 55.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.964286 Total energy: -1160.954909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.954909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.619535 (E_RNA) where: Base-Base interactions energy: -567.159 where: short stacking energy: -516.962 Base-Backbone interact. energy: -0.281 local terms energy: -645.179185 where: bonds (distance) C4'-P energy: -145.493 bonds (distance) P-C4' energy: -141.859 flat angles C4'-P-C4' energy: -150.407 flat angles P-C4'-P energy: -84.149 tors. eta vs tors. theta energy: -123.271 Dist. restrs. and SS energy: 51.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.028571 Total energy: -978.251563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.251563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.512518 (E_RNA) where: Base-Base interactions energy: -452.855 where: short stacking energy: -403.633 Base-Backbone interact. energy: -0.301 local terms energy: -576.356292 where: bonds (distance) C4'-P energy: -139.717 bonds (distance) P-C4' energy: -137.861 flat angles C4'-P-C4' energy: -132.125 flat angles P-C4'-P energy: -92.811 tors. eta vs tors. theta energy: -73.842 Dist. restrs. and SS energy: 51.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.092857 Total energy: -850.206322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.206322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.817478 (E_RNA) where: Base-Base interactions energy: -363.680 where: short stacking energy: -301.428 Base-Backbone interact. energy: -1.467 local terms energy: -545.670962 where: bonds (distance) C4'-P energy: -141.738 bonds (distance) P-C4' energy: -141.846 flat angles C4'-P-C4' energy: -143.088 flat angles P-C4'-P energy: -76.793 tors. eta vs tors. theta energy: -42.206 Dist. restrs. and SS energy: 60.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 24 Temperature: 1.157143 Total energy: -779.681954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.681954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.432201 (E_RNA) where: Base-Base interactions energy: -343.815 where: short stacking energy: -307.177 Base-Backbone interact. energy: -0.860 local terms energy: -493.756897 where: bonds (distance) C4'-P energy: -122.103 bonds (distance) P-C4' energy: -139.358 flat angles C4'-P-C4' energy: -109.907 flat angles P-C4'-P energy: -84.621 tors. eta vs tors. theta energy: -37.767 Dist. restrs. and SS energy: 58.750 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 24 Temperature: 1.221429 Total energy: -742.393197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -742.393197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.583878 (E_RNA) where: Base-Base interactions energy: -361.975 where: short stacking energy: -287.868 Base-Backbone interact. energy: 5.253 local terms energy: -451.862204 where: bonds (distance) C4'-P energy: -111.976 bonds (distance) P-C4' energy: -132.080 flat angles C4'-P-C4' energy: -112.518 flat angles P-C4'-P energy: -50.655 tors. eta vs tors. theta energy: -44.633 Dist. restrs. and SS energy: 66.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.285714 Total energy: -606.642839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.642839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.324046 (E_RNA) where: Base-Base interactions energy: -268.319 where: short stacking energy: -218.216 Base-Backbone interact. energy: 6.608 local terms energy: -412.613841 where: bonds (distance) C4'-P energy: -123.921 bonds (distance) P-C4' energy: -133.455 flat angles C4'-P-C4' energy: -92.723 flat angles P-C4'-P energy: -60.999 tors. eta vs tors. theta energy: -1.516 Dist. restrs. and SS energy: 67.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -524.921754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.921754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.939092 (E_RNA) where: Base-Base interactions energy: -245.271 where: short stacking energy: -197.268 Base-Backbone interact. energy: 0.324 local terms energy: -348.992056 where: bonds (distance) C4'-P energy: -111.632 bonds (distance) P-C4' energy: -135.339 flat angles C4'-P-C4' energy: -80.316 flat angles P-C4'-P energy: -43.324 tors. eta vs tors. theta energy: 21.617 Dist. restrs. and SS energy: 69.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1220.931832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.931832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.773719 (E_RNA) where: Base-Base interactions energy: -575.929 where: short stacking energy: -541.038 Base-Backbone interact. energy: 0.957 local terms energy: -696.801491 where: bonds (distance) C4'-P energy: -167.274 bonds (distance) P-C4' energy: -164.008 flat angles C4'-P-C4' energy: -141.180 flat angles P-C4'-P energy: -101.854 tors. eta vs tors. theta energy: -122.486 Dist. restrs. and SS energy: 50.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.964286 Total energy: -1146.291933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.291933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.191158 (E_RNA) where: Base-Base interactions energy: -545.708 where: short stacking energy: -474.936 Base-Backbone interact. energy: -0.795 local terms energy: -657.688146 where: bonds (distance) C4'-P energy: -148.197 bonds (distance) P-C4' energy: -157.318 flat angles C4'-P-C4' energy: -155.893 flat angles P-C4'-P energy: -84.664 tors. eta vs tors. theta energy: -111.616 Dist. restrs. and SS energy: 57.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.028571 Total energy: -987.035650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.035650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.543428 (E_RNA) where: Base-Base interactions energy: -443.847 where: short stacking energy: -388.182 Base-Backbone interact. energy: 3.029 local terms energy: -588.724961 where: bonds (distance) C4'-P energy: -148.711 bonds (distance) P-C4' energy: -148.673 flat angles C4'-P-C4' energy: -116.055 flat angles P-C4'-P energy: -105.657 tors. eta vs tors. theta energy: -69.628 Dist. restrs. and SS energy: 42.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 25 Temperature: 1.092857 Total energy: -799.592392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.592392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.488797 (E_RNA) where: Base-Base interactions energy: -340.110 where: short stacking energy: -293.961 Base-Backbone interact. energy: -0.175 local terms energy: -514.203331 where: bonds (distance) C4'-P energy: -151.336 bonds (distance) P-C4' energy: -126.488 flat angles C4'-P-C4' energy: -137.496 flat angles P-C4'-P energy: -64.993 tors. eta vs tors. theta energy: -33.891 Dist. restrs. and SS energy: 54.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 25 Temperature: 1.157143 Total energy: -761.453662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.453662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.680910 (E_RNA) where: Base-Base interactions energy: -346.839 where: short stacking energy: -287.545 Base-Backbone interact. energy: 3.809 local terms energy: -488.651800 where: bonds (distance) C4'-P energy: -121.460 bonds (distance) P-C4' energy: -134.936 flat angles C4'-P-C4' energy: -136.221 flat angles P-C4'-P energy: -65.462 tors. eta vs tors. theta energy: -30.572 Dist. restrs. and SS energy: 70.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 25 Temperature: 1.221429 Total energy: -765.239728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.239728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.189089 (E_RNA) where: Base-Base interactions energy: -340.483 where: short stacking energy: -278.311 Base-Backbone interact. energy: -3.399 local terms energy: -479.306674 where: bonds (distance) C4'-P energy: -126.903 bonds (distance) P-C4' energy: -114.677 flat angles C4'-P-C4' energy: -125.544 flat angles P-C4'-P energy: -75.787 tors. eta vs tors. theta energy: -36.395 Dist. restrs. and SS energy: 57.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 25 Temperature: 1.285714 Total energy: -624.386047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.386047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.336313 (E_RNA) where: Base-Base interactions energy: -299.683 where: short stacking energy: -245.369 Base-Backbone interact. energy: 7.859 local terms energy: -423.512328 where: bonds (distance) C4'-P energy: -124.487 bonds (distance) P-C4' energy: -134.536 flat angles C4'-P-C4' energy: -97.735 flat angles P-C4'-P energy: -56.095 tors. eta vs tors. theta energy: -10.659 Dist. restrs. and SS energy: 90.950 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -518.919195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.919195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.275001 (E_RNA) where: Base-Base interactions energy: -247.603 where: short stacking energy: -193.532 Base-Backbone interact. energy: 2.816 local terms energy: -339.487820 where: bonds (distance) C4'-P energy: -122.361 bonds (distance) P-C4' energy: -122.147 flat angles C4'-P-C4' energy: -78.943 flat angles P-C4'-P energy: -57.071 tors. eta vs tors. theta energy: 41.033 Dist. restrs. and SS energy: 65.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1272.431161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.431161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.577065 (E_RNA) where: Base-Base interactions energy: -576.403 where: short stacking energy: -540.534 Base-Backbone interact. energy: -1.751 local terms energy: -744.423141 where: bonds (distance) C4'-P energy: -153.328 bonds (distance) P-C4' energy: -166.370 flat angles C4'-P-C4' energy: -171.111 flat angles P-C4'-P energy: -112.352 tors. eta vs tors. theta energy: -141.262 Dist. restrs. and SS energy: 50.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.964286 Total energy: -1164.141980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.141980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.408442 (E_RNA) where: Base-Base interactions energy: -564.992 where: short stacking energy: -493.980 Base-Backbone interact. energy: -1.454 local terms energy: -658.962422 where: bonds (distance) C4'-P energy: -146.922 bonds (distance) P-C4' energy: -161.783 flat angles C4'-P-C4' energy: -143.215 flat angles P-C4'-P energy: -90.522 tors. eta vs tors. theta energy: -116.521 Dist. restrs. and SS energy: 61.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.028571 Total energy: -1037.957077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.957077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.008727 (E_RNA) where: Base-Base interactions energy: -492.869 where: short stacking energy: -434.705 Base-Backbone interact. energy: -0.619 local terms energy: -587.520699 where: bonds (distance) C4'-P energy: -141.261 bonds (distance) P-C4' energy: -147.185 flat angles C4'-P-C4' energy: -144.458 flat angles P-C4'-P energy: -58.441 tors. eta vs tors. theta energy: -96.176 Dist. restrs. and SS energy: 43.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 26 Temperature: 1.092857 Total energy: -852.929028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.929028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.936552 (E_RNA) where: Base-Base interactions energy: -378.568 where: short stacking energy: -293.594 Base-Backbone interact. energy: -1.030 local terms energy: -530.339028 where: bonds (distance) C4'-P energy: -150.291 bonds (distance) P-C4' energy: -145.645 flat angles C4'-P-C4' energy: -112.063 flat angles P-C4'-P energy: -75.013 tors. eta vs tors. theta energy: -47.327 Dist. restrs. and SS energy: 57.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 26 Temperature: 1.157143 Total energy: -785.260973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.260973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.049746 (E_RNA) where: Base-Base interactions energy: -355.815 where: short stacking energy: -289.985 Base-Backbone interact. energy: 3.689 local terms energy: -498.923996 where: bonds (distance) C4'-P energy: -105.877 bonds (distance) P-C4' energy: -149.470 flat angles C4'-P-C4' energy: -121.200 flat angles P-C4'-P energy: -90.158 tors. eta vs tors. theta energy: -32.219 Dist. restrs. and SS energy: 65.789 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.221429 Total energy: -729.802680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.802680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.439437 (E_RNA) where: Base-Base interactions energy: -316.689 where: short stacking energy: -256.861 Base-Backbone interact. energy: -2.277 local terms energy: -477.472952 where: bonds (distance) C4'-P energy: -139.385 bonds (distance) P-C4' energy: -128.931 flat angles C4'-P-C4' energy: -117.081 flat angles P-C4'-P energy: -78.638 tors. eta vs tors. theta energy: -13.438 Dist. restrs. and SS energy: 66.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.285714 Total energy: -556.068370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.068370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.110164 (E_RNA) where: Base-Base interactions energy: -222.822 where: short stacking energy: -174.695 Base-Backbone interact. energy: 0.220 local terms energy: -407.507536 where: bonds (distance) C4'-P energy: -121.178 bonds (distance) P-C4' energy: -125.939 flat angles C4'-P-C4' energy: -124.699 flat angles P-C4'-P energy: -46.050 tors. eta vs tors. theta energy: 10.358 Dist. restrs. and SS energy: 74.042 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -581.356726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.356726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.956626 (E_RNA) where: Base-Base interactions energy: -252.291 where: short stacking energy: -192.674 Base-Backbone interact. energy: -1.186 local terms energy: -385.479362 where: bonds (distance) C4'-P energy: -119.387 bonds (distance) P-C4' energy: -115.211 flat angles C4'-P-C4' energy: -88.665 flat angles P-C4'-P energy: -67.430 tors. eta vs tors. theta energy: 5.213 Dist. restrs. and SS energy: 57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1236.429984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.429984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.190780 (E_RNA) where: Base-Base interactions energy: -571.122 where: short stacking energy: -526.780 Base-Backbone interact. energy: -1.055 local terms energy: -713.013220 where: bonds (distance) C4'-P energy: -151.194 bonds (distance) P-C4' energy: -168.520 flat angles C4'-P-C4' energy: -159.920 flat angles P-C4'-P energy: -99.787 tors. eta vs tors. theta energy: -133.592 Dist. restrs. and SS energy: 48.761 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.964286 Total energy: -1192.150443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.150443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.937641 (E_RNA) where: Base-Base interactions energy: -574.599 where: short stacking energy: -506.938 Base-Backbone interact. energy: -0.441 local terms energy: -662.897875 where: bonds (distance) C4'-P energy: -144.537 bonds (distance) P-C4' energy: -147.620 flat angles C4'-P-C4' energy: -149.504 flat angles P-C4'-P energy: -102.767 tors. eta vs tors. theta energy: -118.470 Dist. restrs. and SS energy: 45.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.028571 Total energy: -1069.392968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.392968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.800802 (E_RNA) where: Base-Base interactions energy: -500.645 where: short stacking energy: -437.766 Base-Backbone interact. energy: 7.677 local terms energy: -622.833219 where: bonds (distance) C4'-P energy: -137.036 bonds (distance) P-C4' energy: -148.761 flat angles C4'-P-C4' energy: -131.511 flat angles P-C4'-P energy: -101.405 tors. eta vs tors. theta energy: -104.120 Dist. restrs. and SS energy: 46.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.092857 Total energy: -851.935076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.935076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.370615 (E_RNA) where: Base-Base interactions energy: -398.574 where: short stacking energy: -292.144 Base-Backbone interact. energy: 0.381 local terms energy: -513.178343 where: bonds (distance) C4'-P energy: -133.362 bonds (distance) P-C4' energy: -148.838 flat angles C4'-P-C4' energy: -119.536 flat angles P-C4'-P energy: -75.827 tors. eta vs tors. theta energy: -35.616 Dist. restrs. and SS energy: 59.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 27 Temperature: 1.157143 Total energy: -752.493063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.493063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.904163 (E_RNA) where: Base-Base interactions energy: -340.719 where: short stacking energy: -256.806 Base-Backbone interact. energy: -3.094 local terms energy: -473.090727 where: bonds (distance) C4'-P energy: -129.512 bonds (distance) P-C4' energy: -144.200 flat angles C4'-P-C4' energy: -118.427 flat angles P-C4'-P energy: -71.685 tors. eta vs tors. theta energy: -9.267 Dist. restrs. and SS energy: 64.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.221429 Total energy: -718.754627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.754627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.774132 (E_RNA) where: Base-Base interactions energy: -322.099 where: short stacking energy: -264.832 Base-Backbone interact. energy: 1.873 local terms energy: -458.548206 where: bonds (distance) C4'-P energy: -133.460 bonds (distance) P-C4' energy: -135.313 flat angles C4'-P-C4' energy: -114.417 flat angles P-C4'-P energy: -63.219 tors. eta vs tors. theta energy: -12.140 Dist. restrs. and SS energy: 60.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.285714 Total energy: -598.913509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.913509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.384151 (E_RNA) where: Base-Base interactions energy: -236.666 where: short stacking energy: -192.645 Base-Backbone interact. energy: -1.331 local terms energy: -445.387348 where: bonds (distance) C4'-P energy: -127.251 bonds (distance) P-C4' energy: -138.410 flat angles C4'-P-C4' energy: -111.720 flat angles P-C4'-P energy: -55.246 tors. eta vs tors. theta energy: -12.761 Dist. restrs. and SS energy: 84.471 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -553.203932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.203932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.038865 (E_RNA) where: Base-Base interactions energy: -231.746 where: short stacking energy: -167.444 Base-Backbone interact. energy: 5.411 local terms energy: -383.704126 where: bonds (distance) C4'-P energy: -107.432 bonds (distance) P-C4' energy: -115.134 flat angles C4'-P-C4' energy: -111.459 flat angles P-C4'-P energy: -55.633 tors. eta vs tors. theta energy: 5.954 Dist. restrs. and SS energy: 56.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1242.223455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.223455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.641420 (E_RNA) where: Base-Base interactions energy: -586.822 where: short stacking energy: -522.197 Base-Backbone interact. energy: -0.500 local terms energy: -705.319008 where: bonds (distance) C4'-P energy: -151.699 bonds (distance) P-C4' energy: -166.990 flat angles C4'-P-C4' energy: -156.499 flat angles P-C4'-P energy: -100.847 tors. eta vs tors. theta energy: -129.285 Dist. restrs. and SS energy: 50.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.964286 Total energy: -1172.957904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.957904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.290428 (E_RNA) where: Base-Base interactions energy: -564.553 where: short stacking energy: -510.379 Base-Backbone interact. energy: -2.255 local terms energy: -657.482063 where: bonds (distance) C4'-P energy: -137.027 bonds (distance) P-C4' energy: -149.252 flat angles C4'-P-C4' energy: -157.117 flat angles P-C4'-P energy: -91.152 tors. eta vs tors. theta energy: -122.933 Dist. restrs. and SS energy: 51.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.028571 Total energy: -1021.929662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.929662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.160238 (E_RNA) where: Base-Base interactions energy: -433.633 where: short stacking energy: -390.122 Base-Backbone interact. energy: 2.059 local terms energy: -639.585847 where: bonds (distance) C4'-P energy: -160.644 bonds (distance) P-C4' energy: -151.429 flat angles C4'-P-C4' energy: -150.082 flat angles P-C4'-P energy: -87.699 tors. eta vs tors. theta energy: -89.732 Dist. restrs. and SS energy: 49.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 28 Temperature: 1.092857 Total energy: -861.647006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.647006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.942187 (E_RNA) where: Base-Base interactions energy: -386.380 where: short stacking energy: -322.456 Base-Backbone interact. energy: 0.494 local terms energy: -535.056724 where: bonds (distance) C4'-P energy: -126.694 bonds (distance) P-C4' energy: -136.425 flat angles C4'-P-C4' energy: -145.822 flat angles P-C4'-P energy: -73.985 tors. eta vs tors. theta energy: -52.130 Dist. restrs. and SS energy: 59.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 28 Temperature: 1.157143 Total energy: -726.507486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.507486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.360307 (E_RNA) where: Base-Base interactions energy: -319.944 where: short stacking energy: -248.011 Base-Backbone interact. energy: -3.167 local terms energy: -465.249332 where: bonds (distance) C4'-P energy: -138.186 bonds (distance) P-C4' energy: -116.485 flat angles C4'-P-C4' energy: -120.983 flat angles P-C4'-P energy: -66.640 tors. eta vs tors. theta energy: -22.955 Dist. restrs. and SS energy: 61.853 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 28 Temperature: 1.221429 Total energy: -726.060189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.060189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.786823 (E_RNA) where: Base-Base interactions energy: -328.840 where: short stacking energy: -262.904 Base-Backbone interact. energy: 0.309 local terms energy: -460.256534 where: bonds (distance) C4'-P energy: -108.895 bonds (distance) P-C4' energy: -146.200 flat angles C4'-P-C4' energy: -109.502 flat angles P-C4'-P energy: -64.593 tors. eta vs tors. theta energy: -31.066 Dist. restrs. and SS energy: 62.727 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.285714 Total energy: -603.636298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.636298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.275324 (E_RNA) where: Base-Base interactions energy: -275.932 where: short stacking energy: -217.641 Base-Backbone interact. energy: 12.400 local terms energy: -410.742807 where: bonds (distance) C4'-P energy: -127.626 bonds (distance) P-C4' energy: -139.123 flat angles C4'-P-C4' energy: -98.753 flat angles P-C4'-P energy: -53.695 tors. eta vs tors. theta energy: 8.454 Dist. restrs. and SS energy: 70.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -544.129862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.129862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.793472 (E_RNA) where: Base-Base interactions energy: -217.424 where: short stacking energy: -174.628 Base-Backbone interact. energy: 6.931 local terms energy: -388.300535 where: bonds (distance) C4'-P energy: -114.706 bonds (distance) P-C4' energy: -105.261 flat angles C4'-P-C4' energy: -105.293 flat angles P-C4'-P energy: -68.390 tors. eta vs tors. theta energy: 5.350 Dist. restrs. and SS energy: 54.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1230.078852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.078852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.927882 (E_RNA) where: Base-Base interactions energy: -592.780 where: short stacking energy: -535.955 Base-Backbone interact. energy: -0.382 local terms energy: -687.765954 where: bonds (distance) C4'-P energy: -165.247 bonds (distance) P-C4' energy: -148.205 flat angles C4'-P-C4' energy: -165.524 flat angles P-C4'-P energy: -87.643 tors. eta vs tors. theta energy: -121.148 Dist. restrs. and SS energy: 50.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.964286 Total energy: -1144.002569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.002569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.265238 (E_RNA) where: Base-Base interactions energy: -566.223 where: short stacking energy: -519.437 Base-Backbone interact. energy: -0.807 local terms energy: -643.234620 where: bonds (distance) C4'-P energy: -149.097 bonds (distance) P-C4' energy: -148.852 flat angles C4'-P-C4' energy: -138.427 flat angles P-C4'-P energy: -84.021 tors. eta vs tors. theta energy: -122.837 Dist. restrs. and SS energy: 66.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.028571 Total energy: -1017.163090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.163090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.490408 (E_RNA) where: Base-Base interactions energy: -472.283 where: short stacking energy: -435.553 Base-Backbone interact. energy: 4.177 local terms energy: -596.383582 where: bonds (distance) C4'-P energy: -115.895 bonds (distance) P-C4' energy: -138.937 flat angles C4'-P-C4' energy: -151.672 flat angles P-C4'-P energy: -102.995 tors. eta vs tors. theta energy: -86.885 Dist. restrs. and SS energy: 47.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 29 Temperature: 1.092857 Total energy: -857.661252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.661252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.212622 (E_RNA) where: Base-Base interactions energy: -410.856 where: short stacking energy: -330.701 Base-Backbone interact. energy: -0.239 local terms energy: -511.117409 where: bonds (distance) C4'-P energy: -123.269 bonds (distance) P-C4' energy: -144.560 flat angles C4'-P-C4' energy: -133.915 flat angles P-C4'-P energy: -72.132 tors. eta vs tors. theta energy: -37.240 Dist. restrs. and SS energy: 64.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 29 Temperature: 1.157143 Total energy: -800.175213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.175213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.214584 (E_RNA) where: Base-Base interactions energy: -358.436 where: short stacking energy: -289.757 Base-Backbone interact. energy: -3.465 local terms energy: -498.313178 where: bonds (distance) C4'-P energy: -133.692 bonds (distance) P-C4' energy: -151.817 flat angles C4'-P-C4' energy: -102.589 flat angles P-C4'-P energy: -69.371 tors. eta vs tors. theta energy: -40.843 Dist. restrs. and SS energy: 60.039 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 29 Temperature: 1.221429 Total energy: -732.057264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.057264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.594302 (E_RNA) where: Base-Base interactions energy: -336.124 where: short stacking energy: -281.748 Base-Backbone interact. energy: -1.785 local terms energy: -456.685069 where: bonds (distance) C4'-P energy: -129.669 bonds (distance) P-C4' energy: -143.666 flat angles C4'-P-C4' energy: -96.435 flat angles P-C4'-P energy: -54.070 tors. eta vs tors. theta energy: -32.845 Dist. restrs. and SS energy: 62.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.285714 Total energy: -594.654648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.654648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.981937 (E_RNA) where: Base-Base interactions energy: -266.437 where: short stacking energy: -226.003 Base-Backbone interact. energy: -1.114 local terms energy: -403.431808 where: bonds (distance) C4'-P energy: -112.746 bonds (distance) P-C4' energy: -125.954 flat angles C4'-P-C4' energy: -104.059 flat angles P-C4'-P energy: -61.247 tors. eta vs tors. theta energy: 0.574 Dist. restrs. and SS energy: 76.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -554.504562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.504562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.642694 (E_RNA) where: Base-Base interactions energy: -247.345 where: short stacking energy: -201.719 Base-Backbone interact. energy: 3.037 local terms energy: -378.334473 where: bonds (distance) C4'-P energy: -116.017 bonds (distance) P-C4' energy: -127.200 flat angles C4'-P-C4' energy: -97.096 flat angles P-C4'-P energy: -50.666 tors. eta vs tors. theta energy: 12.644 Dist. restrs. and SS energy: 68.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1269.667070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.667070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.287185 (E_RNA) where: Base-Base interactions energy: -615.344 where: short stacking energy: -551.633 Base-Backbone interact. energy: 1.831 local terms energy: -698.774831 where: bonds (distance) C4'-P energy: -159.218 bonds (distance) P-C4' energy: -149.268 flat angles C4'-P-C4' energy: -141.365 flat angles P-C4'-P energy: -120.128 tors. eta vs tors. theta energy: -128.796 Dist. restrs. and SS energy: 42.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.964286 Total energy: -1161.635278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.635278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.282832 (E_RNA) where: Base-Base interactions energy: -566.000 where: short stacking energy: -510.431 Base-Backbone interact. energy: 0.960 local terms energy: -655.242895 where: bonds (distance) C4'-P energy: -136.680 bonds (distance) P-C4' energy: -137.475 flat angles C4'-P-C4' energy: -146.436 flat angles P-C4'-P energy: -106.631 tors. eta vs tors. theta energy: -128.022 Dist. restrs. and SS energy: 58.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.028571 Total energy: -1029.837073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.837073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1075.126675 (E_RNA) where: Base-Base interactions energy: -475.971 where: short stacking energy: -425.468 Base-Backbone interact. energy: 7.675 local terms energy: -606.831188 where: bonds (distance) C4'-P energy: -134.769 bonds (distance) P-C4' energy: -143.355 flat angles C4'-P-C4' energy: -145.316 flat angles P-C4'-P energy: -84.649 tors. eta vs tors. theta energy: -98.743 Dist. restrs. and SS energy: 45.290 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.092857 Total energy: -861.381837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.381837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.793980 (E_RNA) where: Base-Base interactions energy: -394.819 where: short stacking energy: -317.035 Base-Backbone interact. energy: 0.111 local terms energy: -517.085471 where: bonds (distance) C4'-P energy: -132.636 bonds (distance) P-C4' energy: -121.538 flat angles C4'-P-C4' energy: -132.274 flat angles P-C4'-P energy: -82.474 tors. eta vs tors. theta energy: -48.163 Dist. restrs. and SS energy: 50.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 30 Temperature: 1.157143 Total energy: -845.671005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.671005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.923595 (E_RNA) where: Base-Base interactions energy: -386.422 where: short stacking energy: -308.148 Base-Backbone interact. energy: 0.865 local terms energy: -528.366559 where: bonds (distance) C4'-P energy: -128.333 bonds (distance) P-C4' energy: -144.801 flat angles C4'-P-C4' energy: -116.057 flat angles P-C4'-P energy: -92.218 tors. eta vs tors. theta energy: -46.958 Dist. restrs. and SS energy: 68.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.221429 Total energy: -712.605772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.605772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.403017 (E_RNA) where: Base-Base interactions energy: -333.415 where: short stacking energy: -277.772 Base-Backbone interact. energy: 1.656 local terms energy: -443.643681 where: bonds (distance) C4'-P energy: -123.110 bonds (distance) P-C4' energy: -135.731 flat angles C4'-P-C4' energy: -97.477 flat angles P-C4'-P energy: -58.287 tors. eta vs tors. theta energy: -29.039 Dist. restrs. and SS energy: 62.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.285714 Total energy: -615.059476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.059476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.196095 (E_RNA) where: Base-Base interactions energy: -282.661 where: short stacking energy: -226.850 Base-Backbone interact. energy: 3.454 local terms energy: -399.988800 where: bonds (distance) C4'-P energy: -118.442 bonds (distance) P-C4' energy: -125.921 flat angles C4'-P-C4' energy: -96.140 flat angles P-C4'-P energy: -74.929 tors. eta vs tors. theta energy: 15.443 Dist. restrs. and SS energy: 64.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -529.614862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.614862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.275610 (E_RNA) where: Base-Base interactions energy: -243.153 where: short stacking energy: -204.228 Base-Backbone interact. energy: 9.881 local terms energy: -368.004073 where: bonds (distance) C4'-P energy: -109.138 bonds (distance) P-C4' energy: -120.492 flat angles C4'-P-C4' energy: -104.302 flat angles P-C4'-P energy: -42.911 tors. eta vs tors. theta energy: 8.839 Dist. restrs. and SS energy: 71.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1267.889246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.889246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.357821 (E_RNA) where: Base-Base interactions energy: -645.974 where: short stacking energy: -564.271 Base-Backbone interact. energy: 1.284 local terms energy: -672.667392 where: bonds (distance) C4'-P energy: -151.631 bonds (distance) P-C4' energy: -148.681 flat angles C4'-P-C4' energy: -153.112 flat angles P-C4'-P energy: -95.439 tors. eta vs tors. theta energy: -123.805 Dist. restrs. and SS energy: 49.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.964286 Total energy: -1151.104249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.104249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.332281 (E_RNA) where: Base-Base interactions energy: -536.429 where: short stacking energy: -488.110 Base-Backbone interact. energy: -1.360 local terms energy: -659.543428 where: bonds (distance) C4'-P energy: -139.026 bonds (distance) P-C4' energy: -147.042 flat angles C4'-P-C4' energy: -156.683 flat angles P-C4'-P energy: -98.226 tors. eta vs tors. theta energy: -118.566 Dist. restrs. and SS energy: 46.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.028571 Total energy: -1016.404490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.404490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.591950 (E_RNA) where: Base-Base interactions energy: -463.571 where: short stacking energy: -409.001 Base-Backbone interact. energy: 6.083 local terms energy: -603.103365 where: bonds (distance) C4'-P energy: -136.772 bonds (distance) P-C4' energy: -158.053 flat angles C4'-P-C4' energy: -156.105 flat angles P-C4'-P energy: -70.360 tors. eta vs tors. theta energy: -81.813 Dist. restrs. and SS energy: 44.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 31 Temperature: 1.092857 Total energy: -934.111732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.111732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.345434 (E_RNA) where: Base-Base interactions energy: -451.823 where: short stacking energy: -348.769 Base-Backbone interact. energy: -1.430 local terms energy: -552.092409 where: bonds (distance) C4'-P energy: -152.618 bonds (distance) P-C4' energy: -149.428 flat angles C4'-P-C4' energy: -120.163 flat angles P-C4'-P energy: -83.315 tors. eta vs tors. theta energy: -46.567 Dist. restrs. and SS energy: 71.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 31 Temperature: 1.157143 Total energy: -820.254184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.254184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.605843 (E_RNA) where: Base-Base interactions energy: -366.284 where: short stacking energy: -280.360 Base-Backbone interact. energy: 2.561 local terms energy: -508.883334 where: bonds (distance) C4'-P energy: -131.944 bonds (distance) P-C4' energy: -155.589 flat angles C4'-P-C4' energy: -114.735 flat angles P-C4'-P energy: -62.857 tors. eta vs tors. theta energy: -43.759 Dist. restrs. and SS energy: 52.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 31 Temperature: 1.221429 Total energy: -717.117040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.117040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.378187 (E_RNA) where: Base-Base interactions energy: -284.191 where: short stacking energy: -246.559 Base-Backbone interact. energy: -2.490 local terms energy: -481.697289 where: bonds (distance) C4'-P energy: -142.897 bonds (distance) P-C4' energy: -125.223 flat angles C4'-P-C4' energy: -107.712 flat angles P-C4'-P energy: -75.833 tors. eta vs tors. theta energy: -30.032 Dist. restrs. and SS energy: 51.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.285714 Total energy: -665.257572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.257572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.363402 (E_RNA) where: Base-Base interactions energy: -322.785 where: short stacking energy: -245.405 Base-Backbone interact. energy: 3.346 local terms energy: -418.924888 where: bonds (distance) C4'-P energy: -95.944 bonds (distance) P-C4' energy: -125.946 flat angles C4'-P-C4' energy: -120.598 flat angles P-C4'-P energy: -73.732 tors. eta vs tors. theta energy: -2.704 Dist. restrs. and SS energy: 73.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -610.322676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.322676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.638984 (E_RNA) where: Base-Base interactions energy: -258.682 where: short stacking energy: -217.633 Base-Backbone interact. energy: 1.212 local terms energy: -417.169701 where: bonds (distance) C4'-P energy: -116.269 bonds (distance) P-C4' energy: -134.728 flat angles C4'-P-C4' energy: -92.748 flat angles P-C4'-P energy: -69.093 tors. eta vs tors. theta energy: -4.333 Dist. restrs. and SS energy: 64.316 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1219.494014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.494014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.678828 (E_RNA) where: Base-Base interactions energy: -569.607 where: short stacking energy: -516.098 Base-Backbone interact. energy: -2.068 local terms energy: -697.004014 where: bonds (distance) C4'-P energy: -140.832 bonds (distance) P-C4' energy: -162.894 flat angles C4'-P-C4' energy: -157.314 flat angles P-C4'-P energy: -115.333 tors. eta vs tors. theta energy: -120.631 Dist. restrs. and SS energy: 49.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 32 Temperature: 0.964286 Total energy: -1172.677100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.677100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.728616 (E_RNA) where: Base-Base interactions energy: -578.832 where: short stacking energy: -500.444 Base-Backbone interact. energy: 0.952 local terms energy: -642.849252 where: bonds (distance) C4'-P energy: -140.622 bonds (distance) P-C4' energy: -148.666 flat angles C4'-P-C4' energy: -153.811 flat angles P-C4'-P energy: -85.923 tors. eta vs tors. theta energy: -113.827 Dist. restrs. and SS energy: 48.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 32 Temperature: 1.028571 Total energy: -1000.780600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.780600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.990662 (E_RNA) where: Base-Base interactions energy: -465.146 where: short stacking energy: -406.949 Base-Backbone interact. energy: 4.678 local terms energy: -592.522495 where: bonds (distance) C4'-P energy: -151.119 bonds (distance) P-C4' energy: -141.291 flat angles C4'-P-C4' energy: -136.202 flat angles P-C4'-P energy: -80.154 tors. eta vs tors. theta energy: -83.756 Dist. restrs. and SS energy: 52.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 32 Temperature: 1.092857 Total energy: -930.329516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.329516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.516477 (E_RNA) where: Base-Base interactions energy: -441.265 where: short stacking energy: -352.004 Base-Backbone interact. energy: -0.415 local terms energy: -549.836337 where: bonds (distance) C4'-P energy: -110.519 bonds (distance) P-C4' energy: -148.770 flat angles C4'-P-C4' energy: -136.075 flat angles P-C4'-P energy: -81.444 tors. eta vs tors. theta energy: -73.028 Dist. restrs. and SS energy: 61.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.157143 Total energy: -808.403503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.403503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.612684 (E_RNA) where: Base-Base interactions energy: -372.052 where: short stacking energy: -296.640 Base-Backbone interact. energy: -0.184 local terms energy: -479.376576 where: bonds (distance) C4'-P energy: -128.300 bonds (distance) P-C4' energy: -139.090 flat angles C4'-P-C4' energy: -111.059 flat angles P-C4'-P energy: -54.524 tors. eta vs tors. theta energy: -46.403 Dist. restrs. and SS energy: 43.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 32 Temperature: 1.221429 Total energy: -713.241061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.241061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.958278 (E_RNA) where: Base-Base interactions energy: -296.804 where: short stacking energy: -244.710 Base-Backbone interact. energy: -2.324 local terms energy: -477.830635 where: bonds (distance) C4'-P energy: -107.004 bonds (distance) P-C4' energy: -159.721 flat angles C4'-P-C4' energy: -121.155 flat angles P-C4'-P energy: -73.650 tors. eta vs tors. theta energy: -16.301 Dist. restrs. and SS energy: 63.717 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.285714 Total energy: -634.153685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.153685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.589263 (E_RNA) where: Base-Base interactions energy: -253.228 where: short stacking energy: -195.597 Base-Backbone interact. energy: -1.175 local terms energy: -419.186015 where: bonds (distance) C4'-P energy: -110.433 bonds (distance) P-C4' energy: -124.110 flat angles C4'-P-C4' energy: -105.990 flat angles P-C4'-P energy: -79.361 tors. eta vs tors. theta energy: 0.708 Dist. restrs. and SS energy: 39.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -554.287261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.287261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.969842 (E_RNA) where: Base-Base interactions energy: -243.481 where: short stacking energy: -187.054 Base-Backbone interact. energy: 4.563 local terms energy: -386.051475 where: bonds (distance) C4'-P energy: -118.889 bonds (distance) P-C4' energy: -141.625 flat angles C4'-P-C4' energy: -89.989 flat angles P-C4'-P energy: -54.336 tors. eta vs tors. theta energy: 18.788 Dist. restrs. and SS energy: 70.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1207.106881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.106881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.139894 (E_RNA) where: Base-Base interactions energy: -580.611 where: short stacking energy: -517.169 Base-Backbone interact. energy: 0.338 local terms energy: -681.867221 where: bonds (distance) C4'-P energy: -144.240 bonds (distance) P-C4' energy: -160.634 flat angles C4'-P-C4' energy: -157.802 flat angles P-C4'-P energy: -98.572 tors. eta vs tors. theta energy: -120.619 Dist. restrs. and SS energy: 55.033 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 33 Temperature: 0.964286 Total energy: -1195.546898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.546898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1261.531032 (E_RNA) where: Base-Base interactions energy: -579.720 where: short stacking energy: -489.527 Base-Backbone interact. energy: -2.229 local terms energy: -679.582447 where: bonds (distance) C4'-P energy: -158.842 bonds (distance) P-C4' energy: -157.001 flat angles C4'-P-C4' energy: -161.054 flat angles P-C4'-P energy: -91.434 tors. eta vs tors. theta energy: -111.251 Dist. restrs. and SS energy: 65.984 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 33 Temperature: 1.028571 Total energy: -986.404805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.404805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.755886 (E_RNA) where: Base-Base interactions energy: -450.522 where: short stacking energy: -383.070 Base-Backbone interact. energy: 5.297 local terms energy: -593.531657 where: bonds (distance) C4'-P energy: -145.724 bonds (distance) P-C4' energy: -155.723 flat angles C4'-P-C4' energy: -128.462 flat angles P-C4'-P energy: -82.595 tors. eta vs tors. theta energy: -81.028 Dist. restrs. and SS energy: 52.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 33 Temperature: 1.092857 Total energy: -880.155485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.155485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.349215 (E_RNA) where: Base-Base interactions energy: -418.323 where: short stacking energy: -354.058 Base-Backbone interact. energy: -2.190 local terms energy: -518.836245 where: bonds (distance) C4'-P energy: -119.479 bonds (distance) P-C4' energy: -147.198 flat angles C4'-P-C4' energy: -116.110 flat angles P-C4'-P energy: -88.353 tors. eta vs tors. theta energy: -47.696 Dist. restrs. and SS energy: 59.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 33 Temperature: 1.157143 Total energy: -857.167465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.167465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.528538 (E_RNA) where: Base-Base interactions energy: -350.730 where: short stacking energy: -280.805 Base-Backbone interact. energy: -2.331 local terms energy: -548.467947 where: bonds (distance) C4'-P energy: -136.681 bonds (distance) P-C4' energy: -141.964 flat angles C4'-P-C4' energy: -135.693 flat angles P-C4'-P energy: -91.183 tors. eta vs tors. theta energy: -42.947 Dist. restrs. and SS energy: 44.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 33 Temperature: 1.221429 Total energy: -698.147200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.147200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.027925 (E_RNA) where: Base-Base interactions energy: -293.375 where: short stacking energy: -245.100 Base-Backbone interact. energy: -0.623 local terms energy: -467.029642 where: bonds (distance) C4'-P energy: -126.964 bonds (distance) P-C4' energy: -134.370 flat angles C4'-P-C4' energy: -117.592 flat angles P-C4'-P energy: -87.704 tors. eta vs tors. theta energy: -0.399 Dist. restrs. and SS energy: 62.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 33 Temperature: 1.285714 Total energy: -658.026567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.026567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.922156 (E_RNA) where: Base-Base interactions energy: -267.060 where: short stacking energy: -202.513 Base-Backbone interact. energy: -0.286 local terms energy: -447.575526 where: bonds (distance) C4'-P energy: -126.180 bonds (distance) P-C4' energy: -140.089 flat angles C4'-P-C4' energy: -116.682 flat angles P-C4'-P energy: -67.383 tors. eta vs tors. theta energy: 2.759 Dist. restrs. and SS energy: 56.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -516.699840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.699840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.705364 (E_RNA) where: Base-Base interactions energy: -205.955 where: short stacking energy: -143.654 Base-Backbone interact. energy: 2.692 local terms energy: -379.441962 where: bonds (distance) C4'-P energy: -121.078 bonds (distance) P-C4' energy: -116.382 flat angles C4'-P-C4' energy: -105.289 flat angles P-C4'-P energy: -53.488 tors. eta vs tors. theta energy: 16.796 Dist. restrs. and SS energy: 66.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1212.093592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.093592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.235941 (E_RNA) where: Base-Base interactions energy: -578.325 where: short stacking energy: -520.104 Base-Backbone interact. energy: -0.658 local terms energy: -686.253012 where: bonds (distance) C4'-P energy: -156.524 bonds (distance) P-C4' energy: -153.679 flat angles C4'-P-C4' energy: -159.770 flat angles P-C4'-P energy: -103.054 tors. eta vs tors. theta energy: -113.225 Dist. restrs. and SS energy: 53.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 34 Temperature: 0.964286 Total energy: -1179.356554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.356554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.848320 (E_RNA) where: Base-Base interactions energy: -573.046 where: short stacking energy: -472.079 Base-Backbone interact. energy: -0.909 local terms energy: -660.893938 where: bonds (distance) C4'-P energy: -132.274 bonds (distance) P-C4' energy: -156.843 flat angles C4'-P-C4' energy: -165.436 flat angles P-C4'-P energy: -97.293 tors. eta vs tors. theta energy: -109.049 Dist. restrs. and SS energy: 55.492 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 34 Temperature: 1.028571 Total energy: -1060.945669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.945669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.094466 (E_RNA) where: Base-Base interactions energy: -523.033 where: short stacking energy: -445.622 Base-Backbone interact. energy: 8.479 local terms energy: -591.540500 where: bonds (distance) C4'-P energy: -145.978 bonds (distance) P-C4' energy: -140.818 flat angles C4'-P-C4' energy: -128.371 flat angles P-C4'-P energy: -94.990 tors. eta vs tors. theta energy: -81.383 Dist. restrs. and SS energy: 45.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 34 Temperature: 1.092857 Total energy: -868.309000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.309000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.650576 (E_RNA) where: Base-Base interactions energy: -400.017 where: short stacking energy: -324.353 Base-Backbone interact. energy: -4.148 local terms energy: -519.485986 where: bonds (distance) C4'-P energy: -125.212 bonds (distance) P-C4' energy: -137.394 flat angles C4'-P-C4' energy: -125.870 flat angles P-C4'-P energy: -83.914 tors. eta vs tors. theta energy: -47.096 Dist. restrs. and SS energy: 55.342 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 34 Temperature: 1.157143 Total energy: -838.879381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.879381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.898851 (E_RNA) where: Base-Base interactions energy: -399.347 where: short stacking energy: -304.944 Base-Backbone interact. energy: -0.051 local terms energy: -481.500635 where: bonds (distance) C4'-P energy: -112.802 bonds (distance) P-C4' energy: -138.890 flat angles C4'-P-C4' energy: -127.650 flat angles P-C4'-P energy: -75.024 tors. eta vs tors. theta energy: -27.135 Dist. restrs. and SS energy: 42.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.221429 Total energy: -706.259606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.259606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.963344 (E_RNA) where: Base-Base interactions energy: -280.362 where: short stacking energy: -225.230 Base-Backbone interact. energy: -1.101 local terms energy: -476.500172 where: bonds (distance) C4'-P energy: -126.985 bonds (distance) P-C4' energy: -140.561 flat angles C4'-P-C4' energy: -128.179 flat angles P-C4'-P energy: -71.405 tors. eta vs tors. theta energy: -9.371 Dist. restrs. and SS energy: 51.704 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 34 Temperature: 1.285714 Total energy: -674.300649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.300649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.589022 (E_RNA) where: Base-Base interactions energy: -319.976 where: short stacking energy: -242.898 Base-Backbone interact. energy: -1.121 local terms energy: -405.492472 where: bonds (distance) C4'-P energy: -118.406 bonds (distance) P-C4' energy: -124.474 flat angles C4'-P-C4' energy: -102.830 flat angles P-C4'-P energy: -45.713 tors. eta vs tors. theta energy: -14.070 Dist. restrs. and SS energy: 52.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -520.315067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.315067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.360217 (E_RNA) where: Base-Base interactions energy: -202.483 where: short stacking energy: -152.880 Base-Backbone interact. energy: -1.319 local terms energy: -372.558591 where: bonds (distance) C4'-P energy: -130.053 bonds (distance) P-C4' energy: -129.433 flat angles C4'-P-C4' energy: -75.552 flat angles P-C4'-P energy: -56.861 tors. eta vs tors. theta energy: 19.340 Dist. restrs. and SS energy: 56.045 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1212.310282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.310282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.118582 (E_RNA) where: Base-Base interactions energy: -589.841 where: short stacking energy: -527.890 Base-Backbone interact. energy: 1.123 local terms energy: -686.401143 where: bonds (distance) C4'-P energy: -154.115 bonds (distance) P-C4' energy: -159.225 flat angles C4'-P-C4' energy: -154.467 flat angles P-C4'-P energy: -105.191 tors. eta vs tors. theta energy: -113.404 Dist. restrs. and SS energy: 62.808 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 35 Temperature: 0.964286 Total energy: -1165.921527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.921527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.223915 (E_RNA) where: Base-Base interactions energy: -566.206 where: short stacking energy: -466.948 Base-Backbone interact. energy: 0.059 local terms energy: -654.076638 where: bonds (distance) C4'-P energy: -134.173 bonds (distance) P-C4' energy: -160.393 flat angles C4'-P-C4' energy: -149.777 flat angles P-C4'-P energy: -89.942 tors. eta vs tors. theta energy: -119.792 Dist. restrs. and SS energy: 54.302 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.028571 Total energy: -1019.004625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.004625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.709432 (E_RNA) where: Base-Base interactions energy: -478.937 where: short stacking energy: -409.098 Base-Backbone interact. energy: 6.278 local terms energy: -588.050175 where: bonds (distance) C4'-P energy: -137.668 bonds (distance) P-C4' energy: -138.652 flat angles C4'-P-C4' energy: -143.644 flat angles P-C4'-P energy: -81.767 tors. eta vs tors. theta energy: -86.318 Dist. restrs. and SS energy: 41.705 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 35 Temperature: 1.092857 Total energy: -929.981621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.981621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.911556 (E_RNA) where: Base-Base interactions energy: -452.260 where: short stacking energy: -348.423 Base-Backbone interact. energy: -3.686 local terms energy: -528.965849 where: bonds (distance) C4'-P energy: -137.228 bonds (distance) P-C4' energy: -144.387 flat angles C4'-P-C4' energy: -137.676 flat angles P-C4'-P energy: -66.708 tors. eta vs tors. theta energy: -42.966 Dist. restrs. and SS energy: 54.930 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 35 Temperature: 1.157143 Total energy: -796.963272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.963272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.136218 (E_RNA) where: Base-Base interactions energy: -381.922 where: short stacking energy: -295.854 Base-Backbone interact. energy: -1.407 local terms energy: -465.806784 where: bonds (distance) C4'-P energy: -135.074 bonds (distance) P-C4' energy: -137.116 flat angles C4'-P-C4' energy: -113.815 flat angles P-C4'-P energy: -69.311 tors. eta vs tors. theta energy: -10.490 Dist. restrs. and SS energy: 52.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.221429 Total energy: -715.427559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.427559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.916898 (E_RNA) where: Base-Base interactions energy: -318.894 where: short stacking energy: -270.552 Base-Backbone interact. energy: 1.119 local terms energy: -463.141858 where: bonds (distance) C4'-P energy: -111.787 bonds (distance) P-C4' energy: -128.627 flat angles C4'-P-C4' energy: -126.073 flat angles P-C4'-P energy: -69.289 tors. eta vs tors. theta energy: -27.366 Dist. restrs. and SS energy: 65.489 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.285714 Total energy: -659.765872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.765872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.755782 (E_RNA) where: Base-Base interactions energy: -292.401 where: short stacking energy: -225.349 Base-Backbone interact. energy: 3.087 local terms energy: -428.442248 where: bonds (distance) C4'-P energy: -112.910 bonds (distance) P-C4' energy: -135.080 flat angles C4'-P-C4' energy: -129.140 flat angles P-C4'-P energy: -63.867 tors. eta vs tors. theta energy: 12.554 Dist. restrs. and SS energy: 57.990 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -565.411494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.411494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.642907 (E_RNA) where: Base-Base interactions energy: -207.076 where: short stacking energy: -156.129 Base-Backbone interact. energy: -1.681 local terms energy: -412.886522 where: bonds (distance) C4'-P energy: -146.126 bonds (distance) P-C4' energy: -116.128 flat angles C4'-P-C4' energy: -112.736 flat angles P-C4'-P energy: -58.220 tors. eta vs tors. theta energy: 20.324 Dist. restrs. and SS energy: 56.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1253.059399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.059399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.774090 (E_RNA) where: Base-Base interactions energy: -604.037 where: short stacking energy: -531.912 Base-Backbone interact. energy: -3.119 local terms energy: -691.618786 where: bonds (distance) C4'-P energy: -144.329 bonds (distance) P-C4' energy: -161.533 flat angles C4'-P-C4' energy: -159.280 flat angles P-C4'-P energy: -105.950 tors. eta vs tors. theta energy: -120.528 Dist. restrs. and SS energy: 45.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 36 Temperature: 0.964286 Total energy: -1193.899715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.899715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.677202 (E_RNA) where: Base-Base interactions energy: -592.198 where: short stacking energy: -498.545 Base-Backbone interact. energy: 4.970 local terms energy: -662.449444 where: bonds (distance) C4'-P energy: -137.955 bonds (distance) P-C4' energy: -159.708 flat angles C4'-P-C4' energy: -146.213 flat angles P-C4'-P energy: -101.024 tors. eta vs tors. theta energy: -117.549 Dist. restrs. and SS energy: 55.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.028571 Total energy: -1051.800215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.800215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.111553 (E_RNA) where: Base-Base interactions energy: -512.282 where: short stacking energy: -438.191 Base-Backbone interact. energy: -1.491 local terms energy: -589.337745 where: bonds (distance) C4'-P energy: -141.166 bonds (distance) P-C4' energy: -130.043 flat angles C4'-P-C4' energy: -130.019 flat angles P-C4'-P energy: -92.621 tors. eta vs tors. theta energy: -95.489 Dist. restrs. and SS energy: 51.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.092857 Total energy: -970.847478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.847478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.440779 (E_RNA) where: Base-Base interactions energy: -472.264 where: short stacking energy: -384.426 Base-Backbone interact. energy: 10.511 local terms energy: -557.687505 where: bonds (distance) C4'-P energy: -138.481 bonds (distance) P-C4' energy: -134.659 flat angles C4'-P-C4' energy: -133.492 flat angles P-C4'-P energy: -76.495 tors. eta vs tors. theta energy: -74.561 Dist. restrs. and SS energy: 48.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.157143 Total energy: -847.381996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.381996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.233007 (E_RNA) where: Base-Base interactions energy: -416.883 where: short stacking energy: -320.026 Base-Backbone interact. energy: -2.120 local terms energy: -471.230308 where: bonds (distance) C4'-P energy: -125.136 bonds (distance) P-C4' energy: -119.699 flat angles C4'-P-C4' energy: -117.933 flat angles P-C4'-P energy: -64.497 tors. eta vs tors. theta energy: -43.966 Dist. restrs. and SS energy: 42.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.221429 Total energy: -709.299557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.299557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.719867 (E_RNA) where: Base-Base interactions energy: -329.220 where: short stacking energy: -253.699 Base-Backbone interact. energy: 1.285 local terms energy: -456.785623 where: bonds (distance) C4'-P energy: -129.337 bonds (distance) P-C4' energy: -130.648 flat angles C4'-P-C4' energy: -114.515 flat angles P-C4'-P energy: -64.007 tors. eta vs tors. theta energy: -18.280 Dist. restrs. and SS energy: 75.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.285714 Total energy: -630.109891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.109891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.945048 (E_RNA) where: Base-Base interactions energy: -294.086 where: short stacking energy: -204.675 Base-Backbone interact. energy: -0.039 local terms energy: -387.820595 where: bonds (distance) C4'-P energy: -116.938 bonds (distance) P-C4' energy: -112.628 flat angles C4'-P-C4' energy: -116.021 flat angles P-C4'-P energy: -48.268 tors. eta vs tors. theta energy: 6.036 Dist. restrs. and SS energy: 51.835 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -579.952885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.952885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.037670 (E_RNA) where: Base-Base interactions energy: -253.771 where: short stacking energy: -185.817 Base-Backbone interact. energy: -0.016 local terms energy: -378.250944 where: bonds (distance) C4'-P energy: -95.209 bonds (distance) P-C4' energy: -129.927 flat angles C4'-P-C4' energy: -100.571 flat angles P-C4'-P energy: -68.450 tors. eta vs tors. theta energy: 15.906 Dist. restrs. and SS energy: 52.085 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1273.144535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.144535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.420685 (E_RNA) where: Base-Base interactions energy: -632.994 where: short stacking energy: -564.710 Base-Backbone interact. energy: -0.107 local terms energy: -687.320159 where: bonds (distance) C4'-P energy: -147.525 bonds (distance) P-C4' energy: -166.315 flat angles C4'-P-C4' energy: -155.325 flat angles P-C4'-P energy: -85.982 tors. eta vs tors. theta energy: -132.173 Dist. restrs. and SS energy: 47.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 37 Temperature: 0.964286 Total energy: -1134.849319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.849319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.505914 (E_RNA) where: Base-Base interactions energy: -538.956 where: short stacking energy: -442.955 Base-Backbone interact. energy: 0.014 local terms energy: -649.564635 where: bonds (distance) C4'-P energy: -135.655 bonds (distance) P-C4' energy: -144.861 flat angles C4'-P-C4' energy: -169.955 flat angles P-C4'-P energy: -90.000 tors. eta vs tors. theta energy: -109.093 Dist. restrs. and SS energy: 53.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 37 Temperature: 1.028571 Total energy: -1016.533129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.533129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.036348 (E_RNA) where: Base-Base interactions energy: -498.576 where: short stacking energy: -406.493 Base-Backbone interact. energy: -0.533 local terms energy: -573.927544 where: bonds (distance) C4'-P energy: -140.493 bonds (distance) P-C4' energy: -152.841 flat angles C4'-P-C4' energy: -127.324 flat angles P-C4'-P energy: -83.142 tors. eta vs tors. theta energy: -70.127 Dist. restrs. and SS energy: 56.503 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.092857 Total energy: -971.151440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.151440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.235347 (E_RNA) where: Base-Base interactions energy: -464.670 where: short stacking energy: -367.336 Base-Backbone interact. energy: 9.199 local terms energy: -562.763862 where: bonds (distance) C4'-P energy: -136.881 bonds (distance) P-C4' energy: -142.069 flat angles C4'-P-C4' energy: -123.202 flat angles P-C4'-P energy: -70.864 tors. eta vs tors. theta energy: -89.747 Dist. restrs. and SS energy: 47.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 37 Temperature: 1.157143 Total energy: -874.389856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.389856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.837082 (E_RNA) where: Base-Base interactions energy: -431.321 where: short stacking energy: -277.476 Base-Backbone interact. energy: -0.861 local terms energy: -504.654921 where: bonds (distance) C4'-P energy: -135.247 bonds (distance) P-C4' energy: -143.529 flat angles C4'-P-C4' energy: -119.978 flat angles P-C4'-P energy: -67.877 tors. eta vs tors. theta energy: -38.024 Dist. restrs. and SS energy: 62.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 37 Temperature: 1.221429 Total energy: -658.760879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.760879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.923553 (E_RNA) where: Base-Base interactions energy: -276.858 where: short stacking energy: -207.903 Base-Backbone interact. energy: 0.341 local terms energy: -444.406330 where: bonds (distance) C4'-P energy: -135.195 bonds (distance) P-C4' energy: -144.011 flat angles C4'-P-C4' energy: -109.273 flat angles P-C4'-P energy: -61.728 tors. eta vs tors. theta energy: 5.801 Dist. restrs. and SS energy: 62.163 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 37 Temperature: 1.285714 Total energy: -599.862508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.862508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.383460 (E_RNA) where: Base-Base interactions energy: -249.407 where: short stacking energy: -180.691 Base-Backbone interact. energy: -2.518 local terms energy: -403.458065 where: bonds (distance) C4'-P energy: -112.655 bonds (distance) P-C4' energy: -131.117 flat angles C4'-P-C4' energy: -102.207 flat angles P-C4'-P energy: -72.993 tors. eta vs tors. theta energy: 15.514 Dist. restrs. and SS energy: 55.521 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -583.903604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.903604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.889043 (E_RNA) where: Base-Base interactions energy: -267.726 where: short stacking energy: -194.343 Base-Backbone interact. energy: 3.400 local terms energy: -384.562992 where: bonds (distance) C4'-P energy: -114.292 bonds (distance) P-C4' energy: -125.900 flat angles C4'-P-C4' energy: -92.436 flat angles P-C4'-P energy: -75.993 tors. eta vs tors. theta energy: 24.059 Dist. restrs. and SS energy: 64.985 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1222.301748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.301748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.264134 (E_RNA) where: Base-Base interactions energy: -592.286 where: short stacking energy: -524.537 Base-Backbone interact. energy: -1.124 local terms energy: -669.854673 where: bonds (distance) C4'-P energy: -142.192 bonds (distance) P-C4' energy: -154.188 flat angles C4'-P-C4' energy: -166.683 flat angles P-C4'-P energy: -83.147 tors. eta vs tors. theta energy: -123.645 Dist. restrs. and SS energy: 40.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 38 Temperature: 0.964286 Total energy: -1159.415059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.415059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.072175 (E_RNA) where: Base-Base interactions energy: -574.466 where: short stacking energy: -452.074 Base-Backbone interact. energy: -0.775 local terms energy: -644.832045 where: bonds (distance) C4'-P energy: -144.386 bonds (distance) P-C4' energy: -147.859 flat angles C4'-P-C4' energy: -142.815 flat angles P-C4'-P energy: -100.383 tors. eta vs tors. theta energy: -109.389 Dist. restrs. and SS energy: 60.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 38 Temperature: 1.028571 Total energy: -1088.172519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.172519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.432410 (E_RNA) where: Base-Base interactions energy: -545.629 where: short stacking energy: -459.228 Base-Backbone interact. energy: 5.183 local terms energy: -599.985972 where: bonds (distance) C4'-P energy: -131.794 bonds (distance) P-C4' energy: -145.635 flat angles C4'-P-C4' energy: -133.165 flat angles P-C4'-P energy: -84.781 tors. eta vs tors. theta energy: -104.610 Dist. restrs. and SS energy: 52.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 38 Temperature: 1.092857 Total energy: -941.686747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.686747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.198037 (E_RNA) where: Base-Base interactions energy: -435.919 where: short stacking energy: -370.148 Base-Backbone interact. energy: -2.379 local terms energy: -561.899824 where: bonds (distance) C4'-P energy: -126.411 bonds (distance) P-C4' energy: -141.801 flat angles C4'-P-C4' energy: -147.487 flat angles P-C4'-P energy: -88.344 tors. eta vs tors. theta energy: -57.856 Dist. restrs. and SS energy: 58.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 38 Temperature: 1.157143 Total energy: -976.752910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.752910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.020538 (E_RNA) where: Base-Base interactions energy: -495.276 where: short stacking energy: -360.652 Base-Backbone interact. energy: -1.523 local terms energy: -536.221428 where: bonds (distance) C4'-P energy: -129.056 bonds (distance) P-C4' energy: -148.643 flat angles C4'-P-C4' energy: -132.049 flat angles P-C4'-P energy: -69.791 tors. eta vs tors. theta energy: -56.683 Dist. restrs. and SS energy: 56.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 38 Temperature: 1.221429 Total energy: -727.175126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.175126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.267700 (E_RNA) where: Base-Base interactions energy: -329.516 where: short stacking energy: -255.081 Base-Backbone interact. energy: 6.299 local terms energy: -464.050130 where: bonds (distance) C4'-P energy: -119.061 bonds (distance) P-C4' energy: -143.498 flat angles C4'-P-C4' energy: -119.575 flat angles P-C4'-P energy: -66.926 tors. eta vs tors. theta energy: -14.990 Dist. restrs. and SS energy: 60.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.285714 Total energy: -632.997948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.997948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.852459 (E_RNA) where: Base-Base interactions energy: -307.009 where: short stacking energy: -235.731 Base-Backbone interact. energy: 1.178 local terms energy: -395.021245 where: bonds (distance) C4'-P energy: -100.059 bonds (distance) P-C4' energy: -112.657 flat angles C4'-P-C4' energy: -109.687 flat angles P-C4'-P energy: -70.324 tors. eta vs tors. theta energy: -2.294 Dist. restrs. and SS energy: 67.855 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -557.461034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.461034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.660566 (E_RNA) where: Base-Base interactions energy: -240.748 where: short stacking energy: -170.708 Base-Backbone interact. energy: 3.184 local terms energy: -379.096818 where: bonds (distance) C4'-P energy: -117.787 bonds (distance) P-C4' energy: -118.066 flat angles C4'-P-C4' energy: -94.000 flat angles P-C4'-P energy: -61.852 tors. eta vs tors. theta energy: 12.609 Dist. restrs. and SS energy: 59.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1250.037591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.037591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.828150 (E_RNA) where: Base-Base interactions energy: -604.028 where: short stacking energy: -527.494 Base-Backbone interact. energy: -1.965 local terms energy: -689.834786 where: bonds (distance) C4'-P energy: -157.490 bonds (distance) P-C4' energy: -162.264 flat angles C4'-P-C4' energy: -154.917 flat angles P-C4'-P energy: -90.094 tors. eta vs tors. theta energy: -125.071 Dist. restrs. and SS energy: 45.791 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.964286 Total energy: -1135.046826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.046826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.710821 (E_RNA) where: Base-Base interactions energy: -552.697 where: short stacking energy: -438.109 Base-Backbone interact. energy: -1.207 local terms energy: -641.806748 where: bonds (distance) C4'-P energy: -142.444 bonds (distance) P-C4' energy: -152.981 flat angles C4'-P-C4' energy: -156.210 flat angles P-C4'-P energy: -95.805 tors. eta vs tors. theta energy: -94.367 Dist. restrs. and SS energy: 60.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.028571 Total energy: -1008.016575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.016575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.283501 (E_RNA) where: Base-Base interactions energy: -475.264 where: short stacking energy: -358.144 Base-Backbone interact. energy: 4.766 local terms energy: -581.785541 where: bonds (distance) C4'-P energy: -140.410 bonds (distance) P-C4' energy: -150.802 flat angles C4'-P-C4' energy: -150.327 flat angles P-C4'-P energy: -71.466 tors. eta vs tors. theta energy: -68.780 Dist. restrs. and SS energy: 44.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 39 Temperature: 1.092857 Total energy: -951.948105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.948105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.371964 (E_RNA) where: Base-Base interactions energy: -454.440 where: short stacking energy: -363.167 Base-Backbone interact. energy: -0.585 local terms energy: -552.346977 where: bonds (distance) C4'-P energy: -132.521 bonds (distance) P-C4' energy: -151.098 flat angles C4'-P-C4' energy: -144.668 flat angles P-C4'-P energy: -63.740 tors. eta vs tors. theta energy: -60.320 Dist. restrs. and SS energy: 55.424 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.157143 Total energy: -891.329238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.329238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.463566 (E_RNA) where: Base-Base interactions energy: -439.911 where: short stacking energy: -295.851 Base-Backbone interact. energy: -3.106 local terms energy: -504.446267 where: bonds (distance) C4'-P energy: -131.340 bonds (distance) P-C4' energy: -143.060 flat angles C4'-P-C4' energy: -134.141 flat angles P-C4'-P energy: -57.336 tors. eta vs tors. theta energy: -38.569 Dist. restrs. and SS energy: 56.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 39 Temperature: 1.221429 Total energy: -735.012098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.012098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.514583 (E_RNA) where: Base-Base interactions energy: -340.184 where: short stacking energy: -261.200 Base-Backbone interact. energy: 0.729 local terms energy: -461.059162 where: bonds (distance) C4'-P energy: -110.359 bonds (distance) P-C4' energy: -133.795 flat angles C4'-P-C4' energy: -113.294 flat angles P-C4'-P energy: -78.438 tors. eta vs tors. theta energy: -25.173 Dist. restrs. and SS energy: 65.502 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.285714 Total energy: -670.521408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.521408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.544730 (E_RNA) where: Base-Base interactions energy: -310.843 where: short stacking energy: -229.596 Base-Backbone interact. energy: -1.412 local terms energy: -420.289859 where: bonds (distance) C4'-P energy: -130.920 bonds (distance) P-C4' energy: -126.612 flat angles C4'-P-C4' energy: -98.679 flat angles P-C4'-P energy: -57.470 tors. eta vs tors. theta energy: -6.609 Dist. restrs. and SS energy: 62.023 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -542.821942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.821942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.348018 (E_RNA) where: Base-Base interactions energy: -254.437 where: short stacking energy: -194.654 Base-Backbone interact. energy: 6.876 local terms energy: -352.786986 where: bonds (distance) C4'-P energy: -112.096 bonds (distance) P-C4' energy: -106.629 flat angles C4'-P-C4' energy: -114.759 flat angles P-C4'-P energy: -55.248 tors. eta vs tors. theta energy: 35.946 Dist. restrs. and SS energy: 57.526 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1235.499080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.499080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.076683 (E_RNA) where: Base-Base interactions energy: -611.892 where: short stacking energy: -536.179 Base-Backbone interact. energy: -0.213 local terms energy: -669.971161 where: bonds (distance) C4'-P energy: -147.801 bonds (distance) P-C4' energy: -141.123 flat angles C4'-P-C4' energy: -153.174 flat angles P-C4'-P energy: -107.072 tors. eta vs tors. theta energy: -120.801 Dist. restrs. and SS energy: 46.578 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.964286 Total energy: -1198.890070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.890070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.637250 (E_RNA) where: Base-Base interactions energy: -596.053 where: short stacking energy: -472.415 Base-Backbone interact. energy: 1.133 local terms energy: -650.717306 where: bonds (distance) C4'-P energy: -143.467 bonds (distance) P-C4' energy: -147.634 flat angles C4'-P-C4' energy: -163.191 flat angles P-C4'-P energy: -92.369 tors. eta vs tors. theta energy: -104.056 Dist. restrs. and SS energy: 46.747 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 40 Temperature: 1.028571 Total energy: -1057.185132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.185132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.665619 (E_RNA) where: Base-Base interactions energy: -512.173 where: short stacking energy: -423.331 Base-Backbone interact. energy: 9.353 local terms energy: -605.846254 where: bonds (distance) C4'-P energy: -135.172 bonds (distance) P-C4' energy: -144.913 flat angles C4'-P-C4' energy: -150.674 flat angles P-C4'-P energy: -89.870 tors. eta vs tors. theta energy: -85.218 Dist. restrs. and SS energy: 51.480 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 40 Temperature: 1.092857 Total energy: -927.100098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.100098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.353102 (E_RNA) where: Base-Base interactions energy: -476.826 where: short stacking energy: -402.378 Base-Backbone interact. energy: -0.931 local terms energy: -510.596500 where: bonds (distance) C4'-P energy: -129.622 bonds (distance) P-C4' energy: -117.050 flat angles C4'-P-C4' energy: -126.082 flat angles P-C4'-P energy: -67.985 tors. eta vs tors. theta energy: -69.857 Dist. restrs. and SS energy: 61.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.157143 Total energy: -922.505999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.505999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.641271 (E_RNA) where: Base-Base interactions energy: -461.209 where: short stacking energy: -309.122 Base-Backbone interact. energy: -0.324 local terms energy: -520.108956 where: bonds (distance) C4'-P energy: -127.317 bonds (distance) P-C4' energy: -137.056 flat angles C4'-P-C4' energy: -120.828 flat angles P-C4'-P energy: -86.012 tors. eta vs tors. theta energy: -48.896 Dist. restrs. and SS energy: 59.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 40 Temperature: 1.221429 Total energy: -690.207194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.207194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.532278 (E_RNA) where: Base-Base interactions energy: -318.272 where: short stacking energy: -226.537 Base-Backbone interact. energy: 0.141 local terms energy: -441.401101 where: bonds (distance) C4'-P energy: -125.025 bonds (distance) P-C4' energy: -135.441 flat angles C4'-P-C4' energy: -116.310 flat angles P-C4'-P energy: -66.957 tors. eta vs tors. theta energy: 2.332 Dist. restrs. and SS energy: 69.325 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.285714 Total energy: -633.547969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.547969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.918521 (E_RNA) where: Base-Base interactions energy: -291.548 where: short stacking energy: -212.158 Base-Backbone interact. energy: 4.683 local terms energy: -402.053192 where: bonds (distance) C4'-P energy: -112.491 bonds (distance) P-C4' energy: -129.644 flat angles C4'-P-C4' energy: -105.338 flat angles P-C4'-P energy: -67.110 tors. eta vs tors. theta energy: 12.530 Dist. restrs. and SS energy: 55.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -567.573646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.573646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.343753 (E_RNA) where: Base-Base interactions energy: -266.933 where: short stacking energy: -188.833 Base-Backbone interact. energy: 1.729 local terms energy: -373.138966 where: bonds (distance) C4'-P energy: -116.267 bonds (distance) P-C4' energy: -100.786 flat angles C4'-P-C4' energy: -95.929 flat angles P-C4'-P energy: -73.694 tors. eta vs tors. theta energy: 13.536 Dist. restrs. and SS energy: 70.770 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1251.538463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.538463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.752231 (E_RNA) where: Base-Base interactions energy: -576.477 where: short stacking energy: -499.020 Base-Backbone interact. energy: -1.122 local terms energy: -716.153124 where: bonds (distance) C4'-P energy: -147.988 bonds (distance) P-C4' energy: -170.375 flat angles C4'-P-C4' energy: -167.956 flat angles P-C4'-P energy: -98.010 tors. eta vs tors. theta energy: -131.825 Dist. restrs. and SS energy: 42.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 41 Temperature: 0.964286 Total energy: -1237.299010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.299010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.152724 (E_RNA) where: Base-Base interactions energy: -600.205 where: short stacking energy: -478.310 Base-Backbone interact. energy: -1.177 local terms energy: -682.771127 where: bonds (distance) C4'-P energy: -152.215 bonds (distance) P-C4' energy: -151.379 flat angles C4'-P-C4' energy: -151.695 flat angles P-C4'-P energy: -115.282 tors. eta vs tors. theta energy: -112.200 Dist. restrs. and SS energy: 46.854 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 41 Temperature: 1.028571 Total energy: -1077.087858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.087858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.303431 (E_RNA) where: Base-Base interactions energy: -550.547 where: short stacking energy: -448.212 Base-Backbone interact. energy: 0.646 local terms energy: -574.402931 where: bonds (distance) C4'-P energy: -123.199 bonds (distance) P-C4' energy: -139.942 flat angles C4'-P-C4' energy: -135.223 flat angles P-C4'-P energy: -88.214 tors. eta vs tors. theta energy: -87.825 Dist. restrs. and SS energy: 47.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 41 Temperature: 1.092857 Total energy: -1012.918725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.918725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.452406 (E_RNA) where: Base-Base interactions energy: -525.458 where: short stacking energy: -366.829 Base-Backbone interact. energy: 0.638 local terms energy: -538.632744 where: bonds (distance) C4'-P energy: -135.346 bonds (distance) P-C4' energy: -132.154 flat angles C4'-P-C4' energy: -148.753 flat angles P-C4'-P energy: -58.184 tors. eta vs tors. theta energy: -64.196 Dist. restrs. and SS energy: 50.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 41 Temperature: 1.157143 Total energy: -851.295979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.295979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.147531 (E_RNA) where: Base-Base interactions energy: -402.203 where: short stacking energy: -333.796 Base-Backbone interact. energy: -2.722 local terms energy: -510.222175 where: bonds (distance) C4'-P energy: -122.859 bonds (distance) P-C4' energy: -139.477 flat angles C4'-P-C4' energy: -125.663 flat angles P-C4'-P energy: -79.328 tors. eta vs tors. theta energy: -42.895 Dist. restrs. and SS energy: 63.852 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 41 Temperature: 1.221429 Total energy: -731.805273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.805273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.211351 (E_RNA) where: Base-Base interactions energy: -346.990 where: short stacking energy: -271.771 Base-Backbone interact. energy: 2.095 local terms energy: -463.316280 where: bonds (distance) C4'-P energy: -131.495 bonds (distance) P-C4' energy: -132.503 flat angles C4'-P-C4' energy: -119.952 flat angles P-C4'-P energy: -56.347 tors. eta vs tors. theta energy: -23.020 Dist. restrs. and SS energy: 76.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.285714 Total energy: -615.298083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.298083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.043458 (E_RNA) where: Base-Base interactions energy: -247.309 where: short stacking energy: -208.514 Base-Backbone interact. energy: 2.270 local terms energy: -421.004990 where: bonds (distance) C4'-P energy: -105.361 bonds (distance) P-C4' energy: -141.413 flat angles C4'-P-C4' energy: -98.722 flat angles P-C4'-P energy: -62.545 tors. eta vs tors. theta energy: -12.965 Dist. restrs. and SS energy: 50.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -583.088208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.088208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.786707 (E_RNA) where: Base-Base interactions energy: -260.015 where: short stacking energy: -202.239 Base-Backbone interact. energy: -1.148 local terms energy: -381.624011 where: bonds (distance) C4'-P energy: -113.998 bonds (distance) P-C4' energy: -128.917 flat angles C4'-P-C4' energy: -87.827 flat angles P-C4'-P energy: -60.592 tors. eta vs tors. theta energy: 9.711 Dist. restrs. and SS energy: 59.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1284.318366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.318366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.791763 (E_RNA) where: Base-Base interactions energy: -611.871 where: short stacking energy: -536.397 Base-Backbone interact. energy: -2.276 local terms energy: -715.644633 where: bonds (distance) C4'-P energy: -157.563 bonds (distance) P-C4' energy: -169.422 flat angles C4'-P-C4' energy: -154.422 flat angles P-C4'-P energy: -105.762 tors. eta vs tors. theta energy: -128.474 Dist. restrs. and SS energy: 45.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 42 Temperature: 0.964286 Total energy: -1224.176517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.176517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.415777 (E_RNA) where: Base-Base interactions energy: -614.454 where: short stacking energy: -494.649 Base-Backbone interact. energy: -1.535 local terms energy: -662.426063 where: bonds (distance) C4'-P energy: -158.186 bonds (distance) P-C4' energy: -157.850 flat angles C4'-P-C4' energy: -149.393 flat angles P-C4'-P energy: -85.046 tors. eta vs tors. theta energy: -111.952 Dist. restrs. and SS energy: 54.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.028571 Total energy: -1106.605753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.605753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.033322 (E_RNA) where: Base-Base interactions energy: -594.623 where: short stacking energy: -396.566 Base-Backbone interact. energy: -0.184 local terms energy: -559.226271 where: bonds (distance) C4'-P energy: -132.269 bonds (distance) P-C4' energy: -145.511 flat angles C4'-P-C4' energy: -132.932 flat angles P-C4'-P energy: -78.331 tors. eta vs tors. theta energy: -70.184 Dist. restrs. and SS energy: 47.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.092857 Total energy: -996.891364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.891364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.651790 (E_RNA) where: Base-Base interactions energy: -477.513 where: short stacking energy: -388.894 Base-Backbone interact. energy: 0.265 local terms energy: -568.403569 where: bonds (distance) C4'-P energy: -139.904 bonds (distance) P-C4' energy: -139.127 flat angles C4'-P-C4' energy: -137.229 flat angles P-C4'-P energy: -74.158 tors. eta vs tors. theta energy: -77.986 Dist. restrs. and SS energy: 48.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 42 Temperature: 1.157143 Total energy: -891.730847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.730847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.125402 (E_RNA) where: Base-Base interactions energy: -438.625 where: short stacking energy: -366.388 Base-Backbone interact. energy: 0.912 local terms energy: -515.412945 where: bonds (distance) C4'-P energy: -106.263 bonds (distance) P-C4' energy: -137.806 flat angles C4'-P-C4' energy: -126.807 flat angles P-C4'-P energy: -73.637 tors. eta vs tors. theta energy: -70.899 Dist. restrs. and SS energy: 61.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 42 Temperature: 1.221429 Total energy: -690.850160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.850160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.824026 (E_RNA) where: Base-Base interactions energy: -293.313 where: short stacking energy: -246.206 Base-Backbone interact. energy: 6.341 local terms energy: -459.851827 where: bonds (distance) C4'-P energy: -126.151 bonds (distance) P-C4' energy: -137.321 flat angles C4'-P-C4' energy: -118.412 flat angles P-C4'-P energy: -71.881 tors. eta vs tors. theta energy: -6.087 Dist. restrs. and SS energy: 55.974 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 42 Temperature: 1.285714 Total energy: -607.398257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.398257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.535841 (E_RNA) where: Base-Base interactions energy: -232.099 where: short stacking energy: -190.199 Base-Backbone interact. energy: 1.569 local terms energy: -437.005767 where: bonds (distance) C4'-P energy: -125.837 bonds (distance) P-C4' energy: -148.872 flat angles C4'-P-C4' energy: -103.278 flat angles P-C4'-P energy: -60.587 tors. eta vs tors. theta energy: 1.567 Dist. restrs. and SS energy: 60.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -568.872146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.872146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.553454 (E_RNA) where: Base-Base interactions energy: -234.079 where: short stacking energy: -179.307 Base-Backbone interact. energy: -0.223 local terms energy: -395.250949 where: bonds (distance) C4'-P energy: -111.413 bonds (distance) P-C4' energy: -127.047 flat angles C4'-P-C4' energy: -107.290 flat angles P-C4'-P energy: -67.212 tors. eta vs tors. theta energy: 17.711 Dist. restrs. and SS energy: 60.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1296.241604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.241604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.877145 (E_RNA) where: Base-Base interactions energy: -643.227 where: short stacking energy: -577.066 Base-Backbone interact. energy: 0.197 local terms energy: -688.847075 where: bonds (distance) C4'-P energy: -147.159 bonds (distance) P-C4' energy: -146.254 flat angles C4'-P-C4' energy: -148.429 flat angles P-C4'-P energy: -117.239 tors. eta vs tors. theta energy: -129.767 Dist. restrs. and SS energy: 35.636 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 43 Temperature: 0.964286 Total energy: -1189.307531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.307531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1235.969680 (E_RNA) where: Base-Base interactions energy: -594.989 where: short stacking energy: -471.732 Base-Backbone interact. energy: -0.366 local terms energy: -640.615041 where: bonds (distance) C4'-P energy: -146.518 bonds (distance) P-C4' energy: -154.261 flat angles C4'-P-C4' energy: -139.191 flat angles P-C4'-P energy: -101.572 tors. eta vs tors. theta energy: -99.073 Dist. restrs. and SS energy: 46.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.028571 Total energy: -1086.775592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.775592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.728017 (E_RNA) where: Base-Base interactions energy: -568.054 where: short stacking energy: -388.366 Base-Backbone interact. energy: -0.288 local terms energy: -562.386059 where: bonds (distance) C4'-P energy: -148.723 bonds (distance) P-C4' energy: -147.004 flat angles C4'-P-C4' energy: -143.687 flat angles P-C4'-P energy: -63.672 tors. eta vs tors. theta energy: -59.300 Dist. restrs. and SS energy: 43.952 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.092857 Total energy: -951.186672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.186672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.240064 (E_RNA) where: Base-Base interactions energy: -429.944 where: short stacking energy: -339.004 Base-Backbone interact. energy: 2.508 local terms energy: -565.804003 where: bonds (distance) C4'-P energy: -134.783 bonds (distance) P-C4' energy: -149.186 flat angles C4'-P-C4' energy: -131.649 flat angles P-C4'-P energy: -84.754 tors. eta vs tors. theta energy: -65.433 Dist. restrs. and SS energy: 42.053 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 43 Temperature: 1.157143 Total energy: -824.409728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.409728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.460461 (E_RNA) where: Base-Base interactions energy: -379.540 where: short stacking energy: -304.428 Base-Backbone interact. energy: 0.720 local terms energy: -503.640395 where: bonds (distance) C4'-P energy: -130.850 bonds (distance) P-C4' energy: -133.603 flat angles C4'-P-C4' energy: -110.963 flat angles P-C4'-P energy: -86.924 tors. eta vs tors. theta energy: -41.301 Dist. restrs. and SS energy: 58.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 43 Temperature: 1.221429 Total energy: -710.662985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.662985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.251424 (E_RNA) where: Base-Base interactions energy: -324.953 where: short stacking energy: -263.425 Base-Backbone interact. energy: -1.956 local terms energy: -455.343149 where: bonds (distance) C4'-P energy: -131.777 bonds (distance) P-C4' energy: -128.393 flat angles C4'-P-C4' energy: -108.929 flat angles P-C4'-P energy: -63.223 tors. eta vs tors. theta energy: -23.022 Dist. restrs. and SS energy: 71.588 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 43 Temperature: 1.285714 Total energy: -638.777941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.777941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.994027 (E_RNA) where: Base-Base interactions energy: -245.247 where: short stacking energy: -202.683 Base-Backbone interact. energy: 2.958 local terms energy: -448.704218 where: bonds (distance) C4'-P energy: -125.014 bonds (distance) P-C4' energy: -153.489 flat angles C4'-P-C4' energy: -119.654 flat angles P-C4'-P energy: -54.223 tors. eta vs tors. theta energy: 3.676 Dist. restrs. and SS energy: 52.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -557.647593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.647593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.326494 (E_RNA) where: Base-Base interactions energy: -233.715 where: short stacking energy: -183.026 Base-Backbone interact. energy: 2.828 local terms energy: -390.439094 where: bonds (distance) C4'-P energy: -120.083 bonds (distance) P-C4' energy: -146.535 flat angles C4'-P-C4' energy: -89.421 flat angles P-C4'-P energy: -63.296 tors. eta vs tors. theta energy: 28.897 Dist. restrs. and SS energy: 63.679 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1286.291569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.291569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.363159 (E_RNA) where: Base-Base interactions energy: -634.565 where: short stacking energy: -572.773 Base-Backbone interact. energy: 0.056 local terms energy: -687.853826 where: bonds (distance) C4'-P energy: -144.899 bonds (distance) P-C4' energy: -143.148 flat angles C4'-P-C4' energy: -160.629 flat angles P-C4'-P energy: -93.656 tors. eta vs tors. theta energy: -145.522 Dist. restrs. and SS energy: 36.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.964286 Total energy: -1158.035158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.035158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.166712 (E_RNA) where: Base-Base interactions energy: -578.926 where: short stacking energy: -469.323 Base-Backbone interact. energy: -1.410 local terms energy: -631.830987 where: bonds (distance) C4'-P energy: -134.844 bonds (distance) P-C4' energy: -139.361 flat angles C4'-P-C4' energy: -149.935 flat angles P-C4'-P energy: -101.409 tors. eta vs tors. theta energy: -106.282 Dist. restrs. and SS energy: 54.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 44 Temperature: 1.028571 Total energy: -1076.648327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.648327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.117292 (E_RNA) where: Base-Base interactions energy: -575.521 where: short stacking energy: -387.004 Base-Backbone interact. energy: -1.876 local terms energy: -549.720449 where: bonds (distance) C4'-P energy: -138.513 bonds (distance) P-C4' energy: -132.008 flat angles C4'-P-C4' energy: -131.142 flat angles P-C4'-P energy: -87.057 tors. eta vs tors. theta energy: -61.000 Dist. restrs. and SS energy: 50.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 44 Temperature: 1.092857 Total energy: -945.463674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.463674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.290113 (E_RNA) where: Base-Base interactions energy: -458.675 where: short stacking energy: -379.468 Base-Backbone interact. energy: 1.362 local terms energy: -525.976553 where: bonds (distance) C4'-P energy: -131.556 bonds (distance) P-C4' energy: -147.115 flat angles C4'-P-C4' energy: -127.310 flat angles P-C4'-P energy: -67.838 tors. eta vs tors. theta energy: -52.157 Dist. restrs. and SS energy: 37.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 44 Temperature: 1.157143 Total energy: -816.469528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.469528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.707647 (E_RNA) where: Base-Base interactions energy: -385.862 where: short stacking energy: -304.419 Base-Backbone interact. energy: 1.316 local terms energy: -491.162100 where: bonds (distance) C4'-P energy: -127.440 bonds (distance) P-C4' energy: -136.044 flat angles C4'-P-C4' energy: -118.181 flat angles P-C4'-P energy: -77.316 tors. eta vs tors. theta energy: -32.180 Dist. restrs. and SS energy: 59.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 44 Temperature: 1.221429 Total energy: -675.048340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.048340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.907049 (E_RNA) where: Base-Base interactions energy: -299.451 where: short stacking energy: -236.945 Base-Backbone interact. energy: -1.023 local terms energy: -441.433313 where: bonds (distance) C4'-P energy: -125.551 bonds (distance) P-C4' energy: -149.982 flat angles C4'-P-C4' energy: -131.245 flat angles P-C4'-P energy: -33.339 tors. eta vs tors. theta energy: -1.316 Dist. restrs. and SS energy: 66.859 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 44 Temperature: 1.285714 Total energy: -617.938180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.938180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.527902 (E_RNA) where: Base-Base interactions energy: -257.311 where: short stacking energy: -196.258 Base-Backbone interact. energy: -1.157 local terms energy: -421.059825 where: bonds (distance) C4'-P energy: -112.645 bonds (distance) P-C4' energy: -131.986 flat angles C4'-P-C4' energy: -110.543 flat angles P-C4'-P energy: -72.019 tors. eta vs tors. theta energy: 6.133 Dist. restrs. and SS energy: 61.590 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -566.370750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.370750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.799104 (E_RNA) where: Base-Base interactions energy: -246.834 where: short stacking energy: -185.904 Base-Backbone interact. energy: 3.068 local terms energy: -385.033867 where: bonds (distance) C4'-P energy: -120.440 bonds (distance) P-C4' energy: -133.289 flat angles C4'-P-C4' energy: -100.272 flat angles P-C4'-P energy: -61.923 tors. eta vs tors. theta energy: 30.890 Dist. restrs. and SS energy: 62.428 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1350.847532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.847532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.270002 (E_RNA) where: Base-Base interactions energy: -651.501 where: short stacking energy: -590.619 Base-Backbone interact. energy: 0.615 local terms energy: -741.383724 where: bonds (distance) C4'-P energy: -141.193 bonds (distance) P-C4' energy: -161.727 flat angles C4'-P-C4' energy: -166.598 flat angles P-C4'-P energy: -109.335 tors. eta vs tors. theta energy: -162.530 Dist. restrs. and SS energy: 41.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.964286 Total energy: -1185.159680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.159680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1236.722911 (E_RNA) where: Base-Base interactions energy: -631.495 where: short stacking energy: -447.555 Base-Backbone interact. energy: -2.073 local terms energy: -603.155060 where: bonds (distance) C4'-P energy: -144.721 bonds (distance) P-C4' energy: -144.865 flat angles C4'-P-C4' energy: -154.414 flat angles P-C4'-P energy: -74.668 tors. eta vs tors. theta energy: -84.487 Dist. restrs. and SS energy: 51.563 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 45 Temperature: 1.028571 Total energy: -1068.473318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.473318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.543673 (E_RNA) where: Base-Base interactions energy: -522.614 where: short stacking energy: -389.342 Base-Backbone interact. energy: 1.144 local terms energy: -598.073337 where: bonds (distance) C4'-P energy: -159.656 bonds (distance) P-C4' energy: -139.941 flat angles C4'-P-C4' energy: -149.629 flat angles P-C4'-P energy: -79.792 tors. eta vs tors. theta energy: -69.055 Dist. restrs. and SS energy: 51.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 45 Temperature: 1.092857 Total energy: -963.449271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.449271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.429891 (E_RNA) where: Base-Base interactions energy: -463.736 where: short stacking energy: -369.471 Base-Backbone interact. energy: -1.747 local terms energy: -537.947601 where: bonds (distance) C4'-P energy: -134.016 bonds (distance) P-C4' energy: -118.514 flat angles C4'-P-C4' energy: -121.728 flat angles P-C4'-P energy: -91.053 tors. eta vs tors. theta energy: -72.637 Dist. restrs. and SS energy: 39.981 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 45 Temperature: 1.157143 Total energy: -841.698848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.698848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.197927 (E_RNA) where: Base-Base interactions energy: -401.294 where: short stacking energy: -302.476 Base-Backbone interact. energy: 0.561 local terms energy: -490.464631 where: bonds (distance) C4'-P energy: -133.304 bonds (distance) P-C4' energy: -141.353 flat angles C4'-P-C4' energy: -114.511 flat angles P-C4'-P energy: -61.708 tors. eta vs tors. theta energy: -39.589 Dist. restrs. and SS energy: 49.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 45 Temperature: 1.221429 Total energy: -736.127911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.127911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.864365 (E_RNA) where: Base-Base interactions energy: -334.370 where: short stacking energy: -267.861 Base-Backbone interact. energy: 0.747 local terms energy: -452.240781 where: bonds (distance) C4'-P energy: -130.785 bonds (distance) P-C4' energy: -133.347 flat angles C4'-P-C4' energy: -109.416 flat angles P-C4'-P energy: -73.502 tors. eta vs tors. theta energy: -5.191 Dist. restrs. and SS energy: 49.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.285714 Total energy: -613.593039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.593039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.589459 (E_RNA) where: Base-Base interactions energy: -264.968 where: short stacking energy: -212.183 Base-Backbone interact. energy: 1.751 local terms energy: -401.372442 where: bonds (distance) C4'-P energy: -131.868 bonds (distance) P-C4' energy: -96.571 flat angles C4'-P-C4' energy: -103.579 flat angles P-C4'-P energy: -69.974 tors. eta vs tors. theta energy: 0.620 Dist. restrs. and SS energy: 50.996 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -543.266924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.266924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.427156 (E_RNA) where: Base-Base interactions energy: -241.876 where: short stacking energy: -175.753 Base-Backbone interact. energy: 11.617 local terms energy: -376.168339 where: bonds (distance) C4'-P energy: -117.079 bonds (distance) P-C4' energy: -134.541 flat angles C4'-P-C4' energy: -109.692 flat angles P-C4'-P energy: -46.786 tors. eta vs tors. theta energy: 31.929 Dist. restrs. and SS energy: 63.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1312.427360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.427360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.400468 (E_RNA) where: Base-Base interactions energy: -645.805 where: short stacking energy: -566.781 Base-Backbone interact. energy: 2.257 local terms energy: -714.852358 where: bonds (distance) C4'-P energy: -160.350 bonds (distance) P-C4' energy: -153.768 flat angles C4'-P-C4' energy: -161.582 flat angles P-C4'-P energy: -96.891 tors. eta vs tors. theta energy: -142.261 Dist. restrs. and SS energy: 45.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.964286 Total energy: -1287.181939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.181939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.992915 (E_RNA) where: Base-Base interactions energy: -694.641 where: short stacking energy: -496.490 Base-Backbone interact. energy: -2.439 local terms energy: -637.912959 where: bonds (distance) C4'-P energy: -153.678 bonds (distance) P-C4' energy: -147.887 flat angles C4'-P-C4' energy: -152.337 flat angles P-C4'-P energy: -88.163 tors. eta vs tors. theta energy: -95.848 Dist. restrs. and SS energy: 47.811 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 46 Temperature: 1.028571 Total energy: -1132.752217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.752217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.372186 (E_RNA) where: Base-Base interactions energy: -571.684 where: short stacking energy: -422.209 Base-Backbone interact. energy: -1.084 local terms energy: -611.604232 where: bonds (distance) C4'-P energy: -158.837 bonds (distance) P-C4' energy: -149.619 flat angles C4'-P-C4' energy: -141.964 flat angles P-C4'-P energy: -79.230 tors. eta vs tors. theta energy: -81.954 Dist. restrs. and SS energy: 51.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.092857 Total energy: -962.667289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.667289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.918580 (E_RNA) where: Base-Base interactions energy: -436.807 where: short stacking energy: -341.521 Base-Backbone interact. energy: -0.610 local terms energy: -561.502446 where: bonds (distance) C4'-P energy: -149.002 bonds (distance) P-C4' energy: -143.249 flat angles C4'-P-C4' energy: -130.128 flat angles P-C4'-P energy: -81.388 tors. eta vs tors. theta energy: -57.735 Dist. restrs. and SS energy: 36.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 46 Temperature: 1.157143 Total energy: -882.000474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.000474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.185589 (E_RNA) where: Base-Base interactions energy: -418.202 where: short stacking energy: -324.299 Base-Backbone interact. energy: -2.374 local terms energy: -528.609391 where: bonds (distance) C4'-P energy: -131.769 bonds (distance) P-C4' energy: -143.416 flat angles C4'-P-C4' energy: -131.885 flat angles P-C4'-P energy: -74.818 tors. eta vs tors. theta energy: -46.721 Dist. restrs. and SS energy: 67.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 46 Temperature: 1.221429 Total energy: -746.110674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.110674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.311425 (E_RNA) where: Base-Base interactions energy: -344.098 where: short stacking energy: -250.563 Base-Backbone interact. energy: -1.105 local terms energy: -468.108681 where: bonds (distance) C4'-P energy: -125.111 bonds (distance) P-C4' energy: -132.971 flat angles C4'-P-C4' energy: -121.350 flat angles P-C4'-P energy: -71.837 tors. eta vs tors. theta energy: -16.839 Dist. restrs. and SS energy: 67.201 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.285714 Total energy: -680.714713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.714713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.687836 (E_RNA) where: Base-Base interactions energy: -291.868 where: short stacking energy: -229.291 Base-Backbone interact. energy: -1.022 local terms energy: -457.798722 where: bonds (distance) C4'-P energy: -140.444 bonds (distance) P-C4' energy: -128.771 flat angles C4'-P-C4' energy: -118.122 flat angles P-C4'-P energy: -62.919 tors. eta vs tors. theta energy: -7.543 Dist. restrs. and SS energy: 69.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -593.587392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.587392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.434283 (E_RNA) where: Base-Base interactions energy: -268.393 where: short stacking energy: -203.270 Base-Backbone interact. energy: -0.545 local terms energy: -362.496421 where: bonds (distance) C4'-P energy: -123.925 bonds (distance) P-C4' energy: -121.705 flat angles C4'-P-C4' energy: -93.388 flat angles P-C4'-P energy: -38.751 tors. eta vs tors. theta energy: 15.273 Dist. restrs. and SS energy: 37.847 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1259.641053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.641053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.856790 (E_RNA) where: Base-Base interactions energy: -608.353 where: short stacking energy: -512.644 Base-Backbone interact. energy: -0.389 local terms energy: -687.114977 where: bonds (distance) C4'-P energy: -150.053 bonds (distance) P-C4' energy: -151.874 flat angles C4'-P-C4' energy: -166.157 flat angles P-C4'-P energy: -99.550 tors. eta vs tors. theta energy: -119.480 Dist. restrs. and SS energy: 36.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 47 Temperature: 0.964286 Total energy: -1238.277352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.277352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.436799 (E_RNA) where: Base-Base interactions energy: -670.895 where: short stacking energy: -480.029 Base-Backbone interact. energy: 2.692 local terms energy: -621.233647 where: bonds (distance) C4'-P energy: -148.929 bonds (distance) P-C4' energy: -146.733 flat angles C4'-P-C4' energy: -133.950 flat angles P-C4'-P energy: -94.312 tors. eta vs tors. theta energy: -97.309 Dist. restrs. and SS energy: 51.159 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 47 Temperature: 1.028571 Total energy: -1166.334566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.334566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.581477 (E_RNA) where: Base-Base interactions energy: -614.326 where: short stacking energy: -463.285 Base-Backbone interact. energy: -1.166 local terms energy: -611.089098 where: bonds (distance) C4'-P energy: -141.950 bonds (distance) P-C4' energy: -136.185 flat angles C4'-P-C4' energy: -147.497 flat angles P-C4'-P energy: -83.872 tors. eta vs tors. theta energy: -101.586 Dist. restrs. and SS energy: 60.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.092857 Total energy: -972.738848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.738848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.987271 (E_RNA) where: Base-Base interactions energy: -451.246 where: short stacking energy: -349.106 Base-Backbone interact. energy: 5.833 local terms energy: -557.573616 where: bonds (distance) C4'-P energy: -139.368 bonds (distance) P-C4' energy: -137.575 flat angles C4'-P-C4' energy: -128.350 flat angles P-C4'-P energy: -88.387 tors. eta vs tors. theta energy: -63.895 Dist. restrs. and SS energy: 30.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 47 Temperature: 1.157143 Total energy: -845.209705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.209705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.052019 (E_RNA) where: Base-Base interactions energy: -387.938 where: short stacking energy: -308.577 Base-Backbone interact. energy: 0.507 local terms energy: -521.621125 where: bonds (distance) C4'-P energy: -122.651 bonds (distance) P-C4' energy: -139.597 flat angles C4'-P-C4' energy: -134.685 flat angles P-C4'-P energy: -86.557 tors. eta vs tors. theta energy: -38.131 Dist. restrs. and SS energy: 63.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 47 Temperature: 1.221429 Total energy: -730.909351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.909351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.597460 (E_RNA) where: Base-Base interactions energy: -356.833 where: short stacking energy: -272.834 Base-Backbone interact. energy: -3.725 local terms energy: -437.039450 where: bonds (distance) C4'-P energy: -123.618 bonds (distance) P-C4' energy: -144.918 flat angles C4'-P-C4' energy: -115.240 flat angles P-C4'-P energy: -48.863 tors. eta vs tors. theta energy: -4.400 Dist. restrs. and SS energy: 66.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.285714 Total energy: -634.333263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.333263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.403015 (E_RNA) where: Base-Base interactions energy: -269.448 where: short stacking energy: -200.486 Base-Backbone interact. energy: 7.606 local terms energy: -433.560981 where: bonds (distance) C4'-P energy: -141.361 bonds (distance) P-C4' energy: -114.152 flat angles C4'-P-C4' energy: -116.783 flat angles P-C4'-P energy: -73.049 tors. eta vs tors. theta energy: 11.785 Dist. restrs. and SS energy: 61.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -573.229728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.229728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.127135 (E_RNA) where: Base-Base interactions energy: -266.936 where: short stacking energy: -192.604 Base-Backbone interact. energy: 4.973 local terms energy: -366.163798 where: bonds (distance) C4'-P energy: -112.715 bonds (distance) P-C4' energy: -124.769 flat angles C4'-P-C4' energy: -93.056 flat angles P-C4'-P energy: -37.273 tors. eta vs tors. theta energy: 1.650 Dist. restrs. and SS energy: 54.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1260.099158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.099158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.691710 (E_RNA) where: Base-Base interactions energy: -627.170 where: short stacking energy: -542.242 Base-Backbone interact. energy: -1.624 local terms energy: -671.897656 where: bonds (distance) C4'-P energy: -149.940 bonds (distance) P-C4' energy: -150.034 flat angles C4'-P-C4' energy: -149.131 flat angles P-C4'-P energy: -105.083 tors. eta vs tors. theta energy: -117.710 Dist. restrs. and SS energy: 40.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 48 Temperature: 0.964286 Total energy: -1260.058802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.058802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.029910 (E_RNA) where: Base-Base interactions energy: -698.283 where: short stacking energy: -503.350 Base-Backbone interact. energy: 1.264 local terms energy: -618.011129 where: bonds (distance) C4'-P energy: -142.569 bonds (distance) P-C4' energy: -149.290 flat angles C4'-P-C4' energy: -147.877 flat angles P-C4'-P energy: -76.592 tors. eta vs tors. theta energy: -101.683 Dist. restrs. and SS energy: 54.971 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 48 Temperature: 1.028571 Total energy: -1111.277308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.277308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.751320 (E_RNA) where: Base-Base interactions energy: -575.592 where: short stacking energy: -432.400 Base-Backbone interact. energy: -0.540 local terms energy: -594.619714 where: bonds (distance) C4'-P energy: -136.941 bonds (distance) P-C4' energy: -131.885 flat angles C4'-P-C4' energy: -135.586 flat angles P-C4'-P energy: -86.402 tors. eta vs tors. theta energy: -103.805 Dist. restrs. and SS energy: 59.474 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 48 Temperature: 1.092857 Total energy: -978.016525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.016525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.278195 (E_RNA) where: Base-Base interactions energy: -490.579 where: short stacking energy: -390.029 Base-Backbone interact. energy: 2.590 local terms energy: -524.289091 where: bonds (distance) C4'-P energy: -136.378 bonds (distance) P-C4' energy: -147.054 flat angles C4'-P-C4' energy: -123.009 flat angles P-C4'-P energy: -68.799 tors. eta vs tors. theta energy: -49.049 Dist. restrs. and SS energy: 34.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 48 Temperature: 1.157143 Total energy: -892.246562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.246562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.427872 (E_RNA) where: Base-Base interactions energy: -451.203 where: short stacking energy: -327.248 Base-Backbone interact. energy: 0.900 local terms energy: -500.124823 where: bonds (distance) C4'-P energy: -131.091 bonds (distance) P-C4' energy: -135.277 flat angles C4'-P-C4' energy: -132.411 flat angles P-C4'-P energy: -58.997 tors. eta vs tors. theta energy: -42.350 Dist. restrs. and SS energy: 58.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 48 Temperature: 1.221429 Total energy: -731.737859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.737859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.494993 (E_RNA) where: Base-Base interactions energy: -354.727 where: short stacking energy: -264.934 Base-Backbone interact. energy: 1.727 local terms energy: -426.494812 where: bonds (distance) C4'-P energy: -98.542 bonds (distance) P-C4' energy: -132.217 flat angles C4'-P-C4' energy: -95.665 flat angles P-C4'-P energy: -85.745 tors. eta vs tors. theta energy: -14.326 Dist. restrs. and SS energy: 47.757 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 48 Temperature: 1.285714 Total energy: -659.079824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.079824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.951411 (E_RNA) where: Base-Base interactions energy: -297.424 where: short stacking energy: -210.391 Base-Backbone interact. energy: 1.101 local terms energy: -421.628227 where: bonds (distance) C4'-P energy: -111.884 bonds (distance) P-C4' energy: -135.336 flat angles C4'-P-C4' energy: -103.973 flat angles P-C4'-P energy: -58.367 tors. eta vs tors. theta energy: -12.068 Dist. restrs. and SS energy: 58.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -558.794455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.794455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.298871 (E_RNA) where: Base-Base interactions energy: -260.268 where: short stacking energy: -193.558 Base-Backbone interact. energy: 7.608 local terms energy: -359.638453 where: bonds (distance) C4'-P energy: -90.968 bonds (distance) P-C4' energy: -149.378 flat angles C4'-P-C4' energy: -91.444 flat angles P-C4'-P energy: -47.359 tors. eta vs tors. theta energy: 19.510 Dist. restrs. and SS energy: 53.504 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1275.436409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.436409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.001816 (E_RNA) where: Base-Base interactions energy: -626.164 where: short stacking energy: -540.792 Base-Backbone interact. energy: -0.653 local terms energy: -693.184986 where: bonds (distance) C4'-P energy: -152.280 bonds (distance) P-C4' energy: -149.735 flat angles C4'-P-C4' energy: -161.159 flat angles P-C4'-P energy: -97.925 tors. eta vs tors. theta energy: -132.086 Dist. restrs. and SS energy: 44.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.964286 Total energy: -1256.089948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.089948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.687016 (E_RNA) where: Base-Base interactions energy: -676.133 where: short stacking energy: -473.720 Base-Backbone interact. energy: -1.229 local terms energy: -631.324532 where: bonds (distance) C4'-P energy: -151.058 bonds (distance) P-C4' energy: -149.952 flat angles C4'-P-C4' energy: -139.865 flat angles P-C4'-P energy: -86.084 tors. eta vs tors. theta energy: -104.364 Dist. restrs. and SS energy: 52.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 49 Temperature: 1.028571 Total energy: -1124.132625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.132625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.971360 (E_RNA) where: Base-Base interactions energy: -591.460 where: short stacking energy: -424.618 Base-Backbone interact. energy: -1.231 local terms energy: -592.279745 where: bonds (distance) C4'-P energy: -129.915 bonds (distance) P-C4' energy: -154.152 flat angles C4'-P-C4' energy: -146.402 flat angles P-C4'-P energy: -86.092 tors. eta vs tors. theta energy: -75.718 Dist. restrs. and SS energy: 60.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 49 Temperature: 1.092857 Total energy: -968.441912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.441912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.091455 (E_RNA) where: Base-Base interactions energy: -467.997 where: short stacking energy: -338.000 Base-Backbone interact. energy: -4.516 local terms energy: -554.578186 where: bonds (distance) C4'-P energy: -140.153 bonds (distance) P-C4' energy: -139.811 flat angles C4'-P-C4' energy: -154.504 flat angles P-C4'-P energy: -73.009 tors. eta vs tors. theta energy: -47.102 Dist. restrs. and SS energy: 58.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 49 Temperature: 1.157143 Total energy: -893.778778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.778778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.757479 (E_RNA) where: Base-Base interactions energy: -433.042 where: short stacking energy: -327.606 Base-Backbone interact. energy: 2.411 local terms energy: -501.125677 where: bonds (distance) C4'-P energy: -117.646 bonds (distance) P-C4' energy: -141.066 flat angles C4'-P-C4' energy: -134.983 flat angles P-C4'-P energy: -53.990 tors. eta vs tors. theta energy: -53.440 Dist. restrs. and SS energy: 37.979 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 49 Temperature: 1.221429 Total energy: -791.316531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.316531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.781454 (E_RNA) where: Base-Base interactions energy: -391.706 where: short stacking energy: -292.927 Base-Backbone interact. energy: 2.992 local terms energy: -450.067407 where: bonds (distance) C4'-P energy: -96.373 bonds (distance) P-C4' energy: -131.596 flat angles C4'-P-C4' energy: -137.117 flat angles P-C4'-P energy: -59.100 tors. eta vs tors. theta energy: -25.882 Dist. restrs. and SS energy: 47.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 49 Temperature: 1.285714 Total energy: -664.825611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.825611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.623906 (E_RNA) where: Base-Base interactions energy: -296.010 where: short stacking energy: -231.596 Base-Backbone interact. energy: 2.589 local terms energy: -429.203415 where: bonds (distance) C4'-P energy: -126.029 bonds (distance) P-C4' energy: -121.967 flat angles C4'-P-C4' energy: -123.928 flat angles P-C4'-P energy: -55.380 tors. eta vs tors. theta energy: -1.899 Dist. restrs. and SS energy: 57.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -521.996344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.996344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.950608 (E_RNA) where: Base-Base interactions energy: -219.882 where: short stacking energy: -176.111 Base-Backbone interact. energy: 5.976 local terms energy: -363.044944 where: bonds (distance) C4'-P energy: -111.495 bonds (distance) P-C4' energy: -127.596 flat angles C4'-P-C4' energy: -85.810 flat angles P-C4'-P energy: -52.728 tors. eta vs tors. theta energy: 14.585 Dist. restrs. and SS energy: 54.954 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1338.439761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.439761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.821804 (E_RNA) where: Base-Base interactions energy: -748.174 where: short stacking energy: -515.769 Base-Backbone interact. energy: 3.689 local terms energy: -638.336894 where: bonds (distance) C4'-P energy: -140.128 bonds (distance) P-C4' energy: -161.930 flat angles C4'-P-C4' energy: -138.465 flat angles P-C4'-P energy: -93.476 tors. eta vs tors. theta energy: -104.337 Dist. restrs. and SS energy: 44.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 50 Temperature: 0.964286 Total energy: -1234.410125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.410125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.808764 (E_RNA) where: Base-Base interactions energy: -617.457 where: short stacking energy: -513.226 Base-Backbone interact. energy: -2.359 local terms energy: -651.992825 where: bonds (distance) C4'-P energy: -138.212 bonds (distance) P-C4' energy: -150.671 flat angles C4'-P-C4' energy: -157.313 flat angles P-C4'-P energy: -78.832 tors. eta vs tors. theta energy: -126.965 Dist. restrs. and SS energy: 37.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 50 Temperature: 1.028571 Total energy: -1095.461021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.461021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.511765 (E_RNA) where: Base-Base interactions energy: -574.549 where: short stacking energy: -428.544 Base-Backbone interact. energy: -2.697 local terms energy: -575.265638 where: bonds (distance) C4'-P energy: -133.461 bonds (distance) P-C4' energy: -144.763 flat angles C4'-P-C4' energy: -139.142 flat angles P-C4'-P energy: -77.469 tors. eta vs tors. theta energy: -80.431 Dist. restrs. and SS energy: 57.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 50 Temperature: 1.092857 Total energy: -1004.985386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.985386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.924654 (E_RNA) where: Base-Base interactions energy: -514.004 where: short stacking energy: -342.990 Base-Backbone interact. energy: 0.401 local terms energy: -542.321638 where: bonds (distance) C4'-P energy: -138.377 bonds (distance) P-C4' energy: -149.288 flat angles C4'-P-C4' energy: -131.161 flat angles P-C4'-P energy: -69.783 tors. eta vs tors. theta energy: -53.712 Dist. restrs. and SS energy: 50.939 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 50 Temperature: 1.157143 Total energy: -905.750321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.750321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.480085 (E_RNA) where: Base-Base interactions energy: -431.982 where: short stacking energy: -315.371 Base-Backbone interact. energy: -1.297 local terms energy: -516.200340 where: bonds (distance) C4'-P energy: -128.464 bonds (distance) P-C4' energy: -129.968 flat angles C4'-P-C4' energy: -141.215 flat angles P-C4'-P energy: -72.902 tors. eta vs tors. theta energy: -43.651 Dist. restrs. and SS energy: 43.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 50 Temperature: 1.221429 Total energy: -714.217916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.217916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.021438 (E_RNA) where: Base-Base interactions energy: -311.447 where: short stacking energy: -231.495 Base-Backbone interact. energy: 5.755 local terms energy: -472.329458 where: bonds (distance) C4'-P energy: -123.957 bonds (distance) P-C4' energy: -136.524 flat angles C4'-P-C4' energy: -116.155 flat angles P-C4'-P energy: -84.700 tors. eta vs tors. theta energy: -10.994 Dist. restrs. and SS energy: 63.804 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 50 Temperature: 1.285714 Total energy: -637.020684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.020684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.476423 (E_RNA) where: Base-Base interactions energy: -273.569 where: short stacking energy: -189.851 Base-Backbone interact. energy: -5.723 local terms energy: -423.184627 where: bonds (distance) C4'-P energy: -128.424 bonds (distance) P-C4' energy: -115.668 flat angles C4'-P-C4' energy: -126.032 flat angles P-C4'-P energy: -61.946 tors. eta vs tors. theta energy: 8.886 Dist. restrs. and SS energy: 65.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -548.358096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.358096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.151518 (E_RNA) where: Base-Base interactions energy: -237.918 where: short stacking energy: -206.146 Base-Backbone interact. energy: 6.425 local terms energy: -377.658875 where: bonds (distance) C4'-P energy: -117.371 bonds (distance) P-C4' energy: -113.385 flat angles C4'-P-C4' energy: -103.931 flat angles P-C4'-P energy: -53.129 tors. eta vs tors. theta energy: 10.157 Dist. restrs. and SS energy: 60.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1354.811624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.811624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.602141 (E_RNA) where: Base-Base interactions energy: -760.026 where: short stacking energy: -535.817 Base-Backbone interact. energy: -2.814 local terms energy: -636.761501 where: bonds (distance) C4'-P energy: -153.964 bonds (distance) P-C4' energy: -145.311 flat angles C4'-P-C4' energy: -144.614 flat angles P-C4'-P energy: -82.720 tors. eta vs tors. theta energy: -110.152 Dist. restrs. and SS energy: 44.791 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 51 Temperature: 0.964286 Total energy: -1223.546381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.546381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.827260 (E_RNA) where: Base-Base interactions energy: -639.662 where: short stacking energy: -477.268 Base-Backbone interact. energy: -0.646 local terms energy: -647.519237 where: bonds (distance) C4'-P energy: -148.912 bonds (distance) P-C4' energy: -161.261 flat angles C4'-P-C4' energy: -147.254 flat angles P-C4'-P energy: -89.605 tors. eta vs tors. theta energy: -100.488 Dist. restrs. and SS energy: 64.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 51 Temperature: 1.028571 Total energy: -1109.181929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.181929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.326643 (E_RNA) where: Base-Base interactions energy: -526.545 where: short stacking energy: -464.242 Base-Backbone interact. energy: -2.384 local terms energy: -628.397653 where: bonds (distance) C4'-P energy: -144.046 bonds (distance) P-C4' energy: -159.914 flat angles C4'-P-C4' energy: -143.951 flat angles P-C4'-P energy: -80.501 tors. eta vs tors. theta energy: -99.985 Dist. restrs. and SS energy: 48.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 51 Temperature: 1.092857 Total energy: -1007.187227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.187227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.189736 (E_RNA) where: Base-Base interactions energy: -498.182 where: short stacking energy: -372.616 Base-Backbone interact. energy: -3.271 local terms energy: -557.737449 where: bonds (distance) C4'-P energy: -135.800 bonds (distance) P-C4' energy: -149.868 flat angles C4'-P-C4' energy: -125.127 flat angles P-C4'-P energy: -84.284 tors. eta vs tors. theta energy: -62.658 Dist. restrs. and SS energy: 52.003 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 51 Temperature: 1.157143 Total energy: -930.615565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.615565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.427992 (E_RNA) where: Base-Base interactions energy: -435.133 where: short stacking energy: -327.806 Base-Backbone interact. energy: 4.514 local terms energy: -538.809257 where: bonds (distance) C4'-P energy: -130.780 bonds (distance) P-C4' energy: -137.219 flat angles C4'-P-C4' energy: -139.613 flat angles P-C4'-P energy: -82.604 tors. eta vs tors. theta energy: -48.593 Dist. restrs. and SS energy: 38.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.221429 Total energy: -704.174826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.174826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.195935 (E_RNA) where: Base-Base interactions energy: -347.389 where: short stacking energy: -241.731 Base-Backbone interact. energy: 7.297 local terms energy: -425.103669 where: bonds (distance) C4'-P energy: -130.869 bonds (distance) P-C4' energy: -111.782 flat angles C4'-P-C4' energy: -113.057 flat angles P-C4'-P energy: -51.443 tors. eta vs tors. theta energy: -17.952 Dist. restrs. and SS energy: 61.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 51 Temperature: 1.285714 Total energy: -654.612552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.612552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.127826 (E_RNA) where: Base-Base interactions energy: -313.704 where: short stacking energy: -243.418 Base-Backbone interact. energy: 0.282 local terms energy: -403.705239 where: bonds (distance) C4'-P energy: -113.294 bonds (distance) P-C4' energy: -119.106 flat angles C4'-P-C4' energy: -113.239 flat angles P-C4'-P energy: -68.559 tors. eta vs tors. theta energy: 10.492 Dist. restrs. and SS energy: 62.515 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -536.918030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.918030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.324357 (E_RNA) where: Base-Base interactions energy: -223.046 where: short stacking energy: -173.822 Base-Backbone interact. energy: 4.032 local terms energy: -382.311134 where: bonds (distance) C4'-P energy: -133.606 bonds (distance) P-C4' energy: -120.899 flat angles C4'-P-C4' energy: -109.100 flat angles P-C4'-P energy: -39.538 tors. eta vs tors. theta energy: 20.833 Dist. restrs. and SS energy: 64.406 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1378.599814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.599814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.880917 (E_RNA) where: Base-Base interactions energy: -756.001 where: short stacking energy: -557.732 Base-Backbone interact. energy: 0.464 local terms energy: -675.344334 where: bonds (distance) C4'-P energy: -149.219 bonds (distance) P-C4' energy: -165.375 flat angles C4'-P-C4' energy: -157.632 flat angles P-C4'-P energy: -92.450 tors. eta vs tors. theta energy: -110.668 Dist. restrs. and SS energy: 52.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 52 Temperature: 0.964286 Total energy: -1201.311697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.311697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.269829 (E_RNA) where: Base-Base interactions energy: -623.130 where: short stacking energy: -467.447 Base-Backbone interact. energy: -2.788 local terms energy: -636.351344 where: bonds (distance) C4'-P energy: -145.362 bonds (distance) P-C4' energy: -140.570 flat angles C4'-P-C4' energy: -147.662 flat angles P-C4'-P energy: -103.912 tors. eta vs tors. theta energy: -98.846 Dist. restrs. and SS energy: 60.958 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.028571 Total energy: -1101.997783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.997783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.544788 (E_RNA) where: Base-Base interactions energy: -565.216 where: short stacking energy: -474.876 Base-Backbone interact. energy: -2.163 local terms energy: -581.166215 where: bonds (distance) C4'-P energy: -128.422 bonds (distance) P-C4' energy: -141.922 flat angles C4'-P-C4' energy: -126.593 flat angles P-C4'-P energy: -84.128 tors. eta vs tors. theta energy: -100.101 Dist. restrs. and SS energy: 46.547 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 52 Temperature: 1.092857 Total energy: -969.756051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.756051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.265895 (E_RNA) where: Base-Base interactions energy: -471.966 where: short stacking energy: -356.698 Base-Backbone interact. energy: -1.299 local terms energy: -548.000271 where: bonds (distance) C4'-P energy: -120.405 bonds (distance) P-C4' energy: -161.361 flat angles C4'-P-C4' energy: -135.752 flat angles P-C4'-P energy: -74.791 tors. eta vs tors. theta energy: -55.692 Dist. restrs. and SS energy: 51.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 52 Temperature: 1.157143 Total energy: -898.484467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.484467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.902242 (E_RNA) where: Base-Base interactions energy: -433.948 where: short stacking energy: -331.492 Base-Backbone interact. energy: -1.491 local terms energy: -488.462670 where: bonds (distance) C4'-P energy: -121.974 bonds (distance) P-C4' energy: -163.784 flat angles C4'-P-C4' energy: -114.654 flat angles P-C4'-P energy: -45.870 tors. eta vs tors. theta energy: -42.180 Dist. restrs. and SS energy: 25.418 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.221429 Total energy: -720.051522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.051522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.699357 (E_RNA) where: Base-Base interactions energy: -318.202 where: short stacking energy: -250.189 Base-Backbone interact. energy: -1.965 local terms energy: -455.531848 where: bonds (distance) C4'-P energy: -116.594 bonds (distance) P-C4' energy: -147.404 flat angles C4'-P-C4' energy: -110.899 flat angles P-C4'-P energy: -76.848 tors. eta vs tors. theta energy: -3.787 Dist. restrs. and SS energy: 55.648 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.285714 Total energy: -634.575799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.575799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.748049 (E_RNA) where: Base-Base interactions energy: -274.540 where: short stacking energy: -226.390 Base-Backbone interact. energy: 0.673 local terms energy: -415.880693 where: bonds (distance) C4'-P energy: -120.231 bonds (distance) P-C4' energy: -149.413 flat angles C4'-P-C4' energy: -92.389 flat angles P-C4'-P energy: -52.181 tors. eta vs tors. theta energy: -1.666 Dist. restrs. and SS energy: 55.172 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -547.225896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.225896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.997064 (E_RNA) where: Base-Base interactions energy: -257.891 where: short stacking energy: -205.906 Base-Backbone interact. energy: 1.129 local terms energy: -348.234732 where: bonds (distance) C4'-P energy: -116.931 bonds (distance) P-C4' energy: -118.018 flat angles C4'-P-C4' energy: -86.243 flat angles P-C4'-P energy: -50.103 tors. eta vs tors. theta energy: 23.061 Dist. restrs. and SS energy: 57.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1392.854067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.854067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.550872 (E_RNA) where: Base-Base interactions energy: -755.563 where: short stacking energy: -531.794 Base-Backbone interact. energy: -2.541 local terms energy: -680.447342 where: bonds (distance) C4'-P energy: -152.914 bonds (distance) P-C4' energy: -164.970 flat angles C4'-P-C4' energy: -174.974 flat angles P-C4'-P energy: -86.303 tors. eta vs tors. theta energy: -101.287 Dist. restrs. and SS energy: 45.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 53 Temperature: 0.964286 Total energy: -1256.525937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.525937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.023013 (E_RNA) where: Base-Base interactions energy: -664.726 where: short stacking energy: -494.753 Base-Backbone interact. energy: -1.463 local terms energy: -657.834327 where: bonds (distance) C4'-P energy: -152.680 bonds (distance) P-C4' energy: -159.797 flat angles C4'-P-C4' energy: -142.300 flat angles P-C4'-P energy: -89.710 tors. eta vs tors. theta energy: -113.347 Dist. restrs. and SS energy: 67.497 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.028571 Total energy: -1064.762598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.762598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.803011 (E_RNA) where: Base-Base interactions energy: -507.552 where: short stacking energy: -415.775 Base-Backbone interact. energy: 6.380 local terms energy: -607.631184 where: bonds (distance) C4'-P energy: -123.543 bonds (distance) P-C4' energy: -158.184 flat angles C4'-P-C4' energy: -139.382 flat angles P-C4'-P energy: -84.828 tors. eta vs tors. theta energy: -101.694 Dist. restrs. and SS energy: 44.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 53 Temperature: 1.092857 Total energy: -982.691431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.691431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.986082 (E_RNA) where: Base-Base interactions energy: -469.940 where: short stacking energy: -350.658 Base-Backbone interact. energy: -2.302 local terms energy: -562.743738 where: bonds (distance) C4'-P energy: -139.363 bonds (distance) P-C4' energy: -147.933 flat angles C4'-P-C4' energy: -123.054 flat angles P-C4'-P energy: -78.951 tors. eta vs tors. theta energy: -73.444 Dist. restrs. and SS energy: 52.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.157143 Total energy: -823.116265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.116265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.235932 (E_RNA) where: Base-Base interactions energy: -369.114 where: short stacking energy: -269.810 Base-Backbone interact. energy: 0.461 local terms energy: -498.583168 where: bonds (distance) C4'-P energy: -132.792 bonds (distance) P-C4' energy: -151.309 flat angles C4'-P-C4' energy: -107.990 flat angles P-C4'-P energy: -75.912 tors. eta vs tors. theta energy: -30.581 Dist. restrs. and SS energy: 44.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 53 Temperature: 1.221429 Total energy: -698.353742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.353742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.190867 (E_RNA) where: Base-Base interactions energy: -298.380 where: short stacking energy: -235.325 Base-Backbone interact. energy: -1.811 local terms energy: -455.000200 where: bonds (distance) C4'-P energy: -112.796 bonds (distance) P-C4' energy: -135.878 flat angles C4'-P-C4' energy: -122.052 flat angles P-C4'-P energy: -69.578 tors. eta vs tors. theta energy: -14.696 Dist. restrs. and SS energy: 56.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 53 Temperature: 1.285714 Total energy: -614.067844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.067844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.880658 (E_RNA) where: Base-Base interactions energy: -299.737 where: short stacking energy: -221.692 Base-Backbone interact. energy: 4.430 local terms energy: -381.573592 where: bonds (distance) C4'-P energy: -126.792 bonds (distance) P-C4' energy: -122.499 flat angles C4'-P-C4' energy: -91.005 flat angles P-C4'-P energy: -44.434 tors. eta vs tors. theta energy: 3.156 Dist. restrs. and SS energy: 62.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -551.153507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.153507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.725635 (E_RNA) where: Base-Base interactions energy: -241.066 where: short stacking energy: -184.863 Base-Backbone interact. energy: -3.486 local terms energy: -363.173913 where: bonds (distance) C4'-P energy: -110.011 bonds (distance) P-C4' energy: -126.716 flat angles C4'-P-C4' energy: -97.197 flat angles P-C4'-P energy: -46.236 tors. eta vs tors. theta energy: 16.986 Dist. restrs. and SS energy: 56.572 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1454.307369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.307369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1495.052473 (E_RNA) where: Base-Base interactions energy: -798.896 where: short stacking energy: -583.762 Base-Backbone interact. energy: -0.346 local terms energy: -695.811013 where: bonds (distance) C4'-P energy: -147.812 bonds (distance) P-C4' energy: -141.999 flat angles C4'-P-C4' energy: -168.508 flat angles P-C4'-P energy: -101.705 tors. eta vs tors. theta energy: -135.787 Dist. restrs. and SS energy: 40.745 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 54 Temperature: 0.964286 Total energy: -1254.023664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.023664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1297.495651 (E_RNA) where: Base-Base interactions energy: -653.044 where: short stacking energy: -491.781 Base-Backbone interact. energy: 0.152 local terms energy: -644.603072 where: bonds (distance) C4'-P energy: -152.199 bonds (distance) P-C4' energy: -150.019 flat angles C4'-P-C4' energy: -148.701 flat angles P-C4'-P energy: -76.484 tors. eta vs tors. theta energy: -117.199 Dist. restrs. and SS energy: 43.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.028571 Total energy: -1064.021729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.021729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.359879 (E_RNA) where: Base-Base interactions energy: -522.668 where: short stacking energy: -437.909 Base-Backbone interact. energy: 2.301 local terms energy: -596.992690 where: bonds (distance) C4'-P energy: -149.744 bonds (distance) P-C4' energy: -148.050 flat angles C4'-P-C4' energy: -139.674 flat angles P-C4'-P energy: -74.005 tors. eta vs tors. theta energy: -85.520 Dist. restrs. and SS energy: 53.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 54 Temperature: 1.092857 Total energy: -989.390572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.390572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.626636 (E_RNA) where: Base-Base interactions energy: -497.185 where: short stacking energy: -366.230 Base-Backbone interact. energy: -0.212 local terms energy: -564.229343 where: bonds (distance) C4'-P energy: -123.893 bonds (distance) P-C4' energy: -156.717 flat angles C4'-P-C4' energy: -128.499 flat angles P-C4'-P energy: -89.645 tors. eta vs tors. theta energy: -65.475 Dist. restrs. and SS energy: 72.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 54 Temperature: 1.157143 Total energy: -800.014145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.014145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.088303 (E_RNA) where: Base-Base interactions energy: -357.992 where: short stacking energy: -265.562 Base-Backbone interact. energy: -2.379 local terms energy: -482.717046 where: bonds (distance) C4'-P energy: -128.575 bonds (distance) P-C4' energy: -127.628 flat angles C4'-P-C4' energy: -108.666 flat angles P-C4'-P energy: -84.307 tors. eta vs tors. theta energy: -33.541 Dist. restrs. and SS energy: 43.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 54 Temperature: 1.221429 Total energy: -728.479474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.479474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.457531 (E_RNA) where: Base-Base interactions energy: -306.277 where: short stacking energy: -244.652 Base-Backbone interact. energy: 3.338 local terms energy: -476.518160 where: bonds (distance) C4'-P energy: -144.010 bonds (distance) P-C4' energy: -130.763 flat angles C4'-P-C4' energy: -137.642 flat angles P-C4'-P energy: -68.084 tors. eta vs tors. theta energy: 3.980 Dist. restrs. and SS energy: 50.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 54 Temperature: 1.285714 Total energy: -635.510772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.510772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.896813 (E_RNA) where: Base-Base interactions energy: -282.060 where: short stacking energy: -208.510 Base-Backbone interact. energy: 2.144 local terms energy: -407.980450 where: bonds (distance) C4'-P energy: -107.598 bonds (distance) P-C4' energy: -129.023 flat angles C4'-P-C4' energy: -110.330 flat angles P-C4'-P energy: -60.548 tors. eta vs tors. theta energy: -0.481 Dist. restrs. and SS energy: 52.386 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -547.060787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.060787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.375799 (E_RNA) where: Base-Base interactions energy: -231.343 where: short stacking energy: -170.436 Base-Backbone interact. energy: -3.508 local terms energy: -356.524919 where: bonds (distance) C4'-P energy: -118.664 bonds (distance) P-C4' energy: -125.052 flat angles C4'-P-C4' energy: -99.676 flat angles P-C4'-P energy: -44.838 tors. eta vs tors. theta energy: 31.705 Dist. restrs. and SS energy: 44.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1512.321159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.321159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.150489 (E_RNA) where: Base-Base interactions energy: -807.987 where: short stacking energy: -608.926 Base-Backbone interact. energy: -0.480 local terms energy: -746.683785 where: bonds (distance) C4'-P energy: -157.411 bonds (distance) P-C4' energy: -152.124 flat angles C4'-P-C4' energy: -173.092 flat angles P-C4'-P energy: -111.330 tors. eta vs tors. theta energy: -152.727 Dist. restrs. and SS energy: 42.829 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 55 Temperature: 0.964286 Total energy: -1242.478590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.478590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.341440 (E_RNA) where: Base-Base interactions energy: -630.787 where: short stacking energy: -497.538 Base-Backbone interact. energy: -1.168 local terms energy: -656.386012 where: bonds (distance) C4'-P energy: -148.410 bonds (distance) P-C4' energy: -155.345 flat angles C4'-P-C4' energy: -153.602 flat angles P-C4'-P energy: -82.263 tors. eta vs tors. theta energy: -116.765 Dist. restrs. and SS energy: 45.863 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 55 Temperature: 1.028571 Total energy: -1076.760805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.760805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.665646 (E_RNA) where: Base-Base interactions energy: -545.135 where: short stacking energy: -422.726 Base-Backbone interact. energy: -1.133 local terms energy: -582.397211 where: bonds (distance) C4'-P energy: -145.316 bonds (distance) P-C4' energy: -134.526 flat angles C4'-P-C4' energy: -139.036 flat angles P-C4'-P energy: -76.273 tors. eta vs tors. theta energy: -87.246 Dist. restrs. and SS energy: 51.905 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 55 Temperature: 1.092857 Total energy: -944.402677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.402677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.019527 (E_RNA) where: Base-Base interactions energy: -496.780 where: short stacking energy: -339.213 Base-Backbone interact. energy: 3.627 local terms energy: -505.866132 where: bonds (distance) C4'-P energy: -128.016 bonds (distance) P-C4' energy: -148.316 flat angles C4'-P-C4' energy: -125.634 flat angles P-C4'-P energy: -65.269 tors. eta vs tors. theta energy: -38.631 Dist. restrs. and SS energy: 54.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 55 Temperature: 1.157143 Total energy: -871.199822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.199822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.372523 (E_RNA) where: Base-Base interactions energy: -410.090 where: short stacking energy: -317.386 Base-Backbone interact. energy: -2.603 local terms energy: -494.679284 where: bonds (distance) C4'-P energy: -152.030 bonds (distance) P-C4' energy: -136.550 flat angles C4'-P-C4' energy: -119.484 flat angles P-C4'-P energy: -64.924 tors. eta vs tors. theta energy: -21.691 Dist. restrs. and SS energy: 36.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 55 Temperature: 1.221429 Total energy: -695.066376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.066376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.138677 (E_RNA) where: Base-Base interactions energy: -307.590 where: short stacking energy: -226.114 Base-Backbone interact. energy: 2.934 local terms energy: -444.482581 where: bonds (distance) C4'-P energy: -127.054 bonds (distance) P-C4' energy: -126.086 flat angles C4'-P-C4' energy: -122.972 flat angles P-C4'-P energy: -68.363 tors. eta vs tors. theta energy: -0.007 Dist. restrs. and SS energy: 54.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 55 Temperature: 1.285714 Total energy: -585.976387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.976387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.032614 (E_RNA) where: Base-Base interactions energy: -235.686 where: short stacking energy: -165.476 Base-Backbone interact. energy: 7.137 local terms energy: -415.483631 where: bonds (distance) C4'-P energy: -151.917 bonds (distance) P-C4' energy: -117.645 flat angles C4'-P-C4' energy: -101.966 flat angles P-C4'-P energy: -65.750 tors. eta vs tors. theta energy: 21.793 Dist. restrs. and SS energy: 58.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -571.959757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.959757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.240757 (E_RNA) where: Base-Base interactions energy: -246.787 where: short stacking energy: -184.751 Base-Backbone interact. energy: -0.396 local terms energy: -368.057963 where: bonds (distance) C4'-P energy: -121.157 bonds (distance) P-C4' energy: -110.931 flat angles C4'-P-C4' energy: -102.398 flat angles P-C4'-P energy: -52.617 tors. eta vs tors. theta energy: 19.044 Dist. restrs. and SS energy: 43.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1474.757953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.757953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.593942 (E_RNA) where: Base-Base interactions energy: -803.134 where: short stacking energy: -572.449 Base-Backbone interact. energy: -1.998 local terms energy: -719.461541 where: bonds (distance) C4'-P energy: -158.261 bonds (distance) P-C4' energy: -165.721 flat angles C4'-P-C4' energy: -154.848 flat angles P-C4'-P energy: -98.270 tors. eta vs tors. theta energy: -142.361 Dist. restrs. and SS energy: 49.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 56 Temperature: 0.964286 Total energy: -1230.071286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.071286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.479240 (E_RNA) where: Base-Base interactions energy: -615.276 where: short stacking energy: -464.023 Base-Backbone interact. energy: 0.888 local terms energy: -662.091368 where: bonds (distance) C4'-P energy: -140.936 bonds (distance) P-C4' energy: -165.492 flat angles C4'-P-C4' energy: -158.535 flat angles P-C4'-P energy: -82.560 tors. eta vs tors. theta energy: -114.569 Dist. restrs. and SS energy: 46.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.028571 Total energy: -1096.431023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.431023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.930922 (E_RNA) where: Base-Base interactions energy: -553.098 where: short stacking energy: -427.002 Base-Backbone interact. energy: -0.351 local terms energy: -591.482617 where: bonds (distance) C4'-P energy: -142.361 bonds (distance) P-C4' energy: -141.620 flat angles C4'-P-C4' energy: -137.150 flat angles P-C4'-P energy: -84.871 tors. eta vs tors. theta energy: -85.480 Dist. restrs. and SS energy: 48.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 56 Temperature: 1.092857 Total energy: -1014.343736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.343736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.827596 (E_RNA) where: Base-Base interactions energy: -517.443 where: short stacking energy: -366.114 Base-Backbone interact. energy: 1.658 local terms energy: -555.042732 where: bonds (distance) C4'-P energy: -122.989 bonds (distance) P-C4' energy: -145.039 flat angles C4'-P-C4' energy: -137.719 flat angles P-C4'-P energy: -89.471 tors. eta vs tors. theta energy: -59.824 Dist. restrs. and SS energy: 56.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 56 Temperature: 1.157143 Total energy: -801.351887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.351887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.760021 (E_RNA) where: Base-Base interactions energy: -350.454 where: short stacking energy: -280.171 Base-Backbone interact. energy: 9.376 local terms energy: -490.682806 where: bonds (distance) C4'-P energy: -127.981 bonds (distance) P-C4' energy: -130.265 flat angles C4'-P-C4' energy: -125.424 flat angles P-C4'-P energy: -73.467 tors. eta vs tors. theta energy: -33.547 Dist. restrs. and SS energy: 30.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 56 Temperature: 1.221429 Total energy: -746.365256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.365256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.796838 (E_RNA) where: Base-Base interactions energy: -369.777 where: short stacking energy: -271.369 Base-Backbone interact. energy: 5.247 local terms energy: -438.267095 where: bonds (distance) C4'-P energy: -117.473 bonds (distance) P-C4' energy: -124.499 flat angles C4'-P-C4' energy: -110.488 flat angles P-C4'-P energy: -75.459 tors. eta vs tors. theta energy: -10.348 Dist. restrs. and SS energy: 56.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 56 Temperature: 1.285714 Total energy: -635.841941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.841941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.406377 (E_RNA) where: Base-Base interactions energy: -255.509 where: short stacking energy: -193.237 Base-Backbone interact. energy: 0.482 local terms energy: -437.379380 where: bonds (distance) C4'-P energy: -128.330 bonds (distance) P-C4' energy: -145.887 flat angles C4'-P-C4' energy: -101.024 flat angles P-C4'-P energy: -60.516 tors. eta vs tors. theta energy: -1.622 Dist. restrs. and SS energy: 56.564 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -573.629397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.629397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.388497 (E_RNA) where: Base-Base interactions energy: -251.019 where: short stacking energy: -174.155 Base-Backbone interact. energy: -2.361 local terms energy: -370.009003 where: bonds (distance) C4'-P energy: -130.878 bonds (distance) P-C4' energy: -117.834 flat angles C4'-P-C4' energy: -96.775 flat angles P-C4'-P energy: -58.934 tors. eta vs tors. theta energy: 34.412 Dist. restrs. and SS energy: 49.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1524.314271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.314271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.383690 (E_RNA) where: Base-Base interactions energy: -830.489 where: short stacking energy: -588.172 Base-Backbone interact. energy: -0.346 local terms energy: -735.548494 where: bonds (distance) C4'-P energy: -167.993 bonds (distance) P-C4' energy: -156.400 flat angles C4'-P-C4' energy: -170.611 flat angles P-C4'-P energy: -95.882 tors. eta vs tors. theta energy: -144.662 Dist. restrs. and SS energy: 42.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 57 Temperature: 0.964286 Total energy: -1205.514880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.514880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.936875 (E_RNA) where: Base-Base interactions energy: -597.598 where: short stacking energy: -461.990 Base-Backbone interact. energy: -1.845 local terms energy: -649.494131 where: bonds (distance) C4'-P energy: -150.102 bonds (distance) P-C4' energy: -167.123 flat angles C4'-P-C4' energy: -135.990 flat angles P-C4'-P energy: -99.318 tors. eta vs tors. theta energy: -96.960 Dist. restrs. and SS energy: 43.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.028571 Total energy: -1071.879958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.879958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.924433 (E_RNA) where: Base-Base interactions energy: -522.459 where: short stacking energy: -392.157 Base-Backbone interact. energy: -1.709 local terms energy: -591.756140 where: bonds (distance) C4'-P energy: -137.992 bonds (distance) P-C4' energy: -144.332 flat angles C4'-P-C4' energy: -155.133 flat angles P-C4'-P energy: -70.628 tors. eta vs tors. theta energy: -83.670 Dist. restrs. and SS energy: 44.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 57 Temperature: 1.092857 Total energy: -986.564306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.564306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.801649 (E_RNA) where: Base-Base interactions energy: -520.382 where: short stacking energy: -373.209 Base-Backbone interact. energy: -2.881 local terms energy: -525.538795 where: bonds (distance) C4'-P energy: -123.876 bonds (distance) P-C4' energy: -124.446 flat angles C4'-P-C4' energy: -142.567 flat angles P-C4'-P energy: -90.998 tors. eta vs tors. theta energy: -43.651 Dist. restrs. and SS energy: 62.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 57 Temperature: 1.157143 Total energy: -801.966341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.966341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.441606 (E_RNA) where: Base-Base interactions energy: -348.579 where: short stacking energy: -262.101 Base-Backbone interact. energy: -0.177 local terms energy: -492.686215 where: bonds (distance) C4'-P energy: -141.489 bonds (distance) P-C4' energy: -142.397 flat angles C4'-P-C4' energy: -120.759 flat angles P-C4'-P energy: -55.795 tors. eta vs tors. theta energy: -32.247 Dist. restrs. and SS energy: 39.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 57 Temperature: 1.221429 Total energy: -749.035458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.035458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.043040 (E_RNA) where: Base-Base interactions energy: -309.490 where: short stacking energy: -225.309 Base-Backbone interact. energy: 5.400 local terms energy: -492.953548 where: bonds (distance) C4'-P energy: -137.456 bonds (distance) P-C4' energy: -146.390 flat angles C4'-P-C4' energy: -113.734 flat angles P-C4'-P energy: -73.372 tors. eta vs tors. theta energy: -22.001 Dist. restrs. and SS energy: 48.008 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 57 Temperature: 1.285714 Total energy: -690.988438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.988438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.042259 (E_RNA) where: Base-Base interactions energy: -305.545 where: short stacking energy: -226.362 Base-Backbone interact. energy: -0.581 local terms energy: -441.916891 where: bonds (distance) C4'-P energy: -120.077 bonds (distance) P-C4' energy: -138.262 flat angles C4'-P-C4' energy: -112.974 flat angles P-C4'-P energy: -60.896 tors. eta vs tors. theta energy: -9.708 Dist. restrs. and SS energy: 57.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -581.048072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.048072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.247329 (E_RNA) where: Base-Base interactions energy: -245.137 where: short stacking energy: -189.689 Base-Backbone interact. energy: -1.004 local terms energy: -382.105602 where: bonds (distance) C4'-P energy: -110.176 bonds (distance) P-C4' energy: -133.493 flat angles C4'-P-C4' energy: -95.202 flat angles P-C4'-P energy: -55.929 tors. eta vs tors. theta energy: 12.694 Dist. restrs. and SS energy: 47.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1498.804076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1498.804076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.943479 (E_RNA) where: Base-Base interactions energy: -836.282 where: short stacking energy: -584.934 Base-Backbone interact. energy: -1.039 local terms energy: -703.622513 where: bonds (distance) C4'-P energy: -139.611 bonds (distance) P-C4' energy: -156.760 flat angles C4'-P-C4' energy: -151.301 flat angles P-C4'-P energy: -111.900 tors. eta vs tors. theta energy: -144.051 Dist. restrs. and SS energy: 42.139 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 58 Temperature: 0.964286 Total energy: -1251.871216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.871216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.966394 (E_RNA) where: Base-Base interactions energy: -623.345 where: short stacking energy: -500.789 Base-Backbone interact. energy: -1.002 local terms energy: -666.618671 where: bonds (distance) C4'-P energy: -140.502 bonds (distance) P-C4' energy: -167.904 flat angles C4'-P-C4' energy: -156.687 flat angles P-C4'-P energy: -84.413 tors. eta vs tors. theta energy: -117.113 Dist. restrs. and SS energy: 39.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 58 Temperature: 1.028571 Total energy: -1078.638692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.638692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.430354 (E_RNA) where: Base-Base interactions energy: -533.314 where: short stacking energy: -390.096 Base-Backbone interact. energy: -1.141 local terms energy: -583.975642 where: bonds (distance) C4'-P energy: -142.989 bonds (distance) P-C4' energy: -157.188 flat angles C4'-P-C4' energy: -124.850 flat angles P-C4'-P energy: -79.991 tors. eta vs tors. theta energy: -78.957 Dist. restrs. and SS energy: 39.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 58 Temperature: 1.092857 Total energy: -998.558054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.558054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.730808 (E_RNA) where: Base-Base interactions energy: -506.687 where: short stacking energy: -406.028 Base-Backbone interact. energy: 0.694 local terms energy: -541.737178 where: bonds (distance) C4'-P energy: -117.961 bonds (distance) P-C4' energy: -134.097 flat angles C4'-P-C4' energy: -133.213 flat angles P-C4'-P energy: -85.853 tors. eta vs tors. theta energy: -70.614 Dist. restrs. and SS energy: 49.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.157143 Total energy: -887.522807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.522807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.644972 (E_RNA) where: Base-Base interactions energy: -420.855 where: short stacking energy: -322.315 Base-Backbone interact. energy: -3.341 local terms energy: -502.448591 where: bonds (distance) C4'-P energy: -116.957 bonds (distance) P-C4' energy: -134.731 flat angles C4'-P-C4' energy: -125.801 flat angles P-C4'-P energy: -67.802 tors. eta vs tors. theta energy: -57.158 Dist. restrs. and SS energy: 39.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 58 Temperature: 1.221429 Total energy: -705.519515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.519515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.380585 (E_RNA) where: Base-Base interactions energy: -306.481 where: short stacking energy: -241.642 Base-Backbone interact. energy: -1.080 local terms energy: -454.819877 where: bonds (distance) C4'-P energy: -129.804 bonds (distance) P-C4' energy: -129.294 flat angles C4'-P-C4' energy: -100.862 flat angles P-C4'-P energy: -73.173 tors. eta vs tors. theta energy: -21.687 Dist. restrs. and SS energy: 56.861 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 58 Temperature: 1.285714 Total energy: -681.216085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.216085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.335862 (E_RNA) where: Base-Base interactions energy: -320.757 where: short stacking energy: -218.247 Base-Backbone interact. energy: 3.454 local terms energy: -423.032830 where: bonds (distance) C4'-P energy: -121.319 bonds (distance) P-C4' energy: -127.108 flat angles C4'-P-C4' energy: -117.903 flat angles P-C4'-P energy: -56.203 tors. eta vs tors. theta energy: -0.500 Dist. restrs. and SS energy: 59.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -551.901194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.901194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.597813 (E_RNA) where: Base-Base interactions energy: -246.218 where: short stacking energy: -188.685 Base-Backbone interact. energy: 2.076 local terms energy: -365.455914 where: bonds (distance) C4'-P energy: -118.930 bonds (distance) P-C4' energy: -114.728 flat angles C4'-P-C4' energy: -103.932 flat angles P-C4'-P energy: -42.082 tors. eta vs tors. theta energy: 14.216 Dist. restrs. and SS energy: 57.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1444.536583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.536583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.011736 (E_RNA) where: Base-Base interactions energy: -780.839 where: short stacking energy: -564.447 Base-Backbone interact. energy: -2.319 local terms energy: -701.853355 where: bonds (distance) C4'-P energy: -152.459 bonds (distance) P-C4' energy: -153.685 flat angles C4'-P-C4' energy: -164.580 flat angles P-C4'-P energy: -89.330 tors. eta vs tors. theta energy: -141.800 Dist. restrs. and SS energy: 40.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 59 Temperature: 0.964286 Total energy: -1269.708040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.708040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.038219 (E_RNA) where: Base-Base interactions energy: -662.759 where: short stacking energy: -516.191 Base-Backbone interact. energy: 0.603 local terms energy: -647.882393 where: bonds (distance) C4'-P energy: -146.544 bonds (distance) P-C4' energy: -151.951 flat angles C4'-P-C4' energy: -157.030 flat angles P-C4'-P energy: -87.997 tors. eta vs tors. theta energy: -104.361 Dist. restrs. and SS energy: 40.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.028571 Total energy: -1052.570010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.570010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.485947 (E_RNA) where: Base-Base interactions energy: -508.899 where: short stacking energy: -347.541 Base-Backbone interact. energy: -1.914 local terms energy: -589.672865 where: bonds (distance) C4'-P energy: -138.202 bonds (distance) P-C4' energy: -151.702 flat angles C4'-P-C4' energy: -143.879 flat angles P-C4'-P energy: -91.411 tors. eta vs tors. theta energy: -64.478 Dist. restrs. and SS energy: 47.916 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 59 Temperature: 1.092857 Total energy: -996.991187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.991187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.817601 (E_RNA) where: Base-Base interactions energy: -484.494 where: short stacking energy: -367.355 Base-Backbone interact. energy: 0.811 local terms energy: -571.134475 where: bonds (distance) C4'-P energy: -139.606 bonds (distance) P-C4' energy: -149.627 flat angles C4'-P-C4' energy: -141.626 flat angles P-C4'-P energy: -72.753 tors. eta vs tors. theta energy: -67.523 Dist. restrs. and SS energy: 57.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 59 Temperature: 1.157143 Total energy: -878.580098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.580098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.522057 (E_RNA) where: Base-Base interactions energy: -409.922 where: short stacking energy: -301.868 Base-Backbone interact. energy: -2.830 local terms energy: -504.770162 where: bonds (distance) C4'-P energy: -136.825 bonds (distance) P-C4' energy: -145.707 flat angles C4'-P-C4' energy: -104.595 flat angles P-C4'-P energy: -71.272 tors. eta vs tors. theta energy: -46.372 Dist. restrs. and SS energy: 38.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 59 Temperature: 1.221429 Total energy: -665.707435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.707435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.684634 (E_RNA) where: Base-Base interactions energy: -275.587 where: short stacking energy: -215.286 Base-Backbone interact. energy: 2.199 local terms energy: -437.297392 where: bonds (distance) C4'-P energy: -132.432 bonds (distance) P-C4' energy: -132.272 flat angles C4'-P-C4' energy: -111.767 flat angles P-C4'-P energy: -73.639 tors. eta vs tors. theta energy: 12.812 Dist. restrs. and SS energy: 44.977 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 59 Temperature: 1.285714 Total energy: -705.558608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.558608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.116092 (E_RNA) where: Base-Base interactions energy: -369.341 where: short stacking energy: -251.171 Base-Backbone interact. energy: 2.664 local terms energy: -400.439105 where: bonds (distance) C4'-P energy: -97.921 bonds (distance) P-C4' energy: -117.290 flat angles C4'-P-C4' energy: -113.728 flat angles P-C4'-P energy: -68.273 tors. eta vs tors. theta energy: -3.228 Dist. restrs. and SS energy: 61.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -572.475817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.475817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.736449 (E_RNA) where: Base-Base interactions energy: -233.864 where: short stacking energy: -180.839 Base-Backbone interact. energy: 5.177 local terms energy: -389.049604 where: bonds (distance) C4'-P energy: -100.804 bonds (distance) P-C4' energy: -130.347 flat angles C4'-P-C4' energy: -111.151 flat angles P-C4'-P energy: -51.640 tors. eta vs tors. theta energy: 4.892 Dist. restrs. and SS energy: 45.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1435.779996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.779996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.422341 (E_RNA) where: Base-Base interactions energy: -771.018 where: short stacking energy: -543.071 Base-Backbone interact. energy: -2.150 local terms energy: -699.254553 where: bonds (distance) C4'-P energy: -144.566 bonds (distance) P-C4' energy: -158.812 flat angles C4'-P-C4' energy: -160.032 flat angles P-C4'-P energy: -102.650 tors. eta vs tors. theta energy: -133.194 Dist. restrs. and SS energy: 36.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.964286 Total energy: -1222.322604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.322604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1261.291326 (E_RNA) where: Base-Base interactions energy: -608.275 where: short stacking energy: -477.922 Base-Backbone interact. energy: 1.758 local terms energy: -654.774449 where: bonds (distance) C4'-P energy: -147.259 bonds (distance) P-C4' energy: -151.018 flat angles C4'-P-C4' energy: -154.269 flat angles P-C4'-P energy: -82.002 tors. eta vs tors. theta energy: -120.226 Dist. restrs. and SS energy: 38.969 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.028571 Total energy: -1088.423197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.423197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.818047 (E_RNA) where: Base-Base interactions energy: -555.898 where: short stacking energy: -408.463 Base-Backbone interact. energy: -1.480 local terms energy: -581.439907 where: bonds (distance) C4'-P energy: -136.124 bonds (distance) P-C4' energy: -138.681 flat angles C4'-P-C4' energy: -141.011 flat angles P-C4'-P energy: -86.625 tors. eta vs tors. theta energy: -78.998 Dist. restrs. and SS energy: 50.395 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 60 Temperature: 1.092857 Total energy: -979.488961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.488961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.669358 (E_RNA) where: Base-Base interactions energy: -485.221 where: short stacking energy: -386.717 Base-Backbone interact. energy: -0.058 local terms energy: -549.390519 where: bonds (distance) C4'-P energy: -138.622 bonds (distance) P-C4' energy: -121.940 flat angles C4'-P-C4' energy: -126.105 flat angles P-C4'-P energy: -84.803 tors. eta vs tors. theta energy: -77.922 Dist. restrs. and SS energy: 55.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 60 Temperature: 1.157143 Total energy: -844.466164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.466164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.163306 (E_RNA) where: Base-Base interactions energy: -406.590 where: short stacking energy: -307.936 Base-Backbone interact. energy: 4.074 local terms energy: -484.647324 where: bonds (distance) C4'-P energy: -125.819 bonds (distance) P-C4' energy: -140.122 flat angles C4'-P-C4' energy: -105.117 flat angles P-C4'-P energy: -82.462 tors. eta vs tors. theta energy: -31.127 Dist. restrs. and SS energy: 42.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 60 Temperature: 1.221429 Total energy: -685.684778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.684778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.871371 (E_RNA) where: Base-Base interactions energy: -308.405 where: short stacking energy: -236.141 Base-Backbone interact. energy: 9.083 local terms energy: -429.549426 where: bonds (distance) C4'-P energy: -132.301 bonds (distance) P-C4' energy: -120.075 flat angles C4'-P-C4' energy: -105.244 flat angles P-C4'-P energy: -68.460 tors. eta vs tors. theta energy: -3.469 Dist. restrs. and SS energy: 43.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 60 Temperature: 1.285714 Total energy: -693.707845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.707845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.419413 (E_RNA) where: Base-Base interactions energy: -336.476 where: short stacking energy: -239.655 Base-Backbone interact. energy: 1.643 local terms energy: -402.586734 where: bonds (distance) C4'-P energy: -114.984 bonds (distance) P-C4' energy: -127.337 flat angles C4'-P-C4' energy: -88.835 flat angles P-C4'-P energy: -68.123 tors. eta vs tors. theta energy: -3.308 Dist. restrs. and SS energy: 43.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -561.909563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.909563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.118284 (E_RNA) where: Base-Base interactions energy: -239.940 where: short stacking energy: -182.203 Base-Backbone interact. energy: 0.521 local terms energy: -379.699077 where: bonds (distance) C4'-P energy: -106.245 bonds (distance) P-C4' energy: -127.587 flat angles C4'-P-C4' energy: -98.664 flat angles P-C4'-P energy: -57.039 tors. eta vs tors. theta energy: 9.836 Dist. restrs. and SS energy: 57.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1447.449027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.449027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1495.024704 (E_RNA) where: Base-Base interactions energy: -794.997 where: short stacking energy: -561.844 Base-Backbone interact. energy: -0.292 local terms energy: -699.735685 where: bonds (distance) C4'-P energy: -149.552 bonds (distance) P-C4' energy: -157.427 flat angles C4'-P-C4' energy: -160.732 flat angles P-C4'-P energy: -92.032 tors. eta vs tors. theta energy: -139.992 Dist. restrs. and SS energy: 47.576 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 61 Temperature: 0.964286 Total energy: -1237.622393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.622393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.446375 (E_RNA) where: Base-Base interactions energy: -614.078 where: short stacking energy: -470.811 Base-Backbone interact. energy: -1.635 local terms energy: -662.733269 where: bonds (distance) C4'-P energy: -154.068 bonds (distance) P-C4' energy: -155.724 flat angles C4'-P-C4' energy: -147.636 flat angles P-C4'-P energy: -96.602 tors. eta vs tors. theta energy: -108.703 Dist. restrs. and SS energy: 40.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.028571 Total energy: -1146.609533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.609533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1205.241976 (E_RNA) where: Base-Base interactions energy: -584.504 where: short stacking energy: -433.580 Base-Backbone interact. energy: 1.665 local terms energy: -622.403179 where: bonds (distance) C4'-P energy: -133.966 bonds (distance) P-C4' energy: -152.810 flat angles C4'-P-C4' energy: -149.267 flat angles P-C4'-P energy: -88.190 tors. eta vs tors. theta energy: -98.171 Dist. restrs. and SS energy: 58.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 61 Temperature: 1.092857 Total energy: -965.846604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.846604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.764202 (E_RNA) where: Base-Base interactions energy: -464.013 where: short stacking energy: -365.009 Base-Backbone interact. energy: -1.792 local terms energy: -562.958528 where: bonds (distance) C4'-P energy: -148.318 bonds (distance) P-C4' energy: -125.630 flat angles C4'-P-C4' energy: -146.037 flat angles P-C4'-P energy: -83.249 tors. eta vs tors. theta energy: -59.724 Dist. restrs. and SS energy: 62.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.157143 Total energy: -831.008637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.008637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.896119 (E_RNA) where: Base-Base interactions energy: -401.932 where: short stacking energy: -291.136 Base-Backbone interact. energy: 4.275 local terms energy: -469.238696 where: bonds (distance) C4'-P energy: -114.090 bonds (distance) P-C4' energy: -140.481 flat angles C4'-P-C4' energy: -107.247 flat angles P-C4'-P energy: -68.998 tors. eta vs tors. theta energy: -38.424 Dist. restrs. and SS energy: 35.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 61 Temperature: 1.221429 Total energy: -657.104198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.104198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.673390 (E_RNA) where: Base-Base interactions energy: -277.486 where: short stacking energy: -217.375 Base-Backbone interact. energy: -0.017 local terms energy: -433.170226 where: bonds (distance) C4'-P energy: -122.540 bonds (distance) P-C4' energy: -120.982 flat angles C4'-P-C4' energy: -124.928 flat angles P-C4'-P energy: -88.191 tors. eta vs tors. theta energy: 23.470 Dist. restrs. and SS energy: 53.569 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 61 Temperature: 1.285714 Total energy: -617.143568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.143568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.199398 (E_RNA) where: Base-Base interactions energy: -301.773 where: short stacking energy: -220.629 Base-Backbone interact. energy: 3.767 local terms energy: -392.193635 where: bonds (distance) C4'-P energy: -115.278 bonds (distance) P-C4' energy: -123.946 flat angles C4'-P-C4' energy: -88.692 flat angles P-C4'-P energy: -74.495 tors. eta vs tors. theta energy: 10.217 Dist. restrs. and SS energy: 73.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -547.290213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.290213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.785518 (E_RNA) where: Base-Base interactions energy: -233.684 where: short stacking energy: -186.162 Base-Backbone interact. energy: 3.516 local terms energy: -387.618357 where: bonds (distance) C4'-P energy: -118.996 bonds (distance) P-C4' energy: -133.791 flat angles C4'-P-C4' energy: -83.496 flat angles P-C4'-P energy: -72.727 tors. eta vs tors. theta energy: 21.392 Dist. restrs. and SS energy: 70.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1488.004804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.004804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.767519 (E_RNA) where: Base-Base interactions energy: -808.712 where: short stacking energy: -570.545 Base-Backbone interact. energy: -3.910 local terms energy: -721.145485 where: bonds (distance) C4'-P energy: -145.357 bonds (distance) P-C4' energy: -168.186 flat angles C4'-P-C4' energy: -160.442 flat angles P-C4'-P energy: -99.082 tors. eta vs tors. theta energy: -148.079 Dist. restrs. and SS energy: 45.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 62 Temperature: 0.964286 Total energy: -1243.182082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.182082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.447273 (E_RNA) where: Base-Base interactions energy: -636.240 where: short stacking energy: -480.300 Base-Backbone interact. energy: 0.017 local terms energy: -648.224580 where: bonds (distance) C4'-P energy: -154.393 bonds (distance) P-C4' energy: -150.865 flat angles C4'-P-C4' energy: -161.206 flat angles P-C4'-P energy: -85.020 tors. eta vs tors. theta energy: -96.741 Dist. restrs. and SS energy: 41.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.028571 Total energy: -1200.777201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.777201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.128693 (E_RNA) where: Base-Base interactions energy: -623.705 where: short stacking energy: -467.366 Base-Backbone interact. energy: -4.037 local terms energy: -626.387200 where: bonds (distance) C4'-P energy: -156.718 bonds (distance) P-C4' energy: -143.863 flat angles C4'-P-C4' energy: -137.937 flat angles P-C4'-P energy: -90.626 tors. eta vs tors. theta energy: -97.242 Dist. restrs. and SS energy: 53.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 62 Temperature: 1.092857 Total energy: -958.303894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.303894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.977931 (E_RNA) where: Base-Base interactions energy: -497.738 where: short stacking energy: -372.913 Base-Backbone interact. energy: -1.457 local terms energy: -511.783328 where: bonds (distance) C4'-P energy: -140.095 bonds (distance) P-C4' energy: -132.193 flat angles C4'-P-C4' energy: -109.773 flat angles P-C4'-P energy: -82.594 tors. eta vs tors. theta energy: -47.128 Dist. restrs. and SS energy: 52.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.157143 Total energy: -915.096621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.096621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.901547 (E_RNA) where: Base-Base interactions energy: -409.259 where: short stacking energy: -301.554 Base-Backbone interact. energy: -3.328 local terms energy: -544.314800 where: bonds (distance) C4'-P energy: -149.625 bonds (distance) P-C4' energy: -137.090 flat angles C4'-P-C4' energy: -130.719 flat angles P-C4'-P energy: -82.765 tors. eta vs tors. theta energy: -44.116 Dist. restrs. and SS energy: 41.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 62 Temperature: 1.221429 Total energy: -748.046293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.046293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.657278 (E_RNA) where: Base-Base interactions energy: -350.548 where: short stacking energy: -282.410 Base-Backbone interact. energy: 4.844 local terms energy: -452.952764 where: bonds (distance) C4'-P energy: -127.939 bonds (distance) P-C4' energy: -120.915 flat angles C4'-P-C4' energy: -101.399 flat angles P-C4'-P energy: -77.922 tors. eta vs tors. theta energy: -24.778 Dist. restrs. and SS energy: 50.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.285714 Total energy: -628.980564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.980564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.691577 (E_RNA) where: Base-Base interactions energy: -256.612 where: short stacking energy: -215.778 Base-Backbone interact. energy: 3.710 local terms energy: -434.789343 where: bonds (distance) C4'-P energy: -124.999 bonds (distance) P-C4' energy: -137.360 flat angles C4'-P-C4' energy: -104.303 flat angles P-C4'-P energy: -64.066 tors. eta vs tors. theta energy: -4.061 Dist. restrs. and SS energy: 58.711 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -584.165065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.165065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.299384 (E_RNA) where: Base-Base interactions energy: -270.841 where: short stacking energy: -186.213 Base-Backbone interact. energy: -3.009 local terms energy: -371.448953 where: bonds (distance) C4'-P energy: -126.663 bonds (distance) P-C4' energy: -120.865 flat angles C4'-P-C4' energy: -100.552 flat angles P-C4'-P energy: -60.783 tors. eta vs tors. theta energy: 37.414 Dist. restrs. and SS energy: 61.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1506.947211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.947211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.471666 (E_RNA) where: Base-Base interactions energy: -830.252 where: short stacking energy: -568.782 Base-Backbone interact. energy: -0.752 local terms energy: -712.468086 where: bonds (distance) C4'-P energy: -148.476 bonds (distance) P-C4' energy: -166.160 flat angles C4'-P-C4' energy: -156.105 flat angles P-C4'-P energy: -93.430 tors. eta vs tors. theta energy: -148.296 Dist. restrs. and SS energy: 36.524 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 63 Temperature: 0.964286 Total energy: -1206.035600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.035600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.834346 (E_RNA) where: Base-Base interactions energy: -625.376 where: short stacking energy: -471.694 Base-Backbone interact. energy: 0.022 local terms energy: -633.480731 where: bonds (distance) C4'-P energy: -154.486 bonds (distance) P-C4' energy: -161.473 flat angles C4'-P-C4' energy: -136.418 flat angles P-C4'-P energy: -83.934 tors. eta vs tors. theta energy: -97.169 Dist. restrs. and SS energy: 52.799 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.028571 Total energy: -1112.141972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.141972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.111806 (E_RNA) where: Base-Base interactions energy: -593.019 where: short stacking energy: -420.964 Base-Backbone interact. energy: -1.719 local terms energy: -567.373921 where: bonds (distance) C4'-P energy: -132.690 bonds (distance) P-C4' energy: -143.279 flat angles C4'-P-C4' energy: -140.382 flat angles P-C4'-P energy: -84.410 tors. eta vs tors. theta energy: -66.614 Dist. restrs. and SS energy: 49.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 63 Temperature: 1.092857 Total energy: -1064.995899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.995899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.289769 (E_RNA) where: Base-Base interactions energy: -552.773 where: short stacking energy: -410.455 Base-Backbone interact. energy: 1.563 local terms energy: -558.079873 where: bonds (distance) C4'-P energy: -126.766 bonds (distance) P-C4' energy: -137.999 flat angles C4'-P-C4' energy: -135.310 flat angles P-C4'-P energy: -82.350 tors. eta vs tors. theta energy: -75.656 Dist. restrs. and SS energy: 44.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 63 Temperature: 1.157143 Total energy: -900.042907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.042907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.483230 (E_RNA) where: Base-Base interactions energy: -453.883 where: short stacking energy: -299.955 Base-Backbone interact. energy: -4.324 local terms energy: -508.276697 where: bonds (distance) C4'-P energy: -148.520 bonds (distance) P-C4' energy: -135.022 flat angles C4'-P-C4' energy: -102.811 flat angles P-C4'-P energy: -71.712 tors. eta vs tors. theta energy: -50.212 Dist. restrs. and SS energy: 66.440 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 63 Temperature: 1.221429 Total energy: -757.627478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.627478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.498598 (E_RNA) where: Base-Base interactions energy: -366.382 where: short stacking energy: -274.016 Base-Backbone interact. energy: -1.938 local terms energy: -451.179020 where: bonds (distance) C4'-P energy: -126.391 bonds (distance) P-C4' energy: -133.050 flat angles C4'-P-C4' energy: -107.042 flat angles P-C4'-P energy: -65.368 tors. eta vs tors. theta energy: -19.328 Dist. restrs. and SS energy: 61.871 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.285714 Total energy: -660.198419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.198419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.541600 (E_RNA) where: Base-Base interactions energy: -282.004 where: short stacking energy: -223.267 Base-Backbone interact. energy: -1.211 local terms energy: -428.326705 where: bonds (distance) C4'-P energy: -117.471 bonds (distance) P-C4' energy: -135.445 flat angles C4'-P-C4' energy: -101.505 flat angles P-C4'-P energy: -74.586 tors. eta vs tors. theta energy: 0.680 Dist. restrs. and SS energy: 51.343 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -579.745461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.745461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.152048 (E_RNA) where: Base-Base interactions energy: -273.653 where: short stacking energy: -194.794 Base-Backbone interact. energy: 0.431 local terms energy: -370.929434 where: bonds (distance) C4'-P energy: -126.309 bonds (distance) P-C4' energy: -123.294 flat angles C4'-P-C4' energy: -88.844 flat angles P-C4'-P energy: -64.687 tors. eta vs tors. theta energy: 32.206 Dist. restrs. and SS energy: 64.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1507.894140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.894140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.316238 (E_RNA) where: Base-Base interactions energy: -822.540 where: short stacking energy: -568.507 Base-Backbone interact. energy: -1.068 local terms energy: -717.708023 where: bonds (distance) C4'-P energy: -154.480 bonds (distance) P-C4' energy: -146.221 flat angles C4'-P-C4' energy: -168.991 flat angles P-C4'-P energy: -106.330 tors. eta vs tors. theta energy: -141.686 Dist. restrs. and SS energy: 33.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 64 Temperature: 0.964286 Total energy: -1181.710438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.710438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.334264 (E_RNA) where: Base-Base interactions energy: -607.293 where: short stacking energy: -447.608 Base-Backbone interact. energy: 0.261 local terms energy: -622.302244 where: bonds (distance) C4'-P energy: -136.655 bonds (distance) P-C4' energy: -156.554 flat angles C4'-P-C4' energy: -140.530 flat angles P-C4'-P energy: -102.436 tors. eta vs tors. theta energy: -86.126 Dist. restrs. and SS energy: 47.624 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.028571 Total energy: -1169.504153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.504153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.164441 (E_RNA) where: Base-Base interactions energy: -612.968 where: short stacking energy: -473.006 Base-Backbone interact. energy: 4.240 local terms energy: -601.436092 where: bonds (distance) C4'-P energy: -132.027 bonds (distance) P-C4' energy: -147.432 flat angles C4'-P-C4' energy: -136.706 flat angles P-C4'-P energy: -80.152 tors. eta vs tors. theta energy: -105.119 Dist. restrs. and SS energy: 40.660 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 64 Temperature: 1.092857 Total energy: -996.604616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.604616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.378379 (E_RNA) where: Base-Base interactions energy: -505.022 where: short stacking energy: -353.901 Base-Backbone interact. energy: -0.024 local terms energy: -537.333212 where: bonds (distance) C4'-P energy: -100.775 bonds (distance) P-C4' energy: -156.600 flat angles C4'-P-C4' energy: -131.542 flat angles P-C4'-P energy: -80.541 tors. eta vs tors. theta energy: -67.876 Dist. restrs. and SS energy: 45.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 64 Temperature: 1.157143 Total energy: -959.635999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.635999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.932141 (E_RNA) where: Base-Base interactions energy: -515.133 where: short stacking energy: -339.607 Base-Backbone interact. energy: -0.693 local terms energy: -509.106447 where: bonds (distance) C4'-P energy: -125.450 bonds (distance) P-C4' energy: -147.022 flat angles C4'-P-C4' energy: -124.632 flat angles P-C4'-P energy: -70.856 tors. eta vs tors. theta energy: -41.145 Dist. restrs. and SS energy: 65.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 64 Temperature: 1.221429 Total energy: -731.941292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.941292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.570371 (E_RNA) where: Base-Base interactions energy: -360.127 where: short stacking energy: -271.299 Base-Backbone interact. energy: 0.307 local terms energy: -426.750967 where: bonds (distance) C4'-P energy: -112.168 bonds (distance) P-C4' energy: -133.862 flat angles C4'-P-C4' energy: -109.204 flat angles P-C4'-P energy: -49.934 tors. eta vs tors. theta energy: -21.583 Dist. restrs. and SS energy: 54.629 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 64 Temperature: 1.285714 Total energy: -646.761609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.761609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.233277 (E_RNA) where: Base-Base interactions energy: -250.300 where: short stacking energy: -181.831 Base-Backbone interact. energy: 2.356 local terms energy: -450.289558 where: bonds (distance) C4'-P energy: -128.140 bonds (distance) P-C4' energy: -136.328 flat angles C4'-P-C4' energy: -138.480 flat angles P-C4'-P energy: -63.782 tors. eta vs tors. theta energy: 16.440 Dist. restrs. and SS energy: 51.472 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -597.104149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.104149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.419147 (E_RNA) where: Base-Base interactions energy: -243.691 where: short stacking energy: -193.873 Base-Backbone interact. energy: 1.877 local terms energy: -409.604732 where: bonds (distance) C4'-P energy: -124.830 bonds (distance) P-C4' energy: -132.077 flat angles C4'-P-C4' energy: -98.363 flat angles P-C4'-P energy: -67.439 tors. eta vs tors. theta energy: 13.104 Dist. restrs. and SS energy: 54.315 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1542.832649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.832649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.909895 (E_RNA) where: Base-Base interactions energy: -857.440 where: short stacking energy: -601.779 Base-Backbone interact. energy: -1.257 local terms energy: -724.213682 where: bonds (distance) C4'-P energy: -153.908 bonds (distance) P-C4' energy: -159.641 flat angles C4'-P-C4' energy: -154.715 flat angles P-C4'-P energy: -97.713 tors. eta vs tors. theta energy: -158.236 Dist. restrs. and SS energy: 40.077 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 65 Temperature: 0.964286 Total energy: -1166.767588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.767588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.771591 (E_RNA) where: Base-Base interactions energy: -597.906 where: short stacking energy: -463.905 Base-Backbone interact. energy: 4.610 local terms energy: -619.475353 where: bonds (distance) C4'-P energy: -130.557 bonds (distance) P-C4' energy: -150.443 flat angles C4'-P-C4' energy: -152.889 flat angles P-C4'-P energy: -91.393 tors. eta vs tors. theta energy: -94.193 Dist. restrs. and SS energy: 46.004 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 65 Temperature: 1.028571 Total energy: -1164.292104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.292104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.012701 (E_RNA) where: Base-Base interactions energy: -605.353 where: short stacking energy: -449.925 Base-Backbone interact. energy: -1.333 local terms energy: -599.327148 where: bonds (distance) C4'-P energy: -128.154 bonds (distance) P-C4' energy: -143.195 flat angles C4'-P-C4' energy: -143.395 flat angles P-C4'-P energy: -91.393 tors. eta vs tors. theta energy: -93.191 Dist. restrs. and SS energy: 41.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 65 Temperature: 1.092857 Total energy: -1033.335458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.335458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.789623 (E_RNA) where: Base-Base interactions energy: -502.192 where: short stacking energy: -365.141 Base-Backbone interact. energy: -1.797 local terms energy: -560.800567 where: bonds (distance) C4'-P energy: -142.088 bonds (distance) P-C4' energy: -129.625 flat angles C4'-P-C4' energy: -131.211 flat angles P-C4'-P energy: -102.233 tors. eta vs tors. theta energy: -55.643 Dist. restrs. and SS energy: 31.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 65 Temperature: 1.157143 Total energy: -891.716761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.716761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.137141 (E_RNA) where: Base-Base interactions energy: -442.138 where: short stacking energy: -313.958 Base-Backbone interact. energy: 0.985 local terms energy: -514.983777 where: bonds (distance) C4'-P energy: -128.875 bonds (distance) P-C4' energy: -147.429 flat angles C4'-P-C4' energy: -133.375 flat angles P-C4'-P energy: -67.000 tors. eta vs tors. theta energy: -38.304 Dist. restrs. and SS energy: 64.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 65 Temperature: 1.221429 Total energy: -696.074306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.074306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.288436 (E_RNA) where: Base-Base interactions energy: -322.112 where: short stacking energy: -239.007 Base-Backbone interact. energy: 3.470 local terms energy: -431.646235 where: bonds (distance) C4'-P energy: -112.698 bonds (distance) P-C4' energy: -133.551 flat angles C4'-P-C4' energy: -112.853 flat angles P-C4'-P energy: -79.333 tors. eta vs tors. theta energy: 6.788 Dist. restrs. and SS energy: 54.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 65 Temperature: 1.285714 Total energy: -725.526994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.526994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.799778 (E_RNA) where: Base-Base interactions energy: -318.221 where: short stacking energy: -260.167 Base-Backbone interact. energy: -1.134 local terms energy: -456.444779 where: bonds (distance) C4'-P energy: -137.005 bonds (distance) P-C4' energy: -137.313 flat angles C4'-P-C4' energy: -110.364 flat angles P-C4'-P energy: -69.004 tors. eta vs tors. theta energy: -2.759 Dist. restrs. and SS energy: 50.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -605.466337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.466337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.821972 (E_RNA) where: Base-Base interactions energy: -241.493 where: short stacking energy: -181.782 Base-Backbone interact. energy: 3.435 local terms energy: -420.764039 where: bonds (distance) C4'-P energy: -137.449 bonds (distance) P-C4' energy: -124.177 flat angles C4'-P-C4' energy: -121.145 flat angles P-C4'-P energy: -51.411 tors. eta vs tors. theta energy: 13.417 Dist. restrs. and SS energy: 53.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1593.344039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.344039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.872756 (E_RNA) where: Base-Base interactions energy: -868.020 where: short stacking energy: -595.774 Base-Backbone interact. energy: -1.448 local terms energy: -763.404158 where: bonds (distance) C4'-P energy: -159.743 bonds (distance) P-C4' energy: -165.516 flat angles C4'-P-C4' energy: -167.800 flat angles P-C4'-P energy: -101.222 tors. eta vs tors. theta energy: -169.123 Dist. restrs. and SS energy: 39.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 66 Temperature: 0.964286 Total energy: -1181.164603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.164603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.445948 (E_RNA) where: Base-Base interactions energy: -597.152 where: short stacking energy: -459.478 Base-Backbone interact. energy: 0.805 local terms energy: -621.098453 where: bonds (distance) C4'-P energy: -136.728 bonds (distance) P-C4' energy: -149.116 flat angles C4'-P-C4' energy: -150.456 flat angles P-C4'-P energy: -97.041 tors. eta vs tors. theta energy: -87.758 Dist. restrs. and SS energy: 36.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 66 Temperature: 1.028571 Total energy: -1136.016999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.016999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.351650 (E_RNA) where: Base-Base interactions energy: -576.036 where: short stacking energy: -420.045 Base-Backbone interact. energy: 1.127 local terms energy: -610.442730 where: bonds (distance) C4'-P energy: -135.769 bonds (distance) P-C4' energy: -147.150 flat angles C4'-P-C4' energy: -154.188 flat angles P-C4'-P energy: -86.586 tors. eta vs tors. theta energy: -86.750 Dist. restrs. and SS energy: 49.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.092857 Total energy: -1122.501436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.501436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.633176 (E_RNA) where: Base-Base interactions energy: -572.513 where: short stacking energy: -405.915 Base-Backbone interact. energy: -1.824 local terms energy: -588.296225 where: bonds (distance) C4'-P energy: -130.315 bonds (distance) P-C4' energy: -144.310 flat angles C4'-P-C4' energy: -134.531 flat angles P-C4'-P energy: -90.084 tors. eta vs tors. theta energy: -89.056 Dist. restrs. and SS energy: 40.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 66 Temperature: 1.157143 Total energy: -943.388027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.388027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.976572 (E_RNA) where: Base-Base interactions energy: -475.628 where: short stacking energy: -304.677 Base-Backbone interact. energy: -0.826 local terms energy: -524.522141 where: bonds (distance) C4'-P energy: -127.232 bonds (distance) P-C4' energy: -142.921 flat angles C4'-P-C4' energy: -127.973 flat angles P-C4'-P energy: -86.302 tors. eta vs tors. theta energy: -40.093 Dist. restrs. and SS energy: 57.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 66 Temperature: 1.221429 Total energy: -697.246292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.246292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.346787 (E_RNA) where: Base-Base interactions energy: -295.832 where: short stacking energy: -222.021 Base-Backbone interact. energy: 1.485 local terms energy: -452.000174 where: bonds (distance) C4'-P energy: -126.036 bonds (distance) P-C4' energy: -135.389 flat angles C4'-P-C4' energy: -126.772 flat angles P-C4'-P energy: -78.909 tors. eta vs tors. theta energy: 15.105 Dist. restrs. and SS energy: 49.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 66 Temperature: 1.285714 Total energy: -626.687808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.687808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.056772 (E_RNA) where: Base-Base interactions energy: -238.861 where: short stacking energy: -202.480 Base-Backbone interact. energy: -3.131 local terms energy: -436.064748 where: bonds (distance) C4'-P energy: -125.882 bonds (distance) P-C4' energy: -141.031 flat angles C4'-P-C4' energy: -114.047 flat angles P-C4'-P energy: -64.179 tors. eta vs tors. theta energy: 9.073 Dist. restrs. and SS energy: 51.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -649.710170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.710170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.206880 (E_RNA) where: Base-Base interactions energy: -263.045 where: short stacking energy: -200.621 Base-Backbone interact. energy: -1.559 local terms energy: -433.603111 where: bonds (distance) C4'-P energy: -110.957 bonds (distance) P-C4' energy: -141.188 flat angles C4'-P-C4' energy: -110.073 flat angles P-C4'-P energy: -76.634 tors. eta vs tors. theta energy: 5.248 Dist. restrs. and SS energy: 48.497 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1593.088958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.088958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.396208 (E_RNA) where: Base-Base interactions energy: -915.035 where: short stacking energy: -619.176 Base-Backbone interact. energy: -0.060 local terms energy: -724.300857 where: bonds (distance) C4'-P energy: -145.973 bonds (distance) P-C4' energy: -155.698 flat angles C4'-P-C4' energy: -158.987 flat angles P-C4'-P energy: -102.017 tors. eta vs tors. theta energy: -161.626 Dist. restrs. and SS energy: 46.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 67 Temperature: 0.964286 Total energy: -1238.347367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.347367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.577083 (E_RNA) where: Base-Base interactions energy: -624.380 where: short stacking energy: -493.120 Base-Backbone interact. energy: 0.132 local terms energy: -652.328768 where: bonds (distance) C4'-P energy: -140.292 bonds (distance) P-C4' energy: -161.986 flat angles C4'-P-C4' energy: -142.020 flat angles P-C4'-P energy: -109.983 tors. eta vs tors. theta energy: -98.048 Dist. restrs. and SS energy: 38.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.028571 Total energy: -1120.738133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.738133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.035314 (E_RNA) where: Base-Base interactions energy: -561.210 where: short stacking energy: -408.922 Base-Backbone interact. energy: -0.764 local terms energy: -602.061308 where: bonds (distance) C4'-P energy: -127.023 bonds (distance) P-C4' energy: -134.991 flat angles C4'-P-C4' energy: -146.972 flat angles P-C4'-P energy: -90.709 tors. eta vs tors. theta energy: -102.367 Dist. restrs. and SS energy: 43.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 67 Temperature: 1.092857 Total energy: -1086.870633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.870633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.443846 (E_RNA) where: Base-Base interactions energy: -551.290 where: short stacking energy: -387.628 Base-Backbone interact. energy: -1.703 local terms energy: -574.450904 where: bonds (distance) C4'-P energy: -149.026 bonds (distance) P-C4' energy: -139.976 flat angles C4'-P-C4' energy: -141.210 flat angles P-C4'-P energy: -77.581 tors. eta vs tors. theta energy: -66.657 Dist. restrs. and SS energy: 40.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 67 Temperature: 1.157143 Total energy: -858.126734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.126734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.243420 (E_RNA) where: Base-Base interactions energy: -418.337 where: short stacking energy: -276.359 Base-Backbone interact. energy: 3.505 local terms energy: -499.411713 where: bonds (distance) C4'-P energy: -127.601 bonds (distance) P-C4' energy: -141.264 flat angles C4'-P-C4' energy: -136.828 flat angles P-C4'-P energy: -77.275 tors. eta vs tors. theta energy: -16.444 Dist. restrs. and SS energy: 56.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 67 Temperature: 1.221429 Total energy: -681.137156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.137156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.071587 (E_RNA) where: Base-Base interactions energy: -296.225 where: short stacking energy: -216.384 Base-Backbone interact. energy: 1.865 local terms energy: -453.710903 where: bonds (distance) C4'-P energy: -119.600 bonds (distance) P-C4' energy: -137.994 flat angles C4'-P-C4' energy: -126.772 flat angles P-C4'-P energy: -78.828 tors. eta vs tors. theta energy: 9.482 Dist. restrs. and SS energy: 66.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 67 Temperature: 1.285714 Total energy: -702.233572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.233572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.638038 (E_RNA) where: Base-Base interactions energy: -311.702 where: short stacking energy: -248.455 Base-Backbone interact. energy: 4.142 local terms energy: -452.077865 where: bonds (distance) C4'-P energy: -124.484 bonds (distance) P-C4' energy: -124.864 flat angles C4'-P-C4' energy: -129.586 flat angles P-C4'-P energy: -71.884 tors. eta vs tors. theta energy: -1.260 Dist. restrs. and SS energy: 57.404 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -549.990961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.990961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.216409 (E_RNA) where: Base-Base interactions energy: -234.838 where: short stacking energy: -160.943 Base-Backbone interact. energy: 2.959 local terms energy: -371.337936 where: bonds (distance) C4'-P energy: -130.341 bonds (distance) P-C4' energy: -125.000 flat angles C4'-P-C4' energy: -92.325 flat angles P-C4'-P energy: -44.923 tors. eta vs tors. theta energy: 21.251 Dist. restrs. and SS energy: 53.225 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1559.898161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.898161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.373415 (E_RNA) where: Base-Base interactions energy: -905.121 where: short stacking energy: -611.780 Base-Backbone interact. energy: -0.487 local terms energy: -706.765488 where: bonds (distance) C4'-P energy: -162.671 bonds (distance) P-C4' energy: -144.676 flat angles C4'-P-C4' energy: -155.224 flat angles P-C4'-P energy: -96.086 tors. eta vs tors. theta energy: -148.108 Dist. restrs. and SS energy: 52.475 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 68 Temperature: 0.964286 Total energy: -1207.997964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.997964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.284354 (E_RNA) where: Base-Base interactions energy: -610.718 where: short stacking energy: -482.916 Base-Backbone interact. energy: -0.666 local terms energy: -643.900154 where: bonds (distance) C4'-P energy: -161.794 bonds (distance) P-C4' energy: -139.086 flat angles C4'-P-C4' energy: -138.014 flat angles P-C4'-P energy: -90.937 tors. eta vs tors. theta energy: -114.068 Dist. restrs. and SS energy: 47.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.028571 Total energy: -1100.741331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.741331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.463450 (E_RNA) where: Base-Base interactions energy: -561.699 where: short stacking energy: -437.276 Base-Backbone interact. energy: 0.236 local terms energy: -591.999747 where: bonds (distance) C4'-P energy: -140.467 bonds (distance) P-C4' energy: -131.230 flat angles C4'-P-C4' energy: -140.722 flat angles P-C4'-P energy: -93.076 tors. eta vs tors. theta energy: -86.505 Dist. restrs. and SS energy: 52.722 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 68 Temperature: 1.092857 Total energy: -1083.651461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.651461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.089359 (E_RNA) where: Base-Base interactions energy: -542.004 where: short stacking energy: -368.552 Base-Backbone interact. energy: -0.943 local terms energy: -562.141944 where: bonds (distance) C4'-P energy: -131.465 bonds (distance) P-C4' energy: -141.257 flat angles C4'-P-C4' energy: -148.904 flat angles P-C4'-P energy: -66.156 tors. eta vs tors. theta energy: -74.359 Dist. restrs. and SS energy: 21.438 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.157143 Total energy: -912.562368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.562368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.065840 (E_RNA) where: Base-Base interactions energy: -463.102 where: short stacking energy: -324.332 Base-Backbone interact. energy: -5.392 local terms energy: -497.571584 where: bonds (distance) C4'-P energy: -125.924 bonds (distance) P-C4' energy: -140.217 flat angles C4'-P-C4' energy: -136.428 flat angles P-C4'-P energy: -52.937 tors. eta vs tors. theta energy: -42.065 Dist. restrs. and SS energy: 53.503 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 68 Temperature: 1.221429 Total energy: -747.893804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.893804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.625444 (E_RNA) where: Base-Base interactions energy: -337.853 where: short stacking energy: -238.794 Base-Backbone interact. energy: -2.513 local terms energy: -455.260047 where: bonds (distance) C4'-P energy: -133.339 bonds (distance) P-C4' energy: -140.172 flat angles C4'-P-C4' energy: -110.183 flat angles P-C4'-P energy: -56.739 tors. eta vs tors. theta energy: -14.827 Dist. restrs. and SS energy: 47.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.285714 Total energy: -647.376421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.376421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.522862 (E_RNA) where: Base-Base interactions energy: -294.082 where: short stacking energy: -227.570 Base-Backbone interact. energy: -3.758 local terms energy: -413.682146 where: bonds (distance) C4'-P energy: -122.108 bonds (distance) P-C4' energy: -126.373 flat angles C4'-P-C4' energy: -97.768 flat angles P-C4'-P energy: -58.751 tors. eta vs tors. theta energy: -8.681 Dist. restrs. and SS energy: 64.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -594.743297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.743297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.195040 (E_RNA) where: Base-Base interactions energy: -250.883 where: short stacking energy: -204.992 Base-Backbone interact. energy: 6.915 local terms energy: -415.227315 where: bonds (distance) C4'-P energy: -137.707 bonds (distance) P-C4' energy: -131.329 flat angles C4'-P-C4' energy: -80.322 flat angles P-C4'-P energy: -74.240 tors. eta vs tors. theta energy: 8.371 Dist. restrs. and SS energy: 64.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1577.526236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.526236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.821336 (E_RNA) where: Base-Base interactions energy: -920.670 where: short stacking energy: -626.347 Base-Backbone interact. energy: -2.343 local terms energy: -694.809094 where: bonds (distance) C4'-P energy: -150.501 bonds (distance) P-C4' energy: -133.608 flat angles C4'-P-C4' energy: -164.446 flat angles P-C4'-P energy: -89.187 tors. eta vs tors. theta energy: -157.067 Dist. restrs. and SS energy: 40.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 69 Temperature: 0.964286 Total energy: -1227.641832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.641832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.488930 (E_RNA) where: Base-Base interactions energy: -614.220 where: short stacking energy: -477.215 Base-Backbone interact. energy: -2.771 local terms energy: -650.497257 where: bonds (distance) C4'-P energy: -151.563 bonds (distance) P-C4' energy: -155.784 flat angles C4'-P-C4' energy: -154.735 flat angles P-C4'-P energy: -93.356 tors. eta vs tors. theta energy: -95.060 Dist. restrs. and SS energy: 39.847 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.028571 Total energy: -1157.772901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.772901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.969386 (E_RNA) where: Base-Base interactions energy: -579.443 where: short stacking energy: -435.479 Base-Backbone interact. energy: 0.158 local terms energy: -629.684357 where: bonds (distance) C4'-P energy: -146.285 bonds (distance) P-C4' energy: -147.735 flat angles C4'-P-C4' energy: -145.990 flat angles P-C4'-P energy: -88.077 tors. eta vs tors. theta energy: -101.597 Dist. restrs. and SS energy: 51.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.092857 Total energy: -1082.852126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.852126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.103680 (E_RNA) where: Base-Base interactions energy: -559.291 where: short stacking energy: -388.604 Base-Backbone interact. energy: -1.479 local terms energy: -551.333787 where: bonds (distance) C4'-P energy: -119.988 bonds (distance) P-C4' energy: -150.081 flat angles C4'-P-C4' energy: -128.845 flat angles P-C4'-P energy: -81.828 tors. eta vs tors. theta energy: -70.591 Dist. restrs. and SS energy: 29.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 69 Temperature: 1.157143 Total energy: -889.603998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.603998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.029716 (E_RNA) where: Base-Base interactions energy: -441.035 where: short stacking energy: -312.122 Base-Backbone interact. energy: -0.815 local terms energy: -501.179597 where: bonds (distance) C4'-P energy: -107.191 bonds (distance) P-C4' energy: -146.551 flat angles C4'-P-C4' energy: -137.097 flat angles P-C4'-P energy: -77.492 tors. eta vs tors. theta energy: -32.849 Dist. restrs. and SS energy: 53.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 69 Temperature: 1.221429 Total energy: -794.834449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.834449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.355932 (E_RNA) where: Base-Base interactions energy: -379.810 where: short stacking energy: -284.407 Base-Backbone interact. energy: 4.330 local terms energy: -466.875835 where: bonds (distance) C4'-P energy: -102.990 bonds (distance) P-C4' energy: -131.514 flat angles C4'-P-C4' energy: -138.509 flat angles P-C4'-P energy: -64.829 tors. eta vs tors. theta energy: -29.034 Dist. restrs. and SS energy: 47.521 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 69 Temperature: 1.285714 Total energy: -700.564135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.564135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.983573 (E_RNA) where: Base-Base interactions energy: -310.417 where: short stacking energy: -231.845 Base-Backbone interact. energy: 3.082 local terms energy: -434.649105 where: bonds (distance) C4'-P energy: -105.294 bonds (distance) P-C4' energy: -136.255 flat angles C4'-P-C4' energy: -126.780 flat angles P-C4'-P energy: -53.312 tors. eta vs tors. theta energy: -13.008 Dist. restrs. and SS energy: 41.419 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -614.254269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.254269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.323052 (E_RNA) where: Base-Base interactions energy: -249.594 where: short stacking energy: -212.620 Base-Backbone interact. energy: -2.311 local terms energy: -402.418107 where: bonds (distance) C4'-P energy: -132.577 bonds (distance) P-C4' energy: -116.037 flat angles C4'-P-C4' energy: -115.633 flat angles P-C4'-P energy: -47.921 tors. eta vs tors. theta energy: 9.750 Dist. restrs. and SS energy: 40.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1585.810806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.810806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1618.047651 (E_RNA) where: Base-Base interactions energy: -887.090 where: short stacking energy: -581.317 Base-Backbone interact. energy: -2.152 local terms energy: -728.806270 where: bonds (distance) C4'-P energy: -155.461 bonds (distance) P-C4' energy: -154.692 flat angles C4'-P-C4' energy: -156.278 flat angles P-C4'-P energy: -101.875 tors. eta vs tors. theta energy: -160.500 Dist. restrs. and SS energy: 32.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 70 Temperature: 0.964286 Total energy: -1218.017581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.017581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.252745 (E_RNA) where: Base-Base interactions energy: -637.490 where: short stacking energy: -490.513 Base-Backbone interact. energy: -1.519 local terms energy: -613.243946 where: bonds (distance) C4'-P energy: -139.995 bonds (distance) P-C4' energy: -146.210 flat angles C4'-P-C4' energy: -144.853 flat angles P-C4'-P energy: -85.128 tors. eta vs tors. theta energy: -97.058 Dist. restrs. and SS energy: 34.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 70 Temperature: 1.028571 Total energy: -1132.843690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.843690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.369650 (E_RNA) where: Base-Base interactions energy: -578.121 where: short stacking energy: -444.062 Base-Backbone interact. energy: -0.814 local terms energy: -612.435120 where: bonds (distance) C4'-P energy: -141.168 bonds (distance) P-C4' energy: -144.913 flat angles C4'-P-C4' energy: -140.294 flat angles P-C4'-P energy: -74.567 tors. eta vs tors. theta energy: -111.492 Dist. restrs. and SS energy: 58.526 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 70 Temperature: 1.092857 Total energy: -1092.625297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.625297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.423573 (E_RNA) where: Base-Base interactions energy: -548.406 where: short stacking energy: -377.692 Base-Backbone interact. energy: 2.923 local terms energy: -576.940211 where: bonds (distance) C4'-P energy: -137.713 bonds (distance) P-C4' energy: -139.920 flat angles C4'-P-C4' energy: -146.827 flat angles P-C4'-P energy: -83.920 tors. eta vs tors. theta energy: -68.560 Dist. restrs. and SS energy: 29.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 70 Temperature: 1.157143 Total energy: -883.099129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.099129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.474376 (E_RNA) where: Base-Base interactions energy: -429.057 where: short stacking energy: -284.313 Base-Backbone interact. energy: -0.350 local terms energy: -501.067530 where: bonds (distance) C4'-P energy: -116.060 bonds (distance) P-C4' energy: -152.037 flat angles C4'-P-C4' energy: -113.111 flat angles P-C4'-P energy: -83.019 tors. eta vs tors. theta energy: -36.840 Dist. restrs. and SS energy: 47.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 70 Temperature: 1.221429 Total energy: -777.989116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.989116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.913456 (E_RNA) where: Base-Base interactions energy: -373.529 where: short stacking energy: -257.079 Base-Backbone interact. energy: -3.271 local terms energy: -439.113071 where: bonds (distance) C4'-P energy: -98.870 bonds (distance) P-C4' energy: -134.261 flat angles C4'-P-C4' energy: -109.817 flat angles P-C4'-P energy: -78.211 tors. eta vs tors. theta energy: -17.955 Dist. restrs. and SS energy: 37.924 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 70 Temperature: 1.285714 Total energy: -685.132353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.132353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.794477 (E_RNA) where: Base-Base interactions energy: -313.289 where: short stacking energy: -240.210 Base-Backbone interact. energy: 3.873 local terms energy: -427.378075 where: bonds (distance) C4'-P energy: -121.372 bonds (distance) P-C4' energy: -117.616 flat angles C4'-P-C4' energy: -121.561 flat angles P-C4'-P energy: -61.471 tors. eta vs tors. theta energy: -5.359 Dist. restrs. and SS energy: 51.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -598.883649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.883649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.504032 (E_RNA) where: Base-Base interactions energy: -279.044 where: short stacking energy: -198.222 Base-Backbone interact. energy: 0.133 local terms energy: -385.593515 where: bonds (distance) C4'-P energy: -111.385 bonds (distance) P-C4' energy: -137.141 flat angles C4'-P-C4' energy: -85.579 flat angles P-C4'-P energy: -59.484 tors. eta vs tors. theta energy: 7.995 Dist. restrs. and SS energy: 65.620 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1592.257641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.257641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.848869 (E_RNA) where: Base-Base interactions energy: -926.976 where: short stacking energy: -614.348 Base-Backbone interact. energy: -2.812 local terms energy: -709.060675 where: bonds (distance) C4'-P energy: -143.917 bonds (distance) P-C4' energy: -154.659 flat angles C4'-P-C4' energy: -155.952 flat angles P-C4'-P energy: -100.447 tors. eta vs tors. theta energy: -154.085 Dist. restrs. and SS energy: 46.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 71 Temperature: 0.964286 Total energy: -1266.919176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.919176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.758570 (E_RNA) where: Base-Base interactions energy: -621.233 where: short stacking energy: -481.169 Base-Backbone interact. energy: 0.153 local terms energy: -686.677784 where: bonds (distance) C4'-P energy: -158.591 bonds (distance) P-C4' energy: -155.096 flat angles C4'-P-C4' energy: -157.416 flat angles P-C4'-P energy: -102.043 tors. eta vs tors. theta energy: -113.532 Dist. restrs. and SS energy: 40.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 71 Temperature: 1.028571 Total energy: -1105.356372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.356372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.480849 (E_RNA) where: Base-Base interactions energy: -557.270 where: short stacking energy: -440.756 Base-Backbone interact. energy: -1.242 local terms energy: -595.968740 where: bonds (distance) C4'-P energy: -131.213 bonds (distance) P-C4' energy: -133.474 flat angles C4'-P-C4' energy: -135.143 flat angles P-C4'-P energy: -99.572 tors. eta vs tors. theta energy: -96.568 Dist. restrs. and SS energy: 49.124 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.092857 Total energy: -1089.525926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.525926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.804905 (E_RNA) where: Base-Base interactions energy: -550.928 where: short stacking energy: -364.215 Base-Backbone interact. energy: 0.057 local terms energy: -569.933476 where: bonds (distance) C4'-P energy: -129.887 bonds (distance) P-C4' energy: -154.713 flat angles C4'-P-C4' energy: -142.667 flat angles P-C4'-P energy: -75.959 tors. eta vs tors. theta energy: -66.708 Dist. restrs. and SS energy: 31.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 71 Temperature: 1.157143 Total energy: -877.585270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.585270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.321600 (E_RNA) where: Base-Base interactions energy: -400.507 where: short stacking energy: -279.844 Base-Backbone interact. energy: -4.271 local terms energy: -531.543413 where: bonds (distance) C4'-P energy: -134.009 bonds (distance) P-C4' energy: -138.296 flat angles C4'-P-C4' energy: -147.616 flat angles P-C4'-P energy: -87.682 tors. eta vs tors. theta energy: -23.940 Dist. restrs. and SS energy: 58.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 71 Temperature: 1.221429 Total energy: -774.537793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.537793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.983174 (E_RNA) where: Base-Base interactions energy: -365.734 where: short stacking energy: -253.660 Base-Backbone interact. energy: -1.132 local terms energy: -448.117610 where: bonds (distance) C4'-P energy: -130.676 bonds (distance) P-C4' energy: -128.627 flat angles C4'-P-C4' energy: -116.880 flat angles P-C4'-P energy: -57.394 tors. eta vs tors. theta energy: -14.540 Dist. restrs. and SS energy: 40.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.285714 Total energy: -653.352554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.352554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.271128 (E_RNA) where: Base-Base interactions energy: -277.970 where: short stacking energy: -200.172 Base-Backbone interact. energy: 0.696 local terms energy: -427.996974 where: bonds (distance) C4'-P energy: -114.891 bonds (distance) P-C4' energy: -117.268 flat angles C4'-P-C4' energy: -121.004 flat angles P-C4'-P energy: -72.435 tors. eta vs tors. theta energy: -2.399 Dist. restrs. and SS energy: 51.919 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -557.496581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.496581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.754751 (E_RNA) where: Base-Base interactions energy: -247.276 where: short stacking energy: -172.165 Base-Backbone interact. energy: 1.498 local terms energy: -371.976856 where: bonds (distance) C4'-P energy: -108.515 bonds (distance) P-C4' energy: -124.880 flat angles C4'-P-C4' energy: -77.193 flat angles P-C4'-P energy: -62.135 tors. eta vs tors. theta energy: 0.747 Dist. restrs. and SS energy: 60.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1594.142365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.142365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.338720 (E_RNA) where: Base-Base interactions energy: -945.229 where: short stacking energy: -622.344 Base-Backbone interact. energy: 0.953 local terms energy: -701.061988 where: bonds (distance) C4'-P energy: -147.767 bonds (distance) P-C4' energy: -157.910 flat angles C4'-P-C4' energy: -171.587 flat angles P-C4'-P energy: -78.938 tors. eta vs tors. theta energy: -144.860 Dist. restrs. and SS energy: 51.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 72 Temperature: 0.964286 Total energy: -1290.345605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.345605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.256572 (E_RNA) where: Base-Base interactions energy: -662.454 where: short stacking energy: -524.483 Base-Backbone interact. energy: -0.785 local terms energy: -664.017602 where: bonds (distance) C4'-P energy: -147.911 bonds (distance) P-C4' energy: -155.273 flat angles C4'-P-C4' energy: -152.459 flat angles P-C4'-P energy: -93.097 tors. eta vs tors. theta energy: -115.278 Dist. restrs. and SS energy: 36.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.028571 Total energy: -1085.005781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.005781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.273033 (E_RNA) where: Base-Base interactions energy: -564.375 where: short stacking energy: -433.234 Base-Backbone interact. energy: -0.845 local terms energy: -571.052842 where: bonds (distance) C4'-P energy: -135.763 bonds (distance) P-C4' energy: -134.056 flat angles C4'-P-C4' energy: -139.549 flat angles P-C4'-P energy: -83.387 tors. eta vs tors. theta energy: -78.298 Dist. restrs. and SS energy: 51.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.092857 Total energy: -1100.926812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.926812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.164247 (E_RNA) where: Base-Base interactions energy: -568.874 where: short stacking energy: -389.366 Base-Backbone interact. energy: -4.445 local terms energy: -561.845842 where: bonds (distance) C4'-P energy: -135.578 bonds (distance) P-C4' energy: -145.842 flat angles C4'-P-C4' energy: -132.419 flat angles P-C4'-P energy: -81.409 tors. eta vs tors. theta energy: -66.598 Dist. restrs. and SS energy: 34.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 72 Temperature: 1.157143 Total energy: -887.818984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.818984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.232998 (E_RNA) where: Base-Base interactions energy: -433.527 where: short stacking energy: -306.899 Base-Backbone interact. energy: -2.802 local terms energy: -505.904739 where: bonds (distance) C4'-P energy: -124.863 bonds (distance) P-C4' energy: -127.038 flat angles C4'-P-C4' energy: -130.073 flat angles P-C4'-P energy: -93.330 tors. eta vs tors. theta energy: -30.601 Dist. restrs. and SS energy: 54.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 72 Temperature: 1.221429 Total energy: -804.302473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.302473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.615000 (E_RNA) where: Base-Base interactions energy: -384.894 where: short stacking energy: -257.334 Base-Backbone interact. energy: 2.388 local terms energy: -475.108559 where: bonds (distance) C4'-P energy: -137.936 bonds (distance) P-C4' energy: -130.750 flat angles C4'-P-C4' energy: -121.916 flat angles P-C4'-P energy: -69.179 tors. eta vs tors. theta energy: -15.329 Dist. restrs. and SS energy: 53.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 72 Temperature: 1.285714 Total energy: -729.444165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.444165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.232151 (E_RNA) where: Base-Base interactions energy: -345.331 where: short stacking energy: -264.315 Base-Backbone interact. energy: 3.460 local terms energy: -435.360939 where: bonds (distance) C4'-P energy: -127.533 bonds (distance) P-C4' energy: -128.441 flat angles C4'-P-C4' energy: -104.418 flat angles P-C4'-P energy: -59.194 tors. eta vs tors. theta energy: -15.775 Dist. restrs. and SS energy: 47.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -602.395904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.395904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.198633 (E_RNA) where: Base-Base interactions energy: -255.308 where: short stacking energy: -199.004 Base-Backbone interact. energy: -0.631 local terms energy: -397.259533 where: bonds (distance) C4'-P energy: -109.872 bonds (distance) P-C4' energy: -116.913 flat angles C4'-P-C4' energy: -121.801 flat angles P-C4'-P energy: -68.705 tors. eta vs tors. theta energy: 20.031 Dist. restrs. and SS energy: 50.803 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1595.601935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.601935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.022506 (E_RNA) where: Base-Base interactions energy: -895.669 where: short stacking energy: -609.090 Base-Backbone interact. energy: 1.529 local terms energy: -739.882986 where: bonds (distance) C4'-P energy: -160.650 bonds (distance) P-C4' energy: -160.513 flat angles C4'-P-C4' energy: -154.264 flat angles P-C4'-P energy: -98.625 tors. eta vs tors. theta energy: -165.830 Dist. restrs. and SS energy: 38.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 73 Temperature: 0.964286 Total energy: -1270.560361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.560361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.357903 (E_RNA) where: Base-Base interactions energy: -646.825 where: short stacking energy: -510.061 Base-Backbone interact. energy: -1.686 local terms energy: -661.846620 where: bonds (distance) C4'-P energy: -134.326 bonds (distance) P-C4' energy: -165.621 flat angles C4'-P-C4' energy: -156.578 flat angles P-C4'-P energy: -96.950 tors. eta vs tors. theta energy: -108.371 Dist. restrs. and SS energy: 39.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 73 Temperature: 1.028571 Total energy: -1068.702284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.702284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.471581 (E_RNA) where: Base-Base interactions energy: -562.712 where: short stacking energy: -408.221 Base-Backbone interact. energy: -1.485 local terms energy: -570.274740 where: bonds (distance) C4'-P energy: -130.476 bonds (distance) P-C4' energy: -140.032 flat angles C4'-P-C4' energy: -133.199 flat angles P-C4'-P energy: -73.764 tors. eta vs tors. theta energy: -92.804 Dist. restrs. and SS energy: 65.769 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.092857 Total energy: -1047.925072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.925072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.386180 (E_RNA) where: Base-Base interactions energy: -549.650 where: short stacking energy: -379.505 Base-Backbone interact. energy: 0.689 local terms energy: -531.424870 where: bonds (distance) C4'-P energy: -131.329 bonds (distance) P-C4' energy: -132.813 flat angles C4'-P-C4' energy: -137.453 flat angles P-C4'-P energy: -56.676 tors. eta vs tors. theta energy: -73.154 Dist. restrs. and SS energy: 32.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 73 Temperature: 1.157143 Total energy: -933.557906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.557906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.850873 (E_RNA) where: Base-Base interactions energy: -462.094 where: short stacking energy: -351.049 Base-Backbone interact. energy: 2.813 local terms energy: -541.569216 where: bonds (distance) C4'-P energy: -136.622 bonds (distance) P-C4' energy: -145.066 flat angles C4'-P-C4' energy: -122.532 flat angles P-C4'-P energy: -83.644 tors. eta vs tors. theta energy: -53.704 Dist. restrs. and SS energy: 67.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.221429 Total energy: -783.640154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.640154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.981100 (E_RNA) where: Base-Base interactions energy: -372.877 where: short stacking energy: -281.723 Base-Backbone interact. energy: -1.901 local terms energy: -454.203673 where: bonds (distance) C4'-P energy: -131.365 bonds (distance) P-C4' energy: -116.381 flat angles C4'-P-C4' energy: -110.481 flat angles P-C4'-P energy: -69.597 tors. eta vs tors. theta energy: -26.379 Dist. restrs. and SS energy: 45.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 73 Temperature: 1.285714 Total energy: -673.956256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.956256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.146224 (E_RNA) where: Base-Base interactions energy: -314.924 where: short stacking energy: -237.582 Base-Backbone interact. energy: 6.048 local terms energy: -435.270969 where: bonds (distance) C4'-P energy: -106.949 bonds (distance) P-C4' energy: -139.894 flat angles C4'-P-C4' energy: -113.950 flat angles P-C4'-P energy: -67.008 tors. eta vs tors. theta energy: -7.471 Dist. restrs. and SS energy: 70.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -555.523059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.523059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.627526 (E_RNA) where: Base-Base interactions energy: -246.215 where: short stacking energy: -177.516 Base-Backbone interact. energy: 8.249 local terms energy: -380.661785 where: bonds (distance) C4'-P energy: -119.521 bonds (distance) P-C4' energy: -126.777 flat angles C4'-P-C4' energy: -107.216 flat angles P-C4'-P energy: -54.516 tors. eta vs tors. theta energy: 27.367 Dist. restrs. and SS energy: 63.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1592.698490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.698490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.901248 (E_RNA) where: Base-Base interactions energy: -899.689 where: short stacking energy: -611.540 Base-Backbone interact. energy: -3.696 local terms energy: -732.516018 where: bonds (distance) C4'-P energy: -150.671 bonds (distance) P-C4' energy: -152.429 flat angles C4'-P-C4' energy: -171.042 flat angles P-C4'-P energy: -109.911 tors. eta vs tors. theta energy: -148.463 Dist. restrs. and SS energy: 43.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 74 Temperature: 0.964286 Total energy: -1251.229884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.229884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.011335 (E_RNA) where: Base-Base interactions energy: -623.656 where: short stacking energy: -474.864 Base-Backbone interact. energy: -0.825 local terms energy: -662.530582 where: bonds (distance) C4'-P energy: -147.877 bonds (distance) P-C4' energy: -151.195 flat angles C4'-P-C4' energy: -161.124 flat angles P-C4'-P energy: -89.902 tors. eta vs tors. theta energy: -112.432 Dist. restrs. and SS energy: 35.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 74 Temperature: 1.028571 Total energy: -1096.939869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.939869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.602147 (E_RNA) where: Base-Base interactions energy: -576.065 where: short stacking energy: -382.423 Base-Backbone interact. energy: -1.869 local terms energy: -541.667909 where: bonds (distance) C4'-P energy: -128.764 bonds (distance) P-C4' energy: -138.017 flat angles C4'-P-C4' energy: -143.117 flat angles P-C4'-P energy: -69.221 tors. eta vs tors. theta energy: -62.548 Dist. restrs. and SS energy: 22.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 74 Temperature: 1.092857 Total energy: -969.552198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.552198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.957473 (E_RNA) where: Base-Base interactions energy: -461.961 where: short stacking energy: -356.177 Base-Backbone interact. energy: -0.795 local terms energy: -574.201874 where: bonds (distance) C4'-P energy: -138.070 bonds (distance) P-C4' energy: -149.969 flat angles C4'-P-C4' energy: -143.549 flat angles P-C4'-P energy: -76.562 tors. eta vs tors. theta energy: -66.051 Dist. restrs. and SS energy: 67.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.157143 Total energy: -912.455040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.455040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.044731 (E_RNA) where: Base-Base interactions energy: -439.577 where: short stacking energy: -316.533 Base-Backbone interact. energy: 2.824 local terms energy: -525.291672 where: bonds (distance) C4'-P energy: -120.935 bonds (distance) P-C4' energy: -136.921 flat angles C4'-P-C4' energy: -138.146 flat angles P-C4'-P energy: -82.064 tors. eta vs tors. theta energy: -47.226 Dist. restrs. and SS energy: 49.590 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.221429 Total energy: -787.921529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.921529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.297944 (E_RNA) where: Base-Base interactions energy: -372.366 where: short stacking energy: -268.566 Base-Backbone interact. energy: -1.224 local terms energy: -469.708432 where: bonds (distance) C4'-P energy: -120.658 bonds (distance) P-C4' energy: -137.146 flat angles C4'-P-C4' energy: -115.697 flat angles P-C4'-P energy: -78.212 tors. eta vs tors. theta energy: -17.996 Dist. restrs. and SS energy: 55.376 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.285714 Total energy: -660.734507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.734507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.088887 (E_RNA) where: Base-Base interactions energy: -275.400 where: short stacking energy: -211.544 Base-Backbone interact. energy: 2.755 local terms energy: -449.443921 where: bonds (distance) C4'-P energy: -130.567 bonds (distance) P-C4' energy: -131.902 flat angles C4'-P-C4' energy: -115.611 flat angles P-C4'-P energy: -68.140 tors. eta vs tors. theta energy: -3.225 Dist. restrs. and SS energy: 61.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -570.603861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.603861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.795977 (E_RNA) where: Base-Base interactions energy: -238.128 where: short stacking energy: -170.071 Base-Backbone interact. energy: 5.218 local terms energy: -386.885430 where: bonds (distance) C4'-P energy: -108.318 bonds (distance) P-C4' energy: -120.491 flat angles C4'-P-C4' energy: -110.402 flat angles P-C4'-P energy: -60.080 tors. eta vs tors. theta energy: 12.405 Dist. restrs. and SS energy: 49.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1593.653909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.653909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.280711 (E_RNA) where: Base-Base interactions energy: -893.979 where: short stacking energy: -616.300 Base-Backbone interact. energy: -4.616 local terms energy: -732.686295 where: bonds (distance) C4'-P energy: -146.127 bonds (distance) P-C4' energy: -158.835 flat angles C4'-P-C4' energy: -161.964 flat angles P-C4'-P energy: -104.772 tors. eta vs tors. theta energy: -160.989 Dist. restrs. and SS energy: 37.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 75 Temperature: 0.964286 Total energy: -1219.283076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.283076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.593767 (E_RNA) where: Base-Base interactions energy: -617.377 where: short stacking energy: -461.892 Base-Backbone interact. energy: -0.270 local terms energy: -631.947153 where: bonds (distance) C4'-P energy: -158.026 bonds (distance) P-C4' energy: -137.861 flat angles C4'-P-C4' energy: -157.499 flat angles P-C4'-P energy: -74.264 tors. eta vs tors. theta energy: -104.298 Dist. restrs. and SS energy: 30.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 75 Temperature: 1.028571 Total energy: -1144.417951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.417951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.724924 (E_RNA) where: Base-Base interactions energy: -599.739 where: short stacking energy: -404.730 Base-Backbone interact. energy: -2.543 local terms energy: -575.443316 where: bonds (distance) C4'-P energy: -131.642 bonds (distance) P-C4' energy: -154.284 flat angles C4'-P-C4' energy: -136.354 flat angles P-C4'-P energy: -74.422 tors. eta vs tors. theta energy: -78.742 Dist. restrs. and SS energy: 33.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 75 Temperature: 1.092857 Total energy: -1006.962135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.962135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.455690 (E_RNA) where: Base-Base interactions energy: -485.259 where: short stacking energy: -362.268 Base-Backbone interact. energy: -2.595 local terms energy: -578.601800 where: bonds (distance) C4'-P energy: -135.944 bonds (distance) P-C4' energy: -159.819 flat angles C4'-P-C4' energy: -134.910 flat angles P-C4'-P energy: -79.211 tors. eta vs tors. theta energy: -68.719 Dist. restrs. and SS energy: 59.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.157143 Total energy: -848.328881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.328881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.011950 (E_RNA) where: Base-Base interactions energy: -415.152 where: short stacking energy: -304.357 Base-Backbone interact. energy: -0.277 local terms energy: -492.582364 where: bonds (distance) C4'-P energy: -137.095 bonds (distance) P-C4' energy: -133.614 flat angles C4'-P-C4' energy: -120.406 flat angles P-C4'-P energy: -63.797 tors. eta vs tors. theta energy: -37.670 Dist. restrs. and SS energy: 59.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.221429 Total energy: -797.756604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.756604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.336112 (E_RNA) where: Base-Base interactions energy: -380.336 where: short stacking energy: -276.312 Base-Backbone interact. energy: -1.759 local terms energy: -457.240902 where: bonds (distance) C4'-P energy: -136.944 bonds (distance) P-C4' energy: -119.467 flat angles C4'-P-C4' energy: -93.891 flat angles P-C4'-P energy: -73.829 tors. eta vs tors. theta energy: -33.111 Dist. restrs. and SS energy: 41.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 75 Temperature: 1.285714 Total energy: -685.807357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.807357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.059282 (E_RNA) where: Base-Base interactions energy: -252.221 where: short stacking energy: -201.068 Base-Backbone interact. energy: 1.168 local terms energy: -477.006404 where: bonds (distance) C4'-P energy: -145.492 bonds (distance) P-C4' energy: -139.793 flat angles C4'-P-C4' energy: -120.617 flat angles P-C4'-P energy: -73.696 tors. eta vs tors. theta energy: 2.592 Dist. restrs. and SS energy: 42.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -599.683901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.683901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.476888 (E_RNA) where: Base-Base interactions energy: -263.084 where: short stacking energy: -210.526 Base-Backbone interact. energy: -0.043 local terms energy: -384.349860 where: bonds (distance) C4'-P energy: -113.036 bonds (distance) P-C4' energy: -112.752 flat angles C4'-P-C4' energy: -88.372 flat angles P-C4'-P energy: -70.164 tors. eta vs tors. theta energy: -0.026 Dist. restrs. and SS energy: 47.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1599.667524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.667524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1642.129501 (E_RNA) where: Base-Base interactions energy: -899.330 where: short stacking energy: -615.806 Base-Backbone interact. energy: -0.738 local terms energy: -742.062053 where: bonds (distance) C4'-P energy: -154.005 bonds (distance) P-C4' energy: -154.830 flat angles C4'-P-C4' energy: -165.947 flat angles P-C4'-P energy: -104.551 tors. eta vs tors. theta energy: -162.729 Dist. restrs. and SS energy: 42.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 76 Temperature: 0.964286 Total energy: -1294.850224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.850224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.938029 (E_RNA) where: Base-Base interactions energy: -687.797 where: short stacking energy: -506.618 Base-Backbone interact. energy: 0.256 local terms energy: -644.396367 where: bonds (distance) C4'-P energy: -141.957 bonds (distance) P-C4' energy: -153.067 flat angles C4'-P-C4' energy: -145.964 flat angles P-C4'-P energy: -90.382 tors. eta vs tors. theta energy: -113.027 Dist. restrs. and SS energy: 37.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 76 Temperature: 1.028571 Total energy: -1147.893352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.893352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.670577 (E_RNA) where: Base-Base interactions energy: -598.081 where: short stacking energy: -381.883 Base-Backbone interact. energy: -0.575 local terms energy: -578.014077 where: bonds (distance) C4'-P energy: -131.711 bonds (distance) P-C4' energy: -150.383 flat angles C4'-P-C4' energy: -149.820 flat angles P-C4'-P energy: -84.913 tors. eta vs tors. theta energy: -61.187 Dist. restrs. and SS energy: 28.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 76 Temperature: 1.092857 Total energy: -935.016339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.016339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.756460 (E_RNA) where: Base-Base interactions energy: -452.480 where: short stacking energy: -326.954 Base-Backbone interact. energy: -1.243 local terms energy: -535.034197 where: bonds (distance) C4'-P energy: -129.314 bonds (distance) P-C4' energy: -143.806 flat angles C4'-P-C4' energy: -137.735 flat angles P-C4'-P energy: -80.961 tors. eta vs tors. theta energy: -43.218 Dist. restrs. and SS energy: 53.740 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 76 Temperature: 1.157143 Total energy: -879.059688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.059688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.742927 (E_RNA) where: Base-Base interactions energy: -444.690 where: short stacking energy: -323.516 Base-Backbone interact. energy: 2.491 local terms energy: -490.543869 where: bonds (distance) C4'-P energy: -121.688 bonds (distance) P-C4' energy: -141.903 flat angles C4'-P-C4' energy: -111.689 flat angles P-C4'-P energy: -61.470 tors. eta vs tors. theta energy: -53.793 Dist. restrs. and SS energy: 53.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 76 Temperature: 1.221429 Total energy: -765.573965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.573965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.127972 (E_RNA) where: Base-Base interactions energy: -386.807 where: short stacking energy: -270.734 Base-Backbone interact. energy: -2.570 local terms energy: -425.751807 where: bonds (distance) C4'-P energy: -129.433 bonds (distance) P-C4' energy: -127.136 flat angles C4'-P-C4' energy: -101.083 flat angles P-C4'-P energy: -50.126 tors. eta vs tors. theta energy: -17.974 Dist. restrs. and SS energy: 49.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 76 Temperature: 1.285714 Total energy: -662.613385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.613385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.110442 (E_RNA) where: Base-Base interactions energy: -284.251 where: short stacking energy: -227.134 Base-Backbone interact. energy: 0.752 local terms energy: -427.611055 where: bonds (distance) C4'-P energy: -126.238 bonds (distance) P-C4' energy: -116.915 flat angles C4'-P-C4' energy: -92.521 flat angles P-C4'-P energy: -76.427 tors. eta vs tors. theta energy: -15.510 Dist. restrs. and SS energy: 48.497 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -575.213171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.213171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.106061 (E_RNA) where: Base-Base interactions energy: -256.131 where: short stacking energy: -202.076 Base-Backbone interact. energy: -1.058 local terms energy: -375.916892 where: bonds (distance) C4'-P energy: -123.603 bonds (distance) P-C4' energy: -126.699 flat angles C4'-P-C4' energy: -102.543 flat angles P-C4'-P energy: -41.317 tors. eta vs tors. theta energy: 18.245 Dist. restrs. and SS energy: 57.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1602.364540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.364540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.800924 (E_RNA) where: Base-Base interactions energy: -913.921 where: short stacking energy: -622.828 Base-Backbone interact. energy: -0.238 local terms energy: -736.642121 where: bonds (distance) C4'-P energy: -158.510 bonds (distance) P-C4' energy: -140.115 flat angles C4'-P-C4' energy: -165.254 flat angles P-C4'-P energy: -111.690 tors. eta vs tors. theta energy: -161.073 Dist. restrs. and SS energy: 48.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 77 Temperature: 0.964286 Total energy: -1314.533545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.533545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.403610 (E_RNA) where: Base-Base interactions energy: -654.175 where: short stacking energy: -481.503 Base-Backbone interact. energy: -1.924 local terms energy: -696.305452 where: bonds (distance) C4'-P energy: -159.824 bonds (distance) P-C4' energy: -155.371 flat angles C4'-P-C4' energy: -171.355 flat angles P-C4'-P energy: -92.555 tors. eta vs tors. theta energy: -117.202 Dist. restrs. and SS energy: 37.870 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 77 Temperature: 1.028571 Total energy: -1156.984876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.984876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.005064 (E_RNA) where: Base-Base interactions energy: -627.835 where: short stacking energy: -395.844 Base-Backbone interact. energy: -4.792 local terms energy: -573.378193 where: bonds (distance) C4'-P energy: -147.576 bonds (distance) P-C4' energy: -147.830 flat angles C4'-P-C4' energy: -137.212 flat angles P-C4'-P energy: -72.445 tors. eta vs tors. theta energy: -68.315 Dist. restrs. and SS energy: 49.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 77 Temperature: 1.092857 Total energy: -949.687409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.687409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.554079 (E_RNA) where: Base-Base interactions energy: -456.418 where: short stacking energy: -329.459 Base-Backbone interact. energy: -1.706 local terms energy: -542.429420 where: bonds (distance) C4'-P energy: -139.490 bonds (distance) P-C4' energy: -151.360 flat angles C4'-P-C4' energy: -128.385 flat angles P-C4'-P energy: -78.834 tors. eta vs tors. theta energy: -44.360 Dist. restrs. and SS energy: 50.867 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 77 Temperature: 1.157143 Total energy: -895.271934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.271934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.872081 (E_RNA) where: Base-Base interactions energy: -452.368 where: short stacking energy: -320.145 Base-Backbone interact. energy: -0.388 local terms energy: -502.116720 where: bonds (distance) C4'-P energy: -132.219 bonds (distance) P-C4' energy: -132.362 flat angles C4'-P-C4' energy: -122.108 flat angles P-C4'-P energy: -79.794 tors. eta vs tors. theta energy: -35.633 Dist. restrs. and SS energy: 59.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 77 Temperature: 1.221429 Total energy: -756.810553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.810553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.329489 (E_RNA) where: Base-Base interactions energy: -380.029 where: short stacking energy: -260.978 Base-Backbone interact. energy: 12.215 local terms energy: -426.515867 where: bonds (distance) C4'-P energy: -130.242 bonds (distance) P-C4' energy: -137.695 flat angles C4'-P-C4' energy: -113.791 flat angles P-C4'-P energy: -61.731 tors. eta vs tors. theta energy: 16.943 Dist. restrs. and SS energy: 37.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.285714 Total energy: -647.511161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.511161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.705881 (E_RNA) where: Base-Base interactions energy: -287.748 where: short stacking energy: -212.555 Base-Backbone interact. energy: 2.700 local terms energy: -411.657677 where: bonds (distance) C4'-P energy: -117.408 bonds (distance) P-C4' energy: -134.921 flat angles C4'-P-C4' energy: -109.181 flat angles P-C4'-P energy: -57.274 tors. eta vs tors. theta energy: 7.127 Dist. restrs. and SS energy: 49.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -595.809670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.809670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.437285 (E_RNA) where: Base-Base interactions energy: -257.472 where: short stacking energy: -211.055 Base-Backbone interact. energy: -2.430 local terms energy: -378.534688 where: bonds (distance) C4'-P energy: -99.464 bonds (distance) P-C4' energy: -127.859 flat angles C4'-P-C4' energy: -122.755 flat angles P-C4'-P energy: -42.163 tors. eta vs tors. theta energy: 13.707 Dist. restrs. and SS energy: 42.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1557.243285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.243285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.871525 (E_RNA) where: Base-Base interactions energy: -894.082 where: short stacking energy: -583.952 Base-Backbone interact. energy: -1.977 local terms energy: -700.812779 where: bonds (distance) C4'-P energy: -146.766 bonds (distance) P-C4' energy: -153.337 flat angles C4'-P-C4' energy: -167.171 flat angles P-C4'-P energy: -89.878 tors. eta vs tors. theta energy: -143.661 Dist. restrs. and SS energy: 39.628 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.964286 Total energy: -1327.121817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.121817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.848125 (E_RNA) where: Base-Base interactions energy: -684.026 where: short stacking energy: -515.781 Base-Backbone interact. energy: 0.119 local terms energy: -685.941066 where: bonds (distance) C4'-P energy: -145.596 bonds (distance) P-C4' energy: -166.193 flat angles C4'-P-C4' energy: -159.261 flat angles P-C4'-P energy: -91.534 tors. eta vs tors. theta energy: -123.357 Dist. restrs. and SS energy: 42.726 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 78 Temperature: 1.028571 Total energy: -1201.741027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.741027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.231420 (E_RNA) where: Base-Base interactions energy: -621.329 where: short stacking energy: -397.623 Base-Backbone interact. energy: -1.937 local terms energy: -610.965609 where: bonds (distance) C4'-P energy: -142.980 bonds (distance) P-C4' energy: -149.957 flat angles C4'-P-C4' energy: -151.649 flat angles P-C4'-P energy: -90.125 tors. eta vs tors. theta energy: -76.255 Dist. restrs. and SS energy: 32.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 78 Temperature: 1.092857 Total energy: -935.894339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.894339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.993329 (E_RNA) where: Base-Base interactions energy: -461.084 where: short stacking energy: -327.187 Base-Backbone interact. energy: 0.103 local terms energy: -522.011731 where: bonds (distance) C4'-P energy: -139.813 bonds (distance) P-C4' energy: -139.065 flat angles C4'-P-C4' energy: -138.654 flat angles P-C4'-P energy: -55.411 tors. eta vs tors. theta energy: -49.068 Dist. restrs. and SS energy: 47.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 78 Temperature: 1.157143 Total energy: -891.698510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.698510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.673868 (E_RNA) where: Base-Base interactions energy: -441.801 where: short stacking energy: -301.023 Base-Backbone interact. energy: -2.548 local terms energy: -490.324617 where: bonds (distance) C4'-P energy: -123.626 bonds (distance) P-C4' energy: -127.084 flat angles C4'-P-C4' energy: -128.896 flat angles P-C4'-P energy: -69.986 tors. eta vs tors. theta energy: -40.733 Dist. restrs. and SS energy: 42.975 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 78 Temperature: 1.221429 Total energy: -778.280958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.280958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.036219 (E_RNA) where: Base-Base interactions energy: -364.800 where: short stacking energy: -271.903 Base-Backbone interact. energy: -1.720 local terms energy: -455.516252 where: bonds (distance) C4'-P energy: -127.022 bonds (distance) P-C4' energy: -138.094 flat angles C4'-P-C4' energy: -91.420 flat angles P-C4'-P energy: -79.021 tors. eta vs tors. theta energy: -19.959 Dist. restrs. and SS energy: 43.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.285714 Total energy: -641.514807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.514807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.364100 (E_RNA) where: Base-Base interactions energy: -273.893 where: short stacking energy: -209.201 Base-Backbone interact. energy: 2.455 local terms energy: -432.926177 where: bonds (distance) C4'-P energy: -124.875 bonds (distance) P-C4' energy: -127.232 flat angles C4'-P-C4' energy: -121.724 flat angles P-C4'-P energy: -63.106 tors. eta vs tors. theta energy: 4.010 Dist. restrs. and SS energy: 62.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -619.959066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.959066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.065869 (E_RNA) where: Base-Base interactions energy: -310.732 where: short stacking energy: -208.821 Base-Backbone interact. energy: 0.908 local terms energy: -373.242118 where: bonds (distance) C4'-P energy: -112.781 bonds (distance) P-C4' energy: -129.455 flat angles C4'-P-C4' energy: -85.279 flat angles P-C4'-P energy: -51.688 tors. eta vs tors. theta energy: 5.961 Dist. restrs. and SS energy: 63.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1622.111459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1622.111459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.257110 (E_RNA) where: Base-Base interactions energy: -936.479 where: short stacking energy: -654.595 Base-Backbone interact. energy: -2.321 local terms energy: -723.457139 where: bonds (distance) C4'-P energy: -143.990 bonds (distance) P-C4' energy: -174.212 flat angles C4'-P-C4' energy: -154.176 flat angles P-C4'-P energy: -95.352 tors. eta vs tors. theta energy: -155.728 Dist. restrs. and SS energy: 40.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.964286 Total energy: -1369.627556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.627556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.730330 (E_RNA) where: Base-Base interactions energy: -722.611 where: short stacking energy: -556.693 Base-Backbone interact. energy: 0.381 local terms energy: -688.499956 where: bonds (distance) C4'-P energy: -151.056 bonds (distance) P-C4' energy: -153.440 flat angles C4'-P-C4' energy: -153.119 flat angles P-C4'-P energy: -104.406 tors. eta vs tors. theta energy: -126.478 Dist. restrs. and SS energy: 41.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 79 Temperature: 1.028571 Total energy: -1189.790127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.790127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.884812 (E_RNA) where: Base-Base interactions energy: -626.303 where: short stacking energy: -369.634 Base-Backbone interact. energy: 2.891 local terms energy: -597.472462 where: bonds (distance) C4'-P energy: -136.978 bonds (distance) P-C4' energy: -151.644 flat angles C4'-P-C4' energy: -145.880 flat angles P-C4'-P energy: -97.600 tors. eta vs tors. theta energy: -65.370 Dist. restrs. and SS energy: 31.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 79 Temperature: 1.092857 Total energy: -952.439451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.439451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.722419 (E_RNA) where: Base-Base interactions energy: -450.307 where: short stacking energy: -321.577 Base-Backbone interact. energy: -1.839 local terms energy: -548.576134 where: bonds (distance) C4'-P energy: -136.281 bonds (distance) P-C4' energy: -137.250 flat angles C4'-P-C4' energy: -144.760 flat angles P-C4'-P energy: -87.313 tors. eta vs tors. theta energy: -42.972 Dist. restrs. and SS energy: 48.283 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 79 Temperature: 1.157143 Total energy: -895.955194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.955194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.055169 (E_RNA) where: Base-Base interactions energy: -435.717 where: short stacking energy: -309.815 Base-Backbone interact. energy: -2.640 local terms energy: -506.698060 where: bonds (distance) C4'-P energy: -132.475 bonds (distance) P-C4' energy: -144.448 flat angles C4'-P-C4' energy: -123.558 flat angles P-C4'-P energy: -66.508 tors. eta vs tors. theta energy: -39.708 Dist. restrs. and SS energy: 49.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 79 Temperature: 1.221429 Total energy: -783.779612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.779612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.460701 (E_RNA) where: Base-Base interactions energy: -368.810 where: short stacking energy: -257.913 Base-Backbone interact. energy: -2.680 local terms energy: -452.970731 where: bonds (distance) C4'-P energy: -121.034 bonds (distance) P-C4' energy: -135.578 flat angles C4'-P-C4' energy: -101.292 flat angles P-C4'-P energy: -70.820 tors. eta vs tors. theta energy: -24.246 Dist. restrs. and SS energy: 40.681 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.285714 Total energy: -638.814919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.814919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.419309 (E_RNA) where: Base-Base interactions energy: -307.160 where: short stacking energy: -224.358 Base-Backbone interact. energy: 0.876 local terms energy: -396.135092 where: bonds (distance) C4'-P energy: -118.725 bonds (distance) P-C4' energy: -137.254 flat angles C4'-P-C4' energy: -112.283 flat angles P-C4'-P energy: -49.431 tors. eta vs tors. theta energy: 21.559 Dist. restrs. and SS energy: 63.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -586.816521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.816521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.034780 (E_RNA) where: Base-Base interactions energy: -269.555 where: short stacking energy: -193.121 Base-Backbone interact. energy: -2.936 local terms energy: -381.543538 where: bonds (distance) C4'-P energy: -124.913 bonds (distance) P-C4' energy: -134.572 flat angles C4'-P-C4' energy: -81.393 flat angles P-C4'-P energy: -53.352 tors. eta vs tors. theta energy: 12.687 Dist. restrs. and SS energy: 67.218 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1590.477050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.477050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.014112 (E_RNA) where: Base-Base interactions energy: -892.382 where: short stacking energy: -626.386 Base-Backbone interact. energy: -3.836 local terms energy: -728.796707 where: bonds (distance) C4'-P energy: -140.623 bonds (distance) P-C4' energy: -151.452 flat angles C4'-P-C4' energy: -168.784 flat angles P-C4'-P energy: -108.102 tors. eta vs tors. theta energy: -159.835 Dist. restrs. and SS energy: 34.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.964286 Total energy: -1320.246925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.246925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.480256 (E_RNA) where: Base-Base interactions energy: -684.372 where: short stacking energy: -512.160 Base-Backbone interact. energy: -2.872 local terms energy: -667.235953 where: bonds (distance) C4'-P energy: -153.075 bonds (distance) P-C4' energy: -148.858 flat angles C4'-P-C4' energy: -148.590 flat angles P-C4'-P energy: -108.149 tors. eta vs tors. theta energy: -108.564 Dist. restrs. and SS energy: 34.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 80 Temperature: 1.028571 Total energy: -1192.448936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.448936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.804609 (E_RNA) where: Base-Base interactions energy: -631.130 where: short stacking energy: -427.286 Base-Backbone interact. energy: -1.438 local terms energy: -589.236823 where: bonds (distance) C4'-P energy: -140.366 bonds (distance) P-C4' energy: -148.253 flat angles C4'-P-C4' energy: -141.299 flat angles P-C4'-P energy: -82.522 tors. eta vs tors. theta energy: -76.797 Dist. restrs. and SS energy: 29.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 80 Temperature: 1.092857 Total energy: -942.470355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.470355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.280808 (E_RNA) where: Base-Base interactions energy: -443.418 where: short stacking energy: -341.796 Base-Backbone interact. energy: 2.727 local terms energy: -560.589926 where: bonds (distance) C4'-P energy: -133.660 bonds (distance) P-C4' energy: -145.460 flat angles C4'-P-C4' energy: -130.970 flat angles P-C4'-P energy: -85.809 tors. eta vs tors. theta energy: -64.692 Dist. restrs. and SS energy: 58.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 80 Temperature: 1.157143 Total energy: -903.035692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.035692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.496326 (E_RNA) where: Base-Base interactions energy: -457.620 where: short stacking energy: -300.851 Base-Backbone interact. energy: 1.233 local terms energy: -487.109424 where: bonds (distance) C4'-P energy: -120.220 bonds (distance) P-C4' energy: -138.088 flat angles C4'-P-C4' energy: -116.034 flat angles P-C4'-P energy: -84.469 tors. eta vs tors. theta energy: -28.298 Dist. restrs. and SS energy: 40.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 80 Temperature: 1.221429 Total energy: -787.533766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.533766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.459741 (E_RNA) where: Base-Base interactions energy: -366.625 where: short stacking energy: -253.186 Base-Backbone interact. energy: 5.097 local terms energy: -468.931951 where: bonds (distance) C4'-P energy: -127.702 bonds (distance) P-C4' energy: -136.263 flat angles C4'-P-C4' energy: -127.573 flat angles P-C4'-P energy: -70.749 tors. eta vs tors. theta energy: -6.645 Dist. restrs. and SS energy: 42.926 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 80 Temperature: 1.285714 Total energy: -640.691326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.691326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.985306 (E_RNA) where: Base-Base interactions energy: -290.440 where: short stacking energy: -210.800 Base-Backbone interact. energy: 4.340 local terms energy: -396.885203 where: bonds (distance) C4'-P energy: -127.828 bonds (distance) P-C4' energy: -130.180 flat angles C4'-P-C4' energy: -98.680 flat angles P-C4'-P energy: -51.646 tors. eta vs tors. theta energy: 11.449 Dist. restrs. and SS energy: 42.294 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -578.666307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.666307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.779901 (E_RNA) where: Base-Base interactions energy: -254.394 where: short stacking energy: -177.073 Base-Backbone interact. energy: 2.209 local terms energy: -375.594368 where: bonds (distance) C4'-P energy: -117.660 bonds (distance) P-C4' energy: -123.435 flat angles C4'-P-C4' energy: -95.107 flat angles P-C4'-P energy: -55.650 tors. eta vs tors. theta energy: 16.258 Dist. restrs. and SS energy: 49.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1605.896133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.896133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.773084 (E_RNA) where: Base-Base interactions energy: -900.158 where: short stacking energy: -609.711 Base-Backbone interact. energy: -3.320 local terms energy: -742.295754 where: bonds (distance) C4'-P energy: -151.670 bonds (distance) P-C4' energy: -160.041 flat angles C4'-P-C4' energy: -167.712 flat angles P-C4'-P energy: -105.698 tors. eta vs tors. theta energy: -157.176 Dist. restrs. and SS energy: 39.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 81 Temperature: 0.964286 Total energy: -1345.606557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.606557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.794983 (E_RNA) where: Base-Base interactions energy: -717.334 where: short stacking energy: -514.329 Base-Backbone interact. energy: -1.206 local terms energy: -668.255519 where: bonds (distance) C4'-P energy: -150.556 bonds (distance) P-C4' energy: -168.989 flat angles C4'-P-C4' energy: -148.628 flat angles P-C4'-P energy: -82.837 tors. eta vs tors. theta energy: -117.245 Dist. restrs. and SS energy: 41.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 81 Temperature: 1.028571 Total energy: -1264.235128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.235128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.660257 (E_RNA) where: Base-Base interactions energy: -669.387 where: short stacking energy: -454.696 Base-Backbone interact. energy: -1.838 local terms energy: -619.435406 where: bonds (distance) C4'-P energy: -144.045 bonds (distance) P-C4' energy: -141.611 flat angles C4'-P-C4' energy: -137.204 flat angles P-C4'-P energy: -91.415 tors. eta vs tors. theta energy: -105.160 Dist. restrs. and SS energy: 26.425 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.092857 Total energy: -964.872765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.872765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.691090 (E_RNA) where: Base-Base interactions energy: -454.300 where: short stacking energy: -350.020 Base-Backbone interact. energy: -3.170 local terms energy: -569.221252 where: bonds (distance) C4'-P energy: -141.606 bonds (distance) P-C4' energy: -152.976 flat angles C4'-P-C4' energy: -128.860 flat angles P-C4'-P energy: -83.346 tors. eta vs tors. theta energy: -62.434 Dist. restrs. and SS energy: 61.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 81 Temperature: 1.157143 Total energy: -904.017782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.017782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.173785 (E_RNA) where: Base-Base interactions energy: -441.905 where: short stacking energy: -301.903 Base-Backbone interact. energy: -1.023 local terms energy: -510.245764 where: bonds (distance) C4'-P energy: -118.944 bonds (distance) P-C4' energy: -153.456 flat angles C4'-P-C4' energy: -125.598 flat angles P-C4'-P energy: -71.067 tors. eta vs tors. theta energy: -41.182 Dist. restrs. and SS energy: 49.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 81 Temperature: 1.221429 Total energy: -840.814307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.814307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.851822 (E_RNA) where: Base-Base interactions energy: -387.469 where: short stacking energy: -264.626 Base-Backbone interact. energy: -2.859 local terms energy: -496.523804 where: bonds (distance) C4'-P energy: -130.241 bonds (distance) P-C4' energy: -147.618 flat angles C4'-P-C4' energy: -123.406 flat angles P-C4'-P energy: -69.666 tors. eta vs tors. theta energy: -25.594 Dist. restrs. and SS energy: 46.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.285714 Total energy: -679.737231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.737231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.919464 (E_RNA) where: Base-Base interactions energy: -300.490 where: short stacking energy: -227.574 Base-Backbone interact. energy: -0.507 local terms energy: -435.922231 where: bonds (distance) C4'-P energy: -127.029 bonds (distance) P-C4' energy: -120.305 flat angles C4'-P-C4' energy: -110.452 flat angles P-C4'-P energy: -75.120 tors. eta vs tors. theta energy: -3.016 Dist. restrs. and SS energy: 57.182 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -589.150586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.150586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.271675 (E_RNA) where: Base-Base interactions energy: -246.989 where: short stacking energy: -198.222 Base-Backbone interact. energy: 0.645 local terms energy: -410.927673 where: bonds (distance) C4'-P energy: -131.896 bonds (distance) P-C4' energy: -143.794 flat angles C4'-P-C4' energy: -110.701 flat angles P-C4'-P energy: -57.712 tors. eta vs tors. theta energy: 33.175 Dist. restrs. and SS energy: 68.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1601.892831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.892831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.936926 (E_RNA) where: Base-Base interactions energy: -894.660 where: short stacking energy: -602.572 Base-Backbone interact. energy: -3.111 local terms energy: -734.165366 where: bonds (distance) C4'-P energy: -154.671 bonds (distance) P-C4' energy: -150.522 flat angles C4'-P-C4' energy: -168.249 flat angles P-C4'-P energy: -96.323 tors. eta vs tors. theta energy: -164.400 Dist. restrs. and SS energy: 30.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 82 Temperature: 0.964286 Total energy: -1341.702720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.702720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.010059 (E_RNA) where: Base-Base interactions energy: -690.266 where: short stacking energy: -490.757 Base-Backbone interact. energy: -0.665 local terms energy: -681.078805 where: bonds (distance) C4'-P energy: -165.858 bonds (distance) P-C4' energy: -148.125 flat angles C4'-P-C4' energy: -153.383 flat angles P-C4'-P energy: -86.976 tors. eta vs tors. theta energy: -126.736 Dist. restrs. and SS energy: 30.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 82 Temperature: 1.028571 Total energy: -1244.942817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.942817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.304958 (E_RNA) where: Base-Base interactions energy: -656.350 where: short stacking energy: -419.919 Base-Backbone interact. energy: -2.021 local terms energy: -620.934295 where: bonds (distance) C4'-P energy: -149.587 bonds (distance) P-C4' energy: -142.231 flat angles C4'-P-C4' energy: -142.042 flat angles P-C4'-P energy: -95.453 tors. eta vs tors. theta energy: -91.622 Dist. restrs. and SS energy: 34.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.092857 Total energy: -916.546981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.546981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.364632 (E_RNA) where: Base-Base interactions energy: -405.637 where: short stacking energy: -297.937 Base-Backbone interact. energy: 1.797 local terms energy: -552.524634 where: bonds (distance) C4'-P energy: -147.669 bonds (distance) P-C4' energy: -132.807 flat angles C4'-P-C4' energy: -131.342 flat angles P-C4'-P energy: -71.820 tors. eta vs tors. theta energy: -68.886 Dist. restrs. and SS energy: 39.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 82 Temperature: 1.157143 Total energy: -891.265522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.265522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.790215 (E_RNA) where: Base-Base interactions energy: -422.806 where: short stacking energy: -323.985 Base-Backbone interact. energy: 0.736 local terms energy: -513.720041 where: bonds (distance) C4'-P energy: -141.651 bonds (distance) P-C4' energy: -134.413 flat angles C4'-P-C4' energy: -120.261 flat angles P-C4'-P energy: -82.736 tors. eta vs tors. theta energy: -34.660 Dist. restrs. and SS energy: 44.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 82 Temperature: 1.221429 Total energy: -800.134440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.134440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.802180 (E_RNA) where: Base-Base interactions energy: -401.857 where: short stacking energy: -272.845 Base-Backbone interact. energy: 2.361 local terms energy: -451.306253 where: bonds (distance) C4'-P energy: -125.650 bonds (distance) P-C4' energy: -144.261 flat angles C4'-P-C4' energy: -101.171 flat angles P-C4'-P energy: -56.706 tors. eta vs tors. theta energy: -23.518 Dist. restrs. and SS energy: 50.668 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.285714 Total energy: -684.484389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.484389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.961157 (E_RNA) where: Base-Base interactions energy: -300.777 where: short stacking energy: -215.670 Base-Backbone interact. energy: 0.775 local terms energy: -432.958163 where: bonds (distance) C4'-P energy: -113.047 bonds (distance) P-C4' energy: -134.914 flat angles C4'-P-C4' energy: -113.066 flat angles P-C4'-P energy: -62.632 tors. eta vs tors. theta energy: -9.299 Dist. restrs. and SS energy: 48.477 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -613.663459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.663459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.819921 (E_RNA) where: Base-Base interactions energy: -280.250 where: short stacking energy: -213.456 Base-Backbone interact. energy: -0.793 local terms energy: -380.776753 where: bonds (distance) C4'-P energy: -114.236 bonds (distance) P-C4' energy: -117.864 flat angles C4'-P-C4' energy: -108.076 flat angles P-C4'-P energy: -45.946 tors. eta vs tors. theta energy: 5.346 Dist. restrs. and SS energy: 48.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1605.272631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.272631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.693895 (E_RNA) where: Base-Base interactions energy: -888.494 where: short stacking energy: -614.193 Base-Backbone interact. energy: -1.494 local terms energy: -744.705926 where: bonds (distance) C4'-P energy: -145.202 bonds (distance) P-C4' energy: -166.038 flat angles C4'-P-C4' energy: -170.906 flat angles P-C4'-P energy: -98.222 tors. eta vs tors. theta energy: -164.338 Dist. restrs. and SS energy: 29.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 83 Temperature: 0.964286 Total energy: -1344.523046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.523046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.484559 (E_RNA) where: Base-Base interactions energy: -702.223 where: short stacking energy: -530.279 Base-Backbone interact. energy: -0.359 local terms energy: -678.902789 where: bonds (distance) C4'-P energy: -155.488 bonds (distance) P-C4' energy: -138.065 flat angles C4'-P-C4' energy: -157.809 flat angles P-C4'-P energy: -94.594 tors. eta vs tors. theta energy: -132.946 Dist. restrs. and SS energy: 36.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 83 Temperature: 1.028571 Total energy: -1259.258539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.258539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.464765 (E_RNA) where: Base-Base interactions energy: -685.580 where: short stacking energy: -454.899 Base-Backbone interact. energy: -0.910 local terms energy: -605.974667 where: bonds (distance) C4'-P energy: -152.527 bonds (distance) P-C4' energy: -145.238 flat angles C4'-P-C4' energy: -145.367 flat angles P-C4'-P energy: -83.514 tors. eta vs tors. theta energy: -79.329 Dist. restrs. and SS energy: 33.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.092857 Total energy: -987.826901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.826901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.376325 (E_RNA) where: Base-Base interactions energy: -493.917 where: short stacking energy: -367.778 Base-Backbone interact. energy: 2.793 local terms energy: -550.252590 where: bonds (distance) C4'-P energy: -143.689 bonds (distance) P-C4' energy: -138.139 flat angles C4'-P-C4' energy: -128.386 flat angles P-C4'-P energy: -85.547 tors. eta vs tors. theta energy: -54.491 Dist. restrs. and SS energy: 53.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.157143 Total energy: -873.542121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.542121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.215141 (E_RNA) where: Base-Base interactions energy: -414.553 where: short stacking energy: -288.747 Base-Backbone interact. energy: 0.902 local terms energy: -498.563967 where: bonds (distance) C4'-P energy: -114.230 bonds (distance) P-C4' energy: -147.835 flat angles C4'-P-C4' energy: -131.692 flat angles P-C4'-P energy: -79.814 tors. eta vs tors. theta energy: -24.992 Dist. restrs. and SS energy: 38.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 83 Temperature: 1.221429 Total energy: -830.948382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.948382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.391773 (E_RNA) where: Base-Base interactions energy: -398.602 where: short stacking energy: -282.579 Base-Backbone interact. energy: -2.450 local terms energy: -482.339251 where: bonds (distance) C4'-P energy: -122.949 bonds (distance) P-C4' energy: -147.202 flat angles C4'-P-C4' energy: -101.514 flat angles P-C4'-P energy: -76.037 tors. eta vs tors. theta energy: -34.638 Dist. restrs. and SS energy: 52.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 83 Temperature: 1.285714 Total energy: -653.142516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.142516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.411225 (E_RNA) where: Base-Base interactions energy: -306.096 where: short stacking energy: -239.419 Base-Backbone interact. energy: 4.123 local terms energy: -406.438198 where: bonds (distance) C4'-P energy: -108.541 bonds (distance) P-C4' energy: -120.902 flat angles C4'-P-C4' energy: -101.368 flat angles P-C4'-P energy: -63.822 tors. eta vs tors. theta energy: -11.806 Dist. restrs. and SS energy: 55.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -604.633168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.633168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.788824 (E_RNA) where: Base-Base interactions energy: -278.466 where: short stacking energy: -190.952 Base-Backbone interact. energy: 4.113 local terms energy: -384.436138 where: bonds (distance) C4'-P energy: -114.527 bonds (distance) P-C4' energy: -129.260 flat angles C4'-P-C4' energy: -106.249 flat angles P-C4'-P energy: -58.085 tors. eta vs tors. theta energy: 23.685 Dist. restrs. and SS energy: 54.156 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1620.574512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.574512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.085726 (E_RNA) where: Base-Base interactions energy: -939.813 where: short stacking energy: -624.151 Base-Backbone interact. energy: -2.825 local terms energy: -715.447514 where: bonds (distance) C4'-P energy: -146.596 bonds (distance) P-C4' energy: -153.431 flat angles C4'-P-C4' energy: -150.648 flat angles P-C4'-P energy: -112.680 tors. eta vs tors. theta energy: -152.093 Dist. restrs. and SS energy: 37.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 84 Temperature: 0.964286 Total energy: -1352.852297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.852297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.162213 (E_RNA) where: Base-Base interactions energy: -718.866 where: short stacking energy: -531.725 Base-Backbone interact. energy: -0.657 local terms energy: -676.639401 where: bonds (distance) C4'-P energy: -142.919 bonds (distance) P-C4' energy: -149.761 flat angles C4'-P-C4' energy: -159.472 flat angles P-C4'-P energy: -96.205 tors. eta vs tors. theta energy: -128.283 Dist. restrs. and SS energy: 43.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 84 Temperature: 1.028571 Total energy: -1252.191031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.191031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.380183 (E_RNA) where: Base-Base interactions energy: -660.430 where: short stacking energy: -441.375 Base-Backbone interact. energy: -1.275 local terms energy: -619.675122 where: bonds (distance) C4'-P energy: -137.545 bonds (distance) P-C4' energy: -154.976 flat angles C4'-P-C4' energy: -135.874 flat angles P-C4'-P energy: -88.072 tors. eta vs tors. theta energy: -103.208 Dist. restrs. and SS energy: 29.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 84 Temperature: 1.092857 Total energy: -975.807005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.807005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.472216 (E_RNA) where: Base-Base interactions energy: -474.391 where: short stacking energy: -331.206 Base-Backbone interact. energy: 2.253 local terms energy: -555.335128 where: bonds (distance) C4'-P energy: -129.873 bonds (distance) P-C4' energy: -156.772 flat angles C4'-P-C4' energy: -137.855 flat angles P-C4'-P energy: -89.894 tors. eta vs tors. theta energy: -40.940 Dist. restrs. and SS energy: 51.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 84 Temperature: 1.157143 Total energy: -932.813710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.813710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.395921 (E_RNA) where: Base-Base interactions energy: -456.453 where: short stacking energy: -320.482 Base-Backbone interact. energy: 3.867 local terms energy: -528.810337 where: bonds (distance) C4'-P energy: -125.737 bonds (distance) P-C4' energy: -138.816 flat angles C4'-P-C4' energy: -122.884 flat angles P-C4'-P energy: -99.864 tors. eta vs tors. theta energy: -41.509 Dist. restrs. and SS energy: 48.582 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.221429 Total energy: -809.468481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.468481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.977473 (E_RNA) where: Base-Base interactions energy: -395.732 where: short stacking energy: -270.351 Base-Backbone interact. energy: 2.988 local terms energy: -475.233183 where: bonds (distance) C4'-P energy: -133.378 bonds (distance) P-C4' energy: -120.427 flat angles C4'-P-C4' energy: -105.457 flat angles P-C4'-P energy: -81.481 tors. eta vs tors. theta energy: -34.490 Dist. restrs. and SS energy: 58.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.285714 Total energy: -722.178577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.178577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.118606 (E_RNA) where: Base-Base interactions energy: -322.888 where: short stacking energy: -244.529 Base-Backbone interact. energy: -2.876 local terms energy: -454.354481 where: bonds (distance) C4'-P energy: -100.087 bonds (distance) P-C4' energy: -145.569 flat angles C4'-P-C4' energy: -120.032 flat angles P-C4'-P energy: -72.469 tors. eta vs tors. theta energy: -16.197 Dist. restrs. and SS energy: 57.940 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -599.353231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.353231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.147675 (E_RNA) where: Base-Base interactions energy: -288.084 where: short stacking energy: -219.952 Base-Backbone interact. energy: 0.237 local terms energy: -367.300930 where: bonds (distance) C4'-P energy: -110.167 bonds (distance) P-C4' energy: -121.555 flat angles C4'-P-C4' energy: -86.503 flat angles P-C4'-P energy: -68.763 tors. eta vs tors. theta energy: 19.687 Dist. restrs. and SS energy: 55.794 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1587.151492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.151492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.096024 (E_RNA) where: Base-Base interactions energy: -879.592 where: short stacking energy: -624.643 Base-Backbone interact. energy: -2.413 local terms energy: -734.090459 where: bonds (distance) C4'-P energy: -143.646 bonds (distance) P-C4' energy: -172.289 flat angles C4'-P-C4' energy: -169.174 flat angles P-C4'-P energy: -94.817 tors. eta vs tors. theta energy: -154.165 Dist. restrs. and SS energy: 28.945 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 85 Temperature: 0.964286 Total energy: -1305.482094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.482094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.516864 (E_RNA) where: Base-Base interactions energy: -681.877 where: short stacking energy: -489.644 Base-Backbone interact. energy: -1.069 local terms energy: -659.570879 where: bonds (distance) C4'-P energy: -157.227 bonds (distance) P-C4' energy: -143.227 flat angles C4'-P-C4' energy: -159.647 flat angles P-C4'-P energy: -81.433 tors. eta vs tors. theta energy: -118.036 Dist. restrs. and SS energy: 37.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 85 Temperature: 1.028571 Total energy: -1297.231474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.231474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.385277 (E_RNA) where: Base-Base interactions energy: -703.447 where: short stacking energy: -484.840 Base-Backbone interact. energy: -2.468 local terms energy: -617.470752 where: bonds (distance) C4'-P energy: -140.071 bonds (distance) P-C4' energy: -144.322 flat angles C4'-P-C4' energy: -157.325 flat angles P-C4'-P energy: -79.145 tors. eta vs tors. theta energy: -96.608 Dist. restrs. and SS energy: 26.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 85 Temperature: 1.092857 Total energy: -1032.710142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.710142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.143784 (E_RNA) where: Base-Base interactions energy: -533.231 where: short stacking energy: -366.962 Base-Backbone interact. energy: -1.894 local terms energy: -551.018010 where: bonds (distance) C4'-P energy: -132.190 bonds (distance) P-C4' energy: -142.691 flat angles C4'-P-C4' energy: -133.657 flat angles P-C4'-P energy: -79.961 tors. eta vs tors. theta energy: -62.519 Dist. restrs. and SS energy: 53.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 85 Temperature: 1.157143 Total energy: -950.622131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.622131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.682353 (E_RNA) where: Base-Base interactions energy: -480.067 where: short stacking energy: -337.533 Base-Backbone interact. energy: -0.451 local terms energy: -525.164537 where: bonds (distance) C4'-P energy: -122.112 bonds (distance) P-C4' energy: -144.516 flat angles C4'-P-C4' energy: -153.416 flat angles P-C4'-P energy: -52.181 tors. eta vs tors. theta energy: -52.939 Dist. restrs. and SS energy: 55.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.221429 Total energy: -834.518902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.518902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.966640 (E_RNA) where: Base-Base interactions energy: -412.688 where: short stacking energy: -277.153 Base-Backbone interact. energy: 5.998 local terms energy: -477.276625 where: bonds (distance) C4'-P energy: -127.757 bonds (distance) P-C4' energy: -121.202 flat angles C4'-P-C4' energy: -146.768 flat angles P-C4'-P energy: -51.456 tors. eta vs tors. theta energy: -30.093 Dist. restrs. and SS energy: 49.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.285714 Total energy: -666.724147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.724147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.564636 (E_RNA) where: Base-Base interactions energy: -299.727 where: short stacking energy: -225.240 Base-Backbone interact. energy: 0.522 local terms energy: -413.360103 where: bonds (distance) C4'-P energy: -128.651 bonds (distance) P-C4' energy: -120.439 flat angles C4'-P-C4' energy: -107.423 flat angles P-C4'-P energy: -56.893 tors. eta vs tors. theta energy: 0.046 Dist. restrs. and SS energy: 45.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -591.037908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.037908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.824931 (E_RNA) where: Base-Base interactions energy: -302.360 where: short stacking energy: -228.502 Base-Backbone interact. energy: 4.788 local terms energy: -360.253495 where: bonds (distance) C4'-P energy: -106.417 bonds (distance) P-C4' energy: -129.159 flat angles C4'-P-C4' energy: -93.340 flat angles P-C4'-P energy: -36.941 tors. eta vs tors. theta energy: 5.604 Dist. restrs. and SS energy: 66.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1652.396845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.396845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.009966 (E_RNA) where: Base-Base interactions energy: -940.864 where: short stacking energy: -653.029 Base-Backbone interact. energy: -0.231 local terms energy: -757.914508 where: bonds (distance) C4'-P energy: -146.808 bonds (distance) P-C4' energy: -151.950 flat angles C4'-P-C4' energy: -175.380 flat angles P-C4'-P energy: -108.703 tors. eta vs tors. theta energy: -175.074 Dist. restrs. and SS energy: 46.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 86 Temperature: 0.964286 Total energy: -1293.772734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.772734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.709321 (E_RNA) where: Base-Base interactions energy: -676.578 where: short stacking energy: -493.026 Base-Backbone interact. energy: -1.243 local terms energy: -651.888929 where: bonds (distance) C4'-P energy: -152.829 bonds (distance) P-C4' energy: -149.637 flat angles C4'-P-C4' energy: -136.362 flat angles P-C4'-P energy: -102.648 tors. eta vs tors. theta energy: -110.412 Dist. restrs. and SS energy: 35.937 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 86 Temperature: 1.028571 Total energy: -1309.781371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.781371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.212316 (E_RNA) where: Base-Base interactions energy: -682.620 where: short stacking energy: -473.103 Base-Backbone interact. energy: -1.196 local terms energy: -659.397169 where: bonds (distance) C4'-P energy: -156.222 bonds (distance) P-C4' energy: -151.580 flat angles C4'-P-C4' energy: -156.192 flat angles P-C4'-P energy: -81.138 tors. eta vs tors. theta energy: -114.265 Dist. restrs. and SS energy: 33.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 86 Temperature: 1.092857 Total energy: -1016.316914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.316914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.775694 (E_RNA) where: Base-Base interactions energy: -510.362 where: short stacking energy: -345.395 Base-Backbone interact. energy: -2.807 local terms energy: -558.606722 where: bonds (distance) C4'-P energy: -132.357 bonds (distance) P-C4' energy: -145.954 flat angles C4'-P-C4' energy: -136.424 flat angles P-C4'-P energy: -81.167 tors. eta vs tors. theta energy: -62.706 Dist. restrs. and SS energy: 55.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 86 Temperature: 1.157143 Total energy: -900.743669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.743669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.706591 (E_RNA) where: Base-Base interactions energy: -446.271 where: short stacking energy: -337.333 Base-Backbone interact. energy: 2.097 local terms energy: -517.532573 where: bonds (distance) C4'-P energy: -133.627 bonds (distance) P-C4' energy: -133.016 flat angles C4'-P-C4' energy: -128.830 flat angles P-C4'-P energy: -69.042 tors. eta vs tors. theta energy: -53.017 Dist. restrs. and SS energy: 60.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.221429 Total energy: -833.271451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.271451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.608330 (E_RNA) where: Base-Base interactions energy: -433.596 where: short stacking energy: -268.317 Base-Backbone interact. energy: -1.007 local terms energy: -453.004806 where: bonds (distance) C4'-P energy: -127.788 bonds (distance) P-C4' energy: -131.536 flat angles C4'-P-C4' energy: -113.276 flat angles P-C4'-P energy: -72.910 tors. eta vs tors. theta energy: -7.494 Dist. restrs. and SS energy: 54.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.285714 Total energy: -652.188161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.188161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.713312 (E_RNA) where: Base-Base interactions energy: -309.773 where: short stacking energy: -230.957 Base-Backbone interact. energy: -3.510 local terms energy: -389.431204 where: bonds (distance) C4'-P energy: -115.054 bonds (distance) P-C4' energy: -107.934 flat angles C4'-P-C4' energy: -91.552 flat angles P-C4'-P energy: -68.494 tors. eta vs tors. theta energy: -6.397 Dist. restrs. and SS energy: 50.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -591.736602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.736602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.904563 (E_RNA) where: Base-Base interactions energy: -248.478 where: short stacking energy: -189.040 Base-Backbone interact. energy: -4.167 local terms energy: -404.259575 where: bonds (distance) C4'-P energy: -127.230 bonds (distance) P-C4' energy: -116.025 flat angles C4'-P-C4' energy: -92.207 flat angles P-C4'-P energy: -74.476 tors. eta vs tors. theta energy: 5.678 Dist. restrs. and SS energy: 65.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1650.638859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.638859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.087252 (E_RNA) where: Base-Base interactions energy: -924.106 where: short stacking energy: -651.252 Base-Backbone interact. energy: -1.850 local terms energy: -766.131954 where: bonds (distance) C4'-P energy: -151.070 bonds (distance) P-C4' energy: -176.420 flat angles C4'-P-C4' energy: -161.027 flat angles P-C4'-P energy: -107.838 tors. eta vs tors. theta energy: -169.777 Dist. restrs. and SS energy: 41.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 87 Temperature: 0.964286 Total energy: -1372.112021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.112021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.988346 (E_RNA) where: Base-Base interactions energy: -741.473 where: short stacking energy: -512.280 Base-Backbone interact. energy: -1.191 local terms energy: -652.324031 where: bonds (distance) C4'-P energy: -129.047 bonds (distance) P-C4' energy: -151.942 flat angles C4'-P-C4' energy: -162.472 flat angles P-C4'-P energy: -91.850 tors. eta vs tors. theta energy: -117.014 Dist. restrs. and SS energy: 22.876 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 87 Temperature: 1.028571 Total energy: -1210.439046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.439046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.999118 (E_RNA) where: Base-Base interactions energy: -638.888 where: short stacking energy: -458.520 Base-Backbone interact. energy: -0.661 local terms energy: -612.449434 where: bonds (distance) C4'-P energy: -134.282 bonds (distance) P-C4' energy: -129.699 flat angles C4'-P-C4' energy: -143.670 flat angles P-C4'-P energy: -98.633 tors. eta vs tors. theta energy: -106.165 Dist. restrs. and SS energy: 41.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 87 Temperature: 1.092857 Total energy: -1057.324659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.324659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.740245 (E_RNA) where: Base-Base interactions energy: -556.047 where: short stacking energy: -416.998 Base-Backbone interact. energy: -2.612 local terms energy: -550.081862 where: bonds (distance) C4'-P energy: -139.282 bonds (distance) P-C4' energy: -132.214 flat angles C4'-P-C4' energy: -125.951 flat angles P-C4'-P energy: -86.147 tors. eta vs tors. theta energy: -66.488 Dist. restrs. and SS energy: 51.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 87 Temperature: 1.157143 Total energy: -837.897811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.897811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.896988 (E_RNA) where: Base-Base interactions energy: -426.487 where: short stacking energy: -303.895 Base-Backbone interact. energy: 5.491 local terms energy: -471.901282 where: bonds (distance) C4'-P energy: -125.868 bonds (distance) P-C4' energy: -137.682 flat angles C4'-P-C4' energy: -105.885 flat angles P-C4'-P energy: -73.432 tors. eta vs tors. theta energy: -29.034 Dist. restrs. and SS energy: 54.999 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 87 Temperature: 1.221429 Total energy: -916.024600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.024600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.275892 (E_RNA) where: Base-Base interactions energy: -487.281 where: short stacking energy: -309.278 Base-Backbone interact. energy: -0.434 local terms energy: -481.560225 where: bonds (distance) C4'-P energy: -125.423 bonds (distance) P-C4' energy: -131.844 flat angles C4'-P-C4' energy: -118.124 flat angles P-C4'-P energy: -59.993 tors. eta vs tors. theta energy: -46.176 Dist. restrs. and SS energy: 53.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.285714 Total energy: -673.379905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.379905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.698078 (E_RNA) where: Base-Base interactions energy: -296.554 where: short stacking energy: -223.751 Base-Backbone interact. energy: -0.748 local terms energy: -432.395695 where: bonds (distance) C4'-P energy: -118.940 bonds (distance) P-C4' energy: -136.540 flat angles C4'-P-C4' energy: -109.046 flat angles P-C4'-P energy: -77.510 tors. eta vs tors. theta energy: 9.639 Dist. restrs. and SS energy: 56.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -587.713148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.713148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.698720 (E_RNA) where: Base-Base interactions energy: -243.299 where: short stacking energy: -182.208 Base-Backbone interact. energy: -1.344 local terms energy: -411.055131 where: bonds (distance) C4'-P energy: -113.762 bonds (distance) P-C4' energy: -129.570 flat angles C4'-P-C4' energy: -116.921 flat angles P-C4'-P energy: -48.728 tors. eta vs tors. theta energy: -2.074 Dist. restrs. and SS energy: 67.986 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1603.448676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.448676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.997725 (E_RNA) where: Base-Base interactions energy: -908.189 where: short stacking energy: -644.597 Base-Backbone interact. energy: -1.671 local terms energy: -737.137491 where: bonds (distance) C4'-P energy: -157.143 bonds (distance) P-C4' energy: -145.033 flat angles C4'-P-C4' energy: -162.592 flat angles P-C4'-P energy: -100.892 tors. eta vs tors. theta energy: -171.477 Dist. restrs. and SS energy: 43.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 88 Temperature: 0.964286 Total energy: -1423.518457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.518457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.803974 (E_RNA) where: Base-Base interactions energy: -773.583 where: short stacking energy: -526.028 Base-Backbone interact. energy: -2.865 local terms energy: -670.356357 where: bonds (distance) C4'-P energy: -150.629 bonds (distance) P-C4' energy: -147.082 flat angles C4'-P-C4' energy: -151.119 flat angles P-C4'-P energy: -86.820 tors. eta vs tors. theta energy: -134.706 Dist. restrs. and SS energy: 23.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 88 Temperature: 1.028571 Total energy: -1176.945464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.945464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.675911 (E_RNA) where: Base-Base interactions energy: -627.589 where: short stacking energy: -417.426 Base-Backbone interact. energy: -1.173 local terms energy: -582.913273 where: bonds (distance) C4'-P energy: -127.439 bonds (distance) P-C4' energy: -143.071 flat angles C4'-P-C4' energy: -139.920 flat angles P-C4'-P energy: -90.205 tors. eta vs tors. theta energy: -82.279 Dist. restrs. and SS energy: 34.730 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 88 Temperature: 1.092857 Total energy: -1078.515259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.515259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.598669 (E_RNA) where: Base-Base interactions energy: -562.151 where: short stacking energy: -410.359 Base-Backbone interact. energy: -2.057 local terms energy: -557.390443 where: bonds (distance) C4'-P energy: -131.697 bonds (distance) P-C4' energy: -133.617 flat angles C4'-P-C4' energy: -127.107 flat angles P-C4'-P energy: -82.447 tors. eta vs tors. theta energy: -82.522 Dist. restrs. and SS energy: 43.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 88 Temperature: 1.157143 Total energy: -887.608851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.608851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.870982 (E_RNA) where: Base-Base interactions energy: -454.076 where: short stacking energy: -338.287 Base-Backbone interact. energy: 1.253 local terms energy: -485.048276 where: bonds (distance) C4'-P energy: -112.997 bonds (distance) P-C4' energy: -128.733 flat angles C4'-P-C4' energy: -115.101 flat angles P-C4'-P energy: -76.612 tors. eta vs tors. theta energy: -51.606 Dist. restrs. and SS energy: 50.262 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 88 Temperature: 1.221429 Total energy: -818.631909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.631909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.706301 (E_RNA) where: Base-Base interactions energy: -429.573 where: short stacking energy: -245.814 Base-Backbone interact. energy: -0.340 local terms energy: -449.793821 where: bonds (distance) C4'-P energy: -127.882 bonds (distance) P-C4' energy: -127.144 flat angles C4'-P-C4' energy: -113.992 flat angles P-C4'-P energy: -77.138 tors. eta vs tors. theta energy: -3.638 Dist. restrs. and SS energy: 61.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.285714 Total energy: -733.422857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.422857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.436241 (E_RNA) where: Base-Base interactions energy: -309.592 where: short stacking energy: -232.316 Base-Backbone interact. energy: -3.909 local terms energy: -463.935657 where: bonds (distance) C4'-P energy: -132.607 bonds (distance) P-C4' energy: -128.869 flat angles C4'-P-C4' energy: -120.857 flat angles P-C4'-P energy: -57.664 tors. eta vs tors. theta energy: -23.939 Dist. restrs. and SS energy: 44.013 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -581.469727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.469727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.233249 (E_RNA) where: Base-Base interactions energy: -273.237 where: short stacking energy: -211.268 Base-Backbone interact. energy: 0.403 local terms energy: -378.399452 where: bonds (distance) C4'-P energy: -109.557 bonds (distance) P-C4' energy: -125.481 flat angles C4'-P-C4' energy: -93.441 flat angles P-C4'-P energy: -61.638 tors. eta vs tors. theta energy: 11.718 Dist. restrs. and SS energy: 69.764 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1584.701226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.701226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.838879 (E_RNA) where: Base-Base interactions energy: -894.519 where: short stacking energy: -617.581 Base-Backbone interact. energy: -3.020 local terms energy: -723.300380 where: bonds (distance) C4'-P energy: -149.685 bonds (distance) P-C4' energy: -141.419 flat angles C4'-P-C4' energy: -177.110 flat angles P-C4'-P energy: -89.787 tors. eta vs tors. theta energy: -165.299 Dist. restrs. and SS energy: 36.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 89 Temperature: 0.964286 Total energy: -1462.065451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.065451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.739376 (E_RNA) where: Base-Base interactions energy: -789.086 where: short stacking energy: -547.373 Base-Backbone interact. energy: -1.887 local terms energy: -699.765433 where: bonds (distance) C4'-P energy: -149.635 bonds (distance) P-C4' energy: -159.221 flat angles C4'-P-C4' energy: -157.803 flat angles P-C4'-P energy: -107.676 tors. eta vs tors. theta energy: -125.430 Dist. restrs. and SS energy: 28.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 89 Temperature: 1.028571 Total energy: -1176.936062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.936062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.878717 (E_RNA) where: Base-Base interactions energy: -620.153 where: short stacking energy: -414.159 Base-Backbone interact. energy: 0.626 local terms energy: -592.351581 where: bonds (distance) C4'-P energy: -153.629 bonds (distance) P-C4' energy: -143.583 flat angles C4'-P-C4' energy: -138.924 flat angles P-C4'-P energy: -79.427 tors. eta vs tors. theta energy: -76.789 Dist. restrs. and SS energy: 34.943 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 89 Temperature: 1.092857 Total energy: -1072.933883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.933883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.773542 (E_RNA) where: Base-Base interactions energy: -542.103 where: short stacking energy: -384.211 Base-Backbone interact. energy: -1.596 local terms energy: -580.074537 where: bonds (distance) C4'-P energy: -130.012 bonds (distance) P-C4' energy: -163.915 flat angles C4'-P-C4' energy: -152.321 flat angles P-C4'-P energy: -61.909 tors. eta vs tors. theta energy: -71.918 Dist. restrs. and SS energy: 50.840 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 89 Temperature: 1.157143 Total energy: -923.442725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.442725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.728901 (E_RNA) where: Base-Base interactions energy: -422.467 where: short stacking energy: -300.171 Base-Backbone interact. energy: 0.655 local terms energy: -552.916866 where: bonds (distance) C4'-P energy: -119.234 bonds (distance) P-C4' energy: -163.407 flat angles C4'-P-C4' energy: -126.932 flat angles P-C4'-P energy: -85.278 tors. eta vs tors. theta energy: -58.067 Dist. restrs. and SS energy: 51.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.221429 Total energy: -833.198702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.198702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.797402 (E_RNA) where: Base-Base interactions energy: -426.829 where: short stacking energy: -267.962 Base-Backbone interact. energy: -1.172 local terms energy: -454.795673 where: bonds (distance) C4'-P energy: -128.816 bonds (distance) P-C4' energy: -134.523 flat angles C4'-P-C4' energy: -110.519 flat angles P-C4'-P energy: -62.850 tors. eta vs tors. theta energy: -18.087 Dist. restrs. and SS energy: 49.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 89 Temperature: 1.285714 Total energy: -640.308588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.308588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.864085 (E_RNA) where: Base-Base interactions energy: -288.335 where: short stacking energy: -228.567 Base-Backbone interact. energy: -0.961 local terms energy: -401.568584 where: bonds (distance) C4'-P energy: -95.430 bonds (distance) P-C4' energy: -135.206 flat angles C4'-P-C4' energy: -113.812 flat angles P-C4'-P energy: -56.908 tors. eta vs tors. theta energy: -0.212 Dist. restrs. and SS energy: 50.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -580.712655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.712655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.779924 (E_RNA) where: Base-Base interactions energy: -240.086 where: short stacking energy: -151.253 Base-Backbone interact. energy: -2.682 local terms energy: -395.012516 where: bonds (distance) C4'-P energy: -118.712 bonds (distance) P-C4' energy: -134.925 flat angles C4'-P-C4' energy: -92.059 flat angles P-C4'-P energy: -76.605 tors. eta vs tors. theta energy: 27.288 Dist. restrs. and SS energy: 57.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1558.281035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.281035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.926993 (E_RNA) where: Base-Base interactions energy: -885.644 where: short stacking energy: -596.493 Base-Backbone interact. energy: -2.035 local terms energy: -706.247498 where: bonds (distance) C4'-P energy: -157.717 bonds (distance) P-C4' energy: -152.416 flat angles C4'-P-C4' energy: -148.871 flat angles P-C4'-P energy: -104.777 tors. eta vs tors. theta energy: -142.466 Dist. restrs. and SS energy: 35.646 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 90 Temperature: 0.964286 Total energy: -1516.970448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.970448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.251581 (E_RNA) where: Base-Base interactions energy: -856.903 where: short stacking energy: -582.733 Base-Backbone interact. energy: -3.976 local terms energy: -679.373218 where: bonds (distance) C4'-P energy: -147.871 bonds (distance) P-C4' energy: -150.555 flat angles C4'-P-C4' energy: -156.009 flat angles P-C4'-P energy: -87.469 tors. eta vs tors. theta energy: -137.470 Dist. restrs. and SS energy: 23.281 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 90 Temperature: 1.028571 Total energy: -1195.576570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.576570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.531236 (E_RNA) where: Base-Base interactions energy: -629.133 where: short stacking energy: -414.450 Base-Backbone interact. energy: -0.151 local terms energy: -601.247843 where: bonds (distance) C4'-P energy: -132.197 bonds (distance) P-C4' energy: -146.960 flat angles C4'-P-C4' energy: -136.404 flat angles P-C4'-P energy: -97.070 tors. eta vs tors. theta energy: -88.616 Dist. restrs. and SS energy: 34.955 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 90 Temperature: 1.092857 Total energy: -1038.793773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.793773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.023871 (E_RNA) where: Base-Base interactions energy: -557.149 where: short stacking energy: -393.183 Base-Backbone interact. energy: 3.265 local terms energy: -542.138961 where: bonds (distance) C4'-P energy: -130.671 bonds (distance) P-C4' energy: -131.653 flat angles C4'-P-C4' energy: -114.681 flat angles P-C4'-P energy: -98.741 tors. eta vs tors. theta energy: -66.392 Dist. restrs. and SS energy: 57.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.157143 Total energy: -869.936921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.936921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.983522 (E_RNA) where: Base-Base interactions energy: -416.632 where: short stacking energy: -284.466 Base-Backbone interact. energy: -0.039 local terms energy: -505.312158 where: bonds (distance) C4'-P energy: -132.358 bonds (distance) P-C4' energy: -151.322 flat angles C4'-P-C4' energy: -112.390 flat angles P-C4'-P energy: -82.610 tors. eta vs tors. theta energy: -26.631 Dist. restrs. and SS energy: 52.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.221429 Total energy: -866.716171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.716171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.492499 (E_RNA) where: Base-Base interactions energy: -467.985 where: short stacking energy: -312.491 Base-Backbone interact. energy: 1.441 local terms energy: -463.949199 where: bonds (distance) C4'-P energy: -138.262 bonds (distance) P-C4' energy: -125.852 flat angles C4'-P-C4' energy: -118.675 flat angles P-C4'-P energy: -56.623 tors. eta vs tors. theta energy: -24.538 Dist. restrs. and SS energy: 63.776 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.285714 Total energy: -701.215244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.215244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.213718 (E_RNA) where: Base-Base interactions energy: -294.510 where: short stacking energy: -206.664 Base-Backbone interact. energy: 1.842 local terms energy: -456.545139 where: bonds (distance) C4'-P energy: -124.154 bonds (distance) P-C4' energy: -135.964 flat angles C4'-P-C4' energy: -113.744 flat angles P-C4'-P energy: -69.146 tors. eta vs tors. theta energy: -13.536 Dist. restrs. and SS energy: 47.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -615.325596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.325596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.896951 (E_RNA) where: Base-Base interactions energy: -280.621 where: short stacking energy: -199.065 Base-Backbone interact. energy: 3.830 local terms energy: -394.106014 where: bonds (distance) C4'-P energy: -119.929 bonds (distance) P-C4' energy: -105.866 flat angles C4'-P-C4' energy: -103.516 flat angles P-C4'-P energy: -66.986 tors. eta vs tors. theta energy: 2.192 Dist. restrs. and SS energy: 55.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1619.426080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.426080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.911028 (E_RNA) where: Base-Base interactions energy: -919.155 where: short stacking energy: -635.884 Base-Backbone interact. energy: -3.791 local terms energy: -734.965314 where: bonds (distance) C4'-P energy: -155.841 bonds (distance) P-C4' energy: -146.546 flat angles C4'-P-C4' energy: -157.495 flat angles P-C4'-P energy: -110.889 tors. eta vs tors. theta energy: -164.194 Dist. restrs. and SS energy: 38.485 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 91 Temperature: 0.964286 Total energy: -1461.946612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.946612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.803093 (E_RNA) where: Base-Base interactions energy: -777.942 where: short stacking energy: -530.157 Base-Backbone interact. energy: -2.690 local terms energy: -705.171130 where: bonds (distance) C4'-P energy: -144.617 bonds (distance) P-C4' energy: -159.520 flat angles C4'-P-C4' energy: -167.636 flat angles P-C4'-P energy: -98.401 tors. eta vs tors. theta energy: -134.998 Dist. restrs. and SS energy: 23.856 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 91 Temperature: 1.028571 Total energy: -1211.504804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.504804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.171521 (E_RNA) where: Base-Base interactions energy: -617.639 where: short stacking energy: -428.950 Base-Backbone interact. energy: 1.188 local terms energy: -628.720421 where: bonds (distance) C4'-P energy: -146.262 bonds (distance) P-C4' energy: -138.837 flat angles C4'-P-C4' energy: -142.918 flat angles P-C4'-P energy: -98.231 tors. eta vs tors. theta energy: -102.472 Dist. restrs. and SS energy: 33.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 91 Temperature: 1.092857 Total energy: -1040.089902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.089902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.158582 (E_RNA) where: Base-Base interactions energy: -539.417 where: short stacking energy: -391.114 Base-Backbone interact. energy: -3.374 local terms energy: -546.367289 where: bonds (distance) C4'-P energy: -129.619 bonds (distance) P-C4' energy: -143.890 flat angles C4'-P-C4' energy: -116.619 flat angles P-C4'-P energy: -75.829 tors. eta vs tors. theta energy: -80.411 Dist. restrs. and SS energy: 49.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.157143 Total energy: -873.996792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.996792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.423450 (E_RNA) where: Base-Base interactions energy: -415.421 where: short stacking energy: -282.938 Base-Backbone interact. energy: -1.978 local terms energy: -492.024338 where: bonds (distance) C4'-P energy: -136.528 bonds (distance) P-C4' energy: -152.451 flat angles C4'-P-C4' energy: -115.651 flat angles P-C4'-P energy: -50.273 tors. eta vs tors. theta energy: -37.122 Dist. restrs. and SS energy: 35.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 91 Temperature: 1.221429 Total energy: -903.996483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.996483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.316243 (E_RNA) where: Base-Base interactions energy: -488.470 where: short stacking energy: -295.620 Base-Backbone interact. energy: -2.719 local terms energy: -481.126931 where: bonds (distance) C4'-P energy: -125.935 bonds (distance) P-C4' energy: -128.145 flat angles C4'-P-C4' energy: -131.518 flat angles P-C4'-P energy: -71.075 tors. eta vs tors. theta energy: -24.454 Dist. restrs. and SS energy: 68.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 91 Temperature: 1.285714 Total energy: -678.102299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.102299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.490165 (E_RNA) where: Base-Base interactions energy: -297.676 where: short stacking energy: -224.621 Base-Backbone interact. energy: -0.743 local terms energy: -430.070827 where: bonds (distance) C4'-P energy: -116.819 bonds (distance) P-C4' energy: -121.655 flat angles C4'-P-C4' energy: -110.009 flat angles P-C4'-P energy: -63.093 tors. eta vs tors. theta energy: -18.494 Dist. restrs. and SS energy: 50.388 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -654.859809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.859809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.739298 (E_RNA) where: Base-Base interactions energy: -295.692 where: short stacking energy: -239.492 Base-Backbone interact. energy: -0.294 local terms energy: -420.753568 where: bonds (distance) C4'-P energy: -112.676 bonds (distance) P-C4' energy: -114.257 flat angles C4'-P-C4' energy: -127.358 flat angles P-C4'-P energy: -58.729 tors. eta vs tors. theta energy: -7.734 Dist. restrs. and SS energy: 61.879 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1582.622676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.622676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.356818 (E_RNA) where: Base-Base interactions energy: -881.705 where: short stacking energy: -605.094 Base-Backbone interact. energy: -2.128 local terms energy: -731.523161 where: bonds (distance) C4'-P energy: -151.986 bonds (distance) P-C4' energy: -159.809 flat angles C4'-P-C4' energy: -162.797 flat angles P-C4'-P energy: -107.369 tors. eta vs tors. theta energy: -149.563 Dist. restrs. and SS energy: 32.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.964286 Total energy: -1476.522612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.522612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.425945 (E_RNA) where: Base-Base interactions energy: -843.163 where: short stacking energy: -563.410 Base-Backbone interact. energy: -1.899 local terms energy: -655.364051 where: bonds (distance) C4'-P energy: -139.347 bonds (distance) P-C4' energy: -144.293 flat angles C4'-P-C4' energy: -148.476 flat angles P-C4'-P energy: -98.896 tors. eta vs tors. theta energy: -124.353 Dist. restrs. and SS energy: 23.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 92 Temperature: 1.028571 Total energy: -1198.455743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.455743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.433733 (E_RNA) where: Base-Base interactions energy: -655.602 where: short stacking energy: -462.827 Base-Backbone interact. energy: 0.744 local terms energy: -583.575405 where: bonds (distance) C4'-P energy: -119.930 bonds (distance) P-C4' energy: -133.456 flat angles C4'-P-C4' energy: -148.883 flat angles P-C4'-P energy: -89.311 tors. eta vs tors. theta energy: -91.995 Dist. restrs. and SS energy: 39.978 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 92 Temperature: 1.092857 Total energy: -1078.624660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.624660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.036498 (E_RNA) where: Base-Base interactions energy: -565.131 where: short stacking energy: -376.663 Base-Backbone interact. energy: 1.650 local terms energy: -557.556000 where: bonds (distance) C4'-P energy: -143.136 bonds (distance) P-C4' energy: -150.990 flat angles C4'-P-C4' energy: -136.400 flat angles P-C4'-P energy: -72.004 tors. eta vs tors. theta energy: -55.025 Dist. restrs. and SS energy: 42.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 92 Temperature: 1.157143 Total energy: -995.605835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.605835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.640869 (E_RNA) where: Base-Base interactions energy: -516.832 where: short stacking energy: -344.471 Base-Backbone interact. energy: -3.315 local terms energy: -517.493902 where: bonds (distance) C4'-P energy: -146.126 bonds (distance) P-C4' energy: -129.689 flat angles C4'-P-C4' energy: -124.238 flat angles P-C4'-P energy: -61.212 tors. eta vs tors. theta energy: -56.230 Dist. restrs. and SS energy: 42.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.221429 Total energy: -854.772908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.772908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.939063 (E_RNA) where: Base-Base interactions energy: -449.280 where: short stacking energy: -265.959 Base-Backbone interact. energy: 1.324 local terms energy: -458.983008 where: bonds (distance) C4'-P energy: -135.348 bonds (distance) P-C4' energy: -137.273 flat angles C4'-P-C4' energy: -86.467 flat angles P-C4'-P energy: -71.926 tors. eta vs tors. theta energy: -27.968 Dist. restrs. and SS energy: 52.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.285714 Total energy: -725.167909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.167909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.135745 (E_RNA) where: Base-Base interactions energy: -325.656 where: short stacking energy: -253.079 Base-Backbone interact. energy: -2.277 local terms energy: -451.202717 where: bonds (distance) C4'-P energy: -143.994 bonds (distance) P-C4' energy: -137.065 flat angles C4'-P-C4' energy: -105.881 flat angles P-C4'-P energy: -47.371 tors. eta vs tors. theta energy: -16.892 Dist. restrs. and SS energy: 53.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -593.420319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.420319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.233947 (E_RNA) where: Base-Base interactions energy: -280.695 where: short stacking energy: -178.988 Base-Backbone interact. energy: -1.195 local terms energy: -359.344260 where: bonds (distance) C4'-P energy: -126.905 bonds (distance) P-C4' energy: -105.395 flat angles C4'-P-C4' energy: -99.536 flat angles P-C4'-P energy: -37.491 tors. eta vs tors. theta energy: 9.983 Dist. restrs. and SS energy: 47.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1558.882418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.882418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.388365 (E_RNA) where: Base-Base interactions energy: -869.357 where: short stacking energy: -608.680 Base-Backbone interact. energy: -2.494 local terms energy: -713.537667 where: bonds (distance) C4'-P energy: -152.061 bonds (distance) P-C4' energy: -152.490 flat angles C4'-P-C4' energy: -156.801 flat angles P-C4'-P energy: -91.774 tors. eta vs tors. theta energy: -160.411 Dist. restrs. and SS energy: 26.506 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 93 Temperature: 0.964286 Total energy: -1491.234932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.234932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.699611 (E_RNA) where: Base-Base interactions energy: -844.474 where: short stacking energy: -541.413 Base-Backbone interact. energy: -1.636 local terms energy: -664.590493 where: bonds (distance) C4'-P energy: -129.283 bonds (distance) P-C4' energy: -156.035 flat angles C4'-P-C4' energy: -159.603 flat angles P-C4'-P energy: -91.680 tors. eta vs tors. theta energy: -127.989 Dist. restrs. and SS energy: 19.465 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 93 Temperature: 1.028571 Total energy: -1205.021156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.021156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.956384 (E_RNA) where: Base-Base interactions energy: -629.833 where: short stacking energy: -421.697 Base-Backbone interact. energy: -0.946 local terms energy: -614.177498 where: bonds (distance) C4'-P energy: -137.200 bonds (distance) P-C4' energy: -148.304 flat angles C4'-P-C4' energy: -152.855 flat angles P-C4'-P energy: -75.511 tors. eta vs tors. theta energy: -100.308 Dist. restrs. and SS energy: 39.935 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 93 Temperature: 1.092857 Total energy: -1019.907390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.907390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.549530 (E_RNA) where: Base-Base interactions energy: -540.864 where: short stacking energy: -355.844 Base-Backbone interact. energy: -2.503 local terms energy: -518.182035 where: bonds (distance) C4'-P energy: -128.226 bonds (distance) P-C4' energy: -138.679 flat angles C4'-P-C4' energy: -130.207 flat angles P-C4'-P energy: -64.885 tors. eta vs tors. theta energy: -56.185 Dist. restrs. and SS energy: 41.642 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 93 Temperature: 1.157143 Total energy: -946.534445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.534445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.010684 (E_RNA) where: Base-Base interactions energy: -506.210 where: short stacking energy: -335.100 Base-Backbone interact. energy: 0.710 local terms energy: -498.511064 where: bonds (distance) C4'-P energy: -129.750 bonds (distance) P-C4' energy: -141.471 flat angles C4'-P-C4' energy: -130.587 flat angles P-C4'-P energy: -60.991 tors. eta vs tors. theta energy: -35.712 Dist. restrs. and SS energy: 57.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 93 Temperature: 1.221429 Total energy: -830.052512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.052512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.479591 (E_RNA) where: Base-Base interactions energy: -444.302 where: short stacking energy: -280.924 Base-Backbone interact. energy: -0.841 local terms energy: -437.336755 where: bonds (distance) C4'-P energy: -120.330 bonds (distance) P-C4' energy: -147.382 flat angles C4'-P-C4' energy: -97.490 flat angles P-C4'-P energy: -79.555 tors. eta vs tors. theta energy: 7.420 Dist. restrs. and SS energy: 52.427 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 93 Temperature: 1.285714 Total energy: -634.464364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.464364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.876411 (E_RNA) where: Base-Base interactions energy: -275.694 where: short stacking energy: -196.148 Base-Backbone interact. energy: -0.231 local terms energy: -414.950925 where: bonds (distance) C4'-P energy: -119.873 bonds (distance) P-C4' energy: -133.371 flat angles C4'-P-C4' energy: -120.603 flat angles P-C4'-P energy: -54.746 tors. eta vs tors. theta energy: 13.641 Dist. restrs. and SS energy: 56.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -551.242930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.242930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.815815 (E_RNA) where: Base-Base interactions energy: -250.965 where: short stacking energy: -198.978 Base-Backbone interact. energy: 0.160 local terms energy: -355.011005 where: bonds (distance) C4'-P energy: -113.302 bonds (distance) P-C4' energy: -119.489 flat angles C4'-P-C4' energy: -74.545 flat angles P-C4'-P energy: -69.345 tors. eta vs tors. theta energy: 21.671 Dist. restrs. and SS energy: 54.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1588.453520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.453520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.863578 (E_RNA) where: Base-Base interactions energy: -905.888 where: short stacking energy: -619.439 Base-Backbone interact. energy: 1.174 local terms energy: -712.149749 where: bonds (distance) C4'-P energy: -160.484 bonds (distance) P-C4' energy: -141.798 flat angles C4'-P-C4' energy: -159.206 flat angles P-C4'-P energy: -95.953 tors. eta vs tors. theta energy: -154.709 Dist. restrs. and SS energy: 28.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 94 Temperature: 0.964286 Total energy: -1498.730884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1498.730884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.675026 (E_RNA) where: Base-Base interactions energy: -831.371 where: short stacking energy: -524.357 Base-Backbone interact. energy: -2.005 local terms energy: -686.299000 where: bonds (distance) C4'-P energy: -146.429 bonds (distance) P-C4' energy: -167.432 flat angles C4'-P-C4' energy: -150.461 flat angles P-C4'-P energy: -90.977 tors. eta vs tors. theta energy: -131.000 Dist. restrs. and SS energy: 20.944 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 94 Temperature: 1.028571 Total energy: -1176.714621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.714621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.168877 (E_RNA) where: Base-Base interactions energy: -569.045 where: short stacking energy: -398.294 Base-Backbone interact. energy: -0.077 local terms energy: -643.046837 where: bonds (distance) C4'-P energy: -160.477 bonds (distance) P-C4' energy: -153.464 flat angles C4'-P-C4' energy: -165.389 flat angles P-C4'-P energy: -84.296 tors. eta vs tors. theta energy: -79.421 Dist. restrs. and SS energy: 35.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 94 Temperature: 1.092857 Total energy: -1016.801608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.801608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.820919 (E_RNA) where: Base-Base interactions energy: -504.326 where: short stacking energy: -340.176 Base-Backbone interact. energy: 3.050 local terms energy: -567.544595 where: bonds (distance) C4'-P energy: -128.937 bonds (distance) P-C4' energy: -145.803 flat angles C4'-P-C4' energy: -150.978 flat angles P-C4'-P energy: -81.352 tors. eta vs tors. theta energy: -60.474 Dist. restrs. and SS energy: 52.019 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 94 Temperature: 1.157143 Total energy: -946.339290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.339290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.746148 (E_RNA) where: Base-Base interactions energy: -473.473 where: short stacking energy: -302.810 Base-Backbone interact. energy: -3.262 local terms energy: -527.011138 where: bonds (distance) C4'-P energy: -124.984 bonds (distance) P-C4' energy: -151.606 flat angles C4'-P-C4' energy: -127.042 flat angles P-C4'-P energy: -69.165 tors. eta vs tors. theta energy: -54.214 Dist. restrs. and SS energy: 57.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 94 Temperature: 1.221429 Total energy: -871.687866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.687866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.821262 (E_RNA) where: Base-Base interactions energy: -454.035 where: short stacking energy: -297.355 Base-Backbone interact. energy: -0.922 local terms energy: -473.863639 where: bonds (distance) C4'-P energy: -133.466 bonds (distance) P-C4' energy: -128.634 flat angles C4'-P-C4' energy: -109.862 flat angles P-C4'-P energy: -75.677 tors. eta vs tors. theta energy: -26.224 Dist. restrs. and SS energy: 57.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 94 Temperature: 1.285714 Total energy: -691.143024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.143024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.504325 (E_RNA) where: Base-Base interactions energy: -303.418 where: short stacking energy: -204.384 Base-Backbone interact. energy: 0.575 local terms energy: -440.661445 where: bonds (distance) C4'-P energy: -128.142 bonds (distance) P-C4' energy: -129.999 flat angles C4'-P-C4' energy: -121.416 flat angles P-C4'-P energy: -65.489 tors. eta vs tors. theta energy: 4.385 Dist. restrs. and SS energy: 52.361 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -575.342737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.342737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.601532 (E_RNA) where: Base-Base interactions energy: -247.896 where: short stacking energy: -179.376 Base-Backbone interact. energy: 3.880 local terms energy: -391.585023 where: bonds (distance) C4'-P energy: -128.955 bonds (distance) P-C4' energy: -116.585 flat angles C4'-P-C4' energy: -98.518 flat angles P-C4'-P energy: -68.948 tors. eta vs tors. theta energy: 21.422 Dist. restrs. and SS energy: 60.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1602.401051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.401051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.296871 (E_RNA) where: Base-Base interactions energy: -906.061 where: short stacking energy: -624.745 Base-Backbone interact. energy: 0.930 local terms energy: -733.165267 where: bonds (distance) C4'-P energy: -160.097 bonds (distance) P-C4' energy: -148.500 flat angles C4'-P-C4' energy: -169.863 flat angles P-C4'-P energy: -94.610 tors. eta vs tors. theta energy: -160.095 Dist. restrs. and SS energy: 35.896 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 95 Temperature: 0.964286 Total energy: -1516.048697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.048697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.115341 (E_RNA) where: Base-Base interactions energy: -859.699 where: short stacking energy: -539.278 Base-Backbone interact. energy: -3.912 local terms energy: -677.503959 where: bonds (distance) C4'-P energy: -145.518 bonds (distance) P-C4' energy: -165.504 flat angles C4'-P-C4' energy: -147.931 flat angles P-C4'-P energy: -88.776 tors. eta vs tors. theta energy: -129.776 Dist. restrs. and SS energy: 25.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 95 Temperature: 1.028571 Total energy: -1176.632015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.632015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.006642 (E_RNA) where: Base-Base interactions energy: -608.650 where: short stacking energy: -448.815 Base-Backbone interact. energy: -1.358 local terms energy: -601.998627 where: bonds (distance) C4'-P energy: -131.952 bonds (distance) P-C4' energy: -127.196 flat angles C4'-P-C4' energy: -140.934 flat angles P-C4'-P energy: -101.770 tors. eta vs tors. theta energy: -100.147 Dist. restrs. and SS energy: 35.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 95 Temperature: 1.092857 Total energy: -1023.838687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.838687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.522056 (E_RNA) where: Base-Base interactions energy: -552.286 where: short stacking energy: -359.380 Base-Backbone interact. energy: -2.477 local terms energy: -532.758449 where: bonds (distance) C4'-P energy: -125.720 bonds (distance) P-C4' energy: -145.460 flat angles C4'-P-C4' energy: -125.855 flat angles P-C4'-P energy: -76.133 tors. eta vs tors. theta energy: -59.590 Dist. restrs. and SS energy: 63.683 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 95 Temperature: 1.157143 Total energy: -1023.209096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.209096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.105894 (E_RNA) where: Base-Base interactions energy: -534.111 where: short stacking energy: -370.038 Base-Backbone interact. energy: -1.105 local terms energy: -531.890434 where: bonds (distance) C4'-P energy: -122.915 bonds (distance) P-C4' energy: -134.686 flat angles C4'-P-C4' energy: -128.375 flat angles P-C4'-P energy: -70.806 tors. eta vs tors. theta energy: -75.108 Dist. restrs. and SS energy: 43.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 95 Temperature: 1.221429 Total energy: -884.010027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.010027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.103254 (E_RNA) where: Base-Base interactions energy: -468.291 where: short stacking energy: -300.209 Base-Backbone interact. energy: -0.705 local terms energy: -472.106587 where: bonds (distance) C4'-P energy: -117.708 bonds (distance) P-C4' energy: -121.958 flat angles C4'-P-C4' energy: -122.855 flat angles P-C4'-P energy: -81.736 tors. eta vs tors. theta energy: -27.849 Dist. restrs. and SS energy: 57.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.285714 Total energy: -629.385259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.385259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.964373 (E_RNA) where: Base-Base interactions energy: -277.859 where: short stacking energy: -218.939 Base-Backbone interact. energy: -1.788 local terms energy: -407.318262 where: bonds (distance) C4'-P energy: -127.050 bonds (distance) P-C4' energy: -132.099 flat angles C4'-P-C4' energy: -100.863 flat angles P-C4'-P energy: -55.320 tors. eta vs tors. theta energy: 8.014 Dist. restrs. and SS energy: 57.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -552.259495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.259495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.642161 (E_RNA) where: Base-Base interactions energy: -232.925 where: short stacking energy: -173.108 Base-Backbone interact. energy: 2.522 local terms energy: -372.239008 where: bonds (distance) C4'-P energy: -113.257 bonds (distance) P-C4' energy: -124.340 flat angles C4'-P-C4' energy: -114.591 flat angles P-C4'-P energy: -56.657 tors. eta vs tors. theta energy: 36.605 Dist. restrs. and SS energy: 50.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1581.254370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.254370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.565852 (E_RNA) where: Base-Base interactions energy: -885.846 where: short stacking energy: -620.774 Base-Backbone interact. energy: 1.120 local terms energy: -731.839131 where: bonds (distance) C4'-P energy: -154.549 bonds (distance) P-C4' energy: -151.916 flat angles C4'-P-C4' energy: -163.853 flat angles P-C4'-P energy: -111.683 tors. eta vs tors. theta energy: -149.837 Dist. restrs. and SS energy: 35.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.964286 Total energy: -1515.332636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.332636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.763176 (E_RNA) where: Base-Base interactions energy: -839.832 where: short stacking energy: -540.309 Base-Backbone interact. energy: -3.809 local terms energy: -692.122497 where: bonds (distance) C4'-P energy: -141.253 bonds (distance) P-C4' energy: -149.212 flat angles C4'-P-C4' energy: -154.511 flat angles P-C4'-P energy: -110.428 tors. eta vs tors. theta energy: -136.718 Dist. restrs. and SS energy: 20.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 96 Temperature: 1.028571 Total energy: -1172.887083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.887083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.767680 (E_RNA) where: Base-Base interactions energy: -598.182 where: short stacking energy: -430.243 Base-Backbone interact. energy: 0.615 local terms energy: -611.200638 where: bonds (distance) C4'-P energy: -145.161 bonds (distance) P-C4' energy: -144.314 flat angles C4'-P-C4' energy: -131.889 flat angles P-C4'-P energy: -97.009 tors. eta vs tors. theta energy: -92.828 Dist. restrs. and SS energy: 35.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 96 Temperature: 1.092857 Total energy: -1049.162961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.162961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.733125 (E_RNA) where: Base-Base interactions energy: -526.662 where: short stacking energy: -373.121 Base-Backbone interact. energy: -0.856 local terms energy: -596.215294 where: bonds (distance) C4'-P energy: -142.206 bonds (distance) P-C4' energy: -142.409 flat angles C4'-P-C4' energy: -152.433 flat angles P-C4'-P energy: -90.407 tors. eta vs tors. theta energy: -68.760 Dist. restrs. and SS energy: 74.570 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.157143 Total energy: -1009.309367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.309367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.909567 (E_RNA) where: Base-Base interactions energy: -495.237 where: short stacking energy: -351.323 Base-Backbone interact. energy: 0.391 local terms energy: -564.063662 where: bonds (distance) C4'-P energy: -149.715 bonds (distance) P-C4' energy: -146.026 flat angles C4'-P-C4' energy: -136.671 flat angles P-C4'-P energy: -66.727 tors. eta vs tors. theta energy: -64.924 Dist. restrs. and SS energy: 49.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 96 Temperature: 1.221429 Total energy: -839.170202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.170202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.011696 (E_RNA) where: Base-Base interactions energy: -446.724 where: short stacking energy: -279.788 Base-Backbone interact. energy: 2.464 local terms energy: -457.751544 where: bonds (distance) C4'-P energy: -114.905 bonds (distance) P-C4' energy: -138.257 flat angles C4'-P-C4' energy: -125.361 flat angles P-C4'-P energy: -67.353 tors. eta vs tors. theta energy: -11.876 Dist. restrs. and SS energy: 62.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 96 Temperature: 1.285714 Total energy: -663.328335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.328335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.055520 (E_RNA) where: Base-Base interactions energy: -296.726 where: short stacking energy: -233.199 Base-Backbone interact. energy: 4.908 local terms energy: -414.236990 where: bonds (distance) C4'-P energy: -101.929 bonds (distance) P-C4' energy: -127.545 flat angles C4'-P-C4' energy: -116.356 flat angles P-C4'-P energy: -67.779 tors. eta vs tors. theta energy: -0.628 Dist. restrs. and SS energy: 42.727 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -553.361479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.361479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.253002 (E_RNA) where: Base-Base interactions energy: -228.552 where: short stacking energy: -173.703 Base-Backbone interact. energy: 5.341 local terms energy: -379.041998 where: bonds (distance) C4'-P energy: -111.711 bonds (distance) P-C4' energy: -117.213 flat angles C4'-P-C4' energy: -106.514 flat angles P-C4'-P energy: -76.264 tors. eta vs tors. theta energy: 32.660 Dist. restrs. and SS energy: 48.892 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1582.016093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.016093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.894628 (E_RNA) where: Base-Base interactions energy: -887.194 where: short stacking energy: -587.296 Base-Backbone interact. energy: -1.080 local terms energy: -717.620912 where: bonds (distance) C4'-P energy: -150.017 bonds (distance) P-C4' energy: -154.050 flat angles C4'-P-C4' energy: -156.709 flat angles P-C4'-P energy: -113.555 tors. eta vs tors. theta energy: -143.290 Dist. restrs. and SS energy: 23.879 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.964286 Total energy: -1520.798978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.798978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.634959 (E_RNA) where: Base-Base interactions energy: -877.917 where: short stacking energy: -553.016 Base-Backbone interact. energy: -2.173 local terms energy: -668.545284 where: bonds (distance) C4'-P energy: -145.087 bonds (distance) P-C4' energy: -152.667 flat angles C4'-P-C4' energy: -160.359 flat angles P-C4'-P energy: -90.218 tors. eta vs tors. theta energy: -120.214 Dist. restrs. and SS energy: 27.836 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 97 Temperature: 1.028571 Total energy: -1207.048983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.048983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.872762 (E_RNA) where: Base-Base interactions energy: -614.647 where: short stacking energy: -430.025 Base-Backbone interact. energy: -2.221 local terms energy: -622.004976 where: bonds (distance) C4'-P energy: -136.750 bonds (distance) P-C4' energy: -158.574 flat angles C4'-P-C4' energy: -137.102 flat angles P-C4'-P energy: -96.982 tors. eta vs tors. theta energy: -92.598 Dist. restrs. and SS energy: 31.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.092857 Total energy: -1119.408892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.408892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.152180 (E_RNA) where: Base-Base interactions energy: -575.372 where: short stacking energy: -367.012 Base-Backbone interact. energy: -0.609 local terms energy: -612.171002 where: bonds (distance) C4'-P energy: -150.627 bonds (distance) P-C4' energy: -143.425 flat angles C4'-P-C4' energy: -151.542 flat angles P-C4'-P energy: -85.065 tors. eta vs tors. theta energy: -81.512 Dist. restrs. and SS energy: 68.743 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.157143 Total energy: -986.818692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.818692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.666878 (E_RNA) where: Base-Base interactions energy: -543.399 where: short stacking energy: -352.201 Base-Backbone interact. energy: -1.334 local terms energy: -496.933516 where: bonds (distance) C4'-P energy: -132.291 bonds (distance) P-C4' energy: -109.235 flat angles C4'-P-C4' energy: -119.170 flat angles P-C4'-P energy: -83.054 tors. eta vs tors. theta energy: -53.183 Dist. restrs. and SS energy: 54.848 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.221429 Total energy: -868.866499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.866499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.464747 (E_RNA) where: Base-Base interactions energy: -474.922 where: short stacking energy: -314.100 Base-Backbone interact. energy: -1.218 local terms energy: -447.325003 where: bonds (distance) C4'-P energy: -91.677 bonds (distance) P-C4' energy: -144.148 flat angles C4'-P-C4' energy: -119.251 flat angles P-C4'-P energy: -66.627 tors. eta vs tors. theta energy: -25.622 Dist. restrs. and SS energy: 54.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 97 Temperature: 1.285714 Total energy: -685.996116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.996116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.386704 (E_RNA) where: Base-Base interactions energy: -283.970 where: short stacking energy: -214.877 Base-Backbone interact. energy: 0.434 local terms energy: -453.851018 where: bonds (distance) C4'-P energy: -111.530 bonds (distance) P-C4' energy: -135.318 flat angles C4'-P-C4' energy: -111.640 flat angles P-C4'-P energy: -84.769 tors. eta vs tors. theta energy: -10.593 Dist. restrs. and SS energy: 51.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -570.338794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.338794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.669068 (E_RNA) where: Base-Base interactions energy: -229.175 where: short stacking energy: -181.177 Base-Backbone interact. energy: 2.003 local terms energy: -394.497101 where: bonds (distance) C4'-P energy: -125.714 bonds (distance) P-C4' energy: -110.834 flat angles C4'-P-C4' energy: -102.974 flat angles P-C4'-P energy: -63.700 tors. eta vs tors. theta energy: 8.725 Dist. restrs. and SS energy: 51.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1562.269326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.269326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.098871 (E_RNA) where: Base-Base interactions energy: -899.612 where: short stacking energy: -622.223 Base-Backbone interact. energy: -0.618 local terms energy: -705.869079 where: bonds (distance) C4'-P energy: -156.721 bonds (distance) P-C4' energy: -154.123 flat angles C4'-P-C4' energy: -164.258 flat angles P-C4'-P energy: -86.008 tors. eta vs tors. theta energy: -144.760 Dist. restrs. and SS energy: 43.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 98 Temperature: 0.964286 Total energy: -1567.487000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.487000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.472302 (E_RNA) where: Base-Base interactions energy: -903.474 where: short stacking energy: -586.280 Base-Backbone interact. energy: -2.028 local terms energy: -686.969830 where: bonds (distance) C4'-P energy: -142.928 bonds (distance) P-C4' energy: -162.616 flat angles C4'-P-C4' energy: -147.913 flat angles P-C4'-P energy: -90.437 tors. eta vs tors. theta energy: -143.076 Dist. restrs. and SS energy: 24.985 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 98 Temperature: 1.028571 Total energy: -1178.077957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.077957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.565825 (E_RNA) where: Base-Base interactions energy: -645.462 where: short stacking energy: -434.316 Base-Backbone interact. energy: 0.200 local terms energy: -573.303636 where: bonds (distance) C4'-P energy: -133.736 bonds (distance) P-C4' energy: -135.975 flat angles C4'-P-C4' energy: -134.575 flat angles P-C4'-P energy: -89.398 tors. eta vs tors. theta energy: -79.619 Dist. restrs. and SS energy: 40.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 98 Temperature: 1.092857 Total energy: -1086.955063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.955063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.697150 (E_RNA) where: Base-Base interactions energy: -582.766 where: short stacking energy: -365.595 Base-Backbone interact. energy: 2.097 local terms energy: -573.028302 where: bonds (distance) C4'-P energy: -138.553 bonds (distance) P-C4' energy: -152.152 flat angles C4'-P-C4' energy: -135.525 flat angles P-C4'-P energy: -67.766 tors. eta vs tors. theta energy: -79.031 Dist. restrs. and SS energy: 66.742 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.157143 Total energy: -992.805864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.805864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.305711 (E_RNA) where: Base-Base interactions energy: -502.444 where: short stacking energy: -347.146 Base-Backbone interact. energy: -0.407 local terms energy: -533.454785 where: bonds (distance) C4'-P energy: -122.082 bonds (distance) P-C4' energy: -135.562 flat angles C4'-P-C4' energy: -141.971 flat angles P-C4'-P energy: -73.346 tors. eta vs tors. theta energy: -60.494 Dist. restrs. and SS energy: 43.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 98 Temperature: 1.221429 Total energy: -843.314005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.314005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.887293 (E_RNA) where: Base-Base interactions energy: -457.885 where: short stacking energy: -285.323 Base-Backbone interact. energy: -0.229 local terms energy: -456.773361 where: bonds (distance) C4'-P energy: -113.805 bonds (distance) P-C4' energy: -138.354 flat angles C4'-P-C4' energy: -109.849 flat angles P-C4'-P energy: -73.741 tors. eta vs tors. theta energy: -21.025 Dist. restrs. and SS energy: 71.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 98 Temperature: 1.285714 Total energy: -682.475499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.475499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.771482 (E_RNA) where: Base-Base interactions energy: -286.564 where: short stacking energy: -221.201 Base-Backbone interact. energy: 0.301 local terms energy: -455.508053 where: bonds (distance) C4'-P energy: -141.285 bonds (distance) P-C4' energy: -150.642 flat angles C4'-P-C4' energy: -96.905 flat angles P-C4'-P energy: -66.551 tors. eta vs tors. theta energy: -0.126 Dist. restrs. and SS energy: 59.296 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -543.103522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.103522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.940039 (E_RNA) where: Base-Base interactions energy: -241.869 where: short stacking energy: -186.399 Base-Backbone interact. energy: 4.179 local terms energy: -368.249757 where: bonds (distance) C4'-P energy: -108.132 bonds (distance) P-C4' energy: -131.866 flat angles C4'-P-C4' energy: -81.235 flat angles P-C4'-P energy: -57.089 tors. eta vs tors. theta energy: 10.072 Dist. restrs. and SS energy: 62.837 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1546.063754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.063754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.984299 (E_RNA) where: Base-Base interactions energy: -870.550 where: short stacking energy: -584.365 Base-Backbone interact. energy: -0.904 local terms energy: -720.530314 where: bonds (distance) C4'-P energy: -148.275 bonds (distance) P-C4' energy: -167.607 flat angles C4'-P-C4' energy: -163.404 flat angles P-C4'-P energy: -92.858 tors. eta vs tors. theta energy: -148.385 Dist. restrs. and SS energy: 45.921 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 99 Temperature: 0.964286 Total energy: -1540.910850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.910850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.153249 (E_RNA) where: Base-Base interactions energy: -918.762 where: short stacking energy: -590.900 Base-Backbone interact. energy: 0.022 local terms energy: -655.412861 where: bonds (distance) C4'-P energy: -152.092 bonds (distance) P-C4' energy: -129.264 flat angles C4'-P-C4' energy: -145.881 flat angles P-C4'-P energy: -92.436 tors. eta vs tors. theta energy: -135.739 Dist. restrs. and SS energy: 33.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 99 Temperature: 1.028571 Total energy: -1202.359802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.359802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.894141 (E_RNA) where: Base-Base interactions energy: -635.750 where: short stacking energy: -451.586 Base-Backbone interact. energy: -1.364 local terms energy: -607.780054 where: bonds (distance) C4'-P energy: -127.739 bonds (distance) P-C4' energy: -146.106 flat angles C4'-P-C4' energy: -139.442 flat angles P-C4'-P energy: -108.175 tors. eta vs tors. theta energy: -86.318 Dist. restrs. and SS energy: 42.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 99 Temperature: 1.092857 Total energy: -1031.474510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.474510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.184015 (E_RNA) where: Base-Base interactions energy: -570.001 where: short stacking energy: -371.914 Base-Backbone interact. energy: 6.974 local terms energy: -525.156602 where: bonds (distance) C4'-P energy: -135.445 bonds (distance) P-C4' energy: -133.283 flat angles C4'-P-C4' energy: -135.026 flat angles P-C4'-P energy: -67.719 tors. eta vs tors. theta energy: -53.684 Dist. restrs. and SS energy: 56.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 99 Temperature: 1.157143 Total energy: -953.251306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.251306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.047137 (E_RNA) where: Base-Base interactions energy: -507.069 where: short stacking energy: -312.234 Base-Backbone interact. energy: 5.014 local terms energy: -510.992817 where: bonds (distance) C4'-P energy: -127.613 bonds (distance) P-C4' energy: -144.003 flat angles C4'-P-C4' energy: -116.721 flat angles P-C4'-P energy: -71.910 tors. eta vs tors. theta energy: -50.746 Dist. restrs. and SS energy: 59.796 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 99 Temperature: 1.221429 Total energy: -820.277190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.277190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.944275 (E_RNA) where: Base-Base interactions energy: -419.142 where: short stacking energy: -256.269 Base-Backbone interact. energy: 4.599 local terms energy: -457.401230 where: bonds (distance) C4'-P energy: -111.151 bonds (distance) P-C4' energy: -131.516 flat angles C4'-P-C4' energy: -134.448 flat angles P-C4'-P energy: -75.812 tors. eta vs tors. theta energy: -4.474 Dist. restrs. and SS energy: 51.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 99 Temperature: 1.285714 Total energy: -650.106116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.106116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.310962 (E_RNA) where: Base-Base interactions energy: -276.138 where: short stacking energy: -219.739 Base-Backbone interact. energy: 0.416 local terms energy: -418.589120 where: bonds (distance) C4'-P energy: -119.211 bonds (distance) P-C4' energy: -131.613 flat angles C4'-P-C4' energy: -105.816 flat angles P-C4'-P energy: -79.920 tors. eta vs tors. theta energy: 17.970 Dist. restrs. and SS energy: 44.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -586.432975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.432975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.122597 (E_RNA) where: Base-Base interactions energy: -258.569 where: short stacking energy: -199.202 Base-Backbone interact. energy: 0.972 local terms energy: -394.525184 where: bonds (distance) C4'-P energy: -125.477 bonds (distance) P-C4' energy: -123.444 flat angles C4'-P-C4' energy: -97.768 flat angles P-C4'-P energy: -52.255 tors. eta vs tors. theta energy: 4.419 Dist. restrs. and SS energy: 65.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1606.662652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.662652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.340777 (E_RNA) where: Base-Base interactions energy: -929.319 where: short stacking energy: -604.600 Base-Backbone interact. energy: -2.270 local terms energy: -707.751324 where: bonds (distance) C4'-P energy: -152.219 bonds (distance) P-C4' energy: -156.877 flat angles C4'-P-C4' energy: -159.276 flat angles P-C4'-P energy: -79.522 tors. eta vs tors. theta energy: -159.857 Dist. restrs. and SS energy: 32.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.964286 Total energy: -1517.564275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.564275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.814172 (E_RNA) where: Base-Base interactions energy: -845.423 where: short stacking energy: -538.417 Base-Backbone interact. energy: -1.880 local terms energy: -697.511411 where: bonds (distance) C4'-P energy: -151.820 bonds (distance) P-C4' energy: -163.603 flat angles C4'-P-C4' energy: -154.906 flat angles P-C4'-P energy: -95.076 tors. eta vs tors. theta energy: -132.106 Dist. restrs. and SS energy: 27.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 100 Temperature: 1.028571 Total energy: -1255.610763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.610763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.732322 (E_RNA) where: Base-Base interactions energy: -654.201 where: short stacking energy: -480.746 Base-Backbone interact. energy: -1.231 local terms energy: -643.299614 where: bonds (distance) C4'-P energy: -137.292 bonds (distance) P-C4' energy: -139.799 flat angles C4'-P-C4' energy: -156.438 flat angles P-C4'-P energy: -100.898 tors. eta vs tors. theta energy: -108.872 Dist. restrs. and SS energy: 43.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 100 Temperature: 1.092857 Total energy: -1069.357931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.357931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.869324 (E_RNA) where: Base-Base interactions energy: -579.980 where: short stacking energy: -392.200 Base-Backbone interact. energy: 6.947 local terms energy: -556.836094 where: bonds (distance) C4'-P energy: -130.656 bonds (distance) P-C4' energy: -151.714 flat angles C4'-P-C4' energy: -131.995 flat angles P-C4'-P energy: -64.403 tors. eta vs tors. theta energy: -78.068 Dist. restrs. and SS energy: 60.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 100 Temperature: 1.157143 Total energy: -968.360850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.360850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.765631 (E_RNA) where: Base-Base interactions energy: -522.570 where: short stacking energy: -334.420 Base-Backbone interact. energy: -0.525 local terms energy: -505.670675 where: bonds (distance) C4'-P energy: -126.462 bonds (distance) P-C4' energy: -146.227 flat angles C4'-P-C4' energy: -114.932 flat angles P-C4'-P energy: -68.293 tors. eta vs tors. theta energy: -49.757 Dist. restrs. and SS energy: 60.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 100 Temperature: 1.221429 Total energy: -913.276971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.276971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.323123 (E_RNA) where: Base-Base interactions energy: -501.443 where: short stacking energy: -301.545 Base-Backbone interact. energy: 2.500 local terms energy: -467.380713 where: bonds (distance) C4'-P energy: -133.065 bonds (distance) P-C4' energy: -137.404 flat angles C4'-P-C4' energy: -112.548 flat angles P-C4'-P energy: -62.705 tors. eta vs tors. theta energy: -21.659 Dist. restrs. and SS energy: 53.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 100 Temperature: 1.285714 Total energy: -661.834920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.834920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.110130 (E_RNA) where: Base-Base interactions energy: -307.333 where: short stacking energy: -255.953 Base-Backbone interact. energy: 0.457 local terms energy: -421.234319 where: bonds (distance) C4'-P energy: -133.022 bonds (distance) P-C4' energy: -118.472 flat angles C4'-P-C4' energy: -110.953 flat angles P-C4'-P energy: -48.724 tors. eta vs tors. theta energy: -10.063 Dist. restrs. and SS energy: 66.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -533.539884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.539884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.200423 (E_RNA) where: Base-Base interactions energy: -243.955 where: short stacking energy: -168.060 Base-Backbone interact. energy: 1.228 local terms energy: -353.473401 where: bonds (distance) C4'-P energy: -95.654 bonds (distance) P-C4' energy: -117.406 flat angles C4'-P-C4' energy: -107.708 flat angles P-C4'-P energy: -40.119 tors. eta vs tors. theta energy: 7.413 Dist. restrs. and SS energy: 62.661 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1572.345659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.345659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.976984 (E_RNA) where: Base-Base interactions energy: -899.237 where: short stacking energy: -587.097 Base-Backbone interact. energy: -1.466 local terms energy: -708.273837 where: bonds (distance) C4'-P energy: -152.325 bonds (distance) P-C4' energy: -149.435 flat angles C4'-P-C4' energy: -168.464 flat angles P-C4'-P energy: -95.072 tors. eta vs tors. theta energy: -142.978 Dist. restrs. and SS energy: 36.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 101 Temperature: 0.964286 Total energy: -1495.414493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1495.414493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.835887 (E_RNA) where: Base-Base interactions energy: -877.922 where: short stacking energy: -563.270 Base-Backbone interact. energy: -1.069 local terms energy: -646.845475 where: bonds (distance) C4'-P energy: -143.301 bonds (distance) P-C4' energy: -135.004 flat angles C4'-P-C4' energy: -147.059 flat angles P-C4'-P energy: -92.183 tors. eta vs tors. theta energy: -129.299 Dist. restrs. and SS energy: 30.421 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 101 Temperature: 1.028571 Total energy: -1250.513838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.513838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.120184 (E_RNA) where: Base-Base interactions energy: -650.072 where: short stacking energy: -458.615 Base-Backbone interact. energy: -2.048 local terms energy: -637.999666 where: bonds (distance) C4'-P energy: -143.934 bonds (distance) P-C4' energy: -158.219 flat angles C4'-P-C4' energy: -159.415 flat angles P-C4'-P energy: -80.538 tors. eta vs tors. theta energy: -95.893 Dist. restrs. and SS energy: 39.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 101 Temperature: 1.092857 Total energy: -1040.063314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.063314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.709691 (E_RNA) where: Base-Base interactions energy: -564.822 where: short stacking energy: -356.160 Base-Backbone interact. energy: -1.679 local terms energy: -533.209098 where: bonds (distance) C4'-P energy: -126.122 bonds (distance) P-C4' energy: -136.321 flat angles C4'-P-C4' energy: -138.661 flat angles P-C4'-P energy: -67.660 tors. eta vs tors. theta energy: -64.445 Dist. restrs. and SS energy: 59.646 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.157143 Total energy: -975.817180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.817180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.992239 (E_RNA) where: Base-Base interactions energy: -498.388 where: short stacking energy: -309.844 Base-Backbone interact. energy: -2.429 local terms energy: -531.174868 where: bonds (distance) C4'-P energy: -118.348 bonds (distance) P-C4' energy: -141.509 flat angles C4'-P-C4' energy: -137.144 flat angles P-C4'-P energy: -78.134 tors. eta vs tors. theta energy: -56.040 Dist. restrs. and SS energy: 56.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 101 Temperature: 1.221429 Total energy: -918.887375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.887375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.914715 (E_RNA) where: Base-Base interactions energy: -505.743 where: short stacking energy: -304.099 Base-Backbone interact. energy: -0.502 local terms energy: -482.669931 where: bonds (distance) C4'-P energy: -133.404 bonds (distance) P-C4' energy: -123.258 flat angles C4'-P-C4' energy: -131.475 flat angles P-C4'-P energy: -72.170 tors. eta vs tors. theta energy: -22.363 Dist. restrs. and SS energy: 70.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 101 Temperature: 1.285714 Total energy: -662.769496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.769496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.023489 (E_RNA) where: Base-Base interactions energy: -285.047 where: short stacking energy: -187.868 Base-Backbone interact. energy: 4.714 local terms energy: -444.690891 where: bonds (distance) C4'-P energy: -129.641 bonds (distance) P-C4' energy: -132.274 flat angles C4'-P-C4' energy: -120.198 flat angles P-C4'-P energy: -71.221 tors. eta vs tors. theta energy: 8.643 Dist. restrs. and SS energy: 62.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -573.806537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.806537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.021142 (E_RNA) where: Base-Base interactions energy: -244.259 where: short stacking energy: -171.647 Base-Backbone interact. energy: 0.988 local terms energy: -374.750361 where: bonds (distance) C4'-P energy: -110.041 bonds (distance) P-C4' energy: -129.608 flat angles C4'-P-C4' energy: -92.179 flat angles P-C4'-P energy: -63.287 tors. eta vs tors. theta energy: 20.365 Dist. restrs. and SS energy: 44.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 5 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 4178521 moves confirmed later: 4792784 all moves confirmed: 8971305 percent of confirmed moves: 56.070656 current total energy: -1518.697562 recalc. total energy: -1499.951875 replica 1 ended at temp. level: 2, temp: 0.964286 for this replica: moves confirmed at first: 4521128 moves confirmed later: 5286693 all moves confirmed: 9807821 percent of confirmed moves: 61.298881 current total energy: -1345.066332 recalc. total energy: -1314.413465 replica 3 ended at temp. level: 3, temp: 1.028571 for this replica: moves confirmed at first: 4339029 moves confirmed later: 4975677 all moves confirmed: 9314706 percent of confirmed moves: 58.216912 current total energy: -1087.084446 recalc. total energy: -1068.042352 replica 7 ended at temp. level: 4, temp: 1.092857 for this replica: moves confirmed at first: 4924095 moves confirmed later: 5859787 all moves confirmed: 10783882 percent of confirmed moves: 67.399263 current total energy: -974.135726 recalc. total energy: -960.788035 replica 2 ended at temp. level: 5, temp: 1.157143 for this replica: moves confirmed at first: 4415668 moves confirmed later: 5089640 all moves confirmed: 9505308 percent of confirmed moves: 59.408175 current total energy: -871.700226 recalc. total energy: -853.996348 replica 6 ended at temp. level: 6, temp: 1.221429 for this replica: moves confirmed at first: 5361629 moves confirmed later: 6491340 all moves confirmed: 11852969 percent of confirmed moves: 74.081056 current total energy: -794.315307 recalc. total energy: -783.148178 replica 8 ended at temp. level: 7, temp: 1.285714 for this replica: moves confirmed at first: 5399024 moves confirmed later: 6541156 all moves confirmed: 11940180 percent of confirmed moves: 74.626125 current total energy: -617.123953 recalc. total energy: -611.706687 replica 4 ended at temp. level: 8, temp: 1.350000 for this replica: moves confirmed at first: 5565158 moves confirmed later: 6795353 all moves confirmed: 12360511 percent of confirmed moves: 77.253194 current total energy: -454.439426 recalc. total energy: -443.364247 fness is set Stiffness is set Stiffness is set Stiffness is set Time of doing 160000 iterations: 517.018 seconds