SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-baec8c77/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUUUUUAGUGUUGCCAAACCUGCUUGUUUCAGUUUCAGGAUGUUAAAGAUAGUAACUGAAGAAAUUGGAAAAUAGUUCUUGCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 100 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 505 n_atoms_counter: 505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 100.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -397.746387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.746387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.746387 (E_RNA) where: Base-Base interactions energy: -8.300 where: short stacking energy: -8.300 Base-Backbone interact. energy: -0.000 local terms energy: -389.446403 where: bonds (distance) C4'-P energy: -97.158 bonds (distance) P-C4' energy: -90.360 flat angles C4'-P-C4' energy: -73.422 flat angles P-C4'-P energy: -83.987 tors. eta vs tors. theta energy: -44.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -482.576754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.576754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.576754 (E_RNA) where: Base-Base interactions energy: -209.224 where: short stacking energy: -194.106 Base-Backbone interact. energy: -0.337 local terms energy: -273.015708 where: bonds (distance) C4'-P energy: -62.802 bonds (distance) P-C4' energy: -67.004 flat angles C4'-P-C4' energy: -65.097 flat angles P-C4'-P energy: -26.763 tors. eta vs tors. theta energy: -51.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -480.223535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.223535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.223535 (E_RNA) where: Base-Base interactions energy: -196.429 where: short stacking energy: -192.006 Base-Backbone interact. energy: 0.240 local terms energy: -284.035147 where: bonds (distance) C4'-P energy: -59.006 bonds (distance) P-C4' energy: -75.535 flat angles C4'-P-C4' energy: -75.779 flat angles P-C4'-P energy: -37.246 tors. eta vs tors. theta energy: -36.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -438.753214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.753214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.753214 (E_RNA) where: Base-Base interactions energy: -180.508 where: short stacking energy: -152.192 Base-Backbone interact. energy: -1.378 local terms energy: -256.867041 where: bonds (distance) C4'-P energy: -51.968 bonds (distance) P-C4' energy: -53.566 flat angles C4'-P-C4' energy: -66.926 flat angles P-C4'-P energy: -44.772 tors. eta vs tors. theta energy: -39.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -425.065912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.065912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.065912 (E_RNA) where: Base-Base interactions energy: -193.430 where: short stacking energy: -155.077 Base-Backbone interact. energy: -1.117 local terms energy: -230.518695 where: bonds (distance) C4'-P energy: -53.589 bonds (distance) P-C4' energy: -67.317 flat angles C4'-P-C4' energy: -54.776 flat angles P-C4'-P energy: -34.950 tors. eta vs tors. theta energy: -19.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -417.760875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.760875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.760875 (E_RNA) where: Base-Base interactions energy: -190.633 where: short stacking energy: -143.801 Base-Backbone interact. energy: -1.352 local terms energy: -225.776776 where: bonds (distance) C4'-P energy: -58.415 bonds (distance) P-C4' energy: -55.323 flat angles C4'-P-C4' energy: -45.094 flat angles P-C4'-P energy: -37.875 tors. eta vs tors. theta energy: -29.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -400.945974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.945974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.945974 (E_RNA) where: Base-Base interactions energy: -16.542 where: short stacking energy: -16.542 Base-Backbone interact. energy: -0.000 local terms energy: -384.403741 where: bonds (distance) C4'-P energy: -94.744 bonds (distance) P-C4' energy: -87.617 flat angles C4'-P-C4' energy: -73.267 flat angles P-C4'-P energy: -83.293 tors. eta vs tors. theta energy: -45.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -400.033181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.033181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.033181 (E_RNA) where: Base-Base interactions energy: -19.782 where: short stacking energy: -19.782 Base-Backbone interact. energy: -0.000 local terms energy: -380.250896 where: bonds (distance) C4'-P energy: -92.266 bonds (distance) P-C4' energy: -86.835 flat angles C4'-P-C4' energy: -73.305 flat angles P-C4'-P energy: -83.035 tors. eta vs tors. theta energy: -44.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -400.694687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.694687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.694687 (E_RNA) where: Base-Base interactions energy: -20.476 where: short stacking energy: -20.476 Base-Backbone interact. energy: -0.000 local terms energy: -380.218580 where: bonds (distance) C4'-P energy: -92.266 bonds (distance) P-C4' energy: -86.835 flat angles C4'-P-C4' energy: -73.286 flat angles P-C4'-P energy: -83.080 tors. eta vs tors. theta energy: -44.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -399.193415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.193415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.193415 (E_RNA) where: Base-Base interactions energy: -12.648 where: short stacking energy: -12.648 Base-Backbone interact. energy: -0.000 local terms energy: -386.545493 where: bonds (distance) C4'-P energy: -95.324 bonds (distance) P-C4' energy: -89.649 flat angles C4'-P-C4' energy: -72.950 flat angles P-C4'-P energy: -83.659 tors. eta vs tors. theta energy: -44.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -397.270211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.270211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.270211 (E_RNA) where: Base-Base interactions energy: -13.717 where: short stacking energy: -13.717 Base-Backbone interact. energy: -0.000 local terms energy: -383.553578 where: bonds (distance) C4'-P energy: -93.714 bonds (distance) P-C4' energy: -89.385 flat angles C4'-P-C4' energy: -72.583 flat angles P-C4'-P energy: -83.108 tors. eta vs tors. theta energy: -44.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -606.081453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.081453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.081453 (E_RNA) where: Base-Base interactions energy: -305.148 where: short stacking energy: -212.168 Base-Backbone interact. energy: -1.642 local terms energy: -299.291866 where: bonds (distance) C4'-P energy: -69.675 bonds (distance) P-C4' energy: -66.107 flat angles C4'-P-C4' energy: -60.823 flat angles P-C4'-P energy: -44.394 tors. eta vs tors. theta energy: -58.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -480.930236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.930236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.930236 (E_RNA) where: Base-Base interactions energy: -184.661 where: short stacking energy: -156.075 Base-Backbone interact. energy: 0.702 local terms energy: -296.970412 where: bonds (distance) C4'-P energy: -74.350 bonds (distance) P-C4' energy: -69.076 flat angles C4'-P-C4' energy: -73.273 flat angles P-C4'-P energy: -39.254 tors. eta vs tors. theta energy: -41.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -456.956561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.956561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.956561 (E_RNA) where: Base-Base interactions energy: -201.447 where: short stacking energy: -154.786 Base-Backbone interact. energy: 0.712 local terms energy: -256.221580 where: bonds (distance) C4'-P energy: -52.317 bonds (distance) P-C4' energy: -65.983 flat angles C4'-P-C4' energy: -65.605 flat angles P-C4'-P energy: -38.265 tors. eta vs tors. theta energy: -34.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -459.311692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.311692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.311692 (E_RNA) where: Base-Base interactions energy: -232.250 where: short stacking energy: -142.519 Base-Backbone interact. energy: -0.789 local terms energy: -226.273235 where: bonds (distance) C4'-P energy: -53.431 bonds (distance) P-C4' energy: -66.034 flat angles C4'-P-C4' energy: -53.145 flat angles P-C4'-P energy: -36.928 tors. eta vs tors. theta energy: -16.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -374.106294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.106294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.106294 (E_RNA) where: Base-Base interactions energy: -153.154 where: short stacking energy: -120.496 Base-Backbone interact. energy: -0.605 local terms energy: -220.347729 where: bonds (distance) C4'-P energy: -62.067 bonds (distance) P-C4' energy: -61.035 flat angles C4'-P-C4' energy: -58.738 flat angles P-C4'-P energy: -30.294 tors. eta vs tors. theta energy: -8.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -409.049197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.049197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.049197 (E_RNA) where: Base-Base interactions energy: -180.846 where: short stacking energy: -121.881 Base-Backbone interact. energy: -1.129 local terms energy: -227.074140 where: bonds (distance) C4'-P energy: -63.871 bonds (distance) P-C4' energy: -64.900 flat angles C4'-P-C4' energy: -51.589 flat angles P-C4'-P energy: -42.507 tors. eta vs tors. theta energy: -4.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -305.596435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.596435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.596435 (E_RNA) where: Base-Base interactions energy: -110.184 where: short stacking energy: -93.626 Base-Backbone interact. energy: -1.586 local terms energy: -193.826379 where: bonds (distance) C4'-P energy: -39.400 bonds (distance) P-C4' energy: -54.210 flat angles C4'-P-C4' energy: -61.062 flat angles P-C4'-P energy: -30.784 tors. eta vs tors. theta energy: -8.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -301.760537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.760537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.760537 (E_RNA) where: Base-Base interactions energy: -112.030 where: short stacking energy: -80.391 Base-Backbone interact. energy: 1.667 local terms energy: -191.398008 where: bonds (distance) C4'-P energy: -47.931 bonds (distance) P-C4' energy: -60.407 flat angles C4'-P-C4' energy: -53.685 flat angles P-C4'-P energy: -26.021 tors. eta vs tors. theta energy: -3.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -313.281344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.281344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.281344 (E_RNA) where: Base-Base interactions energy: -152.551 where: short stacking energy: -99.369 Base-Backbone interact. energy: 0.159 local terms energy: -160.889663 where: bonds (distance) C4'-P energy: -44.119 bonds (distance) P-C4' energy: -47.984 flat angles C4'-P-C4' energy: -44.417 flat angles P-C4'-P energy: -18.365 tors. eta vs tors. theta energy: -6.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -329.730192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.730192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.730192 (E_RNA) where: Base-Base interactions energy: -132.037 where: short stacking energy: -65.270 Base-Backbone interact. energy: -2.818 local terms energy: -194.874898 where: bonds (distance) C4'-P energy: -56.627 bonds (distance) P-C4' energy: -59.612 flat angles C4'-P-C4' energy: -43.337 flat angles P-C4'-P energy: -34.427 tors. eta vs tors. theta energy: -0.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -647.027043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.027043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.027043 (E_RNA) where: Base-Base interactions energy: -345.787 where: short stacking energy: -191.817 Base-Backbone interact. energy: -1.544 local terms energy: -299.695753 where: bonds (distance) C4'-P energy: -70.437 bonds (distance) P-C4' energy: -65.416 flat angles C4'-P-C4' energy: -67.499 flat angles P-C4'-P energy: -47.033 tors. eta vs tors. theta energy: -49.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -538.039633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.039633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.039633 (E_RNA) where: Base-Base interactions energy: -289.490 where: short stacking energy: -170.439 Base-Backbone interact. energy: -0.528 local terms energy: -248.021313 where: bonds (distance) C4'-P energy: -60.411 bonds (distance) P-C4' energy: -66.277 flat angles C4'-P-C4' energy: -63.010 flat angles P-C4'-P energy: -26.297 tors. eta vs tors. theta energy: -32.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -512.310003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.310003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.310003 (E_RNA) where: Base-Base interactions energy: -253.852 where: short stacking energy: -164.543 Base-Backbone interact. energy: -1.667 local terms energy: -256.790872 where: bonds (distance) C4'-P energy: -53.762 bonds (distance) P-C4' energy: -53.835 flat angles C4'-P-C4' energy: -73.316 flat angles P-C4'-P energy: -37.923 tors. eta vs tors. theta energy: -37.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -465.753417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.753417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.753417 (E_RNA) where: Base-Base interactions energy: -207.393 where: short stacking energy: -146.683 Base-Backbone interact. energy: -1.339 local terms energy: -257.021141 where: bonds (distance) C4'-P energy: -55.659 bonds (distance) P-C4' energy: -64.328 flat angles C4'-P-C4' energy: -62.255 flat angles P-C4'-P energy: -41.082 tors. eta vs tors. theta energy: -33.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -454.317977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.317977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.317977 (E_RNA) where: Base-Base interactions energy: -236.086 where: short stacking energy: -125.489 Base-Backbone interact. energy: -1.170 local terms energy: -217.062186 where: bonds (distance) C4'-P energy: -58.804 bonds (distance) P-C4' energy: -54.562 flat angles C4'-P-C4' energy: -55.130 flat angles P-C4'-P energy: -27.506 tors. eta vs tors. theta energy: -21.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -338.500677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.500677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.500677 (E_RNA) where: Base-Base interactions energy: -137.632 where: short stacking energy: -94.755 Base-Backbone interact. energy: -2.487 local terms energy: -198.381376 where: bonds (distance) C4'-P energy: -71.540 bonds (distance) P-C4' energy: -58.243 flat angles C4'-P-C4' energy: -45.217 flat angles P-C4'-P energy: -25.965 tors. eta vs tors. theta energy: 2.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -342.019626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.019626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.019626 (E_RNA) where: Base-Base interactions energy: -141.896 where: short stacking energy: -98.753 Base-Backbone interact. energy: 0.645 local terms energy: -200.769018 where: bonds (distance) C4'-P energy: -44.350 bonds (distance) P-C4' energy: -66.434 flat angles C4'-P-C4' energy: -54.218 flat angles P-C4'-P energy: -31.331 tors. eta vs tors. theta energy: -4.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -309.450260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.450260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.450260 (E_RNA) where: Base-Base interactions energy: -128.566 where: short stacking energy: -73.918 Base-Backbone interact. energy: 7.490 local terms energy: -188.374303 where: bonds (distance) C4'-P energy: -64.909 bonds (distance) P-C4' energy: -51.203 flat angles C4'-P-C4' energy: -49.479 flat angles P-C4'-P energy: -29.278 tors. eta vs tors. theta energy: 6.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -336.247911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.247911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.247911 (E_RNA) where: Base-Base interactions energy: -153.960 where: short stacking energy: -85.421 Base-Backbone interact. energy: 0.004 local terms energy: -182.291987 where: bonds (distance) C4'-P energy: -38.978 bonds (distance) P-C4' energy: -62.612 flat angles C4'-P-C4' energy: -55.242 flat angles P-C4'-P energy: -23.078 tors. eta vs tors. theta energy: -2.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -262.599003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.599003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.599003 (E_RNA) where: Base-Base interactions energy: -71.480 where: short stacking energy: -67.728 Base-Backbone interact. energy: -1.439 local terms energy: -189.679734 where: bonds (distance) C4'-P energy: -58.753 bonds (distance) P-C4' energy: -69.404 flat angles C4'-P-C4' energy: -39.550 flat angles P-C4'-P energy: -25.984 tors. eta vs tors. theta energy: 4.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -714.653201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.653201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.653201 (E_RNA) where: Base-Base interactions energy: -414.504 where: short stacking energy: -226.293 Base-Backbone interact. energy: -1.478 local terms energy: -298.670821 where: bonds (distance) C4'-P energy: -61.216 bonds (distance) P-C4' energy: -67.494 flat angles C4'-P-C4' energy: -66.656 flat angles P-C4'-P energy: -45.470 tors. eta vs tors. theta energy: -57.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -597.449307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.449307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.449307 (E_RNA) where: Base-Base interactions energy: -331.139 where: short stacking energy: -163.574 Base-Backbone interact. energy: 0.065 local terms energy: -266.374992 where: bonds (distance) C4'-P energy: -66.026 bonds (distance) P-C4' energy: -59.594 flat angles C4'-P-C4' energy: -59.899 flat angles P-C4'-P energy: -42.522 tors. eta vs tors. theta energy: -38.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -532.329767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.329767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.329767 (E_RNA) where: Base-Base interactions energy: -273.472 where: short stacking energy: -172.500 Base-Backbone interact. energy: -0.397 local terms energy: -258.460975 where: bonds (distance) C4'-P energy: -56.403 bonds (distance) P-C4' energy: -56.424 flat angles C4'-P-C4' energy: -69.779 flat angles P-C4'-P energy: -37.830 tors. eta vs tors. theta energy: -38.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -465.596702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.596702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.596702 (E_RNA) where: Base-Base interactions energy: -213.042 where: short stacking energy: -136.295 Base-Backbone interact. energy: -1.608 local terms energy: -250.946964 where: bonds (distance) C4'-P energy: -59.530 bonds (distance) P-C4' energy: -67.356 flat angles C4'-P-C4' energy: -62.263 flat angles P-C4'-P energy: -38.501 tors. eta vs tors. theta energy: -23.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -508.157560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.157560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.157560 (E_RNA) where: Base-Base interactions energy: -265.327 where: short stacking energy: -161.197 Base-Backbone interact. energy: -0.544 local terms energy: -242.286713 where: bonds (distance) C4'-P energy: -47.883 bonds (distance) P-C4' energy: -54.970 flat angles C4'-P-C4' energy: -63.052 flat angles P-C4'-P energy: -35.378 tors. eta vs tors. theta energy: -41.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -393.096845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.096845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.096845 (E_RNA) where: Base-Base interactions energy: -185.438 where: short stacking energy: -109.875 Base-Backbone interact. energy: 0.084 local terms energy: -207.743427 where: bonds (distance) C4'-P energy: -59.158 bonds (distance) P-C4' energy: -62.199 flat angles C4'-P-C4' energy: -40.349 flat angles P-C4'-P energy: -29.236 tors. eta vs tors. theta energy: -16.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -350.899762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.899762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.899762 (E_RNA) where: Base-Base interactions energy: -138.961 where: short stacking energy: -84.913 Base-Backbone interact. energy: 1.527 local terms energy: -213.465858 where: bonds (distance) C4'-P energy: -48.401 bonds (distance) P-C4' energy: -74.121 flat angles C4'-P-C4' energy: -49.207 flat angles P-C4'-P energy: -29.164 tors. eta vs tors. theta energy: -12.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -280.497868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.497868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.497868 (E_RNA) where: Base-Base interactions energy: -101.027 where: short stacking energy: -89.979 Base-Backbone interact. energy: -1.497 local terms energy: -177.973563 where: bonds (distance) C4'-P energy: -55.336 bonds (distance) P-C4' energy: -69.012 flat angles C4'-P-C4' energy: -38.538 flat angles P-C4'-P energy: -18.636 tors. eta vs tors. theta energy: 3.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -353.264009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.264009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.264009 (E_RNA) where: Base-Base interactions energy: -186.827 where: short stacking energy: -100.074 Base-Backbone interact. energy: 1.937 local terms energy: -168.373741 where: bonds (distance) C4'-P energy: -45.602 bonds (distance) P-C4' energy: -56.415 flat angles C4'-P-C4' energy: -51.555 flat angles P-C4'-P energy: -19.688 tors. eta vs tors. theta energy: 4.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -254.686164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.686164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.686164 (E_RNA) where: Base-Base interactions energy: -65.190 where: short stacking energy: -54.365 Base-Backbone interact. energy: 1.335 local terms energy: -190.830792 where: bonds (distance) C4'-P energy: -60.060 bonds (distance) P-C4' energy: -56.366 flat angles C4'-P-C4' energy: -44.250 flat angles P-C4'-P energy: -37.045 tors. eta vs tors. theta energy: 6.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -734.702844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.702844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.702844 (E_RNA) where: Base-Base interactions energy: -432.486 where: short stacking energy: -227.186 Base-Backbone interact. energy: -1.059 local terms energy: -301.157801 where: bonds (distance) C4'-P energy: -53.799 bonds (distance) P-C4' energy: -73.552 flat angles C4'-P-C4' energy: -67.942 flat angles P-C4'-P energy: -50.866 tors. eta vs tors. theta energy: -54.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -641.984261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.984261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.984261 (E_RNA) where: Base-Base interactions energy: -365.343 where: short stacking energy: -221.460 Base-Backbone interact. energy: 0.750 local terms energy: -277.390635 where: bonds (distance) C4'-P energy: -57.356 bonds (distance) P-C4' energy: -60.821 flat angles C4'-P-C4' energy: -64.912 flat angles P-C4'-P energy: -40.264 tors. eta vs tors. theta energy: -54.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -544.043613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.043613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.043613 (E_RNA) where: Base-Base interactions energy: -277.205 where: short stacking energy: -183.094 Base-Backbone interact. energy: -0.386 local terms energy: -266.452954 where: bonds (distance) C4'-P energy: -61.897 bonds (distance) P-C4' energy: -64.018 flat angles C4'-P-C4' energy: -57.221 flat angles P-C4'-P energy: -42.866 tors. eta vs tors. theta energy: -40.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -526.605531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.605531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.605531 (E_RNA) where: Base-Base interactions energy: -264.154 where: short stacking energy: -185.934 Base-Backbone interact. energy: -1.609 local terms energy: -260.842393 where: bonds (distance) C4'-P energy: -55.214 bonds (distance) P-C4' energy: -72.439 flat angles C4'-P-C4' energy: -46.735 flat angles P-C4'-P energy: -35.649 tors. eta vs tors. theta energy: -50.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -434.329720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.329720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.329720 (E_RNA) where: Base-Base interactions energy: -212.812 where: short stacking energy: -151.619 Base-Backbone interact. energy: -0.232 local terms energy: -221.286093 where: bonds (distance) C4'-P energy: -50.485 bonds (distance) P-C4' energy: -49.733 flat angles C4'-P-C4' energy: -50.462 flat angles P-C4'-P energy: -35.602 tors. eta vs tors. theta energy: -35.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -465.600362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.600362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.600362 (E_RNA) where: Base-Base interactions energy: -233.702 where: short stacking energy: -135.171 Base-Backbone interact. energy: -0.706 local terms energy: -231.192386 where: bonds (distance) C4'-P energy: -44.781 bonds (distance) P-C4' energy: -59.499 flat angles C4'-P-C4' energy: -58.481 flat angles P-C4'-P energy: -43.973 tors. eta vs tors. theta energy: -24.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -334.617213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.617213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.617213 (E_RNA) where: Base-Base interactions energy: -153.317 where: short stacking energy: -99.231 Base-Backbone interact. energy: 0.485 local terms energy: -181.785466 where: bonds (distance) C4'-P energy: -58.575 bonds (distance) P-C4' energy: -49.082 flat angles C4'-P-C4' energy: -49.176 flat angles P-C4'-P energy: -23.245 tors. eta vs tors. theta energy: -1.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -310.082864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.082864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.082864 (E_RNA) where: Base-Base interactions energy: -111.584 where: short stacking energy: -79.649 Base-Backbone interact. energy: -1.523 local terms energy: -196.976494 where: bonds (distance) C4'-P energy: -47.577 bonds (distance) P-C4' energy: -67.840 flat angles C4'-P-C4' energy: -60.475 flat angles P-C4'-P energy: -24.816 tors. eta vs tors. theta energy: 3.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -362.891452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.891452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.891452 (E_RNA) where: Base-Base interactions energy: -151.054 where: short stacking energy: -88.946 Base-Backbone interact. energy: 0.700 local terms energy: -212.537982 where: bonds (distance) C4'-P energy: -49.858 bonds (distance) P-C4' energy: -62.310 flat angles C4'-P-C4' energy: -56.647 flat angles P-C4'-P energy: -36.614 tors. eta vs tors. theta energy: -7.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -266.886591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.886591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.886591 (E_RNA) where: Base-Base interactions energy: -102.423 where: short stacking energy: -88.995 Base-Backbone interact. energy: -0.932 local terms energy: -163.531603 where: bonds (distance) C4'-P energy: -63.736 bonds (distance) P-C4' energy: -43.728 flat angles C4'-P-C4' energy: -41.762 flat angles P-C4'-P energy: -21.916 tors. eta vs tors. theta energy: 7.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -754.753078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.753078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.753078 (E_RNA) where: Base-Base interactions energy: -458.543 where: short stacking energy: -230.346 Base-Backbone interact. energy: -2.450 local terms energy: -293.760198 where: bonds (distance) C4'-P energy: -61.422 bonds (distance) P-C4' energy: -57.542 flat angles C4'-P-C4' energy: -66.269 flat angles P-C4'-P energy: -46.036 tors. eta vs tors. theta energy: -62.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -698.889130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.889130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.889130 (E_RNA) where: Base-Base interactions energy: -420.067 where: short stacking energy: -196.620 Base-Backbone interact. energy: 2.070 local terms energy: -280.891682 where: bonds (distance) C4'-P energy: -65.892 bonds (distance) P-C4' energy: -61.678 flat angles C4'-P-C4' energy: -63.484 flat angles P-C4'-P energy: -40.993 tors. eta vs tors. theta energy: -48.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -565.573599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.573599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.573599 (E_RNA) where: Base-Base interactions energy: -303.911 where: short stacking energy: -178.126 Base-Backbone interact. energy: -0.638 local terms energy: -261.024673 where: bonds (distance) C4'-P energy: -53.290 bonds (distance) P-C4' energy: -61.910 flat angles C4'-P-C4' energy: -61.656 flat angles P-C4'-P energy: -41.703 tors. eta vs tors. theta energy: -42.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -505.952658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.952658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.952658 (E_RNA) where: Base-Base interactions energy: -274.442 where: short stacking energy: -147.242 Base-Backbone interact. energy: -2.126 local terms energy: -229.384503 where: bonds (distance) C4'-P energy: -56.735 bonds (distance) P-C4' energy: -59.499 flat angles C4'-P-C4' energy: -57.255 flat angles P-C4'-P energy: -40.833 tors. eta vs tors. theta energy: -15.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -472.509160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.509160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.509160 (E_RNA) where: Base-Base interactions energy: -243.229 where: short stacking energy: -143.477 Base-Backbone interact. energy: 0.296 local terms energy: -229.576357 where: bonds (distance) C4'-P energy: -52.038 bonds (distance) P-C4' energy: -54.240 flat angles C4'-P-C4' energy: -66.343 flat angles P-C4'-P energy: -25.063 tors. eta vs tors. theta energy: -31.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -527.475231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.475231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.475231 (E_RNA) where: Base-Base interactions energy: -287.032 where: short stacking energy: -132.990 Base-Backbone interact. energy: -0.867 local terms energy: -239.575837 where: bonds (distance) C4'-P energy: -60.141 bonds (distance) P-C4' energy: -68.872 flat angles C4'-P-C4' energy: -51.720 flat angles P-C4'-P energy: -41.901 tors. eta vs tors. theta energy: -16.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -355.231357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.231357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.231357 (E_RNA) where: Base-Base interactions energy: -154.185 where: short stacking energy: -91.547 Base-Backbone interact. energy: -0.976 local terms energy: -200.070723 where: bonds (distance) C4'-P energy: -51.457 bonds (distance) P-C4' energy: -50.403 flat angles C4'-P-C4' energy: -66.356 flat angles P-C4'-P energy: -30.634 tors. eta vs tors. theta energy: -1.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -376.130916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.130916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.130916 (E_RNA) where: Base-Base interactions energy: -159.625 where: short stacking energy: -90.708 Base-Backbone interact. energy: -1.633 local terms energy: -214.872279 where: bonds (distance) C4'-P energy: -54.233 bonds (distance) P-C4' energy: -61.802 flat angles C4'-P-C4' energy: -57.028 flat angles P-C4'-P energy: -39.472 tors. eta vs tors. theta energy: -2.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -271.673528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.673528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.673528 (E_RNA) where: Base-Base interactions energy: -111.510 where: short stacking energy: -92.126 Base-Backbone interact. energy: 0.236 local terms energy: -160.400175 where: bonds (distance) C4'-P energy: -47.623 bonds (distance) P-C4' energy: -43.009 flat angles C4'-P-C4' energy: -40.930 flat angles P-C4'-P energy: -17.491 tors. eta vs tors. theta energy: -11.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -248.737625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.737625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.737625 (E_RNA) where: Base-Base interactions energy: -84.188 where: short stacking energy: -62.385 Base-Backbone interact. energy: -0.064 local terms energy: -164.485180 where: bonds (distance) C4'-P energy: -54.650 bonds (distance) P-C4' energy: -52.649 flat angles C4'-P-C4' energy: -38.942 flat angles P-C4'-P energy: -35.620 tors. eta vs tors. theta energy: 17.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -811.789406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.789406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.789406 (E_RNA) where: Base-Base interactions energy: -512.657 where: short stacking energy: -233.242 Base-Backbone interact. energy: -1.030 local terms energy: -298.102646 where: bonds (distance) C4'-P energy: -65.257 bonds (distance) P-C4' energy: -51.703 flat angles C4'-P-C4' energy: -74.397 flat angles P-C4'-P energy: -41.622 tors. eta vs tors. theta energy: -65.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -729.597145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.597145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.597145 (E_RNA) where: Base-Base interactions energy: -447.272 where: short stacking energy: -192.717 Base-Backbone interact. energy: -1.584 local terms energy: -280.740773 where: bonds (distance) C4'-P energy: -56.688 bonds (distance) P-C4' energy: -61.886 flat angles C4'-P-C4' energy: -74.455 flat angles P-C4'-P energy: -35.393 tors. eta vs tors. theta energy: -52.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -568.106389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.106389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.106389 (E_RNA) where: Base-Base interactions energy: -287.789 where: short stacking energy: -190.361 Base-Backbone interact. energy: 0.221 local terms energy: -280.537985 where: bonds (distance) C4'-P energy: -60.073 bonds (distance) P-C4' energy: -61.391 flat angles C4'-P-C4' energy: -62.039 flat angles P-C4'-P energy: -40.938 tors. eta vs tors. theta energy: -56.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -609.264028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.264028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.264028 (E_RNA) where: Base-Base interactions energy: -385.023 where: short stacking energy: -178.671 Base-Backbone interact. energy: -2.482 local terms energy: -221.758357 where: bonds (distance) C4'-P energy: -37.032 bonds (distance) P-C4' energy: -60.335 flat angles C4'-P-C4' energy: -62.371 flat angles P-C4'-P energy: -26.195 tors. eta vs tors. theta energy: -35.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -583.596968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.596968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.596968 (E_RNA) where: Base-Base interactions energy: -322.105 where: short stacking energy: -158.989 Base-Backbone interact. energy: 1.117 local terms energy: -262.609804 where: bonds (distance) C4'-P energy: -56.507 bonds (distance) P-C4' energy: -57.961 flat angles C4'-P-C4' energy: -61.685 flat angles P-C4'-P energy: -43.655 tors. eta vs tors. theta energy: -42.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -402.586127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.586127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.586127 (E_RNA) where: Base-Base interactions energy: -206.770 where: short stacking energy: -132.362 Base-Backbone interact. energy: 0.703 local terms energy: -196.518307 where: bonds (distance) C4'-P energy: -51.479 bonds (distance) P-C4' energy: -55.608 flat angles C4'-P-C4' energy: -45.612 flat angles P-C4'-P energy: -27.503 tors. eta vs tors. theta energy: -16.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -377.073793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.073793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.073793 (E_RNA) where: Base-Base interactions energy: -179.096 where: short stacking energy: -103.186 Base-Backbone interact. energy: -0.527 local terms energy: -197.451213 where: bonds (distance) C4'-P energy: -52.820 bonds (distance) P-C4' energy: -65.645 flat angles C4'-P-C4' energy: -42.353 flat angles P-C4'-P energy: -32.901 tors. eta vs tors. theta energy: -3.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -388.572937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.572937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.572937 (E_RNA) where: Base-Base interactions energy: -194.067 where: short stacking energy: -126.729 Base-Backbone interact. energy: 1.224 local terms energy: -195.729898 where: bonds (distance) C4'-P energy: -48.904 bonds (distance) P-C4' energy: -41.932 flat angles C4'-P-C4' energy: -49.845 flat angles P-C4'-P energy: -34.183 tors. eta vs tors. theta energy: -20.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -278.222062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.222062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.222062 (E_RNA) where: Base-Base interactions energy: -90.204 where: short stacking energy: -72.803 Base-Backbone interact. energy: -2.214 local terms energy: -185.804058 where: bonds (distance) C4'-P energy: -63.037 bonds (distance) P-C4' energy: -52.821 flat angles C4'-P-C4' energy: -48.755 flat angles P-C4'-P energy: -22.644 tors. eta vs tors. theta energy: 1.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -267.976082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.976082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.976082 (E_RNA) where: Base-Base interactions energy: -96.805 where: short stacking energy: -78.610 Base-Backbone interact. energy: -2.335 local terms energy: -168.836059 where: bonds (distance) C4'-P energy: -48.339 bonds (distance) P-C4' energy: -65.004 flat angles C4'-P-C4' energy: -34.589 flat angles P-C4'-P energy: -26.622 tors. eta vs tors. theta energy: 5.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -798.781983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.781983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.781983 (E_RNA) where: Base-Base interactions energy: -503.649 where: short stacking energy: -230.277 Base-Backbone interact. energy: -1.958 local terms energy: -293.174850 where: bonds (distance) C4'-P energy: -67.300 bonds (distance) P-C4' energy: -61.674 flat angles C4'-P-C4' energy: -66.343 flat angles P-C4'-P energy: -39.315 tors. eta vs tors. theta energy: -58.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -755.174734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.174734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.174734 (E_RNA) where: Base-Base interactions energy: -475.861 where: short stacking energy: -195.984 Base-Backbone interact. energy: -0.866 local terms energy: -278.448239 where: bonds (distance) C4'-P energy: -66.173 bonds (distance) P-C4' energy: -56.729 flat angles C4'-P-C4' energy: -66.292 flat angles P-C4'-P energy: -42.044 tors. eta vs tors. theta energy: -47.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -579.698027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.698027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.698027 (E_RNA) where: Base-Base interactions energy: -324.698 where: short stacking energy: -180.958 Base-Backbone interact. energy: 4.079 local terms energy: -259.079147 where: bonds (distance) C4'-P energy: -65.881 bonds (distance) P-C4' energy: -48.823 flat angles C4'-P-C4' energy: -63.931 flat angles P-C4'-P energy: -35.273 tors. eta vs tors. theta energy: -45.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -559.450472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.450472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.450472 (E_RNA) where: Base-Base interactions energy: -323.182 where: short stacking energy: -162.253 Base-Backbone interact. energy: -0.322 local terms energy: -235.946716 where: bonds (distance) C4'-P energy: -45.420 bonds (distance) P-C4' energy: -57.558 flat angles C4'-P-C4' energy: -62.855 flat angles P-C4'-P energy: -42.867 tors. eta vs tors. theta energy: -27.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -545.481533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.481533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.481533 (E_RNA) where: Base-Base interactions energy: -299.158 where: short stacking energy: -165.512 Base-Backbone interact. energy: -1.221 local terms energy: -245.102637 where: bonds (distance) C4'-P energy: -61.238 bonds (distance) P-C4' energy: -58.616 flat angles C4'-P-C4' energy: -56.021 flat angles P-C4'-P energy: -36.049 tors. eta vs tors. theta energy: -33.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -397.295582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.295582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.295582 (E_RNA) where: Base-Base interactions energy: -177.519 where: short stacking energy: -119.321 Base-Backbone interact. energy: -0.982 local terms energy: -218.794287 where: bonds (distance) C4'-P energy: -46.003 bonds (distance) P-C4' energy: -63.398 flat angles C4'-P-C4' energy: -54.038 flat angles P-C4'-P energy: -37.335 tors. eta vs tors. theta energy: -18.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -389.296772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.296772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.296772 (E_RNA) where: Base-Base interactions energy: -173.746 where: short stacking energy: -94.494 Base-Backbone interact. energy: -3.572 local terms energy: -211.978443 where: bonds (distance) C4'-P energy: -53.138 bonds (distance) P-C4' energy: -60.901 flat angles C4'-P-C4' energy: -55.086 flat angles P-C4'-P energy: -37.586 tors. eta vs tors. theta energy: -5.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -295.231889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.231889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.231889 (E_RNA) where: Base-Base interactions energy: -114.431 where: short stacking energy: -80.035 Base-Backbone interact. energy: 1.886 local terms energy: -182.687042 where: bonds (distance) C4'-P energy: -41.235 bonds (distance) P-C4' energy: -61.725 flat angles C4'-P-C4' energy: -50.225 flat angles P-C4'-P energy: -25.889 tors. eta vs tors. theta energy: -3.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -393.551055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.551055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.551055 (E_RNA) where: Base-Base interactions energy: -202.398 where: short stacking energy: -111.375 Base-Backbone interact. energy: 1.728 local terms energy: -192.881124 where: bonds (distance) C4'-P energy: -54.006 bonds (distance) P-C4' energy: -63.073 flat angles C4'-P-C4' energy: -52.112 flat angles P-C4'-P energy: -20.324 tors. eta vs tors. theta energy: -3.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -261.882039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.882039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.882039 (E_RNA) where: Base-Base interactions energy: -78.655 where: short stacking energy: -66.771 Base-Backbone interact. energy: -1.151 local terms energy: -182.075744 where: bonds (distance) C4'-P energy: -59.922 bonds (distance) P-C4' energy: -56.855 flat angles C4'-P-C4' energy: -50.094 flat angles P-C4'-P energy: -24.896 tors. eta vs tors. theta energy: 9.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -815.478022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.478022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.478022 (E_RNA) where: Base-Base interactions energy: -510.802 where: short stacking energy: -238.717 Base-Backbone interact. energy: -2.213 local terms energy: -302.462323 where: bonds (distance) C4'-P energy: -63.427 bonds (distance) P-C4' energy: -49.607 flat angles C4'-P-C4' energy: -73.851 flat angles P-C4'-P energy: -46.838 tors. eta vs tors. theta energy: -68.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -734.481980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.481980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.481980 (E_RNA) where: Base-Base interactions energy: -451.775 where: short stacking energy: -204.166 Base-Backbone interact. energy: -2.626 local terms energy: -280.081015 where: bonds (distance) C4'-P energy: -62.390 bonds (distance) P-C4' energy: -67.615 flat angles C4'-P-C4' energy: -60.277 flat angles P-C4'-P energy: -46.941 tors. eta vs tors. theta energy: -42.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -615.203372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.203372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.203372 (E_RNA) where: Base-Base interactions energy: -341.473 where: short stacking energy: -193.170 Base-Backbone interact. energy: -0.704 local terms energy: -273.026970 where: bonds (distance) C4'-P energy: -51.427 bonds (distance) P-C4' energy: -61.916 flat angles C4'-P-C4' energy: -63.715 flat angles P-C4'-P energy: -43.442 tors. eta vs tors. theta energy: -52.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -557.250067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.250067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.250067 (E_RNA) where: Base-Base interactions energy: -321.475 where: short stacking energy: -160.152 Base-Backbone interact. energy: 1.423 local terms energy: -237.197382 where: bonds (distance) C4'-P energy: -54.574 bonds (distance) P-C4' energy: -59.248 flat angles C4'-P-C4' energy: -55.824 flat angles P-C4'-P energy: -40.816 tors. eta vs tors. theta energy: -26.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -516.629789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.629789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.629789 (E_RNA) where: Base-Base interactions energy: -265.141 where: short stacking energy: -157.195 Base-Backbone interact. energy: 0.421 local terms energy: -251.909809 where: bonds (distance) C4'-P energy: -54.442 bonds (distance) P-C4' energy: -69.153 flat angles C4'-P-C4' energy: -64.704 flat angles P-C4'-P energy: -32.047 tors. eta vs tors. theta energy: -31.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -417.170075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.170075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.170075 (E_RNA) where: Base-Base interactions energy: -189.877 where: short stacking energy: -143.043 Base-Backbone interact. energy: 2.255 local terms energy: -229.548503 where: bonds (distance) C4'-P energy: -58.537 bonds (distance) P-C4' energy: -58.287 flat angles C4'-P-C4' energy: -55.786 flat angles P-C4'-P energy: -27.268 tors. eta vs tors. theta energy: -29.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -418.493659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.493659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.493659 (E_RNA) where: Base-Base interactions energy: -206.029 where: short stacking energy: -123.022 Base-Backbone interact. energy: 0.327 local terms energy: -212.791330 where: bonds (distance) C4'-P energy: -51.778 bonds (distance) P-C4' energy: -57.078 flat angles C4'-P-C4' energy: -50.775 flat angles P-C4'-P energy: -31.294 tors. eta vs tors. theta energy: -21.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -302.022190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.022190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.022190 (E_RNA) where: Base-Base interactions energy: -113.090 where: short stacking energy: -96.419 Base-Backbone interact. energy: -0.615 local terms energy: -188.317617 where: bonds (distance) C4'-P energy: -52.952 bonds (distance) P-C4' energy: -53.811 flat angles C4'-P-C4' energy: -56.043 flat angles P-C4'-P energy: -32.116 tors. eta vs tors. theta energy: 6.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -419.178461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.178461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.178461 (E_RNA) where: Base-Base interactions energy: -213.645 where: short stacking energy: -114.737 Base-Backbone interact. energy: -1.048 local terms energy: -204.486144 where: bonds (distance) C4'-P energy: -46.642 bonds (distance) P-C4' energy: -57.262 flat angles C4'-P-C4' energy: -48.114 flat angles P-C4'-P energy: -29.299 tors. eta vs tors. theta energy: -23.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -260.726612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.726612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.726612 (E_RNA) where: Base-Base interactions energy: -87.855 where: short stacking energy: -65.648 Base-Backbone interact. energy: 0.973 local terms energy: -173.844523 where: bonds (distance) C4'-P energy: -47.997 bonds (distance) P-C4' energy: -56.582 flat angles C4'-P-C4' energy: -45.022 flat angles P-C4'-P energy: -34.052 tors. eta vs tors. theta energy: 9.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -856.137032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.137032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.137032 (E_RNA) where: Base-Base interactions energy: -533.111 where: short stacking energy: -254.785 Base-Backbone interact. energy: -0.517 local terms energy: -322.509315 where: bonds (distance) C4'-P energy: -66.404 bonds (distance) P-C4' energy: -63.358 flat angles C4'-P-C4' energy: -64.742 flat angles P-C4'-P energy: -51.880 tors. eta vs tors. theta energy: -76.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -704.906996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.906996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.906996 (E_RNA) where: Base-Base interactions energy: -447.279 where: short stacking energy: -190.385 Base-Backbone interact. energy: -0.591 local terms energy: -257.036582 where: bonds (distance) C4'-P energy: -63.851 bonds (distance) P-C4' energy: -60.377 flat angles C4'-P-C4' energy: -63.009 flat angles P-C4'-P energy: -35.087 tors. eta vs tors. theta energy: -34.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -593.183503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.183503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.183503 (E_RNA) where: Base-Base interactions energy: -333.621 where: short stacking energy: -180.153 Base-Backbone interact. energy: -0.465 local terms energy: -259.097288 where: bonds (distance) C4'-P energy: -64.264 bonds (distance) P-C4' energy: -63.089 flat angles C4'-P-C4' energy: -58.077 flat angles P-C4'-P energy: -39.843 tors. eta vs tors. theta energy: -33.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -643.207183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.207183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.207183 (E_RNA) where: Base-Base interactions energy: -402.316 where: short stacking energy: -174.007 Base-Backbone interact. energy: -2.323 local terms energy: -238.567576 where: bonds (distance) C4'-P energy: -49.314 bonds (distance) P-C4' energy: -59.255 flat angles C4'-P-C4' energy: -52.884 flat angles P-C4'-P energy: -42.176 tors. eta vs tors. theta energy: -34.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -539.881806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.881806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.881806 (E_RNA) where: Base-Base interactions energy: -307.170 where: short stacking energy: -154.513 Base-Backbone interact. energy: -1.491 local terms energy: -231.220415 where: bonds (distance) C4'-P energy: -34.708 bonds (distance) P-C4' energy: -67.510 flat angles C4'-P-C4' energy: -63.587 flat angles P-C4'-P energy: -35.451 tors. eta vs tors. theta energy: -29.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -440.297550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.297550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.297550 (E_RNA) where: Base-Base interactions energy: -219.942 where: short stacking energy: -115.668 Base-Backbone interact. energy: -1.209 local terms energy: -219.146450 where: bonds (distance) C4'-P energy: -48.683 bonds (distance) P-C4' energy: -66.090 flat angles C4'-P-C4' energy: -48.020 flat angles P-C4'-P energy: -42.666 tors. eta vs tors. theta energy: -13.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -357.816798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.816798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.816798 (E_RNA) where: Base-Base interactions energy: -140.639 where: short stacking energy: -86.735 Base-Backbone interact. energy: -0.419 local terms energy: -216.759289 where: bonds (distance) C4'-P energy: -62.299 bonds (distance) P-C4' energy: -67.414 flat angles C4'-P-C4' energy: -43.717 flat angles P-C4'-P energy: -40.097 tors. eta vs tors. theta energy: -3.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -502.419748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.419748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.419748 (E_RNA) where: Base-Base interactions energy: -291.614 where: short stacking energy: -136.882 Base-Backbone interact. energy: 1.150 local terms energy: -211.955114 where: bonds (distance) C4'-P energy: -54.562 bonds (distance) P-C4' energy: -58.143 flat angles C4'-P-C4' energy: -49.918 flat angles P-C4'-P energy: -31.105 tors. eta vs tors. theta energy: -18.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -268.297360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.297360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.297360 (E_RNA) where: Base-Base interactions energy: -78.272 where: short stacking energy: -74.233 Base-Backbone interact. energy: -0.129 local terms energy: -189.896302 where: bonds (distance) C4'-P energy: -52.039 bonds (distance) P-C4' energy: -59.642 flat angles C4'-P-C4' energy: -35.788 flat angles P-C4'-P energy: -45.534 tors. eta vs tors. theta energy: 3.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -274.085062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.085062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.085062 (E_RNA) where: Base-Base interactions energy: -93.153 where: short stacking energy: -75.625 Base-Backbone interact. energy: -0.780 local terms energy: -180.152089 where: bonds (distance) C4'-P energy: -58.303 bonds (distance) P-C4' energy: -50.594 flat angles C4'-P-C4' energy: -44.506 flat angles P-C4'-P energy: -31.198 tors. eta vs tors. theta energy: 4.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -823.074250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.074250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.074250 (E_RNA) where: Base-Base interactions energy: -523.242 where: short stacking energy: -233.506 Base-Backbone interact. energy: -3.356 local terms energy: -296.475593 where: bonds (distance) C4'-P energy: -60.908 bonds (distance) P-C4' energy: -64.982 flat angles C4'-P-C4' energy: -60.950 flat angles P-C4'-P energy: -40.843 tors. eta vs tors. theta energy: -68.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -751.682442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.682442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.682442 (E_RNA) where: Base-Base interactions energy: -471.120 where: short stacking energy: -209.584 Base-Backbone interact. energy: -0.985 local terms energy: -279.576854 where: bonds (distance) C4'-P energy: -54.466 bonds (distance) P-C4' energy: -61.613 flat angles C4'-P-C4' energy: -64.731 flat angles P-C4'-P energy: -47.941 tors. eta vs tors. theta energy: -50.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -697.676224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.676224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.676224 (E_RNA) where: Base-Base interactions energy: -438.467 where: short stacking energy: -187.135 Base-Backbone interact. energy: -1.291 local terms energy: -257.918552 where: bonds (distance) C4'-P energy: -65.861 bonds (distance) P-C4' energy: -66.521 flat angles C4'-P-C4' energy: -50.054 flat angles P-C4'-P energy: -35.675 tors. eta vs tors. theta energy: -39.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -510.385516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.385516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.385516 (E_RNA) where: Base-Base interactions energy: -288.540 where: short stacking energy: -150.196 Base-Backbone interact. energy: 2.457 local terms energy: -224.302655 where: bonds (distance) C4'-P energy: -67.975 bonds (distance) P-C4' energy: -64.033 flat angles C4'-P-C4' energy: -51.467 flat angles P-C4'-P energy: -28.777 tors. eta vs tors. theta energy: -12.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -528.640932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.640932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.640932 (E_RNA) where: Base-Base interactions energy: -283.507 where: short stacking energy: -158.581 Base-Backbone interact. energy: -1.046 local terms energy: -244.087787 where: bonds (distance) C4'-P energy: -59.690 bonds (distance) P-C4' energy: -57.667 flat angles C4'-P-C4' energy: -46.074 flat angles P-C4'-P energy: -39.233 tors. eta vs tors. theta energy: -41.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -613.629401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.629401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.629401 (E_RNA) where: Base-Base interactions energy: -357.733 where: short stacking energy: -172.330 Base-Backbone interact. energy: -1.925 local terms energy: -253.971840 where: bonds (distance) C4'-P energy: -49.793 bonds (distance) P-C4' energy: -59.699 flat angles C4'-P-C4' energy: -63.648 flat angles P-C4'-P energy: -39.671 tors. eta vs tors. theta energy: -41.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -485.588669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.588669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.588669 (E_RNA) where: Base-Base interactions energy: -271.391 where: short stacking energy: -112.063 Base-Backbone interact. energy: -1.509 local terms energy: -212.688860 where: bonds (distance) C4'-P energy: -57.697 bonds (distance) P-C4' energy: -53.611 flat angles C4'-P-C4' energy: -57.891 flat angles P-C4'-P energy: -30.455 tors. eta vs tors. theta energy: -13.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -339.985923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.985923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.985923 (E_RNA) where: Base-Base interactions energy: -141.013 where: short stacking energy: -87.294 Base-Backbone interact. energy: -0.952 local terms energy: -198.021209 where: bonds (distance) C4'-P energy: -58.882 bonds (distance) P-C4' energy: -54.412 flat angles C4'-P-C4' energy: -52.881 flat angles P-C4'-P energy: -30.789 tors. eta vs tors. theta energy: -1.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -277.748952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.748952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.748952 (E_RNA) where: Base-Base interactions energy: -104.337 where: short stacking energy: -100.101 Base-Backbone interact. energy: -1.694 local terms energy: -171.717578 where: bonds (distance) C4'-P energy: -50.238 bonds (distance) P-C4' energy: -52.605 flat angles C4'-P-C4' energy: -44.279 flat angles P-C4'-P energy: -15.702 tors. eta vs tors. theta energy: -8.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -267.925555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.925555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.925555 (E_RNA) where: Base-Base interactions energy: -107.593 where: short stacking energy: -78.293 Base-Backbone interact. energy: -1.989 local terms energy: -158.343516 where: bonds (distance) C4'-P energy: -51.727 bonds (distance) P-C4' energy: -53.421 flat angles C4'-P-C4' energy: -46.457 flat angles P-C4'-P energy: -23.095 tors. eta vs tors. theta energy: 16.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -807.870408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.870408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.870408 (E_RNA) where: Base-Base interactions energy: -508.832 where: short stacking energy: -240.896 Base-Backbone interact. energy: -2.598 local terms energy: -296.440395 where: bonds (distance) C4'-P energy: -61.693 bonds (distance) P-C4' energy: -55.066 flat angles C4'-P-C4' energy: -69.499 flat angles P-C4'-P energy: -44.827 tors. eta vs tors. theta energy: -65.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -806.391089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.391089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.391089 (E_RNA) where: Base-Base interactions energy: -533.207 where: short stacking energy: -217.744 Base-Backbone interact. energy: -1.868 local terms energy: -271.316783 where: bonds (distance) C4'-P energy: -53.038 bonds (distance) P-C4' energy: -52.825 flat angles C4'-P-C4' energy: -63.578 flat angles P-C4'-P energy: -43.756 tors. eta vs tors. theta energy: -58.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -693.391726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.391726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.391726 (E_RNA) where: Base-Base interactions energy: -415.393 where: short stacking energy: -182.806 Base-Backbone interact. energy: 0.408 local terms energy: -278.406389 where: bonds (distance) C4'-P energy: -70.736 bonds (distance) P-C4' energy: -65.605 flat angles C4'-P-C4' energy: -67.148 flat angles P-C4'-P energy: -33.208 tors. eta vs tors. theta energy: -41.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -610.878976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.878976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.878976 (E_RNA) where: Base-Base interactions energy: -360.767 where: short stacking energy: -204.069 Base-Backbone interact. energy: 0.045 local terms energy: -250.157004 where: bonds (distance) C4'-P energy: -64.627 bonds (distance) P-C4' energy: -45.358 flat angles C4'-P-C4' energy: -54.309 flat angles P-C4'-P energy: -33.180 tors. eta vs tors. theta energy: -52.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -526.124370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.124370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.124370 (E_RNA) where: Base-Base interactions energy: -275.538 where: short stacking energy: -140.670 Base-Backbone interact. energy: -2.282 local terms energy: -248.304269 where: bonds (distance) C4'-P energy: -57.990 bonds (distance) P-C4' energy: -59.040 flat angles C4'-P-C4' energy: -55.528 flat angles P-C4'-P energy: -44.027 tors. eta vs tors. theta energy: -31.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -689.182872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.182872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.182872 (E_RNA) where: Base-Base interactions energy: -430.432 where: short stacking energy: -185.096 Base-Backbone interact. energy: 0.504 local terms energy: -259.254327 where: bonds (distance) C4'-P energy: -47.952 bonds (distance) P-C4' energy: -69.111 flat angles C4'-P-C4' energy: -50.881 flat angles P-C4'-P energy: -36.988 tors. eta vs tors. theta energy: -54.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -442.993980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.993980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.993980 (E_RNA) where: Base-Base interactions energy: -211.391 where: short stacking energy: -133.295 Base-Backbone interact. energy: 1.106 local terms energy: -232.709560 where: bonds (distance) C4'-P energy: -64.260 bonds (distance) P-C4' energy: -60.790 flat angles C4'-P-C4' energy: -50.796 flat angles P-C4'-P energy: -33.647 tors. eta vs tors. theta energy: -23.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -292.703423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.703423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.703423 (E_RNA) where: Base-Base interactions energy: -96.542 where: short stacking energy: -73.713 Base-Backbone interact. energy: -0.646 local terms energy: -195.515672 where: bonds (distance) C4'-P energy: -56.998 bonds (distance) P-C4' energy: -61.135 flat angles C4'-P-C4' energy: -50.157 flat angles P-C4'-P energy: -30.343 tors. eta vs tors. theta energy: 3.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -272.051880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.051880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.051880 (E_RNA) where: Base-Base interactions energy: -75.081 where: short stacking energy: -65.183 Base-Backbone interact. energy: -0.382 local terms energy: -196.588910 where: bonds (distance) C4'-P energy: -56.143 bonds (distance) P-C4' energy: -62.145 flat angles C4'-P-C4' energy: -56.405 flat angles P-C4'-P energy: -31.630 tors. eta vs tors. theta energy: 9.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -253.022078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.022078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.022078 (E_RNA) where: Base-Base interactions energy: -70.105 where: short stacking energy: -65.914 Base-Backbone interact. energy: 1.612 local terms energy: -184.529092 where: bonds (distance) C4'-P energy: -49.234 bonds (distance) P-C4' energy: -56.863 flat angles C4'-P-C4' energy: -43.098 flat angles P-C4'-P energy: -42.532 tors. eta vs tors. theta energy: 7.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -892.375281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.375281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.375281 (E_RNA) where: Base-Base interactions energy: -564.133 where: short stacking energy: -243.389 Base-Backbone interact. energy: -4.529 local terms energy: -323.713135 where: bonds (distance) C4'-P energy: -69.012 bonds (distance) P-C4' energy: -71.124 flat angles C4'-P-C4' energy: -72.258 flat angles P-C4'-P energy: -50.247 tors. eta vs tors. theta energy: -61.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -789.376663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.376663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.376663 (E_RNA) where: Base-Base interactions energy: -488.713 where: short stacking energy: -230.768 Base-Backbone interact. energy: -1.862 local terms energy: -298.800871 where: bonds (distance) C4'-P energy: -64.058 bonds (distance) P-C4' energy: -63.305 flat angles C4'-P-C4' energy: -65.124 flat angles P-C4'-P energy: -45.522 tors. eta vs tors. theta energy: -60.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -697.898724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.898724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.898724 (E_RNA) where: Base-Base interactions energy: -437.189 where: short stacking energy: -219.318 Base-Backbone interact. energy: -0.856 local terms energy: -259.853076 where: bonds (distance) C4'-P energy: -55.747 bonds (distance) P-C4' energy: -65.026 flat angles C4'-P-C4' energy: -56.159 flat angles P-C4'-P energy: -35.687 tors. eta vs tors. theta energy: -47.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -595.716263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.716263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.716263 (E_RNA) where: Base-Base interactions energy: -334.645 where: short stacking energy: -191.223 Base-Backbone interact. energy: -2.509 local terms energy: -258.562088 where: bonds (distance) C4'-P energy: -63.128 bonds (distance) P-C4' energy: -66.623 flat angles C4'-P-C4' energy: -52.691 flat angles P-C4'-P energy: -31.431 tors. eta vs tors. theta energy: -44.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -730.534278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.534278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.534278 (E_RNA) where: Base-Base interactions energy: -469.958 where: short stacking energy: -194.350 Base-Backbone interact. energy: -5.014 local terms energy: -255.562588 where: bonds (distance) C4'-P energy: -56.498 bonds (distance) P-C4' energy: -61.381 flat angles C4'-P-C4' energy: -53.197 flat angles P-C4'-P energy: -23.847 tors. eta vs tors. theta energy: -60.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -516.823811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.823811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.823811 (E_RNA) where: Base-Base interactions energy: -274.205 where: short stacking energy: -159.507 Base-Backbone interact. energy: -0.546 local terms energy: -242.071988 where: bonds (distance) C4'-P energy: -53.040 bonds (distance) P-C4' energy: -61.969 flat angles C4'-P-C4' energy: -49.011 flat angles P-C4'-P energy: -41.521 tors. eta vs tors. theta energy: -36.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -476.437790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.437790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.437790 (E_RNA) where: Base-Base interactions energy: -268.644 where: short stacking energy: -122.465 Base-Backbone interact. energy: -1.859 local terms energy: -205.934461 where: bonds (distance) C4'-P energy: -52.100 bonds (distance) P-C4' energy: -51.898 flat angles C4'-P-C4' energy: -43.442 flat angles P-C4'-P energy: -41.100 tors. eta vs tors. theta energy: -17.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -293.873736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.873736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.873736 (E_RNA) where: Base-Base interactions energy: -111.219 where: short stacking energy: -92.512 Base-Backbone interact. energy: -2.099 local terms energy: -180.555973 where: bonds (distance) C4'-P energy: -47.235 bonds (distance) P-C4' energy: -58.494 flat angles C4'-P-C4' energy: -54.179 flat angles P-C4'-P energy: -23.788 tors. eta vs tors. theta energy: 3.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -279.938295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.938295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.938295 (E_RNA) where: Base-Base interactions energy: -101.856 where: short stacking energy: -75.284 Base-Backbone interact. energy: 0.686 local terms energy: -178.768203 where: bonds (distance) C4'-P energy: -55.734 bonds (distance) P-C4' energy: -45.551 flat angles C4'-P-C4' energy: -57.406 flat angles P-C4'-P energy: -25.484 tors. eta vs tors. theta energy: 5.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -251.391747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.391747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.391747 (E_RNA) where: Base-Base interactions energy: -90.031 where: short stacking energy: -77.494 Base-Backbone interact. energy: -0.315 local terms energy: -161.046389 where: bonds (distance) C4'-P energy: -41.758 bonds (distance) P-C4' energy: -54.274 flat angles C4'-P-C4' energy: -36.199 flat angles P-C4'-P energy: -23.783 tors. eta vs tors. theta energy: -5.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -865.135222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.135222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.135222 (E_RNA) where: Base-Base interactions energy: -557.352 where: short stacking energy: -243.363 Base-Backbone interact. energy: -1.562 local terms energy: -306.220909 where: bonds (distance) C4'-P energy: -64.808 bonds (distance) P-C4' energy: -73.734 flat angles C4'-P-C4' energy: -59.311 flat angles P-C4'-P energy: -43.868 tors. eta vs tors. theta energy: -64.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -776.071879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.071879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.071879 (E_RNA) where: Base-Base interactions energy: -481.850 where: short stacking energy: -230.361 Base-Backbone interact. energy: 0.352 local terms energy: -294.574173 where: bonds (distance) C4'-P energy: -57.892 bonds (distance) P-C4' energy: -62.922 flat angles C4'-P-C4' energy: -64.287 flat angles P-C4'-P energy: -45.908 tors. eta vs tors. theta energy: -63.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -721.323748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.323748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.323748 (E_RNA) where: Base-Base interactions energy: -445.901 where: short stacking energy: -214.753 Base-Backbone interact. energy: -3.305 local terms energy: -272.117632 where: bonds (distance) C4'-P energy: -53.676 bonds (distance) P-C4' energy: -55.717 flat angles C4'-P-C4' energy: -62.361 flat angles P-C4'-P energy: -42.035 tors. eta vs tors. theta energy: -58.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -787.239954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -787.239954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.239954 (E_RNA) where: Base-Base interactions energy: -508.457 where: short stacking energy: -220.430 Base-Backbone interact. energy: 0.781 local terms energy: -279.564234 where: bonds (distance) C4'-P energy: -55.505 bonds (distance) P-C4' energy: -57.315 flat angles C4'-P-C4' energy: -65.984 flat angles P-C4'-P energy: -40.401 tors. eta vs tors. theta energy: -60.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -605.894907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.894907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.894907 (E_RNA) where: Base-Base interactions energy: -355.622 where: short stacking energy: -175.369 Base-Backbone interact. energy: 0.868 local terms energy: -251.140958 where: bonds (distance) C4'-P energy: -58.680 bonds (distance) P-C4' energy: -60.361 flat angles C4'-P-C4' energy: -64.640 flat angles P-C4'-P energy: -26.010 tors. eta vs tors. theta energy: -41.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -539.222201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.222201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.222201 (E_RNA) where: Base-Base interactions energy: -299.440 where: short stacking energy: -162.579 Base-Backbone interact. energy: -0.010 local terms energy: -239.772498 where: bonds (distance) C4'-P energy: -55.329 bonds (distance) P-C4' energy: -53.711 flat angles C4'-P-C4' energy: -54.519 flat angles P-C4'-P energy: -43.493 tors. eta vs tors. theta energy: -32.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -442.979038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.979038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.979038 (E_RNA) where: Base-Base interactions energy: -240.907 where: short stacking energy: -139.454 Base-Backbone interact. energy: 1.388 local terms energy: -203.459958 where: bonds (distance) C4'-P energy: -41.703 bonds (distance) P-C4' energy: -60.445 flat angles C4'-P-C4' energy: -44.022 flat angles P-C4'-P energy: -24.298 tors. eta vs tors. theta energy: -32.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -320.098995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.098995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.098995 (E_RNA) where: Base-Base interactions energy: -146.606 where: short stacking energy: -81.811 Base-Backbone interact. energy: -2.060 local terms energy: -171.433288 where: bonds (distance) C4'-P energy: -48.608 bonds (distance) P-C4' energy: -46.878 flat angles C4'-P-C4' energy: -40.013 flat angles P-C4'-P energy: -30.319 tors. eta vs tors. theta energy: -5.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -273.860654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.860654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.860654 (E_RNA) where: Base-Base interactions energy: -95.560 where: short stacking energy: -65.347 Base-Backbone interact. energy: -0.091 local terms energy: -178.210240 where: bonds (distance) C4'-P energy: -61.465 bonds (distance) P-C4' energy: -61.395 flat angles C4'-P-C4' energy: -35.804 flat angles P-C4'-P energy: -29.313 tors. eta vs tors. theta energy: 9.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -239.160460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.160460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.160460 (E_RNA) where: Base-Base interactions energy: -88.808 where: short stacking energy: -63.301 Base-Backbone interact. energy: -3.942 local terms energy: -146.410313 where: bonds (distance) C4'-P energy: -36.713 bonds (distance) P-C4' energy: -48.228 flat angles C4'-P-C4' energy: -38.236 flat angles P-C4'-P energy: -30.937 tors. eta vs tors. theta energy: 7.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -887.928456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.928456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.928456 (E_RNA) where: Base-Base interactions energy: -570.016 where: short stacking energy: -246.211 Base-Backbone interact. energy: 2.655 local terms energy: -320.567411 where: bonds (distance) C4'-P energy: -61.977 bonds (distance) P-C4' energy: -70.261 flat angles C4'-P-C4' energy: -72.979 flat angles P-C4'-P energy: -44.071 tors. eta vs tors. theta energy: -71.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -804.971251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.971251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.971251 (E_RNA) where: Base-Base interactions energy: -512.937 where: short stacking energy: -230.333 Base-Backbone interact. energy: -1.033 local terms energy: -291.001438 where: bonds (distance) C4'-P energy: -66.529 bonds (distance) P-C4' energy: -52.347 flat angles C4'-P-C4' energy: -68.297 flat angles P-C4'-P energy: -44.399 tors. eta vs tors. theta energy: -59.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -869.381657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.381657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.381657 (E_RNA) where: Base-Base interactions energy: -559.969 where: short stacking energy: -250.311 Base-Backbone interact. energy: -1.402 local terms energy: -308.010309 where: bonds (distance) C4'-P energy: -69.486 bonds (distance) P-C4' energy: -55.262 flat angles C4'-P-C4' energy: -65.408 flat angles P-C4'-P energy: -40.262 tors. eta vs tors. theta energy: -77.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -679.001868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.001868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.001868 (E_RNA) where: Base-Base interactions energy: -405.992 where: short stacking energy: -196.433 Base-Backbone interact. energy: -0.311 local terms energy: -272.698699 where: bonds (distance) C4'-P energy: -63.505 bonds (distance) P-C4' energy: -57.450 flat angles C4'-P-C4' energy: -60.397 flat angles P-C4'-P energy: -45.786 tors. eta vs tors. theta energy: -45.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -591.816331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.816331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.816331 (E_RNA) where: Base-Base interactions energy: -345.656 where: short stacking energy: -179.741 Base-Backbone interact. energy: -2.153 local terms energy: -244.007953 where: bonds (distance) C4'-P energy: -55.298 bonds (distance) P-C4' energy: -46.213 flat angles C4'-P-C4' energy: -54.802 flat angles P-C4'-P energy: -33.370 tors. eta vs tors. theta energy: -54.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -506.630794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.630794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.630794 (E_RNA) where: Base-Base interactions energy: -268.450 where: short stacking energy: -143.571 Base-Backbone interact. energy: -0.406 local terms energy: -237.774519 where: bonds (distance) C4'-P energy: -60.167 bonds (distance) P-C4' energy: -54.953 flat angles C4'-P-C4' energy: -63.024 flat angles P-C4'-P energy: -29.259 tors. eta vs tors. theta energy: -30.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -433.621847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.621847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.621847 (E_RNA) where: Base-Base interactions energy: -229.207 where: short stacking energy: -125.840 Base-Backbone interact. energy: 2.030 local terms energy: -206.445428 where: bonds (distance) C4'-P energy: -50.960 bonds (distance) P-C4' energy: -67.033 flat angles C4'-P-C4' energy: -39.066 flat angles P-C4'-P energy: -26.261 tors. eta vs tors. theta energy: -23.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -303.317211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.317211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.317211 (E_RNA) where: Base-Base interactions energy: -137.859 where: short stacking energy: -89.565 Base-Backbone interact. energy: -0.107 local terms energy: -165.350816 where: bonds (distance) C4'-P energy: -52.189 bonds (distance) P-C4' energy: -45.970 flat angles C4'-P-C4' energy: -37.421 flat angles P-C4'-P energy: -32.647 tors. eta vs tors. theta energy: 2.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -324.281952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.281952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.281952 (E_RNA) where: Base-Base interactions energy: -123.017 where: short stacking energy: -75.433 Base-Backbone interact. energy: -0.492 local terms energy: -200.773183 where: bonds (distance) C4'-P energy: -54.084 bonds (distance) P-C4' energy: -54.159 flat angles C4'-P-C4' energy: -49.279 flat angles P-C4'-P energy: -38.778 tors. eta vs tors. theta energy: -4.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -239.409939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.409939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.409939 (E_RNA) where: Base-Base interactions energy: -68.335 where: short stacking energy: -59.594 Base-Backbone interact. energy: 2.058 local terms energy: -173.133163 where: bonds (distance) C4'-P energy: -49.483 bonds (distance) P-C4' energy: -68.751 flat angles C4'-P-C4' energy: -33.712 flat angles P-C4'-P energy: -37.287 tors. eta vs tors. theta energy: 16.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -889.540153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.540153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.540153 (E_RNA) where: Base-Base interactions energy: -590.702 where: short stacking energy: -231.324 Base-Backbone interact. energy: -3.169 local terms energy: -295.669571 where: bonds (distance) C4'-P energy: -70.668 bonds (distance) P-C4' energy: -66.892 flat angles C4'-P-C4' energy: -65.487 flat angles P-C4'-P energy: -40.351 tors. eta vs tors. theta energy: -52.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -900.458845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.458845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.458845 (E_RNA) where: Base-Base interactions energy: -584.948 where: short stacking energy: -253.393 Base-Backbone interact. energy: -1.005 local terms energy: -314.505906 where: bonds (distance) C4'-P energy: -59.012 bonds (distance) P-C4' energy: -63.052 flat angles C4'-P-C4' energy: -69.747 flat angles P-C4'-P energy: -44.763 tors. eta vs tors. theta energy: -77.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -805.701556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.701556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.701556 (E_RNA) where: Base-Base interactions energy: -502.981 where: short stacking energy: -225.242 Base-Backbone interact. energy: -2.123 local terms energy: -300.597756 where: bonds (distance) C4'-P energy: -59.051 bonds (distance) P-C4' energy: -61.211 flat angles C4'-P-C4' energy: -66.399 flat angles P-C4'-P energy: -45.258 tors. eta vs tors. theta energy: -68.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -668.057720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.057720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.057720 (E_RNA) where: Base-Base interactions energy: -386.758 where: short stacking energy: -193.761 Base-Backbone interact. energy: -2.017 local terms energy: -279.282233 where: bonds (distance) C4'-P energy: -66.666 bonds (distance) P-C4' energy: -67.928 flat angles C4'-P-C4' energy: -69.522 flat angles P-C4'-P energy: -29.837 tors. eta vs tors. theta energy: -45.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -681.390287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.390287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.390287 (E_RNA) where: Base-Base interactions energy: -410.208 where: short stacking energy: -209.929 Base-Backbone interact. energy: 2.905 local terms energy: -274.087686 where: bonds (distance) C4'-P energy: -65.301 bonds (distance) P-C4' energy: -54.948 flat angles C4'-P-C4' energy: -59.032 flat angles P-C4'-P energy: -43.790 tors. eta vs tors. theta energy: -51.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -548.975507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.975507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.975507 (E_RNA) where: Base-Base interactions energy: -299.884 where: short stacking energy: -153.305 Base-Backbone interact. energy: -1.685 local terms energy: -247.406250 where: bonds (distance) C4'-P energy: -59.515 bonds (distance) P-C4' energy: -67.874 flat angles C4'-P-C4' energy: -55.735 flat angles P-C4'-P energy: -42.624 tors. eta vs tors. theta energy: -21.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -464.373608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.373608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.373608 (E_RNA) where: Base-Base interactions energy: -241.439 where: short stacking energy: -152.854 Base-Backbone interact. energy: -0.710 local terms energy: -222.224863 where: bonds (distance) C4'-P energy: -48.490 bonds (distance) P-C4' energy: -59.135 flat angles C4'-P-C4' energy: -48.669 flat angles P-C4'-P energy: -38.058 tors. eta vs tors. theta energy: -27.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -357.740614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.740614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.740614 (E_RNA) where: Base-Base interactions energy: -171.533 where: short stacking energy: -81.772 Base-Backbone interact. energy: -1.338 local terms energy: -184.869930 where: bonds (distance) C4'-P energy: -60.131 bonds (distance) P-C4' energy: -63.509 flat angles C4'-P-C4' energy: -45.340 flat angles P-C4'-P energy: -18.091 tors. eta vs tors. theta energy: 2.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -272.078518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.078518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.078518 (E_RNA) where: Base-Base interactions energy: -91.896 where: short stacking energy: -86.491 Base-Backbone interact. energy: 2.068 local terms energy: -182.250480 where: bonds (distance) C4'-P energy: -51.802 bonds (distance) P-C4' energy: -58.386 flat angles C4'-P-C4' energy: -51.753 flat angles P-C4'-P energy: -26.780 tors. eta vs tors. theta energy: 6.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -264.759656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.759656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.759656 (E_RNA) where: Base-Base interactions energy: -113.012 where: short stacking energy: -69.355 Base-Backbone interact. energy: 1.986 local terms energy: -153.733430 where: bonds (distance) C4'-P energy: -46.220 bonds (distance) P-C4' energy: -41.459 flat angles C4'-P-C4' energy: -37.082 flat angles P-C4'-P energy: -30.309 tors. eta vs tors. theta energy: 1.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -889.050081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.050081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.050081 (E_RNA) where: Base-Base interactions energy: -596.273 where: short stacking energy: -254.820 Base-Backbone interact. energy: -2.664 local terms energy: -290.113160 where: bonds (distance) C4'-P energy: -68.947 bonds (distance) P-C4' energy: -66.331 flat angles C4'-P-C4' energy: -54.110 flat angles P-C4'-P energy: -37.606 tors. eta vs tors. theta energy: -63.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -879.756993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.756993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.756993 (E_RNA) where: Base-Base interactions energy: -571.669 where: short stacking energy: -246.359 Base-Backbone interact. energy: 0.763 local terms energy: -308.850973 where: bonds (distance) C4'-P energy: -60.508 bonds (distance) P-C4' energy: -63.997 flat angles C4'-P-C4' energy: -65.597 flat angles P-C4'-P energy: -42.422 tors. eta vs tors. theta energy: -76.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -816.849749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.849749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.849749 (E_RNA) where: Base-Base interactions energy: -522.218 where: short stacking energy: -220.093 Base-Backbone interact. energy: -1.633 local terms energy: -292.998707 where: bonds (distance) C4'-P energy: -54.232 bonds (distance) P-C4' energy: -68.705 flat angles C4'-P-C4' energy: -71.050 flat angles P-C4'-P energy: -37.613 tors. eta vs tors. theta energy: -61.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -659.868686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.868686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.868686 (E_RNA) where: Base-Base interactions energy: -403.686 where: short stacking energy: -195.299 Base-Backbone interact. energy: -1.224 local terms energy: -254.958856 where: bonds (distance) C4'-P energy: -54.711 bonds (distance) P-C4' energy: -68.239 flat angles C4'-P-C4' energy: -58.361 flat angles P-C4'-P energy: -36.857 tors. eta vs tors. theta energy: -36.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -680.231975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.231975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.231975 (E_RNA) where: Base-Base interactions energy: -429.921 where: short stacking energy: -203.039 Base-Backbone interact. energy: -0.747 local terms energy: -249.564206 where: bonds (distance) C4'-P energy: -50.828 bonds (distance) P-C4' energy: -57.534 flat angles C4'-P-C4' energy: -59.881 flat angles P-C4'-P energy: -36.716 tors. eta vs tors. theta energy: -44.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -489.503833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.503833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.503833 (E_RNA) where: Base-Base interactions energy: -260.042 where: short stacking energy: -150.367 Base-Backbone interact. energy: -1.246 local terms energy: -228.215586 where: bonds (distance) C4'-P energy: -53.348 bonds (distance) P-C4' energy: -46.809 flat angles C4'-P-C4' energy: -55.274 flat angles P-C4'-P energy: -40.096 tors. eta vs tors. theta energy: -32.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -451.648541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.648541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.648541 (E_RNA) where: Base-Base interactions energy: -224.647 where: short stacking energy: -131.402 Base-Backbone interact. energy: -1.540 local terms energy: -225.461581 where: bonds (distance) C4'-P energy: -63.412 bonds (distance) P-C4' energy: -57.722 flat angles C4'-P-C4' energy: -43.196 flat angles P-C4'-P energy: -37.642 tors. eta vs tors. theta energy: -23.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -353.230348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.230348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.230348 (E_RNA) where: Base-Base interactions energy: -178.295 where: short stacking energy: -104.285 Base-Backbone interact. energy: -0.502 local terms energy: -174.433613 where: bonds (distance) C4'-P energy: -41.810 bonds (distance) P-C4' energy: -52.588 flat angles C4'-P-C4' energy: -64.835 flat angles P-C4'-P energy: -20.675 tors. eta vs tors. theta energy: 5.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -261.546560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.546560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.546560 (E_RNA) where: Base-Base interactions energy: -72.254 where: short stacking energy: -57.414 Base-Backbone interact. energy: 4.640 local terms energy: -193.932380 where: bonds (distance) C4'-P energy: -54.414 bonds (distance) P-C4' energy: -67.417 flat angles C4'-P-C4' energy: -41.994 flat angles P-C4'-P energy: -35.109 tors. eta vs tors. theta energy: 5.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -269.185095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.185095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.185095 (E_RNA) where: Base-Base interactions energy: -79.870 where: short stacking energy: -67.137 Base-Backbone interact. energy: -1.040 local terms energy: -188.275115 where: bonds (distance) C4'-P energy: -57.648 bonds (distance) P-C4' energy: -56.494 flat angles C4'-P-C4' energy: -43.917 flat angles P-C4'-P energy: -33.301 tors. eta vs tors. theta energy: 3.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -872.243542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.243542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.243542 (E_RNA) where: Base-Base interactions energy: -568.270 where: short stacking energy: -229.174 Base-Backbone interact. energy: -3.229 local terms energy: -300.743935 where: bonds (distance) C4'-P energy: -68.985 bonds (distance) P-C4' energy: -61.013 flat angles C4'-P-C4' energy: -59.899 flat angles P-C4'-P energy: -46.221 tors. eta vs tors. theta energy: -64.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -872.712085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.712085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.712085 (E_RNA) where: Base-Base interactions energy: -585.396 where: short stacking energy: -215.527 Base-Backbone interact. energy: 3.737 local terms energy: -291.053486 where: bonds (distance) C4'-P energy: -68.263 bonds (distance) P-C4' energy: -61.978 flat angles C4'-P-C4' energy: -60.293 flat angles P-C4'-P energy: -39.089 tors. eta vs tors. theta energy: -61.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -843.307403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.307403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.307403 (E_RNA) where: Base-Base interactions energy: -544.683 where: short stacking energy: -229.319 Base-Backbone interact. energy: -1.209 local terms energy: -297.415338 where: bonds (distance) C4'-P energy: -58.583 bonds (distance) P-C4' energy: -61.995 flat angles C4'-P-C4' energy: -70.590 flat angles P-C4'-P energy: -40.733 tors. eta vs tors. theta energy: -65.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -745.249692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.249692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.249692 (E_RNA) where: Base-Base interactions energy: -471.762 where: short stacking energy: -220.346 Base-Backbone interact. energy: 1.081 local terms energy: -274.568756 where: bonds (distance) C4'-P energy: -60.215 bonds (distance) P-C4' energy: -55.990 flat angles C4'-P-C4' energy: -55.503 flat angles P-C4'-P energy: -41.477 tors. eta vs tors. theta energy: -61.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -618.815547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.815547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.815547 (E_RNA) where: Base-Base interactions energy: -378.966 where: short stacking energy: -172.631 Base-Backbone interact. energy: -0.492 local terms energy: -239.357227 where: bonds (distance) C4'-P energy: -58.412 bonds (distance) P-C4' energy: -49.307 flat angles C4'-P-C4' energy: -60.041 flat angles P-C4'-P energy: -37.774 tors. eta vs tors. theta energy: -33.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -565.166377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.166377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.166377 (E_RNA) where: Base-Base interactions energy: -338.923 where: short stacking energy: -175.029 Base-Backbone interact. energy: -0.614 local terms energy: -225.629608 where: bonds (distance) C4'-P energy: -40.860 bonds (distance) P-C4' energy: -66.625 flat angles C4'-P-C4' energy: -55.711 flat angles P-C4'-P energy: -35.049 tors. eta vs tors. theta energy: -27.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -408.988252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.988252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.988252 (E_RNA) where: Base-Base interactions energy: -205.831 where: short stacking energy: -101.244 Base-Backbone interact. energy: -1.055 local terms energy: -202.103048 where: bonds (distance) C4'-P energy: -55.592 bonds (distance) P-C4' energy: -53.407 flat angles C4'-P-C4' energy: -44.969 flat angles P-C4'-P energy: -40.553 tors. eta vs tors. theta energy: -7.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -320.864231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.864231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.864231 (E_RNA) where: Base-Base interactions energy: -134.085 where: short stacking energy: -91.988 Base-Backbone interact. energy: -1.430 local terms energy: -185.349155 where: bonds (distance) C4'-P energy: -56.238 bonds (distance) P-C4' energy: -48.407 flat angles C4'-P-C4' energy: -54.241 flat angles P-C4'-P energy: -27.850 tors. eta vs tors. theta energy: 1.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -285.974955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.974955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.974955 (E_RNA) where: Base-Base interactions energy: -118.088 where: short stacking energy: -94.243 Base-Backbone interact. energy: 1.493 local terms energy: -169.380047 where: bonds (distance) C4'-P energy: -40.706 bonds (distance) P-C4' energy: -62.189 flat angles C4'-P-C4' energy: -45.571 flat angles P-C4'-P energy: -23.036 tors. eta vs tors. theta energy: 2.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -267.951537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.951537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.951537 (E_RNA) where: Base-Base interactions energy: -98.263 where: short stacking energy: -59.192 Base-Backbone interact. energy: -0.346 local terms energy: -169.342667 where: bonds (distance) C4'-P energy: -47.751 bonds (distance) P-C4' energy: -46.477 flat angles C4'-P-C4' energy: -54.575 flat angles P-C4'-P energy: -28.872 tors. eta vs tors. theta energy: 8.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -898.010165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.010165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.010165 (E_RNA) where: Base-Base interactions energy: -588.012 where: short stacking energy: -254.816 Base-Backbone interact. energy: -5.374 local terms energy: -304.624338 where: bonds (distance) C4'-P energy: -67.485 bonds (distance) P-C4' energy: -59.208 flat angles C4'-P-C4' energy: -66.245 flat angles P-C4'-P energy: -48.089 tors. eta vs tors. theta energy: -63.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -916.580666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.580666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.580666 (E_RNA) where: Base-Base interactions energy: -607.913 where: short stacking energy: -238.930 Base-Backbone interact. energy: -1.872 local terms energy: -306.796207 where: bonds (distance) C4'-P energy: -60.160 bonds (distance) P-C4' energy: -62.551 flat angles C4'-P-C4' energy: -72.161 flat angles P-C4'-P energy: -48.037 tors. eta vs tors. theta energy: -63.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -821.853202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.853202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.853202 (E_RNA) where: Base-Base interactions energy: -556.519 where: short stacking energy: -231.140 Base-Backbone interact. energy: 0.521 local terms energy: -265.854986 where: bonds (distance) C4'-P energy: -45.152 bonds (distance) P-C4' energy: -55.533 flat angles C4'-P-C4' energy: -59.743 flat angles P-C4'-P energy: -43.757 tors. eta vs tors. theta energy: -61.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -759.725727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.725727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.725727 (E_RNA) where: Base-Base interactions energy: -463.929 where: short stacking energy: -226.543 Base-Backbone interact. energy: -1.427 local terms energy: -294.369253 where: bonds (distance) C4'-P energy: -56.644 bonds (distance) P-C4' energy: -66.951 flat angles C4'-P-C4' energy: -63.813 flat angles P-C4'-P energy: -44.008 tors. eta vs tors. theta energy: -62.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -614.830237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.830237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.830237 (E_RNA) where: Base-Base interactions energy: -393.402 where: short stacking energy: -155.730 Base-Backbone interact. energy: -1.244 local terms energy: -220.184024 where: bonds (distance) C4'-P energy: -54.640 bonds (distance) P-C4' energy: -57.758 flat angles C4'-P-C4' energy: -48.246 flat angles P-C4'-P energy: -39.038 tors. eta vs tors. theta energy: -20.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -566.866422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.866422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.866422 (E_RNA) where: Base-Base interactions energy: -333.780 where: short stacking energy: -160.332 Base-Backbone interact. energy: 8.298 local terms energy: -241.384693 where: bonds (distance) C4'-P energy: -58.648 bonds (distance) P-C4' energy: -65.432 flat angles C4'-P-C4' energy: -33.362 flat angles P-C4'-P energy: -35.452 tors. eta vs tors. theta energy: -48.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -415.532477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.532477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.532477 (E_RNA) where: Base-Base interactions energy: -203.494 where: short stacking energy: -125.744 Base-Backbone interact. energy: -0.021 local terms energy: -212.016792 where: bonds (distance) C4'-P energy: -51.572 bonds (distance) P-C4' energy: -53.470 flat angles C4'-P-C4' energy: -56.013 flat angles P-C4'-P energy: -28.356 tors. eta vs tors. theta energy: -22.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -292.842998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.842998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.842998 (E_RNA) where: Base-Base interactions energy: -100.365 where: short stacking energy: -83.348 Base-Backbone interact. energy: 1.326 local terms energy: -193.803952 where: bonds (distance) C4'-P energy: -59.720 bonds (distance) P-C4' energy: -58.222 flat angles C4'-P-C4' energy: -46.885 flat angles P-C4'-P energy: -23.540 tors. eta vs tors. theta energy: -5.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -285.899495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.899495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.899495 (E_RNA) where: Base-Base interactions energy: -110.359 where: short stacking energy: -65.484 Base-Backbone interact. energy: 1.394 local terms energy: -176.934405 where: bonds (distance) C4'-P energy: -47.704 bonds (distance) P-C4' energy: -63.604 flat angles C4'-P-C4' energy: -33.693 flat angles P-C4'-P energy: -34.144 tors. eta vs tors. theta energy: 2.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -260.163348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.163348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.163348 (E_RNA) where: Base-Base interactions energy: -79.644 where: short stacking energy: -55.579 Base-Backbone interact. energy: 1.287 local terms energy: -181.805658 where: bonds (distance) C4'-P energy: -55.782 bonds (distance) P-C4' energy: -66.256 flat angles C4'-P-C4' energy: -45.370 flat angles P-C4'-P energy: -24.694 tors. eta vs tors. theta energy: 10.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -885.207606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.207606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.207606 (E_RNA) where: Base-Base interactions energy: -585.286 where: short stacking energy: -243.177 Base-Backbone interact. energy: 1.138 local terms energy: -301.059827 where: bonds (distance) C4'-P energy: -52.367 bonds (distance) P-C4' energy: -62.184 flat angles C4'-P-C4' energy: -74.270 flat angles P-C4'-P energy: -47.330 tors. eta vs tors. theta energy: -64.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -910.091401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.091401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.091401 (E_RNA) where: Base-Base interactions energy: -614.810 where: short stacking energy: -258.780 Base-Backbone interact. energy: -1.668 local terms energy: -293.613697 where: bonds (distance) C4'-P energy: -57.707 bonds (distance) P-C4' energy: -62.436 flat angles C4'-P-C4' energy: -65.123 flat angles P-C4'-P energy: -42.862 tors. eta vs tors. theta energy: -65.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -831.909840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.909840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.909840 (E_RNA) where: Base-Base interactions energy: -517.542 where: short stacking energy: -218.797 Base-Backbone interact. energy: -1.381 local terms energy: -312.986983 where: bonds (distance) C4'-P energy: -58.195 bonds (distance) P-C4' energy: -68.613 flat angles C4'-P-C4' energy: -68.708 flat angles P-C4'-P energy: -53.130 tors. eta vs tors. theta energy: -64.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -722.240101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.240101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.240101 (E_RNA) where: Base-Base interactions energy: -442.929 where: short stacking energy: -222.421 Base-Backbone interact. energy: -0.339 local terms energy: -278.972879 where: bonds (distance) C4'-P energy: -45.725 bonds (distance) P-C4' energy: -62.465 flat angles C4'-P-C4' energy: -60.072 flat angles P-C4'-P energy: -52.117 tors. eta vs tors. theta energy: -58.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -706.947898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.947898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.947898 (E_RNA) where: Base-Base interactions energy: -446.017 where: short stacking energy: -192.041 Base-Backbone interact. energy: -1.021 local terms energy: -259.909642 where: bonds (distance) C4'-P energy: -62.732 bonds (distance) P-C4' energy: -59.906 flat angles C4'-P-C4' energy: -56.869 flat angles P-C4'-P energy: -31.719 tors. eta vs tors. theta energy: -48.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -564.391378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.391378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.391378 (E_RNA) where: Base-Base interactions energy: -312.074 where: short stacking energy: -162.495 Base-Backbone interact. energy: -0.063 local terms energy: -252.254596 where: bonds (distance) C4'-P energy: -60.316 bonds (distance) P-C4' energy: -61.100 flat angles C4'-P-C4' energy: -64.241 flat angles P-C4'-P energy: -33.568 tors. eta vs tors. theta energy: -33.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -457.351994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.351994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.351994 (E_RNA) where: Base-Base interactions energy: -246.569 where: short stacking energy: -143.746 Base-Backbone interact. energy: -0.602 local terms energy: -210.181767 where: bonds (distance) C4'-P energy: -49.214 bonds (distance) P-C4' energy: -54.279 flat angles C4'-P-C4' energy: -46.065 flat angles P-C4'-P energy: -38.554 tors. eta vs tors. theta energy: -22.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -300.601930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.601930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.601930 (E_RNA) where: Base-Base interactions energy: -107.697 where: short stacking energy: -90.930 Base-Backbone interact. energy: -0.173 local terms energy: -192.732048 where: bonds (distance) C4'-P energy: -50.189 bonds (distance) P-C4' energy: -56.176 flat angles C4'-P-C4' energy: -50.315 flat angles P-C4'-P energy: -20.810 tors. eta vs tors. theta energy: -15.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -317.502746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.502746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.502746 (E_RNA) where: Base-Base interactions energy: -138.279 where: short stacking energy: -83.413 Base-Backbone interact. energy: -1.279 local terms energy: -177.945073 where: bonds (distance) C4'-P energy: -51.786 bonds (distance) P-C4' energy: -42.676 flat angles C4'-P-C4' energy: -58.379 flat angles P-C4'-P energy: -35.151 tors. eta vs tors. theta energy: 10.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -264.403596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.403596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.403596 (E_RNA) where: Base-Base interactions energy: -88.783 where: short stacking energy: -72.572 Base-Backbone interact. energy: -2.397 local terms energy: -173.223727 where: bonds (distance) C4'-P energy: -58.412 bonds (distance) P-C4' energy: -61.614 flat angles C4'-P-C4' energy: -40.505 flat angles P-C4'-P energy: -22.624 tors. eta vs tors. theta energy: 9.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -940.878801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.878801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.878801 (E_RNA) where: Base-Base interactions energy: -612.709 where: short stacking energy: -265.135 Base-Backbone interact. energy: -0.112 local terms energy: -328.057558 where: bonds (distance) C4'-P energy: -60.695 bonds (distance) P-C4' energy: -67.918 flat angles C4'-P-C4' energy: -70.536 flat angles P-C4'-P energy: -48.349 tors. eta vs tors. theta energy: -80.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -861.563957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.563957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.563957 (E_RNA) where: Base-Base interactions energy: -567.616 where: short stacking energy: -244.570 Base-Backbone interact. energy: 3.389 local terms energy: -297.337404 where: bonds (distance) C4'-P energy: -61.203 bonds (distance) P-C4' energy: -62.299 flat angles C4'-P-C4' energy: -63.791 flat angles P-C4'-P energy: -49.258 tors. eta vs tors. theta energy: -60.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -808.299215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.299215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.299215 (E_RNA) where: Base-Base interactions energy: -509.727 where: short stacking energy: -198.261 Base-Backbone interact. energy: -4.607 local terms energy: -293.964523 where: bonds (distance) C4'-P energy: -57.382 bonds (distance) P-C4' energy: -61.889 flat angles C4'-P-C4' energy: -72.374 flat angles P-C4'-P energy: -44.303 tors. eta vs tors. theta energy: -58.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -731.473736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.473736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.473736 (E_RNA) where: Base-Base interactions energy: -456.401 where: short stacking energy: -218.578 Base-Backbone interact. energy: -1.037 local terms energy: -274.035321 where: bonds (distance) C4'-P energy: -54.391 bonds (distance) P-C4' energy: -64.532 flat angles C4'-P-C4' energy: -54.975 flat angles P-C4'-P energy: -36.028 tors. eta vs tors. theta energy: -64.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -681.102847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.102847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.102847 (E_RNA) where: Base-Base interactions energy: -419.995 where: short stacking energy: -181.184 Base-Backbone interact. energy: -0.220 local terms energy: -260.888053 where: bonds (distance) C4'-P energy: -59.337 bonds (distance) P-C4' energy: -64.732 flat angles C4'-P-C4' energy: -57.307 flat angles P-C4'-P energy: -27.803 tors. eta vs tors. theta energy: -51.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -560.314479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.314479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.314479 (E_RNA) where: Base-Base interactions energy: -304.007 where: short stacking energy: -154.055 Base-Backbone interact. energy: -0.706 local terms energy: -255.601516 where: bonds (distance) C4'-P energy: -60.003 bonds (distance) P-C4' energy: -72.209 flat angles C4'-P-C4' energy: -61.267 flat angles P-C4'-P energy: -25.747 tors. eta vs tors. theta energy: -36.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -494.065830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.065830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.065830 (E_RNA) where: Base-Base interactions energy: -276.224 where: short stacking energy: -125.486 Base-Backbone interact. energy: 2.097 local terms energy: -219.938622 where: bonds (distance) C4'-P energy: -49.221 bonds (distance) P-C4' energy: -55.887 flat angles C4'-P-C4' energy: -57.577 flat angles P-C4'-P energy: -34.688 tors. eta vs tors. theta energy: -22.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -312.105460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.105460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.105460 (E_RNA) where: Base-Base interactions energy: -123.843 where: short stacking energy: -81.864 Base-Backbone interact. energy: -2.397 local terms energy: -185.865215 where: bonds (distance) C4'-P energy: -43.251 bonds (distance) P-C4' energy: -58.917 flat angles C4'-P-C4' energy: -51.803 flat angles P-C4'-P energy: -29.098 tors. eta vs tors. theta energy: -2.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -332.357083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.357083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.357083 (E_RNA) where: Base-Base interactions energy: -151.120 where: short stacking energy: -88.172 Base-Backbone interact. energy: -1.086 local terms energy: -180.151191 where: bonds (distance) C4'-P energy: -63.969 bonds (distance) P-C4' energy: -46.418 flat angles C4'-P-C4' energy: -44.971 flat angles P-C4'-P energy: -38.768 tors. eta vs tors. theta energy: 13.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -255.599436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.599436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.599436 (E_RNA) where: Base-Base interactions energy: -95.788 where: short stacking energy: -72.998 Base-Backbone interact. energy: 3.416 local terms energy: -163.228176 where: bonds (distance) C4'-P energy: -37.543 bonds (distance) P-C4' energy: -59.151 flat angles C4'-P-C4' energy: -45.270 flat angles P-C4'-P energy: -26.173 tors. eta vs tors. theta energy: 4.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -941.345649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.345649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.345649 (E_RNA) where: Base-Base interactions energy: -633.646 where: short stacking energy: -253.224 Base-Backbone interact. energy: -1.707 local terms energy: -305.993374 where: bonds (distance) C4'-P energy: -64.622 bonds (distance) P-C4' energy: -62.625 flat angles C4'-P-C4' energy: -59.896 flat angles P-C4'-P energy: -44.236 tors. eta vs tors. theta energy: -74.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -856.858217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.858217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.858217 (E_RNA) where: Base-Base interactions energy: -552.541 where: short stacking energy: -247.287 Base-Backbone interact. energy: -0.628 local terms energy: -303.688940 where: bonds (distance) C4'-P energy: -62.934 bonds (distance) P-C4' energy: -62.888 flat angles C4'-P-C4' energy: -70.337 flat angles P-C4'-P energy: -44.086 tors. eta vs tors. theta energy: -63.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -816.434253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.434253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.434253 (E_RNA) where: Base-Base interactions energy: -532.104 where: short stacking energy: -208.540 Base-Backbone interact. energy: -1.805 local terms energy: -282.524664 where: bonds (distance) C4'-P energy: -50.996 bonds (distance) P-C4' energy: -62.695 flat angles C4'-P-C4' energy: -57.878 flat angles P-C4'-P energy: -50.864 tors. eta vs tors. theta energy: -60.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -706.148103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.148103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.148103 (E_RNA) where: Base-Base interactions energy: -452.543 where: short stacking energy: -204.189 Base-Backbone interact. energy: -0.557 local terms energy: -253.048009 where: bonds (distance) C4'-P energy: -41.212 bonds (distance) P-C4' energy: -55.829 flat angles C4'-P-C4' energy: -60.657 flat angles P-C4'-P energy: -43.680 tors. eta vs tors. theta energy: -51.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -652.383266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.383266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.383266 (E_RNA) where: Base-Base interactions energy: -408.344 where: short stacking energy: -182.349 Base-Backbone interact. energy: -2.447 local terms energy: -241.592382 where: bonds (distance) C4'-P energy: -44.943 bonds (distance) P-C4' energy: -62.787 flat angles C4'-P-C4' energy: -50.344 flat angles P-C4'-P energy: -44.931 tors. eta vs tors. theta energy: -38.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -573.891269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.891269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.891269 (E_RNA) where: Base-Base interactions energy: -340.635 where: short stacking energy: -155.975 Base-Backbone interact. energy: 3.265 local terms energy: -236.521261 where: bonds (distance) C4'-P energy: -53.232 bonds (distance) P-C4' energy: -55.759 flat angles C4'-P-C4' energy: -58.219 flat angles P-C4'-P energy: -46.286 tors. eta vs tors. theta energy: -23.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -454.787853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.787853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.787853 (E_RNA) where: Base-Base interactions energy: -224.253 where: short stacking energy: -133.441 Base-Backbone interact. energy: 1.401 local terms energy: -231.935553 where: bonds (distance) C4'-P energy: -60.618 bonds (distance) P-C4' energy: -67.306 flat angles C4'-P-C4' energy: -54.454 flat angles P-C4'-P energy: -35.833 tors. eta vs tors. theta energy: -13.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -342.060782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.060782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.060782 (E_RNA) where: Base-Base interactions energy: -171.961 where: short stacking energy: -88.472 Base-Backbone interact. energy: 0.420 local terms energy: -170.519528 where: bonds (distance) C4'-P energy: -51.300 bonds (distance) P-C4' energy: -55.710 flat angles C4'-P-C4' energy: -40.719 flat angles P-C4'-P energy: -32.433 tors. eta vs tors. theta energy: 9.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -304.517511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.517511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.517511 (E_RNA) where: Base-Base interactions energy: -112.897 where: short stacking energy: -69.578 Base-Backbone interact. energy: 1.087 local terms energy: -192.708024 where: bonds (distance) C4'-P energy: -56.674 bonds (distance) P-C4' energy: -57.738 flat angles C4'-P-C4' energy: -50.276 flat angles P-C4'-P energy: -37.618 tors. eta vs tors. theta energy: 9.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -259.493175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.493175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.493175 (E_RNA) where: Base-Base interactions energy: -102.749 where: short stacking energy: -62.855 Base-Backbone interact. energy: -0.784 local terms energy: -155.959593 where: bonds (distance) C4'-P energy: -51.748 bonds (distance) P-C4' energy: -47.935 flat angles C4'-P-C4' energy: -40.269 flat angles P-C4'-P energy: -21.079 tors. eta vs tors. theta energy: 5.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -944.138607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.138607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.138607 (E_RNA) where: Base-Base interactions energy: -628.790 where: short stacking energy: -265.471 Base-Backbone interact. energy: -1.794 local terms energy: -313.554260 where: bonds (distance) C4'-P energy: -60.657 bonds (distance) P-C4' energy: -61.964 flat angles C4'-P-C4' energy: -71.809 flat angles P-C4'-P energy: -38.751 tors. eta vs tors. theta energy: -80.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -889.763901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.763901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.763901 (E_RNA) where: Base-Base interactions energy: -593.518 where: short stacking energy: -230.349 Base-Backbone interact. energy: -3.232 local terms energy: -293.013085 where: bonds (distance) C4'-P energy: -58.409 bonds (distance) P-C4' energy: -62.438 flat angles C4'-P-C4' energy: -68.688 flat angles P-C4'-P energy: -47.825 tors. eta vs tors. theta energy: -55.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -849.003589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.003589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.003589 (E_RNA) where: Base-Base interactions energy: -568.185 where: short stacking energy: -227.758 Base-Backbone interact. energy: -1.513 local terms energy: -279.305534 where: bonds (distance) C4'-P energy: -49.787 bonds (distance) P-C4' energy: -56.809 flat angles C4'-P-C4' energy: -70.133 flat angles P-C4'-P energy: -38.210 tors. eta vs tors. theta energy: -64.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -689.200717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.200717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.200717 (E_RNA) where: Base-Base interactions energy: -413.853 where: short stacking energy: -195.820 Base-Backbone interact. energy: -1.978 local terms energy: -273.369669 where: bonds (distance) C4'-P energy: -55.951 bonds (distance) P-C4' energy: -66.058 flat angles C4'-P-C4' energy: -60.803 flat angles P-C4'-P energy: -41.493 tors. eta vs tors. theta energy: -49.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -613.978632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.978632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.978632 (E_RNA) where: Base-Base interactions energy: -372.591 where: short stacking energy: -161.391 Base-Backbone interact. energy: -0.737 local terms energy: -240.650592 where: bonds (distance) C4'-P energy: -63.354 bonds (distance) P-C4' energy: -56.893 flat angles C4'-P-C4' energy: -43.106 flat angles P-C4'-P energy: -36.978 tors. eta vs tors. theta energy: -40.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -581.713308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.713308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.713308 (E_RNA) where: Base-Base interactions energy: -340.819 where: short stacking energy: -158.717 Base-Backbone interact. energy: 1.814 local terms energy: -242.708314 where: bonds (distance) C4'-P energy: -58.012 bonds (distance) P-C4' energy: -57.922 flat angles C4'-P-C4' energy: -54.135 flat angles P-C4'-P energy: -38.447 tors. eta vs tors. theta energy: -34.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -455.651330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.651330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.651330 (E_RNA) where: Base-Base interactions energy: -234.561 where: short stacking energy: -139.633 Base-Backbone interact. energy: -0.820 local terms energy: -220.270978 where: bonds (distance) C4'-P energy: -51.911 bonds (distance) P-C4' energy: -55.779 flat angles C4'-P-C4' energy: -50.767 flat angles P-C4'-P energy: -35.705 tors. eta vs tors. theta energy: -26.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -304.699031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.699031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.699031 (E_RNA) where: Base-Base interactions energy: -118.912 where: short stacking energy: -90.553 Base-Backbone interact. energy: -0.705 local terms energy: -185.081377 where: bonds (distance) C4'-P energy: -48.548 bonds (distance) P-C4' energy: -55.146 flat angles C4'-P-C4' energy: -42.264 flat angles P-C4'-P energy: -35.572 tors. eta vs tors. theta energy: -3.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -280.324586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.324586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.324586 (E_RNA) where: Base-Base interactions energy: -121.352 where: short stacking energy: -80.430 Base-Backbone interact. energy: 1.021 local terms energy: -159.993560 where: bonds (distance) C4'-P energy: -53.486 bonds (distance) P-C4' energy: -54.802 flat angles C4'-P-C4' energy: -41.598 flat angles P-C4'-P energy: -22.975 tors. eta vs tors. theta energy: 12.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -240.344375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.344375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.344375 (E_RNA) where: Base-Base interactions energy: -80.224 where: short stacking energy: -60.214 Base-Backbone interact. energy: 1.443 local terms energy: -161.563368 where: bonds (distance) C4'-P energy: -49.025 bonds (distance) P-C4' energy: -53.718 flat angles C4'-P-C4' energy: -40.459 flat angles P-C4'-P energy: -34.038 tors. eta vs tors. theta energy: 15.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -948.221353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.221353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.221353 (E_RNA) where: Base-Base interactions energy: -631.649 where: short stacking energy: -260.524 Base-Backbone interact. energy: -2.761 local terms energy: -313.810948 where: bonds (distance) C4'-P energy: -63.951 bonds (distance) P-C4' energy: -64.434 flat angles C4'-P-C4' energy: -65.284 flat angles P-C4'-P energy: -46.033 tors. eta vs tors. theta energy: -74.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -871.922953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.922953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.922953 (E_RNA) where: Base-Base interactions energy: -584.435 where: short stacking energy: -233.363 Base-Backbone interact. energy: -2.085 local terms energy: -285.402881 where: bonds (distance) C4'-P energy: -56.794 bonds (distance) P-C4' energy: -54.817 flat angles C4'-P-C4' energy: -68.190 flat angles P-C4'-P energy: -43.065 tors. eta vs tors. theta energy: -62.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -836.445297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.445297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.445297 (E_RNA) where: Base-Base interactions energy: -539.464 where: short stacking energy: -215.499 Base-Backbone interact. energy: -0.927 local terms energy: -296.054261 where: bonds (distance) C4'-P energy: -64.926 bonds (distance) P-C4' energy: -63.360 flat angles C4'-P-C4' energy: -57.584 flat angles P-C4'-P energy: -46.758 tors. eta vs tors. theta energy: -63.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -713.757332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.757332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.757332 (E_RNA) where: Base-Base interactions energy: -459.138 where: short stacking energy: -219.722 Base-Backbone interact. energy: -0.976 local terms energy: -253.643238 where: bonds (distance) C4'-P energy: -48.424 bonds (distance) P-C4' energy: -57.523 flat angles C4'-P-C4' energy: -53.189 flat angles P-C4'-P energy: -44.163 tors. eta vs tors. theta energy: -50.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -671.622888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.622888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.622888 (E_RNA) where: Base-Base interactions energy: -408.959 where: short stacking energy: -199.814 Base-Backbone interact. energy: -0.599 local terms energy: -262.064688 where: bonds (distance) C4'-P energy: -56.559 bonds (distance) P-C4' energy: -59.020 flat angles C4'-P-C4' energy: -54.368 flat angles P-C4'-P energy: -38.750 tors. eta vs tors. theta energy: -53.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -540.388959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.388959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.388959 (E_RNA) where: Base-Base interactions energy: -284.690 where: short stacking energy: -163.377 Base-Backbone interact. energy: -1.483 local terms energy: -254.215948 where: bonds (distance) C4'-P energy: -59.123 bonds (distance) P-C4' energy: -56.788 flat angles C4'-P-C4' energy: -53.045 flat angles P-C4'-P energy: -40.206 tors. eta vs tors. theta energy: -45.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -454.083994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.083994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.083994 (E_RNA) where: Base-Base interactions energy: -242.208 where: short stacking energy: -144.615 Base-Backbone interact. energy: -0.241 local terms energy: -211.635174 where: bonds (distance) C4'-P energy: -39.692 bonds (distance) P-C4' energy: -56.363 flat angles C4'-P-C4' energy: -51.640 flat angles P-C4'-P energy: -37.162 tors. eta vs tors. theta energy: -26.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -291.904708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.904708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.904708 (E_RNA) where: Base-Base interactions energy: -92.654 where: short stacking energy: -89.566 Base-Backbone interact. energy: -0.021 local terms energy: -199.230260 where: bonds (distance) C4'-P energy: -52.460 bonds (distance) P-C4' energy: -56.541 flat angles C4'-P-C4' energy: -54.300 flat angles P-C4'-P energy: -26.086 tors. eta vs tors. theta energy: -9.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -266.477543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.477543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.477543 (E_RNA) where: Base-Base interactions energy: -91.219 where: short stacking energy: -48.536 Base-Backbone interact. energy: 5.011 local terms energy: -180.269739 where: bonds (distance) C4'-P energy: -49.889 bonds (distance) P-C4' energy: -62.914 flat angles C4'-P-C4' energy: -45.473 flat angles P-C4'-P energy: -31.199 tors. eta vs tors. theta energy: 9.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -244.478338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.478338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.478338 (E_RNA) where: Base-Base interactions energy: -78.161 where: short stacking energy: -65.721 Base-Backbone interact. energy: -0.398 local terms energy: -165.919230 where: bonds (distance) C4'-P energy: -45.289 bonds (distance) P-C4' energy: -60.199 flat angles C4'-P-C4' energy: -35.872 flat angles P-C4'-P energy: -36.890 tors. eta vs tors. theta energy: 12.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -925.843557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.843557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.843557 (E_RNA) where: Base-Base interactions energy: -616.218 where: short stacking energy: -256.614 Base-Backbone interact. energy: -0.982 local terms energy: -308.643602 where: bonds (distance) C4'-P energy: -66.546 bonds (distance) P-C4' energy: -64.486 flat angles C4'-P-C4' energy: -67.657 flat angles P-C4'-P energy: -39.750 tors. eta vs tors. theta energy: -70.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -899.488204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.488204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.488204 (E_RNA) where: Base-Base interactions energy: -581.882 where: short stacking energy: -265.964 Base-Backbone interact. energy: -2.283 local terms energy: -315.323048 where: bonds (distance) C4'-P energy: -59.971 bonds (distance) P-C4' energy: -66.725 flat angles C4'-P-C4' energy: -72.449 flat angles P-C4'-P energy: -48.562 tors. eta vs tors. theta energy: -67.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -869.130153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.130153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.130153 (E_RNA) where: Base-Base interactions energy: -583.505 where: short stacking energy: -232.223 Base-Backbone interact. energy: 0.658 local terms energy: -286.283357 where: bonds (distance) C4'-P energy: -62.940 bonds (distance) P-C4' energy: -56.902 flat angles C4'-P-C4' energy: -67.124 flat angles P-C4'-P energy: -34.129 tors. eta vs tors. theta energy: -65.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -746.096103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.096103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.096103 (E_RNA) where: Base-Base interactions energy: -467.380 where: short stacking energy: -217.307 Base-Backbone interact. energy: -2.602 local terms energy: -276.113485 where: bonds (distance) C4'-P energy: -64.142 bonds (distance) P-C4' energy: -56.309 flat angles C4'-P-C4' energy: -60.677 flat angles P-C4'-P energy: -32.226 tors. eta vs tors. theta energy: -62.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -683.637879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.637879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.637879 (E_RNA) where: Base-Base interactions energy: -405.430 where: short stacking energy: -199.242 Base-Backbone interact. energy: -1.837 local terms energy: -276.371343 where: bonds (distance) C4'-P energy: -49.024 bonds (distance) P-C4' energy: -62.298 flat angles C4'-P-C4' energy: -67.402 flat angles P-C4'-P energy: -41.883 tors. eta vs tors. theta energy: -55.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -501.055074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.055074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.055074 (E_RNA) where: Base-Base interactions energy: -269.790 where: short stacking energy: -138.501 Base-Backbone interact. energy: -2.542 local terms energy: -228.722657 where: bonds (distance) C4'-P energy: -51.646 bonds (distance) P-C4' energy: -59.297 flat angles C4'-P-C4' energy: -51.525 flat angles P-C4'-P energy: -39.235 tors. eta vs tors. theta energy: -27.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -495.882777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.882777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.882777 (E_RNA) where: Base-Base interactions energy: -277.240 where: short stacking energy: -144.925 Base-Backbone interact. energy: -1.863 local terms energy: -216.779749 where: bonds (distance) C4'-P energy: -46.888 bonds (distance) P-C4' energy: -59.125 flat angles C4'-P-C4' energy: -52.301 flat angles P-C4'-P energy: -29.526 tors. eta vs tors. theta energy: -28.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -348.657910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.657910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.657910 (E_RNA) where: Base-Base interactions energy: -132.656 where: short stacking energy: -90.251 Base-Backbone interact. energy: -0.969 local terms energy: -215.032157 where: bonds (distance) C4'-P energy: -55.824 bonds (distance) P-C4' energy: -64.383 flat angles C4'-P-C4' energy: -51.636 flat angles P-C4'-P energy: -38.390 tors. eta vs tors. theta energy: -4.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -261.483624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.483624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.483624 (E_RNA) where: Base-Base interactions energy: -68.448 where: short stacking energy: -59.244 Base-Backbone interact. energy: -1.229 local terms energy: -191.806675 where: bonds (distance) C4'-P energy: -51.461 bonds (distance) P-C4' energy: -62.783 flat angles C4'-P-C4' energy: -52.218 flat angles P-C4'-P energy: -33.316 tors. eta vs tors. theta energy: 7.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -248.260774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.260774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.260774 (E_RNA) where: Base-Base interactions energy: -91.244 where: short stacking energy: -59.919 Base-Backbone interact. energy: -0.144 local terms energy: -156.873024 where: bonds (distance) C4'-P energy: -51.007 bonds (distance) P-C4' energy: -65.601 flat angles C4'-P-C4' energy: -30.229 flat angles P-C4'-P energy: -21.141 tors. eta vs tors. theta energy: 11.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -924.238871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.238871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.238871 (E_RNA) where: Base-Base interactions energy: -602.125 where: short stacking energy: -253.905 Base-Backbone interact. energy: -1.285 local terms energy: -320.828368 where: bonds (distance) C4'-P energy: -49.945 bonds (distance) P-C4' energy: -73.524 flat angles C4'-P-C4' energy: -69.958 flat angles P-C4'-P energy: -43.513 tors. eta vs tors. theta energy: -83.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -886.534849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.534849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.534849 (E_RNA) where: Base-Base interactions energy: -586.865 where: short stacking energy: -237.020 Base-Backbone interact. energy: -1.899 local terms energy: -297.771060 where: bonds (distance) C4'-P energy: -53.794 bonds (distance) P-C4' energy: -65.326 flat angles C4'-P-C4' energy: -74.437 flat angles P-C4'-P energy: -42.327 tors. eta vs tors. theta energy: -61.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -843.918901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.918901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.918901 (E_RNA) where: Base-Base interactions energy: -540.662 where: short stacking energy: -215.873 Base-Backbone interact. energy: -3.182 local terms energy: -300.074382 where: bonds (distance) C4'-P energy: -67.060 bonds (distance) P-C4' energy: -64.634 flat angles C4'-P-C4' energy: -62.097 flat angles P-C4'-P energy: -41.779 tors. eta vs tors. theta energy: -64.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -736.616012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.616012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.616012 (E_RNA) where: Base-Base interactions energy: -461.439 where: short stacking energy: -229.589 Base-Backbone interact. energy: -1.101 local terms energy: -274.075859 where: bonds (distance) C4'-P energy: -62.169 bonds (distance) P-C4' energy: -57.268 flat angles C4'-P-C4' energy: -57.356 flat angles P-C4'-P energy: -39.265 tors. eta vs tors. theta energy: -58.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -660.079148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.079148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.079148 (E_RNA) where: Base-Base interactions energy: -398.831 where: short stacking energy: -179.395 Base-Backbone interact. energy: 1.353 local terms energy: -262.601074 where: bonds (distance) C4'-P energy: -57.716 bonds (distance) P-C4' energy: -53.240 flat angles C4'-P-C4' energy: -61.262 flat angles P-C4'-P energy: -40.932 tors. eta vs tors. theta energy: -49.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -537.197317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.197317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.197317 (E_RNA) where: Base-Base interactions energy: -289.939 where: short stacking energy: -163.115 Base-Backbone interact. energy: -1.671 local terms energy: -245.587431 where: bonds (distance) C4'-P energy: -59.233 bonds (distance) P-C4' energy: -54.353 flat angles C4'-P-C4' energy: -54.214 flat angles P-C4'-P energy: -44.653 tors. eta vs tors. theta energy: -33.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -500.496938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.496938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.496938 (E_RNA) where: Base-Base interactions energy: -258.647 where: short stacking energy: -134.214 Base-Backbone interact. energy: 0.194 local terms energy: -242.044207 where: bonds (distance) C4'-P energy: -44.372 bonds (distance) P-C4' energy: -62.630 flat angles C4'-P-C4' energy: -58.615 flat angles P-C4'-P energy: -46.837 tors. eta vs tors. theta energy: -29.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -328.757457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.757457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.757457 (E_RNA) where: Base-Base interactions energy: -145.220 where: short stacking energy: -113.643 Base-Backbone interact. energy: -0.774 local terms energy: -182.762636 where: bonds (distance) C4'-P energy: -51.015 bonds (distance) P-C4' energy: -49.374 flat angles C4'-P-C4' energy: -44.679 flat angles P-C4'-P energy: -27.520 tors. eta vs tors. theta energy: -10.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -274.742579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.742579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.742579 (E_RNA) where: Base-Base interactions energy: -91.878 where: short stacking energy: -57.258 Base-Backbone interact. energy: 1.023 local terms energy: -183.886788 where: bonds (distance) C4'-P energy: -57.189 bonds (distance) P-C4' energy: -58.840 flat angles C4'-P-C4' energy: -48.859 flat angles P-C4'-P energy: -41.135 tors. eta vs tors. theta energy: 22.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -275.481095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.481095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.481095 (E_RNA) where: Base-Base interactions energy: -100.322 where: short stacking energy: -74.183 Base-Backbone interact. energy: 0.749 local terms energy: -175.909014 where: bonds (distance) C4'-P energy: -51.347 bonds (distance) P-C4' energy: -45.287 flat angles C4'-P-C4' energy: -49.823 flat angles P-C4'-P energy: -37.333 tors. eta vs tors. theta energy: 7.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -922.864527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.864527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.864527 (E_RNA) where: Base-Base interactions energy: -595.085 where: short stacking energy: -249.858 Base-Backbone interact. energy: -1.138 local terms energy: -326.641611 where: bonds (distance) C4'-P energy: -68.787 bonds (distance) P-C4' energy: -69.313 flat angles C4'-P-C4' energy: -67.412 flat angles P-C4'-P energy: -42.572 tors. eta vs tors. theta energy: -78.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -893.484939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.484939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.484939 (E_RNA) where: Base-Base interactions energy: -583.894 where: short stacking energy: -229.563 Base-Backbone interact. energy: -4.235 local terms energy: -305.356239 where: bonds (distance) C4'-P energy: -58.270 bonds (distance) P-C4' energy: -73.651 flat angles C4'-P-C4' energy: -62.661 flat angles P-C4'-P energy: -47.917 tors. eta vs tors. theta energy: -62.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -833.380920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.380920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.380920 (E_RNA) where: Base-Base interactions energy: -540.701 where: short stacking energy: -238.484 Base-Backbone interact. energy: 1.897 local terms energy: -294.576546 where: bonds (distance) C4'-P energy: -56.011 bonds (distance) P-C4' energy: -62.229 flat angles C4'-P-C4' energy: -72.075 flat angles P-C4'-P energy: -39.957 tors. eta vs tors. theta energy: -64.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -764.309850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.309850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.309850 (E_RNA) where: Base-Base interactions energy: -474.391 where: short stacking energy: -222.276 Base-Backbone interact. energy: 2.220 local terms energy: -292.138838 where: bonds (distance) C4'-P energy: -57.710 bonds (distance) P-C4' energy: -61.733 flat angles C4'-P-C4' energy: -62.810 flat angles P-C4'-P energy: -47.333 tors. eta vs tors. theta energy: -62.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -611.674022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.674022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.674022 (E_RNA) where: Base-Base interactions energy: -359.277 where: short stacking energy: -171.370 Base-Backbone interact. energy: -3.422 local terms energy: -248.975205 where: bonds (distance) C4'-P energy: -53.933 bonds (distance) P-C4' energy: -52.399 flat angles C4'-P-C4' energy: -66.946 flat angles P-C4'-P energy: -36.542 tors. eta vs tors. theta energy: -39.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -562.596210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.596210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.596210 (E_RNA) where: Base-Base interactions energy: -322.851 where: short stacking energy: -160.372 Base-Backbone interact. energy: -0.826 local terms energy: -238.919679 where: bonds (distance) C4'-P energy: -64.505 bonds (distance) P-C4' energy: -54.733 flat angles C4'-P-C4' energy: -47.645 flat angles P-C4'-P energy: -38.386 tors. eta vs tors. theta energy: -33.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -469.313591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.313591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.313591 (E_RNA) where: Base-Base interactions energy: -241.491 where: short stacking energy: -140.227 Base-Backbone interact. energy: -0.850 local terms energy: -226.972153 where: bonds (distance) C4'-P energy: -54.000 bonds (distance) P-C4' energy: -60.792 flat angles C4'-P-C4' energy: -55.930 flat angles P-C4'-P energy: -29.227 tors. eta vs tors. theta energy: -27.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -329.819316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.819316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.819316 (E_RNA) where: Base-Base interactions energy: -124.228 where: short stacking energy: -99.380 Base-Backbone interact. energy: -2.465 local terms energy: -203.126250 where: bonds (distance) C4'-P energy: -49.647 bonds (distance) P-C4' energy: -56.430 flat angles C4'-P-C4' energy: -54.995 flat angles P-C4'-P energy: -32.738 tors. eta vs tors. theta energy: -9.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -273.206346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.206346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.206346 (E_RNA) where: Base-Base interactions energy: -103.225 where: short stacking energy: -76.997 Base-Backbone interact. energy: 2.641 local terms energy: -172.621818 where: bonds (distance) C4'-P energy: -52.862 bonds (distance) P-C4' energy: -54.787 flat angles C4'-P-C4' energy: -42.533 flat angles P-C4'-P energy: -23.031 tors. eta vs tors. theta energy: 0.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -263.783510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.783510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.783510 (E_RNA) where: Base-Base interactions energy: -93.779 where: short stacking energy: -71.871 Base-Backbone interact. energy: -0.551 local terms energy: -169.453552 where: bonds (distance) C4'-P energy: -43.131 bonds (distance) P-C4' energy: -46.067 flat angles C4'-P-C4' energy: -48.233 flat angles P-C4'-P energy: -35.457 tors. eta vs tors. theta energy: 3.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -913.794626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.794626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.794626 (E_RNA) where: Base-Base interactions energy: -614.559 where: short stacking energy: -274.842 Base-Backbone interact. energy: -0.527 local terms energy: -298.708885 where: bonds (distance) C4'-P energy: -67.511 bonds (distance) P-C4' energy: -57.558 flat angles C4'-P-C4' energy: -72.350 flat angles P-C4'-P energy: -32.135 tors. eta vs tors. theta energy: -69.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -917.406131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.406131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.406131 (E_RNA) where: Base-Base interactions energy: -630.091 where: short stacking energy: -230.855 Base-Backbone interact. energy: -0.567 local terms energy: -286.747898 where: bonds (distance) C4'-P energy: -53.141 bonds (distance) P-C4' energy: -61.524 flat angles C4'-P-C4' energy: -65.999 flat angles P-C4'-P energy: -40.556 tors. eta vs tors. theta energy: -65.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -812.327323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.327323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.327323 (E_RNA) where: Base-Base interactions energy: -517.866 where: short stacking energy: -234.042 Base-Backbone interact. energy: 0.214 local terms energy: -294.675089 where: bonds (distance) C4'-P energy: -68.496 bonds (distance) P-C4' energy: -59.241 flat angles C4'-P-C4' energy: -56.942 flat angles P-C4'-P energy: -38.886 tors. eta vs tors. theta energy: -71.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -777.570412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.570412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.570412 (E_RNA) where: Base-Base interactions energy: -480.808 where: short stacking energy: -222.920 Base-Backbone interact. energy: -1.550 local terms energy: -295.212070 where: bonds (distance) C4'-P energy: -52.359 bonds (distance) P-C4' energy: -59.991 flat angles C4'-P-C4' energy: -74.382 flat angles P-C4'-P energy: -46.789 tors. eta vs tors. theta energy: -61.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -597.155730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.155730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.155730 (E_RNA) where: Base-Base interactions energy: -337.085 where: short stacking energy: -165.868 Base-Backbone interact. energy: -0.969 local terms energy: -259.102438 where: bonds (distance) C4'-P energy: -57.022 bonds (distance) P-C4' energy: -66.272 flat angles C4'-P-C4' energy: -65.205 flat angles P-C4'-P energy: -39.991 tors. eta vs tors. theta energy: -30.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -562.594677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.594677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.594677 (E_RNA) where: Base-Base interactions energy: -336.253 where: short stacking energy: -180.279 Base-Backbone interact. energy: -1.269 local terms energy: -225.072963 where: bonds (distance) C4'-P energy: -47.755 bonds (distance) P-C4' energy: -52.806 flat angles C4'-P-C4' energy: -54.167 flat angles P-C4'-P energy: -24.518 tors. eta vs tors. theta energy: -45.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -477.719859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.719859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.719859 (E_RNA) where: Base-Base interactions energy: -266.210 where: short stacking energy: -161.586 Base-Backbone interact. energy: 2.269 local terms energy: -213.779253 where: bonds (distance) C4'-P energy: -49.160 bonds (distance) P-C4' energy: -56.256 flat angles C4'-P-C4' energy: -49.906 flat angles P-C4'-P energy: -36.888 tors. eta vs tors. theta energy: -21.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -281.555656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.555656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.555656 (E_RNA) where: Base-Base interactions energy: -96.348 where: short stacking energy: -88.206 Base-Backbone interact. energy: 6.363 local terms energy: -191.570464 where: bonds (distance) C4'-P energy: -46.399 bonds (distance) P-C4' energy: -52.103 flat angles C4'-P-C4' energy: -46.097 flat angles P-C4'-P energy: -36.290 tors. eta vs tors. theta energy: -10.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -288.061970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.061970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.061970 (E_RNA) where: Base-Base interactions energy: -112.513 where: short stacking energy: -91.844 Base-Backbone interact. energy: -1.019 local terms energy: -174.530424 where: bonds (distance) C4'-P energy: -44.469 bonds (distance) P-C4' energy: -57.812 flat angles C4'-P-C4' energy: -41.763 flat angles P-C4'-P energy: -31.994 tors. eta vs tors. theta energy: 1.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -242.821081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.821081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.821081 (E_RNA) where: Base-Base interactions energy: -83.857 where: short stacking energy: -72.465 Base-Backbone interact. energy: -0.736 local terms energy: -158.228819 where: bonds (distance) C4'-P energy: -51.398 bonds (distance) P-C4' energy: -46.513 flat angles C4'-P-C4' energy: -46.480 flat angles P-C4'-P energy: -27.350 tors. eta vs tors. theta energy: 13.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -941.609547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.609547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.609547 (E_RNA) where: Base-Base interactions energy: -622.935 where: short stacking energy: -263.647 Base-Backbone interact. energy: -2.474 local terms energy: -316.200298 where: bonds (distance) C4'-P energy: -66.335 bonds (distance) P-C4' energy: -65.419 flat angles C4'-P-C4' energy: -66.075 flat angles P-C4'-P energy: -46.340 tors. eta vs tors. theta energy: -72.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -905.387159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.387159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.387159 (E_RNA) where: Base-Base interactions energy: -600.398 where: short stacking energy: -226.347 Base-Backbone interact. energy: 0.518 local terms energy: -305.507765 where: bonds (distance) C4'-P energy: -72.468 bonds (distance) P-C4' energy: -57.820 flat angles C4'-P-C4' energy: -70.561 flat angles P-C4'-P energy: -39.851 tors. eta vs tors. theta energy: -64.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -782.029906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.029906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.029906 (E_RNA) where: Base-Base interactions energy: -494.317 where: short stacking energy: -223.731 Base-Backbone interact. energy: -1.446 local terms energy: -286.267307 where: bonds (distance) C4'-P energy: -61.036 bonds (distance) P-C4' energy: -54.150 flat angles C4'-P-C4' energy: -65.668 flat angles P-C4'-P energy: -37.245 tors. eta vs tors. theta energy: -68.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -788.932493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.932493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.932493 (E_RNA) where: Base-Base interactions energy: -515.607 where: short stacking energy: -204.224 Base-Backbone interact. energy: 1.392 local terms energy: -274.717721 where: bonds (distance) C4'-P energy: -47.434 bonds (distance) P-C4' energy: -54.525 flat angles C4'-P-C4' energy: -57.792 flat angles P-C4'-P energy: -51.497 tors. eta vs tors. theta energy: -63.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -628.426411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.426411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.426411 (E_RNA) where: Base-Base interactions energy: -384.050 where: short stacking energy: -178.381 Base-Backbone interact. energy: -0.196 local terms energy: -244.181051 where: bonds (distance) C4'-P energy: -45.940 bonds (distance) P-C4' energy: -63.601 flat angles C4'-P-C4' energy: -51.703 flat angles P-C4'-P energy: -43.618 tors. eta vs tors. theta energy: -39.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -550.185075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.185075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.185075 (E_RNA) where: Base-Base interactions energy: -313.077 where: short stacking energy: -152.161 Base-Backbone interact. energy: -0.241 local terms energy: -236.866882 where: bonds (distance) C4'-P energy: -43.265 bonds (distance) P-C4' energy: -65.757 flat angles C4'-P-C4' energy: -60.948 flat angles P-C4'-P energy: -45.844 tors. eta vs tors. theta energy: -21.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -499.268791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.268791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.268791 (E_RNA) where: Base-Base interactions energy: -264.525 where: short stacking energy: -166.923 Base-Backbone interact. energy: 0.424 local terms energy: -235.168456 where: bonds (distance) C4'-P energy: -60.067 bonds (distance) P-C4' energy: -55.539 flat angles C4'-P-C4' energy: -52.909 flat angles P-C4'-P energy: -39.419 tors. eta vs tors. theta energy: -27.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -356.301570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.301570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.301570 (E_RNA) where: Base-Base interactions energy: -160.403 where: short stacking energy: -99.100 Base-Backbone interact. energy: -1.251 local terms energy: -194.647003 where: bonds (distance) C4'-P energy: -62.290 bonds (distance) P-C4' energy: -51.356 flat angles C4'-P-C4' energy: -54.591 flat angles P-C4'-P energy: -19.766 tors. eta vs tors. theta energy: -6.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -282.127243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.127243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.127243 (E_RNA) where: Base-Base interactions energy: -117.910 where: short stacking energy: -87.167 Base-Backbone interact. energy: -0.461 local terms energy: -163.756341 where: bonds (distance) C4'-P energy: -48.064 bonds (distance) P-C4' energy: -63.866 flat angles C4'-P-C4' energy: -39.564 flat angles P-C4'-P energy: -19.191 tors. eta vs tors. theta energy: 6.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -268.845447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.845447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.845447 (E_RNA) where: Base-Base interactions energy: -64.916 where: short stacking energy: -63.207 Base-Backbone interact. energy: -1.198 local terms energy: -202.730833 where: bonds (distance) C4'-P energy: -52.303 bonds (distance) P-C4' energy: -63.589 flat angles C4'-P-C4' energy: -49.975 flat angles P-C4'-P energy: -32.145 tors. eta vs tors. theta energy: -4.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -957.677944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.677944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.677944 (E_RNA) where: Base-Base interactions energy: -642.590 where: short stacking energy: -279.670 Base-Backbone interact. energy: 0.119 local terms energy: -315.206591 where: bonds (distance) C4'-P energy: -66.358 bonds (distance) P-C4' energy: -60.367 flat angles C4'-P-C4' energy: -65.459 flat angles P-C4'-P energy: -38.712 tors. eta vs tors. theta energy: -84.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -878.489710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.489710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.489710 (E_RNA) where: Base-Base interactions energy: -581.388 where: short stacking energy: -226.979 Base-Backbone interact. energy: -7.623 local terms energy: -289.478845 where: bonds (distance) C4'-P energy: -51.239 bonds (distance) P-C4' energy: -63.063 flat angles C4'-P-C4' energy: -66.215 flat angles P-C4'-P energy: -49.177 tors. eta vs tors. theta energy: -59.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -849.944930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.944930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.944930 (E_RNA) where: Base-Base interactions energy: -541.747 where: short stacking energy: -234.666 Base-Backbone interact. energy: -0.850 local terms energy: -307.347340 where: bonds (distance) C4'-P energy: -59.867 bonds (distance) P-C4' energy: -69.561 flat angles C4'-P-C4' energy: -56.679 flat angles P-C4'-P energy: -51.425 tors. eta vs tors. theta energy: -69.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -789.962495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.962495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.962495 (E_RNA) where: Base-Base interactions energy: -520.389 where: short stacking energy: -218.858 Base-Backbone interact. energy: 0.102 local terms energy: -269.675358 where: bonds (distance) C4'-P energy: -50.924 bonds (distance) P-C4' energy: -61.880 flat angles C4'-P-C4' energy: -56.177 flat angles P-C4'-P energy: -37.760 tors. eta vs tors. theta energy: -62.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -636.891145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.891145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.891145 (E_RNA) where: Base-Base interactions energy: -387.271 where: short stacking energy: -196.009 Base-Backbone interact. energy: 1.176 local terms energy: -250.796068 where: bonds (distance) C4'-P energy: -48.707 bonds (distance) P-C4' energy: -61.140 flat angles C4'-P-C4' energy: -55.039 flat angles P-C4'-P energy: -32.224 tors. eta vs tors. theta energy: -53.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -537.883436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.883436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.883436 (E_RNA) where: Base-Base interactions energy: -287.397 where: short stacking energy: -147.512 Base-Backbone interact. energy: 0.609 local terms energy: -251.095404 where: bonds (distance) C4'-P energy: -56.873 bonds (distance) P-C4' energy: -69.507 flat angles C4'-P-C4' energy: -47.492 flat angles P-C4'-P energy: -36.563 tors. eta vs tors. theta energy: -40.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -470.509987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.509987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.509987 (E_RNA) where: Base-Base interactions energy: -243.969 where: short stacking energy: -128.839 Base-Backbone interact. energy: -1.248 local terms energy: -225.293378 where: bonds (distance) C4'-P energy: -56.540 bonds (distance) P-C4' energy: -62.427 flat angles C4'-P-C4' energy: -47.935 flat angles P-C4'-P energy: -43.052 tors. eta vs tors. theta energy: -15.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -360.719042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.719042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.719042 (E_RNA) where: Base-Base interactions energy: -159.262 where: short stacking energy: -83.454 Base-Backbone interact. energy: -4.217 local terms energy: -197.239589 where: bonds (distance) C4'-P energy: -51.293 bonds (distance) P-C4' energy: -52.348 flat angles C4'-P-C4' energy: -54.671 flat angles P-C4'-P energy: -42.711 tors. eta vs tors. theta energy: 3.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -282.793563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.793563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.793563 (E_RNA) where: Base-Base interactions energy: -87.066 where: short stacking energy: -80.082 Base-Backbone interact. energy: 4.272 local terms energy: -199.999197 where: bonds (distance) C4'-P energy: -62.441 bonds (distance) P-C4' energy: -60.603 flat angles C4'-P-C4' energy: -59.187 flat angles P-C4'-P energy: -16.541 tors. eta vs tors. theta energy: -1.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -260.659241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.659241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.659241 (E_RNA) where: Base-Base interactions energy: -85.925 where: short stacking energy: -58.553 Base-Backbone interact. energy: -1.635 local terms energy: -173.099752 where: bonds (distance) C4'-P energy: -56.047 bonds (distance) P-C4' energy: -49.274 flat angles C4'-P-C4' energy: -50.603 flat angles P-C4'-P energy: -27.769 tors. eta vs tors. theta energy: 10.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -966.688977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.688977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.688977 (E_RNA) where: Base-Base interactions energy: -635.999 where: short stacking energy: -265.674 Base-Backbone interact. energy: -3.394 local terms energy: -327.296755 where: bonds (distance) C4'-P energy: -61.589 bonds (distance) P-C4' energy: -62.088 flat angles C4'-P-C4' energy: -67.244 flat angles P-C4'-P energy: -43.390 tors. eta vs tors. theta energy: -92.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -875.767325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.767325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.767325 (E_RNA) where: Base-Base interactions energy: -581.816 where: short stacking energy: -238.654 Base-Backbone interact. energy: -2.010 local terms energy: -291.941474 where: bonds (distance) C4'-P energy: -60.737 bonds (distance) P-C4' energy: -62.649 flat angles C4'-P-C4' energy: -62.413 flat angles P-C4'-P energy: -39.413 tors. eta vs tors. theta energy: -66.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -885.696604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.696604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.696604 (E_RNA) where: Base-Base interactions energy: -572.228 where: short stacking energy: -269.233 Base-Backbone interact. energy: -1.123 local terms energy: -312.346081 where: bonds (distance) C4'-P energy: -61.218 bonds (distance) P-C4' energy: -62.523 flat angles C4'-P-C4' energy: -74.682 flat angles P-C4'-P energy: -34.429 tors. eta vs tors. theta energy: -79.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -762.994324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.994324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.994324 (E_RNA) where: Base-Base interactions energy: -493.983 where: short stacking energy: -209.935 Base-Backbone interact. energy: 0.869 local terms energy: -269.880710 where: bonds (distance) C4'-P energy: -53.935 bonds (distance) P-C4' energy: -58.585 flat angles C4'-P-C4' energy: -57.769 flat angles P-C4'-P energy: -38.519 tors. eta vs tors. theta energy: -61.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -653.688194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.688194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.688194 (E_RNA) where: Base-Base interactions energy: -394.037 where: short stacking energy: -207.779 Base-Backbone interact. energy: 2.350 local terms energy: -262.001320 where: bonds (distance) C4'-P energy: -66.751 bonds (distance) P-C4' energy: -54.503 flat angles C4'-P-C4' energy: -55.636 flat angles P-C4'-P energy: -30.532 tors. eta vs tors. theta energy: -54.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -602.492123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.492123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.492123 (E_RNA) where: Base-Base interactions energy: -332.192 where: short stacking energy: -173.703 Base-Backbone interact. energy: -0.241 local terms energy: -270.059480 where: bonds (distance) C4'-P energy: -61.589 bonds (distance) P-C4' energy: -53.085 flat angles C4'-P-C4' energy: -64.501 flat angles P-C4'-P energy: -46.529 tors. eta vs tors. theta energy: -44.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -452.720679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.720679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.720679 (E_RNA) where: Base-Base interactions energy: -229.401 where: short stacking energy: -133.037 Base-Backbone interact. energy: 3.193 local terms energy: -226.512650 where: bonds (distance) C4'-P energy: -58.126 bonds (distance) P-C4' energy: -64.069 flat angles C4'-P-C4' energy: -57.537 flat angles P-C4'-P energy: -21.733 tors. eta vs tors. theta energy: -25.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -372.340946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.340946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.340946 (E_RNA) where: Base-Base interactions energy: -185.536 where: short stacking energy: -117.516 Base-Backbone interact. energy: 0.898 local terms energy: -187.702847 where: bonds (distance) C4'-P energy: -54.506 bonds (distance) P-C4' energy: -40.535 flat angles C4'-P-C4' energy: -44.563 flat angles P-C4'-P energy: -34.895 tors. eta vs tors. theta energy: -13.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -289.700744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.700744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.700744 (E_RNA) where: Base-Base interactions energy: -101.532 where: short stacking energy: -84.514 Base-Backbone interact. energy: 3.715 local terms energy: -191.883241 where: bonds (distance) C4'-P energy: -55.485 bonds (distance) P-C4' energy: -43.023 flat angles C4'-P-C4' energy: -57.647 flat angles P-C4'-P energy: -17.956 tors. eta vs tors. theta energy: -17.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -261.281787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.281787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.281787 (E_RNA) where: Base-Base interactions energy: -67.539 where: short stacking energy: -51.142 Base-Backbone interact. energy: -2.073 local terms energy: -191.669328 where: bonds (distance) C4'-P energy: -64.203 bonds (distance) P-C4' energy: -57.252 flat angles C4'-P-C4' energy: -47.550 flat angles P-C4'-P energy: -28.510 tors. eta vs tors. theta energy: 5.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -960.296808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.296808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.296808 (E_RNA) where: Base-Base interactions energy: -644.790 where: short stacking energy: -277.960 Base-Backbone interact. energy: -1.271 local terms energy: -314.236326 where: bonds (distance) C4'-P energy: -55.094 bonds (distance) P-C4' energy: -69.657 flat angles C4'-P-C4' energy: -67.151 flat angles P-C4'-P energy: -41.883 tors. eta vs tors. theta energy: -80.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -880.602584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.602584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.602584 (E_RNA) where: Base-Base interactions energy: -575.182 where: short stacking energy: -235.789 Base-Backbone interact. energy: -1.257 local terms energy: -304.164499 where: bonds (distance) C4'-P energy: -70.760 bonds (distance) P-C4' energy: -68.629 flat angles C4'-P-C4' energy: -59.316 flat angles P-C4'-P energy: -40.229 tors. eta vs tors. theta energy: -65.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -903.267221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.267221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.267221 (E_RNA) where: Base-Base interactions energy: -593.279 where: short stacking energy: -260.635 Base-Backbone interact. energy: 0.724 local terms energy: -310.712041 where: bonds (distance) C4'-P energy: -59.060 bonds (distance) P-C4' energy: -66.306 flat angles C4'-P-C4' energy: -66.375 flat angles P-C4'-P energy: -37.531 tors. eta vs tors. theta energy: -81.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -780.382416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.382416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.382416 (E_RNA) where: Base-Base interactions energy: -505.067 where: short stacking energy: -229.761 Base-Backbone interact. energy: 0.477 local terms energy: -275.792821 where: bonds (distance) C4'-P energy: -59.399 bonds (distance) P-C4' energy: -62.546 flat angles C4'-P-C4' energy: -65.355 flat angles P-C4'-P energy: -32.274 tors. eta vs tors. theta energy: -56.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -628.776396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.776396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.776396 (E_RNA) where: Base-Base interactions energy: -387.423 where: short stacking energy: -196.893 Base-Backbone interact. energy: -2.589 local terms energy: -238.765176 where: bonds (distance) C4'-P energy: -61.874 bonds (distance) P-C4' energy: -43.119 flat angles C4'-P-C4' energy: -59.990 flat angles P-C4'-P energy: -25.495 tors. eta vs tors. theta energy: -48.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -616.773447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.773447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.773447 (E_RNA) where: Base-Base interactions energy: -352.051 where: short stacking energy: -177.823 Base-Backbone interact. energy: -0.334 local terms energy: -264.388969 where: bonds (distance) C4'-P energy: -48.611 bonds (distance) P-C4' energy: -54.852 flat angles C4'-P-C4' energy: -61.242 flat angles P-C4'-P energy: -45.948 tors. eta vs tors. theta energy: -53.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -447.345346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.345346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.345346 (E_RNA) where: Base-Base interactions energy: -241.898 where: short stacking energy: -145.402 Base-Backbone interact. energy: -0.630 local terms energy: -204.816582 where: bonds (distance) C4'-P energy: -45.661 bonds (distance) P-C4' energy: -51.235 flat angles C4'-P-C4' energy: -45.599 flat angles P-C4'-P energy: -34.301 tors. eta vs tors. theta energy: -28.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -298.513813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.513813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.513813 (E_RNA) where: Base-Base interactions energy: -87.790 where: short stacking energy: -85.761 Base-Backbone interact. energy: -0.852 local terms energy: -209.871539 where: bonds (distance) C4'-P energy: -55.074 bonds (distance) P-C4' energy: -59.946 flat angles C4'-P-C4' energy: -46.905 flat angles P-C4'-P energy: -28.392 tors. eta vs tors. theta energy: -19.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -283.413239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.413239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.413239 (E_RNA) where: Base-Base interactions energy: -84.857 where: short stacking energy: -67.834 Base-Backbone interact. energy: -1.390 local terms energy: -197.166427 where: bonds (distance) C4'-P energy: -62.784 bonds (distance) P-C4' energy: -57.591 flat angles C4'-P-C4' energy: -42.092 flat angles P-C4'-P energy: -47.781 tors. eta vs tors. theta energy: 13.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -279.261973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.261973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.261973 (E_RNA) where: Base-Base interactions energy: -120.827 where: short stacking energy: -82.589 Base-Backbone interact. energy: -3.557 local terms energy: -154.877732 where: bonds (distance) C4'-P energy: -46.558 bonds (distance) P-C4' energy: -56.669 flat angles C4'-P-C4' energy: -41.659 flat angles P-C4'-P energy: -13.915 tors. eta vs tors. theta energy: 3.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -955.990566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.990566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.990566 (E_RNA) where: Base-Base interactions energy: -632.948 where: short stacking energy: -281.530 Base-Backbone interact. energy: -2.138 local terms energy: -320.904415 where: bonds (distance) C4'-P energy: -57.761 bonds (distance) P-C4' energy: -67.070 flat angles C4'-P-C4' energy: -68.969 flat angles P-C4'-P energy: -43.914 tors. eta vs tors. theta energy: -83.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -894.988311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.988311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.988311 (E_RNA) where: Base-Base interactions energy: -594.158 where: short stacking energy: -241.135 Base-Backbone interact. energy: -1.649 local terms energy: -299.180600 where: bonds (distance) C4'-P energy: -55.772 bonds (distance) P-C4' energy: -59.609 flat angles C4'-P-C4' energy: -68.176 flat angles P-C4'-P energy: -47.632 tors. eta vs tors. theta energy: -67.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -930.954203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.954203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.954203 (E_RNA) where: Base-Base interactions energy: -622.897 where: short stacking energy: -264.256 Base-Backbone interact. energy: -1.594 local terms energy: -306.463588 where: bonds (distance) C4'-P energy: -55.309 bonds (distance) P-C4' energy: -57.247 flat angles C4'-P-C4' energy: -61.423 flat angles P-C4'-P energy: -47.118 tors. eta vs tors. theta energy: -85.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -741.931141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.931141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.931141 (E_RNA) where: Base-Base interactions energy: -452.166 where: short stacking energy: -183.894 Base-Backbone interact. energy: -2.112 local terms energy: -287.653328 where: bonds (distance) C4'-P energy: -61.811 bonds (distance) P-C4' energy: -66.833 flat angles C4'-P-C4' energy: -60.359 flat angles P-C4'-P energy: -39.163 tors. eta vs tors. theta energy: -59.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -679.620225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.620225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.620225 (E_RNA) where: Base-Base interactions energy: -412.925 where: short stacking energy: -194.640 Base-Backbone interact. energy: -1.422 local terms energy: -265.273167 where: bonds (distance) C4'-P energy: -57.584 bonds (distance) P-C4' energy: -57.376 flat angles C4'-P-C4' energy: -66.658 flat angles P-C4'-P energy: -36.466 tors. eta vs tors. theta energy: -47.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -568.378112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.378112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.378112 (E_RNA) where: Base-Base interactions energy: -332.084 where: short stacking energy: -185.187 Base-Backbone interact. energy: -2.428 local terms energy: -233.865923 where: bonds (distance) C4'-P energy: -50.079 bonds (distance) P-C4' energy: -56.278 flat angles C4'-P-C4' energy: -51.866 flat angles P-C4'-P energy: -27.779 tors. eta vs tors. theta energy: -47.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -469.501308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.501308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.501308 (E_RNA) where: Base-Base interactions energy: -242.627 where: short stacking energy: -133.924 Base-Backbone interact. energy: -2.545 local terms energy: -224.328490 where: bonds (distance) C4'-P energy: -61.086 bonds (distance) P-C4' energy: -51.101 flat angles C4'-P-C4' energy: -50.627 flat angles P-C4'-P energy: -32.054 tors. eta vs tors. theta energy: -29.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -346.201374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.201374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.201374 (E_RNA) where: Base-Base interactions energy: -179.485 where: short stacking energy: -92.635 Base-Backbone interact. energy: -0.706 local terms energy: -166.010242 where: bonds (distance) C4'-P energy: -51.997 bonds (distance) P-C4' energy: -65.498 flat angles C4'-P-C4' energy: -39.018 flat angles P-C4'-P energy: -16.976 tors. eta vs tors. theta energy: 7.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -268.958193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.958193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.958193 (E_RNA) where: Base-Base interactions energy: -85.883 where: short stacking energy: -68.369 Base-Backbone interact. energy: -0.603 local terms energy: -182.472579 where: bonds (distance) C4'-P energy: -40.968 bonds (distance) P-C4' energy: -58.969 flat angles C4'-P-C4' energy: -57.089 flat angles P-C4'-P energy: -33.923 tors. eta vs tors. theta energy: 8.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -261.412958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.412958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.412958 (E_RNA) where: Base-Base interactions energy: -106.674 where: short stacking energy: -86.485 Base-Backbone interact. energy: -2.556 local terms energy: -152.183047 where: bonds (distance) C4'-P energy: -29.797 bonds (distance) P-C4' energy: -52.454 flat angles C4'-P-C4' energy: -43.378 flat angles P-C4'-P energy: -33.016 tors. eta vs tors. theta energy: 6.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -964.291578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.291578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.291578 (E_RNA) where: Base-Base interactions energy: -636.479 where: short stacking energy: -294.265 Base-Backbone interact. energy: -0.458 local terms energy: -327.355066 where: bonds (distance) C4'-P energy: -64.712 bonds (distance) P-C4' energy: -61.757 flat angles C4'-P-C4' energy: -73.775 flat angles P-C4'-P energy: -46.606 tors. eta vs tors. theta energy: -80.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -950.274835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.274835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.274835 (E_RNA) where: Base-Base interactions energy: -614.152 where: short stacking energy: -280.776 Base-Backbone interact. energy: -0.991 local terms energy: -335.131842 where: bonds (distance) C4'-P energy: -64.651 bonds (distance) P-C4' energy: -62.387 flat angles C4'-P-C4' energy: -66.583 flat angles P-C4'-P energy: -51.320 tors. eta vs tors. theta energy: -90.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -852.823200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.823200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.823200 (E_RNA) where: Base-Base interactions energy: -560.545 where: short stacking energy: -224.103 Base-Backbone interact. energy: -1.053 local terms energy: -291.225291 where: bonds (distance) C4'-P energy: -62.885 bonds (distance) P-C4' energy: -61.205 flat angles C4'-P-C4' energy: -66.595 flat angles P-C4'-P energy: -41.062 tors. eta vs tors. theta energy: -59.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -749.317987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.317987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.317987 (E_RNA) where: Base-Base interactions energy: -469.698 where: short stacking energy: -200.854 Base-Backbone interact. energy: -0.888 local terms energy: -278.731695 where: bonds (distance) C4'-P energy: -56.774 bonds (distance) P-C4' energy: -62.346 flat angles C4'-P-C4' energy: -61.096 flat angles P-C4'-P energy: -46.952 tors. eta vs tors. theta energy: -51.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -660.277632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.277632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.277632 (E_RNA) where: Base-Base interactions energy: -410.839 where: short stacking energy: -201.269 Base-Backbone interact. energy: -0.598 local terms energy: -248.840945 where: bonds (distance) C4'-P energy: -62.503 bonds (distance) P-C4' energy: -49.932 flat angles C4'-P-C4' energy: -47.926 flat angles P-C4'-P energy: -43.154 tors. eta vs tors. theta energy: -45.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -526.474233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.474233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.474233 (E_RNA) where: Base-Base interactions energy: -286.740 where: short stacking energy: -174.421 Base-Backbone interact. energy: -0.295 local terms energy: -239.439347 where: bonds (distance) C4'-P energy: -55.488 bonds (distance) P-C4' energy: -59.123 flat angles C4'-P-C4' energy: -59.474 flat angles P-C4'-P energy: -29.111 tors. eta vs tors. theta energy: -36.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -522.355096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.355096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.355096 (E_RNA) where: Base-Base interactions energy: -309.959 where: short stacking energy: -167.591 Base-Backbone interact. energy: -1.898 local terms energy: -210.497960 where: bonds (distance) C4'-P energy: -52.031 bonds (distance) P-C4' energy: -48.927 flat angles C4'-P-C4' energy: -50.295 flat angles P-C4'-P energy: -29.787 tors. eta vs tors. theta energy: -29.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -338.101788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.101788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.101788 (E_RNA) where: Base-Base interactions energy: -140.031 where: short stacking energy: -91.657 Base-Backbone interact. energy: 0.600 local terms energy: -198.670850 where: bonds (distance) C4'-P energy: -58.941 bonds (distance) P-C4' energy: -50.459 flat angles C4'-P-C4' energy: -43.009 flat angles P-C4'-P energy: -38.212 tors. eta vs tors. theta energy: -8.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -266.958433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.958433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.958433 (E_RNA) where: Base-Base interactions energy: -90.810 where: short stacking energy: -71.037 Base-Backbone interact. energy: -1.054 local terms energy: -175.094399 where: bonds (distance) C4'-P energy: -65.734 bonds (distance) P-C4' energy: -56.201 flat angles C4'-P-C4' energy: -14.452 flat angles P-C4'-P energy: -38.384 tors. eta vs tors. theta energy: -0.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -259.610779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.610779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.610779 (E_RNA) where: Base-Base interactions energy: -81.560 where: short stacking energy: -68.605 Base-Backbone interact. energy: 0.213 local terms energy: -178.264362 where: bonds (distance) C4'-P energy: -47.110 bonds (distance) P-C4' energy: -54.822 flat angles C4'-P-C4' energy: -47.732 flat angles P-C4'-P energy: -38.550 tors. eta vs tors. theta energy: 9.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -975.202970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.202970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.202970 (E_RNA) where: Base-Base interactions energy: -638.035 where: short stacking energy: -272.834 Base-Backbone interact. energy: 1.813 local terms energy: -338.981908 where: bonds (distance) C4'-P energy: -69.704 bonds (distance) P-C4' energy: -68.439 flat angles C4'-P-C4' energy: -67.181 flat angles P-C4'-P energy: -43.108 tors. eta vs tors. theta energy: -90.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -924.803822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.803822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.803822 (E_RNA) where: Base-Base interactions energy: -607.846 where: short stacking energy: -244.514 Base-Backbone interact. energy: -1.573 local terms energy: -315.384550 where: bonds (distance) C4'-P energy: -58.524 bonds (distance) P-C4' energy: -69.144 flat angles C4'-P-C4' energy: -63.732 flat angles P-C4'-P energy: -50.290 tors. eta vs tors. theta energy: -73.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -817.614264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.614264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.614264 (E_RNA) where: Base-Base interactions energy: -535.151 where: short stacking energy: -222.512 Base-Backbone interact. energy: -2.008 local terms energy: -280.455781 where: bonds (distance) C4'-P energy: -58.181 bonds (distance) P-C4' energy: -63.187 flat angles C4'-P-C4' energy: -62.607 flat angles P-C4'-P energy: -36.637 tors. eta vs tors. theta energy: -59.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -774.708755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.708755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.708755 (E_RNA) where: Base-Base interactions energy: -488.808 where: short stacking energy: -223.703 Base-Backbone interact. energy: -0.014 local terms energy: -285.886922 where: bonds (distance) C4'-P energy: -56.409 bonds (distance) P-C4' energy: -60.117 flat angles C4'-P-C4' energy: -64.108 flat angles P-C4'-P energy: -39.659 tors. eta vs tors. theta energy: -65.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -677.231559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.231559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.231559 (E_RNA) where: Base-Base interactions energy: -406.796 where: short stacking energy: -217.825 Base-Backbone interact. energy: -0.886 local terms energy: -269.549625 where: bonds (distance) C4'-P energy: -51.961 bonds (distance) P-C4' energy: -61.775 flat angles C4'-P-C4' energy: -58.812 flat angles P-C4'-P energy: -37.885 tors. eta vs tors. theta energy: -59.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -534.479607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.479607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.479607 (E_RNA) where: Base-Base interactions energy: -287.510 where: short stacking energy: -156.837 Base-Backbone interact. energy: -0.395 local terms energy: -246.574962 where: bonds (distance) C4'-P energy: -71.614 bonds (distance) P-C4' energy: -53.783 flat angles C4'-P-C4' energy: -59.294 flat angles P-C4'-P energy: -32.643 tors. eta vs tors. theta energy: -29.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -452.226138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.226138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.226138 (E_RNA) where: Base-Base interactions energy: -251.292 where: short stacking energy: -111.538 Base-Backbone interact. energy: -2.916 local terms energy: -198.017817 where: bonds (distance) C4'-P energy: -62.953 bonds (distance) P-C4' energy: -45.654 flat angles C4'-P-C4' energy: -52.660 flat angles P-C4'-P energy: -38.588 tors. eta vs tors. theta energy: 1.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -356.383967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.383967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.383967 (E_RNA) where: Base-Base interactions energy: -149.811 where: short stacking energy: -91.849 Base-Backbone interact. energy: -0.077 local terms energy: -206.495399 where: bonds (distance) C4'-P energy: -54.975 bonds (distance) P-C4' energy: -71.394 flat angles C4'-P-C4' energy: -39.539 flat angles P-C4'-P energy: -25.033 tors. eta vs tors. theta energy: -15.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -288.072749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.072749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.072749 (E_RNA) where: Base-Base interactions energy: -122.443 where: short stacking energy: -62.951 Base-Backbone interact. energy: -1.210 local terms energy: -164.420091 where: bonds (distance) C4'-P energy: -57.698 bonds (distance) P-C4' energy: -59.524 flat angles C4'-P-C4' energy: -43.054 flat angles P-C4'-P energy: -19.905 tors. eta vs tors. theta energy: 15.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -254.413995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.413995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.413995 (E_RNA) where: Base-Base interactions energy: -99.380 where: short stacking energy: -60.933 Base-Backbone interact. energy: -0.384 local terms energy: -154.650574 where: bonds (distance) C4'-P energy: -54.349 bonds (distance) P-C4' energy: -54.736 flat angles C4'-P-C4' energy: -28.102 flat angles P-C4'-P energy: -34.498 tors. eta vs tors. theta energy: 17.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -992.293965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.293965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.293965 (E_RNA) where: Base-Base interactions energy: -654.426 where: short stacking energy: -294.036 Base-Backbone interact. energy: -2.415 local terms energy: -335.453557 where: bonds (distance) C4'-P energy: -58.135 bonds (distance) P-C4' energy: -64.365 flat angles C4'-P-C4' energy: -71.678 flat angles P-C4'-P energy: -46.410 tors. eta vs tors. theta energy: -94.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -919.802989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.802989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.802989 (E_RNA) where: Base-Base interactions energy: -626.299 where: short stacking energy: -278.476 Base-Backbone interact. energy: 0.068 local terms energy: -293.571488 where: bonds (distance) C4'-P energy: -58.348 bonds (distance) P-C4' energy: -60.694 flat angles C4'-P-C4' energy: -64.928 flat angles P-C4'-P energy: -35.554 tors. eta vs tors. theta energy: -74.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -803.892112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.892112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.892112 (E_RNA) where: Base-Base interactions energy: -513.926 where: short stacking energy: -206.581 Base-Backbone interact. energy: -1.861 local terms energy: -288.104754 where: bonds (distance) C4'-P energy: -61.776 bonds (distance) P-C4' energy: -60.523 flat angles C4'-P-C4' energy: -67.969 flat angles P-C4'-P energy: -42.101 tors. eta vs tors. theta energy: -55.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -774.291358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.291358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.291358 (E_RNA) where: Base-Base interactions energy: -490.265 where: short stacking energy: -221.428 Base-Backbone interact. energy: 1.825 local terms energy: -285.851284 where: bonds (distance) C4'-P energy: -60.683 bonds (distance) P-C4' energy: -53.822 flat angles C4'-P-C4' energy: -64.383 flat angles P-C4'-P energy: -39.417 tors. eta vs tors. theta energy: -67.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -659.196159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.196159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.196159 (E_RNA) where: Base-Base interactions energy: -387.347 where: short stacking energy: -192.501 Base-Backbone interact. energy: 0.003 local terms energy: -271.852228 where: bonds (distance) C4'-P energy: -66.910 bonds (distance) P-C4' energy: -68.108 flat angles C4'-P-C4' energy: -62.727 flat angles P-C4'-P energy: -36.680 tors. eta vs tors. theta energy: -37.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -592.936663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.936663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.936663 (E_RNA) where: Base-Base interactions energy: -341.648 where: short stacking energy: -168.812 Base-Backbone interact. energy: 1.766 local terms energy: -253.054831 where: bonds (distance) C4'-P energy: -62.809 bonds (distance) P-C4' energy: -62.715 flat angles C4'-P-C4' energy: -48.620 flat angles P-C4'-P energy: -38.085 tors. eta vs tors. theta energy: -40.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -499.470495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.470495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.470495 (E_RNA) where: Base-Base interactions energy: -281.388 where: short stacking energy: -122.672 Base-Backbone interact. energy: -1.767 local terms energy: -216.315682 where: bonds (distance) C4'-P energy: -47.473 bonds (distance) P-C4' energy: -52.824 flat angles C4'-P-C4' energy: -55.143 flat angles P-C4'-P energy: -27.086 tors. eta vs tors. theta energy: -33.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -293.936988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.936988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.936988 (E_RNA) where: Base-Base interactions energy: -97.472 where: short stacking energy: -69.579 Base-Backbone interact. energy: -0.343 local terms energy: -196.122102 where: bonds (distance) C4'-P energy: -67.402 bonds (distance) P-C4' energy: -68.941 flat angles C4'-P-C4' energy: -49.019 flat angles P-C4'-P energy: -20.898 tors. eta vs tors. theta energy: 10.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -273.465994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.465994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.465994 (E_RNA) where: Base-Base interactions energy: -102.616 where: short stacking energy: -71.147 Base-Backbone interact. energy: 1.068 local terms energy: -171.917978 where: bonds (distance) C4'-P energy: -49.105 bonds (distance) P-C4' energy: -53.763 flat angles C4'-P-C4' energy: -36.783 flat angles P-C4'-P energy: -34.417 tors. eta vs tors. theta energy: 2.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -252.295686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.295686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.295686 (E_RNA) where: Base-Base interactions energy: -65.696 where: short stacking energy: -56.491 Base-Backbone interact. energy: 2.700 local terms energy: -189.300040 where: bonds (distance) C4'-P energy: -52.422 bonds (distance) P-C4' energy: -54.929 flat angles C4'-P-C4' energy: -58.232 flat angles P-C4'-P energy: -22.271 tors. eta vs tors. theta energy: -1.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1005.114907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.114907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.114907 (E_RNA) where: Base-Base interactions energy: -667.407 where: short stacking energy: -298.147 Base-Backbone interact. energy: -1.665 local terms energy: -336.042969 where: bonds (distance) C4'-P energy: -55.950 bonds (distance) P-C4' energy: -68.271 flat angles C4'-P-C4' energy: -71.164 flat angles P-C4'-P energy: -47.725 tors. eta vs tors. theta energy: -92.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -905.172442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.172442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.172442 (E_RNA) where: Base-Base interactions energy: -598.614 where: short stacking energy: -243.874 Base-Backbone interact. energy: -0.831 local terms energy: -305.728140 where: bonds (distance) C4'-P energy: -57.459 bonds (distance) P-C4' energy: -65.926 flat angles C4'-P-C4' energy: -68.849 flat angles P-C4'-P energy: -42.336 tors. eta vs tors. theta energy: -71.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -823.852921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.852921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.852921 (E_RNA) where: Base-Base interactions energy: -531.797 where: short stacking energy: -240.566 Base-Backbone interact. energy: -2.430 local terms energy: -289.626338 where: bonds (distance) C4'-P energy: -47.547 bonds (distance) P-C4' energy: -63.545 flat angles C4'-P-C4' energy: -70.289 flat angles P-C4'-P energy: -39.160 tors. eta vs tors. theta energy: -69.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -794.612237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.612237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.612237 (E_RNA) where: Base-Base interactions energy: -531.531 where: short stacking energy: -225.051 Base-Backbone interact. energy: 0.421 local terms energy: -263.501529 where: bonds (distance) C4'-P energy: -61.748 bonds (distance) P-C4' energy: -45.194 flat angles C4'-P-C4' energy: -58.480 flat angles P-C4'-P energy: -43.118 tors. eta vs tors. theta energy: -54.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -718.366949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.366949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.366949 (E_RNA) where: Base-Base interactions energy: -454.441 where: short stacking energy: -194.662 Base-Backbone interact. energy: -1.167 local terms energy: -262.758880 where: bonds (distance) C4'-P energy: -54.279 bonds (distance) P-C4' energy: -58.510 flat angles C4'-P-C4' energy: -56.950 flat angles P-C4'-P energy: -37.695 tors. eta vs tors. theta energy: -55.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -552.340913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.340913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.340913 (E_RNA) where: Base-Base interactions energy: -301.569 where: short stacking energy: -167.160 Base-Backbone interact. energy: -0.633 local terms energy: -250.138673 where: bonds (distance) C4'-P energy: -62.854 bonds (distance) P-C4' energy: -59.482 flat angles C4'-P-C4' energy: -56.890 flat angles P-C4'-P energy: -35.368 tors. eta vs tors. theta energy: -35.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -489.237826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.237826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.237826 (E_RNA) where: Base-Base interactions energy: -261.701 where: short stacking energy: -140.698 Base-Backbone interact. energy: 1.220 local terms energy: -228.756538 where: bonds (distance) C4'-P energy: -48.454 bonds (distance) P-C4' energy: -62.946 flat angles C4'-P-C4' energy: -59.617 flat angles P-C4'-P energy: -34.181 tors. eta vs tors. theta energy: -23.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -270.033304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.033304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.033304 (E_RNA) where: Base-Base interactions energy: -88.930 where: short stacking energy: -77.930 Base-Backbone interact. energy: 0.984 local terms energy: -182.087206 where: bonds (distance) C4'-P energy: -46.211 bonds (distance) P-C4' energy: -61.119 flat angles C4'-P-C4' energy: -53.202 flat angles P-C4'-P energy: -29.606 tors. eta vs tors. theta energy: 8.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -295.967394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.967394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.967394 (E_RNA) where: Base-Base interactions energy: -105.387 where: short stacking energy: -73.506 Base-Backbone interact. energy: -0.864 local terms energy: -189.716536 where: bonds (distance) C4'-P energy: -57.607 bonds (distance) P-C4' energy: -57.139 flat angles C4'-P-C4' energy: -40.118 flat angles P-C4'-P energy: -37.105 tors. eta vs tors. theta energy: 2.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -275.332267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.332267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.332267 (E_RNA) where: Base-Base interactions energy: -98.440 where: short stacking energy: -83.326 Base-Backbone interact. energy: 3.514 local terms energy: -180.405817 where: bonds (distance) C4'-P energy: -45.410 bonds (distance) P-C4' energy: -56.200 flat angles C4'-P-C4' energy: -55.314 flat angles P-C4'-P energy: -33.901 tors. eta vs tors. theta energy: 10.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1001.919788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.919788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.919788 (E_RNA) where: Base-Base interactions energy: -647.025 where: short stacking energy: -291.961 Base-Backbone interact. energy: -0.598 local terms energy: -354.296240 where: bonds (distance) C4'-P energy: -68.329 bonds (distance) P-C4' energy: -69.319 flat angles C4'-P-C4' energy: -71.968 flat angles P-C4'-P energy: -43.842 tors. eta vs tors. theta energy: -100.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -845.197056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.197056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.197056 (E_RNA) where: Base-Base interactions energy: -538.517 where: short stacking energy: -226.467 Base-Backbone interact. energy: 0.633 local terms energy: -307.313514 where: bonds (distance) C4'-P energy: -65.185 bonds (distance) P-C4' energy: -62.838 flat angles C4'-P-C4' energy: -69.342 flat angles P-C4'-P energy: -39.963 tors. eta vs tors. theta energy: -69.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -879.226371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.226371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.226371 (E_RNA) where: Base-Base interactions energy: -593.415 where: short stacking energy: -251.665 Base-Backbone interact. energy: -0.169 local terms energy: -285.642486 where: bonds (distance) C4'-P energy: -58.069 bonds (distance) P-C4' energy: -53.063 flat angles C4'-P-C4' energy: -71.136 flat angles P-C4'-P energy: -31.749 tors. eta vs tors. theta energy: -71.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -781.856828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.856828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.856828 (E_RNA) where: Base-Base interactions energy: -504.571 where: short stacking energy: -222.449 Base-Backbone interact. energy: 4.011 local terms energy: -281.297561 where: bonds (distance) C4'-P energy: -71.795 bonds (distance) P-C4' energy: -60.364 flat angles C4'-P-C4' energy: -54.850 flat angles P-C4'-P energy: -36.392 tors. eta vs tors. theta energy: -57.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -687.051247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.051247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.051247 (E_RNA) where: Base-Base interactions energy: -416.390 where: short stacking energy: -203.769 Base-Backbone interact. energy: -2.004 local terms energy: -268.657561 where: bonds (distance) C4'-P energy: -53.947 bonds (distance) P-C4' energy: -69.481 flat angles C4'-P-C4' energy: -52.581 flat angles P-C4'-P energy: -48.958 tors. eta vs tors. theta energy: -43.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -569.770045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.770045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.770045 (E_RNA) where: Base-Base interactions energy: -357.556 where: short stacking energy: -170.691 Base-Backbone interact. energy: -1.646 local terms energy: -210.567668 where: bonds (distance) C4'-P energy: -53.703 bonds (distance) P-C4' energy: -46.479 flat angles C4'-P-C4' energy: -50.149 flat angles P-C4'-P energy: -32.475 tors. eta vs tors. theta energy: -27.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -410.460896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.460896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.460896 (E_RNA) where: Base-Base interactions energy: -242.125 where: short stacking energy: -123.455 Base-Backbone interact. energy: -0.909 local terms energy: -167.427433 where: bonds (distance) C4'-P energy: -40.728 bonds (distance) P-C4' energy: -56.873 flat angles C4'-P-C4' energy: -29.998 flat angles P-C4'-P energy: -29.430 tors. eta vs tors. theta energy: -10.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -301.715811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.715811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.715811 (E_RNA) where: Base-Base interactions energy: -122.525 where: short stacking energy: -83.956 Base-Backbone interact. energy: 2.903 local terms energy: -182.093683 where: bonds (distance) C4'-P energy: -53.349 bonds (distance) P-C4' energy: -61.464 flat angles C4'-P-C4' energy: -47.489 flat angles P-C4'-P energy: -28.637 tors. eta vs tors. theta energy: 8.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -291.056357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.056357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.056357 (E_RNA) where: Base-Base interactions energy: -102.821 where: short stacking energy: -54.456 Base-Backbone interact. energy: 1.435 local terms energy: -189.669612 where: bonds (distance) C4'-P energy: -52.996 bonds (distance) P-C4' energy: -61.805 flat angles C4'-P-C4' energy: -46.430 flat angles P-C4'-P energy: -30.550 tors. eta vs tors. theta energy: 2.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -261.995297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.995297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.995297 (E_RNA) where: Base-Base interactions energy: -104.471 where: short stacking energy: -80.611 Base-Backbone interact. energy: -2.159 local terms energy: -155.365390 where: bonds (distance) C4'-P energy: -56.718 bonds (distance) P-C4' energy: -49.318 flat angles C4'-P-C4' energy: -38.832 flat angles P-C4'-P energy: -14.722 tors. eta vs tors. theta energy: 4.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1005.314645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.314645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.314645 (E_RNA) where: Base-Base interactions energy: -656.135 where: short stacking energy: -295.314 Base-Backbone interact. energy: -3.222 local terms energy: -345.958418 where: bonds (distance) C4'-P energy: -60.372 bonds (distance) P-C4' energy: -65.628 flat angles C4'-P-C4' energy: -72.151 flat angles P-C4'-P energy: -49.516 tors. eta vs tors. theta energy: -98.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -847.339589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.339589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.339589 (E_RNA) where: Base-Base interactions energy: -557.435 where: short stacking energy: -218.545 Base-Backbone interact. energy: 0.377 local terms energy: -290.281905 where: bonds (distance) C4'-P energy: -53.287 bonds (distance) P-C4' energy: -64.675 flat angles C4'-P-C4' energy: -61.043 flat angles P-C4'-P energy: -45.721 tors. eta vs tors. theta energy: -65.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -871.504706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.504706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.504706 (E_RNA) where: Base-Base interactions energy: -568.826 where: short stacking energy: -239.502 Base-Backbone interact. energy: -2.630 local terms energy: -300.048604 where: bonds (distance) C4'-P energy: -60.907 bonds (distance) P-C4' energy: -63.330 flat angles C4'-P-C4' energy: -59.002 flat angles P-C4'-P energy: -46.378 tors. eta vs tors. theta energy: -70.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -747.557604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.557604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.557604 (E_RNA) where: Base-Base interactions energy: -485.796 where: short stacking energy: -198.594 Base-Backbone interact. energy: -4.708 local terms energy: -257.054098 where: bonds (distance) C4'-P energy: -51.108 bonds (distance) P-C4' energy: -54.848 flat angles C4'-P-C4' energy: -67.284 flat angles P-C4'-P energy: -37.645 tors. eta vs tors. theta energy: -46.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -674.169860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.169860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.169860 (E_RNA) where: Base-Base interactions energy: -413.560 where: short stacking energy: -206.353 Base-Backbone interact. energy: -0.710 local terms energy: -259.900030 where: bonds (distance) C4'-P energy: -61.192 bonds (distance) P-C4' energy: -52.917 flat angles C4'-P-C4' energy: -59.893 flat angles P-C4'-P energy: -39.571 tors. eta vs tors. theta energy: -46.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -575.614476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.614476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.614476 (E_RNA) where: Base-Base interactions energy: -352.604 where: short stacking energy: -184.672 Base-Backbone interact. energy: -0.617 local terms energy: -222.393541 where: bonds (distance) C4'-P energy: -50.926 bonds (distance) P-C4' energy: -54.662 flat angles C4'-P-C4' energy: -55.206 flat angles P-C4'-P energy: -23.912 tors. eta vs tors. theta energy: -37.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -421.336411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.336411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.336411 (E_RNA) where: Base-Base interactions energy: -221.296 where: short stacking energy: -108.068 Base-Backbone interact. energy: 2.146 local terms energy: -202.186186 where: bonds (distance) C4'-P energy: -48.488 bonds (distance) P-C4' energy: -66.859 flat angles C4'-P-C4' energy: -46.391 flat angles P-C4'-P energy: -34.007 tors. eta vs tors. theta energy: -6.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -302.225049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.225049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.225049 (E_RNA) where: Base-Base interactions energy: -131.930 where: short stacking energy: -83.665 Base-Backbone interact. energy: -0.938 local terms energy: -169.356802 where: bonds (distance) C4'-P energy: -52.615 bonds (distance) P-C4' energy: -50.175 flat angles C4'-P-C4' energy: -48.625 flat angles P-C4'-P energy: -23.739 tors. eta vs tors. theta energy: 5.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -269.671536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.671536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.671536 (E_RNA) where: Base-Base interactions energy: -85.348 where: short stacking energy: -84.941 Base-Backbone interact. energy: -1.303 local terms energy: -183.020741 where: bonds (distance) C4'-P energy: -38.248 bonds (distance) P-C4' energy: -57.781 flat angles C4'-P-C4' energy: -59.689 flat angles P-C4'-P energy: -31.106 tors. eta vs tors. theta energy: 3.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -241.168702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.168702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.168702 (E_RNA) where: Base-Base interactions energy: -79.938 where: short stacking energy: -58.481 Base-Backbone interact. energy: -1.780 local terms energy: -159.451347 where: bonds (distance) C4'-P energy: -56.636 bonds (distance) P-C4' energy: -54.442 flat angles C4'-P-C4' energy: -34.019 flat angles P-C4'-P energy: -29.629 tors. eta vs tors. theta energy: 15.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1009.870700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.870700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.870700 (E_RNA) where: Base-Base interactions energy: -669.283 where: short stacking energy: -306.973 Base-Backbone interact. energy: -1.584 local terms energy: -339.004194 where: bonds (distance) C4'-P energy: -56.745 bonds (distance) P-C4' energy: -60.758 flat angles C4'-P-C4' energy: -72.743 flat angles P-C4'-P energy: -50.911 tors. eta vs tors. theta energy: -97.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -903.223546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.223546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.223546 (E_RNA) where: Base-Base interactions energy: -583.049 where: short stacking energy: -246.124 Base-Backbone interact. energy: -2.005 local terms energy: -318.168714 where: bonds (distance) C4'-P energy: -65.725 bonds (distance) P-C4' energy: -69.781 flat angles C4'-P-C4' energy: -68.646 flat angles P-C4'-P energy: -47.982 tors. eta vs tors. theta energy: -66.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -786.985291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.985291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.985291 (E_RNA) where: Base-Base interactions energy: -493.365 where: short stacking energy: -239.853 Base-Backbone interact. energy: 0.460 local terms energy: -294.079893 where: bonds (distance) C4'-P energy: -63.028 bonds (distance) P-C4' energy: -66.842 flat angles C4'-P-C4' energy: -64.359 flat angles P-C4'-P energy: -38.404 tors. eta vs tors. theta energy: -61.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -774.500789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.500789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.500789 (E_RNA) where: Base-Base interactions energy: -497.178 where: short stacking energy: -191.203 Base-Backbone interact. energy: -1.263 local terms energy: -276.059637 where: bonds (distance) C4'-P energy: -54.994 bonds (distance) P-C4' energy: -62.837 flat angles C4'-P-C4' energy: -61.491 flat angles P-C4'-P energy: -37.913 tors. eta vs tors. theta energy: -58.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -643.322392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.322392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.322392 (E_RNA) where: Base-Base interactions energy: -378.416 where: short stacking energy: -187.544 Base-Backbone interact. energy: -2.615 local terms energy: -262.291053 where: bonds (distance) C4'-P energy: -56.998 bonds (distance) P-C4' energy: -56.758 flat angles C4'-P-C4' energy: -60.798 flat angles P-C4'-P energy: -39.364 tors. eta vs tors. theta energy: -48.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -606.609154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.609154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.609154 (E_RNA) where: Base-Base interactions energy: -377.941 where: short stacking energy: -181.359 Base-Backbone interact. energy: 0.783 local terms energy: -229.451116 where: bonds (distance) C4'-P energy: -44.867 bonds (distance) P-C4' energy: -52.010 flat angles C4'-P-C4' energy: -57.254 flat angles P-C4'-P energy: -28.462 tors. eta vs tors. theta energy: -46.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -364.386091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.386091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.386091 (E_RNA) where: Base-Base interactions energy: -151.777 where: short stacking energy: -99.482 Base-Backbone interact. energy: -2.393 local terms energy: -210.216121 where: bonds (distance) C4'-P energy: -52.944 bonds (distance) P-C4' energy: -66.005 flat angles C4'-P-C4' energy: -46.286 flat angles P-C4'-P energy: -34.920 tors. eta vs tors. theta energy: -10.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -341.993206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.993206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.993206 (E_RNA) where: Base-Base interactions energy: -173.466 where: short stacking energy: -93.382 Base-Backbone interact. energy: 0.298 local terms energy: -168.824514 where: bonds (distance) C4'-P energy: -29.286 bonds (distance) P-C4' energy: -50.280 flat angles C4'-P-C4' energy: -38.774 flat angles P-C4'-P energy: -33.833 tors. eta vs tors. theta energy: -16.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -273.225523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.225523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.225523 (E_RNA) where: Base-Base interactions energy: -91.120 where: short stacking energy: -88.701 Base-Backbone interact. energy: -2.293 local terms energy: -179.811688 where: bonds (distance) C4'-P energy: -48.626 bonds (distance) P-C4' energy: -60.010 flat angles C4'-P-C4' energy: -48.128 flat angles P-C4'-P energy: -27.141 tors. eta vs tors. theta energy: 4.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -269.094437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.094437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.094437 (E_RNA) where: Base-Base interactions energy: -86.099 where: short stacking energy: -72.355 Base-Backbone interact. energy: -1.989 local terms energy: -181.006731 where: bonds (distance) C4'-P energy: -56.181 bonds (distance) P-C4' energy: -63.652 flat angles C4'-P-C4' energy: -47.663 flat angles P-C4'-P energy: -23.025 tors. eta vs tors. theta energy: 9.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -998.204929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.204929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.204929 (E_RNA) where: Base-Base interactions energy: -669.023 where: short stacking energy: -289.347 Base-Backbone interact. energy: -0.060 local terms energy: -329.121683 where: bonds (distance) C4'-P energy: -63.151 bonds (distance) P-C4' energy: -55.427 flat angles C4'-P-C4' energy: -71.568 flat angles P-C4'-P energy: -45.222 tors. eta vs tors. theta energy: -93.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -937.341278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.341278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.341278 (E_RNA) where: Base-Base interactions energy: -623.471 where: short stacking energy: -259.759 Base-Backbone interact. energy: -1.131 local terms energy: -312.738846 where: bonds (distance) C4'-P energy: -71.043 bonds (distance) P-C4' energy: -57.149 flat angles C4'-P-C4' energy: -69.923 flat angles P-C4'-P energy: -43.793 tors. eta vs tors. theta energy: -70.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -798.729013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.729013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.729013 (E_RNA) where: Base-Base interactions energy: -519.189 where: short stacking energy: -229.110 Base-Backbone interact. energy: 1.930 local terms energy: -281.469335 where: bonds (distance) C4'-P energy: -53.458 bonds (distance) P-C4' energy: -55.942 flat angles C4'-P-C4' energy: -65.279 flat angles P-C4'-P energy: -48.440 tors. eta vs tors. theta energy: -58.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -774.354264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.354264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.354264 (E_RNA) where: Base-Base interactions energy: -500.324 where: short stacking energy: -205.979 Base-Backbone interact. energy: -1.278 local terms energy: -272.752281 where: bonds (distance) C4'-P energy: -60.788 bonds (distance) P-C4' energy: -58.386 flat angles C4'-P-C4' energy: -66.694 flat angles P-C4'-P energy: -35.837 tors. eta vs tors. theta energy: -51.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -624.254513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.254513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.254513 (E_RNA) where: Base-Base interactions energy: -369.010 where: short stacking energy: -179.907 Base-Backbone interact. energy: -0.051 local terms energy: -255.193431 where: bonds (distance) C4'-P energy: -60.673 bonds (distance) P-C4' energy: -53.504 flat angles C4'-P-C4' energy: -57.128 flat angles P-C4'-P energy: -37.336 tors. eta vs tors. theta energy: -46.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -630.786015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.786015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.786015 (E_RNA) where: Base-Base interactions energy: -391.100 where: short stacking energy: -167.344 Base-Backbone interact. energy: -1.070 local terms energy: -238.615978 where: bonds (distance) C4'-P energy: -45.064 bonds (distance) P-C4' energy: -68.292 flat angles C4'-P-C4' energy: -53.411 flat angles P-C4'-P energy: -40.754 tors. eta vs tors. theta energy: -31.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -422.896869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.896869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.896869 (E_RNA) where: Base-Base interactions energy: -216.778 where: short stacking energy: -112.775 Base-Backbone interact. energy: -0.592 local terms energy: -205.526740 where: bonds (distance) C4'-P energy: -54.693 bonds (distance) P-C4' energy: -61.946 flat angles C4'-P-C4' energy: -44.762 flat angles P-C4'-P energy: -37.878 tors. eta vs tors. theta energy: -6.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -397.741578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.741578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.741578 (E_RNA) where: Base-Base interactions energy: -209.985 where: short stacking energy: -93.475 Base-Backbone interact. energy: -0.858 local terms energy: -186.898773 where: bonds (distance) C4'-P energy: -56.727 bonds (distance) P-C4' energy: -40.736 flat angles C4'-P-C4' energy: -46.098 flat angles P-C4'-P energy: -40.182 tors. eta vs tors. theta energy: -3.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -281.976422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.976422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.976422 (E_RNA) where: Base-Base interactions energy: -73.065 where: short stacking energy: -53.124 Base-Backbone interact. energy: -1.114 local terms energy: -207.796882 where: bonds (distance) C4'-P energy: -59.730 bonds (distance) P-C4' energy: -56.442 flat angles C4'-P-C4' energy: -53.462 flat angles P-C4'-P energy: -41.079 tors. eta vs tors. theta energy: 2.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -258.748189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.748189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.748189 (E_RNA) where: Base-Base interactions energy: -87.630 where: short stacking energy: -57.623 Base-Backbone interact. energy: -2.586 local terms energy: -168.532803 where: bonds (distance) C4'-P energy: -52.173 bonds (distance) P-C4' energy: -54.977 flat angles C4'-P-C4' energy: -50.501 flat angles P-C4'-P energy: -18.732 tors. eta vs tors. theta energy: 7.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -987.861025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.861025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.861025 (E_RNA) where: Base-Base interactions energy: -644.519 where: short stacking energy: -288.206 Base-Backbone interact. energy: 0.258 local terms energy: -343.599641 where: bonds (distance) C4'-P energy: -60.900 bonds (distance) P-C4' energy: -68.126 flat angles C4'-P-C4' energy: -77.160 flat angles P-C4'-P energy: -44.189 tors. eta vs tors. theta energy: -93.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -929.559943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.559943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.559943 (E_RNA) where: Base-Base interactions energy: -629.503 where: short stacking energy: -271.367 Base-Backbone interact. energy: -1.065 local terms energy: -298.991850 where: bonds (distance) C4'-P energy: -62.097 bonds (distance) P-C4' energy: -59.321 flat angles C4'-P-C4' energy: -61.727 flat angles P-C4'-P energy: -42.361 tors. eta vs tors. theta energy: -73.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -815.808862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.808862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.808862 (E_RNA) where: Base-Base interactions energy: -535.735 where: short stacking energy: -215.441 Base-Backbone interact. energy: -4.315 local terms energy: -275.758703 where: bonds (distance) C4'-P energy: -54.275 bonds (distance) P-C4' energy: -56.534 flat angles C4'-P-C4' energy: -59.582 flat angles P-C4'-P energy: -47.898 tors. eta vs tors. theta energy: -57.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -764.853560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.853560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.853560 (E_RNA) where: Base-Base interactions energy: -494.592 where: short stacking energy: -204.741 Base-Backbone interact. energy: -0.088 local terms energy: -270.173565 where: bonds (distance) C4'-P energy: -55.078 bonds (distance) P-C4' energy: -56.632 flat angles C4'-P-C4' energy: -64.420 flat angles P-C4'-P energy: -40.853 tors. eta vs tors. theta energy: -53.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -629.078805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.078805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.078805 (E_RNA) where: Base-Base interactions energy: -380.783 where: short stacking energy: -200.502 Base-Backbone interact. energy: 0.099 local terms energy: -248.393945 where: bonds (distance) C4'-P energy: -56.942 bonds (distance) P-C4' energy: -53.666 flat angles C4'-P-C4' energy: -65.039 flat angles P-C4'-P energy: -31.552 tors. eta vs tors. theta energy: -41.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -629.977583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.977583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.977583 (E_RNA) where: Base-Base interactions energy: -376.906 where: short stacking energy: -175.634 Base-Backbone interact. energy: -0.158 local terms energy: -252.913619 where: bonds (distance) C4'-P energy: -53.913 bonds (distance) P-C4' energy: -49.287 flat angles C4'-P-C4' energy: -69.675 flat angles P-C4'-P energy: -40.947 tors. eta vs tors. theta energy: -39.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -387.564237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.564237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.564237 (E_RNA) where: Base-Base interactions energy: -209.592 where: short stacking energy: -127.250 Base-Backbone interact. energy: -2.387 local terms energy: -175.585235 where: bonds (distance) C4'-P energy: -48.446 bonds (distance) P-C4' energy: -47.446 flat angles C4'-P-C4' energy: -42.740 flat angles P-C4'-P energy: -13.241 tors. eta vs tors. theta energy: -23.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -381.806076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.806076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.806076 (E_RNA) where: Base-Base interactions energy: -190.012 where: short stacking energy: -96.100 Base-Backbone interact. energy: -0.308 local terms energy: -191.486298 where: bonds (distance) C4'-P energy: -54.179 bonds (distance) P-C4' energy: -57.960 flat angles C4'-P-C4' energy: -42.934 flat angles P-C4'-P energy: -38.091 tors. eta vs tors. theta energy: 1.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -263.396633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.396633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.396633 (E_RNA) where: Base-Base interactions energy: -106.828 where: short stacking energy: -71.407 Base-Backbone interact. energy: 2.708 local terms energy: -159.276725 where: bonds (distance) C4'-P energy: -48.768 bonds (distance) P-C4' energy: -51.167 flat angles C4'-P-C4' energy: -27.072 flat angles P-C4'-P energy: -38.421 tors. eta vs tors. theta energy: 6.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -252.636823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.636823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.636823 (E_RNA) where: Base-Base interactions energy: -66.803 where: short stacking energy: -43.017 Base-Backbone interact. energy: -1.230 local terms energy: -184.603825 where: bonds (distance) C4'-P energy: -52.890 bonds (distance) P-C4' energy: -63.904 flat angles C4'-P-C4' energy: -45.974 flat angles P-C4'-P energy: -29.261 tors. eta vs tors. theta energy: 7.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1005.662129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.662129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.662129 (E_RNA) where: Base-Base interactions energy: -667.881 where: short stacking energy: -302.596 Base-Backbone interact. energy: 0.369 local terms energy: -338.150410 where: bonds (distance) C4'-P energy: -64.341 bonds (distance) P-C4' energy: -65.339 flat angles C4'-P-C4' energy: -72.210 flat angles P-C4'-P energy: -39.049 tors. eta vs tors. theta energy: -97.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -950.358898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.358898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.358898 (E_RNA) where: Base-Base interactions energy: -622.352 where: short stacking energy: -271.710 Base-Backbone interact. energy: 2.546 local terms energy: -330.552632 where: bonds (distance) C4'-P energy: -68.105 bonds (distance) P-C4' energy: -69.401 flat angles C4'-P-C4' energy: -62.791 flat angles P-C4'-P energy: -48.995 tors. eta vs tors. theta energy: -81.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -855.038797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.038797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.038797 (E_RNA) where: Base-Base interactions energy: -565.218 where: short stacking energy: -243.771 Base-Backbone interact. energy: -1.458 local terms energy: -288.362675 where: bonds (distance) C4'-P energy: -59.220 bonds (distance) P-C4' energy: -57.611 flat angles C4'-P-C4' energy: -61.327 flat angles P-C4'-P energy: -41.006 tors. eta vs tors. theta energy: -69.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -744.262523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.262523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.262523 (E_RNA) where: Base-Base interactions energy: -473.055 where: short stacking energy: -188.947 Base-Backbone interact. energy: -1.417 local terms energy: -269.790606 where: bonds (distance) C4'-P energy: -62.254 bonds (distance) P-C4' energy: -56.292 flat angles C4'-P-C4' energy: -54.161 flat angles P-C4'-P energy: -46.387 tors. eta vs tors. theta energy: -50.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -678.082010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.082010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.082010 (E_RNA) where: Base-Base interactions energy: -417.878 where: short stacking energy: -184.155 Base-Backbone interact. energy: -1.722 local terms energy: -258.482502 where: bonds (distance) C4'-P energy: -49.281 bonds (distance) P-C4' energy: -56.760 flat angles C4'-P-C4' energy: -66.465 flat angles P-C4'-P energy: -38.378 tors. eta vs tors. theta energy: -47.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -642.419299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.419299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.419299 (E_RNA) where: Base-Base interactions energy: -394.412 where: short stacking energy: -187.761 Base-Backbone interact. energy: 0.955 local terms energy: -248.961917 where: bonds (distance) C4'-P energy: -43.224 bonds (distance) P-C4' energy: -54.085 flat angles C4'-P-C4' energy: -58.526 flat angles P-C4'-P energy: -38.465 tors. eta vs tors. theta energy: -54.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -450.668650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.668650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.668650 (E_RNA) where: Base-Base interactions energy: -244.094 where: short stacking energy: -107.548 Base-Backbone interact. energy: 3.100 local terms energy: -209.675168 where: bonds (distance) C4'-P energy: -60.826 bonds (distance) P-C4' energy: -60.532 flat angles C4'-P-C4' energy: -50.380 flat angles P-C4'-P energy: -23.301 tors. eta vs tors. theta energy: -14.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -341.865571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.865571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.865571 (E_RNA) where: Base-Base interactions energy: -153.868 where: short stacking energy: -96.496 Base-Backbone interact. energy: 0.302 local terms energy: -188.299688 where: bonds (distance) C4'-P energy: -48.775 bonds (distance) P-C4' energy: -57.681 flat angles C4'-P-C4' energy: -52.148 flat angles P-C4'-P energy: -31.066 tors. eta vs tors. theta energy: 1.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -261.952392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.952392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.952392 (E_RNA) where: Base-Base interactions energy: -70.366 where: short stacking energy: -51.724 Base-Backbone interact. energy: -0.903 local terms energy: -190.683650 where: bonds (distance) C4'-P energy: -52.040 bonds (distance) P-C4' energy: -66.806 flat angles C4'-P-C4' energy: -57.936 flat angles P-C4'-P energy: -27.686 tors. eta vs tors. theta energy: 13.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -250.913181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.913181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.913181 (E_RNA) where: Base-Base interactions energy: -87.046 where: short stacking energy: -78.248 Base-Backbone interact. energy: 0.379 local terms energy: -164.246816 where: bonds (distance) C4'-P energy: -50.884 bonds (distance) P-C4' energy: -58.370 flat angles C4'-P-C4' energy: -37.466 flat angles P-C4'-P energy: -25.060 tors. eta vs tors. theta energy: 7.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1011.554917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.554917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.554917 (E_RNA) where: Base-Base interactions energy: -673.524 where: short stacking energy: -310.137 Base-Backbone interact. energy: -1.217 local terms energy: -336.813273 where: bonds (distance) C4'-P energy: -68.667 bonds (distance) P-C4' energy: -66.733 flat angles C4'-P-C4' energy: -63.690 flat angles P-C4'-P energy: -43.351 tors. eta vs tors. theta energy: -94.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -926.661263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.661263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.661263 (E_RNA) where: Base-Base interactions energy: -627.914 where: short stacking energy: -274.635 Base-Backbone interact. energy: 3.658 local terms energy: -302.405263 where: bonds (distance) C4'-P energy: -63.173 bonds (distance) P-C4' energy: -57.196 flat angles C4'-P-C4' energy: -61.657 flat angles P-C4'-P energy: -42.593 tors. eta vs tors. theta energy: -77.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -840.851907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.851907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.851907 (E_RNA) where: Base-Base interactions energy: -547.734 where: short stacking energy: -246.724 Base-Backbone interact. energy: 1.431 local terms energy: -294.549070 where: bonds (distance) C4'-P energy: -56.601 bonds (distance) P-C4' energy: -69.920 flat angles C4'-P-C4' energy: -69.302 flat angles P-C4'-P energy: -30.739 tors. eta vs tors. theta energy: -67.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -750.075701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.075701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.075701 (E_RNA) where: Base-Base interactions energy: -480.988 where: short stacking energy: -219.763 Base-Backbone interact. energy: -1.095 local terms energy: -267.992419 where: bonds (distance) C4'-P energy: -58.494 bonds (distance) P-C4' energy: -55.294 flat angles C4'-P-C4' energy: -62.448 flat angles P-C4'-P energy: -35.787 tors. eta vs tors. theta energy: -55.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -649.362745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.362745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.362745 (E_RNA) where: Base-Base interactions energy: -399.994 where: short stacking energy: -179.850 Base-Backbone interact. energy: -0.410 local terms energy: -248.958519 where: bonds (distance) C4'-P energy: -57.476 bonds (distance) P-C4' energy: -55.485 flat angles C4'-P-C4' energy: -61.856 flat angles P-C4'-P energy: -38.260 tors. eta vs tors. theta energy: -35.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -598.487692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.487692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.487692 (E_RNA) where: Base-Base interactions energy: -353.064 where: short stacking energy: -177.373 Base-Backbone interact. energy: -1.329 local terms energy: -244.094752 where: bonds (distance) C4'-P energy: -57.452 bonds (distance) P-C4' energy: -53.602 flat angles C4'-P-C4' energy: -60.341 flat angles P-C4'-P energy: -34.238 tors. eta vs tors. theta energy: -38.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -429.326416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.326416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.326416 (E_RNA) where: Base-Base interactions energy: -242.195 where: short stacking energy: -111.407 Base-Backbone interact. energy: -0.582 local terms energy: -186.549488 where: bonds (distance) C4'-P energy: -48.757 bonds (distance) P-C4' energy: -55.175 flat angles C4'-P-C4' energy: -58.273 flat angles P-C4'-P energy: -19.962 tors. eta vs tors. theta energy: -4.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -386.338104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.338104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.338104 (E_RNA) where: Base-Base interactions energy: -183.246 where: short stacking energy: -116.456 Base-Backbone interact. energy: 0.875 local terms energy: -203.967025 where: bonds (distance) C4'-P energy: -54.471 bonds (distance) P-C4' energy: -69.953 flat angles C4'-P-C4' energy: -46.672 flat angles P-C4'-P energy: -26.483 tors. eta vs tors. theta energy: -6.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -279.409934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.409934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.409934 (E_RNA) where: Base-Base interactions energy: -98.724 where: short stacking energy: -90.355 Base-Backbone interact. energy: -0.566 local terms energy: -180.119681 where: bonds (distance) C4'-P energy: -51.568 bonds (distance) P-C4' energy: -51.968 flat angles C4'-P-C4' energy: -51.931 flat angles P-C4'-P energy: -25.319 tors. eta vs tors. theta energy: 0.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -238.842965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.842965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.842965 (E_RNA) where: Base-Base interactions energy: -69.279 where: short stacking energy: -46.293 Base-Backbone interact. energy: -0.772 local terms energy: -168.792077 where: bonds (distance) C4'-P energy: -55.015 bonds (distance) P-C4' energy: -54.965 flat angles C4'-P-C4' energy: -48.347 flat angles P-C4'-P energy: -24.462 tors. eta vs tors. theta energy: 13.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1011.964565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.964565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.964565 (E_RNA) where: Base-Base interactions energy: -661.767 where: short stacking energy: -292.537 Base-Backbone interact. energy: -3.165 local terms energy: -347.032603 where: bonds (distance) C4'-P energy: -64.811 bonds (distance) P-C4' energy: -65.253 flat angles C4'-P-C4' energy: -76.782 flat angles P-C4'-P energy: -42.900 tors. eta vs tors. theta energy: -97.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -933.895779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.895779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.895779 (E_RNA) where: Base-Base interactions energy: -623.101 where: short stacking energy: -263.172 Base-Backbone interact. energy: -1.485 local terms energy: -309.310477 where: bonds (distance) C4'-P energy: -55.912 bonds (distance) P-C4' energy: -64.973 flat angles C4'-P-C4' energy: -69.412 flat angles P-C4'-P energy: -48.198 tors. eta vs tors. theta energy: -70.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -806.761268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.761268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.761268 (E_RNA) where: Base-Base interactions energy: -529.885 where: short stacking energy: -196.360 Base-Backbone interact. energy: 2.160 local terms energy: -279.035874 where: bonds (distance) C4'-P energy: -61.847 bonds (distance) P-C4' energy: -56.428 flat angles C4'-P-C4' energy: -65.328 flat angles P-C4'-P energy: -45.203 tors. eta vs tors. theta energy: -50.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -762.212431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.212431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.212431 (E_RNA) where: Base-Base interactions energy: -492.856 where: short stacking energy: -212.598 Base-Backbone interact. energy: -1.691 local terms energy: -267.665186 where: bonds (distance) C4'-P energy: -58.203 bonds (distance) P-C4' energy: -47.384 flat angles C4'-P-C4' energy: -66.610 flat angles P-C4'-P energy: -34.428 tors. eta vs tors. theta energy: -61.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -664.262826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.262826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.262826 (E_RNA) where: Base-Base interactions energy: -412.381 where: short stacking energy: -173.511 Base-Backbone interact. energy: -1.722 local terms energy: -250.160057 where: bonds (distance) C4'-P energy: -58.467 bonds (distance) P-C4' energy: -49.580 flat angles C4'-P-C4' energy: -58.236 flat angles P-C4'-P energy: -39.743 tors. eta vs tors. theta energy: -44.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -588.627612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.627612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.627612 (E_RNA) where: Base-Base interactions energy: -358.919 where: short stacking energy: -181.870 Base-Backbone interact. energy: -0.641 local terms energy: -229.067100 where: bonds (distance) C4'-P energy: -45.287 bonds (distance) P-C4' energy: -57.825 flat angles C4'-P-C4' energy: -58.870 flat angles P-C4'-P energy: -32.408 tors. eta vs tors. theta energy: -34.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -403.920619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.920619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.920619 (E_RNA) where: Base-Base interactions energy: -204.295 where: short stacking energy: -116.321 Base-Backbone interact. energy: -0.949 local terms energy: -198.676485 where: bonds (distance) C4'-P energy: -53.864 bonds (distance) P-C4' energy: -57.919 flat angles C4'-P-C4' energy: -47.935 flat angles P-C4'-P energy: -29.289 tors. eta vs tors. theta energy: -9.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -361.872340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.872340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.872340 (E_RNA) where: Base-Base interactions energy: -156.429 where: short stacking energy: -92.350 Base-Backbone interact. energy: 2.797 local terms energy: -208.240765 where: bonds (distance) C4'-P energy: -63.245 bonds (distance) P-C4' energy: -55.486 flat angles C4'-P-C4' energy: -50.049 flat angles P-C4'-P energy: -33.612 tors. eta vs tors. theta energy: -5.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -289.948483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.948483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.948483 (E_RNA) where: Base-Base interactions energy: -126.939 where: short stacking energy: -105.488 Base-Backbone interact. energy: -0.228 local terms energy: -162.781345 where: bonds (distance) C4'-P energy: -44.769 bonds (distance) P-C4' energy: -55.098 flat angles C4'-P-C4' energy: -43.591 flat angles P-C4'-P energy: -28.568 tors. eta vs tors. theta energy: 9.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -257.738050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.738050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.738050 (E_RNA) where: Base-Base interactions energy: -91.472 where: short stacking energy: -69.240 Base-Backbone interact. energy: -0.674 local terms energy: -165.591600 where: bonds (distance) C4'-P energy: -55.037 bonds (distance) P-C4' energy: -52.717 flat angles C4'-P-C4' energy: -47.357 flat angles P-C4'-P energy: -28.223 tors. eta vs tors. theta energy: 17.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1012.798463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.798463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.798463 (E_RNA) where: Base-Base interactions energy: -676.300 where: short stacking energy: -281.730 Base-Backbone interact. energy: -4.096 local terms energy: -332.402257 where: bonds (distance) C4'-P energy: -58.661 bonds (distance) P-C4' energy: -66.986 flat angles C4'-P-C4' energy: -66.414 flat angles P-C4'-P energy: -47.845 tors. eta vs tors. theta energy: -92.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -932.708320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.708320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.708320 (E_RNA) where: Base-Base interactions energy: -613.381 where: short stacking energy: -258.255 Base-Backbone interact. energy: -1.426 local terms energy: -317.902098 where: bonds (distance) C4'-P energy: -63.922 bonds (distance) P-C4' energy: -66.163 flat angles C4'-P-C4' energy: -67.159 flat angles P-C4'-P energy: -44.201 tors. eta vs tors. theta energy: -76.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -833.137233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.137233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.137233 (E_RNA) where: Base-Base interactions energy: -548.325 where: short stacking energy: -217.757 Base-Backbone interact. energy: 0.365 local terms energy: -285.177379 where: bonds (distance) C4'-P energy: -55.981 bonds (distance) P-C4' energy: -64.078 flat angles C4'-P-C4' energy: -64.880 flat angles P-C4'-P energy: -42.820 tors. eta vs tors. theta energy: -57.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -771.127805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.127805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.127805 (E_RNA) where: Base-Base interactions energy: -477.864 where: short stacking energy: -205.874 Base-Backbone interact. energy: -2.055 local terms energy: -291.208634 where: bonds (distance) C4'-P energy: -59.675 bonds (distance) P-C4' energy: -65.062 flat angles C4'-P-C4' energy: -67.777 flat angles P-C4'-P energy: -40.881 tors. eta vs tors. theta energy: -57.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -704.330333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.330333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.330333 (E_RNA) where: Base-Base interactions energy: -433.420 where: short stacking energy: -191.314 Base-Backbone interact. energy: -1.932 local terms energy: -268.978256 where: bonds (distance) C4'-P energy: -62.398 bonds (distance) P-C4' energy: -54.937 flat angles C4'-P-C4' energy: -63.287 flat angles P-C4'-P energy: -41.975 tors. eta vs tors. theta energy: -46.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -618.907840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.907840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.907840 (E_RNA) where: Base-Base interactions energy: -364.960 where: short stacking energy: -173.558 Base-Backbone interact. energy: -1.505 local terms energy: -252.442034 where: bonds (distance) C4'-P energy: -48.193 bonds (distance) P-C4' energy: -60.894 flat angles C4'-P-C4' energy: -59.169 flat angles P-C4'-P energy: -39.759 tors. eta vs tors. theta energy: -44.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -471.651496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.651496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.651496 (E_RNA) where: Base-Base interactions energy: -262.142 where: short stacking energy: -145.905 Base-Backbone interact. energy: 0.472 local terms energy: -209.981708 where: bonds (distance) C4'-P energy: -53.846 bonds (distance) P-C4' energy: -52.709 flat angles C4'-P-C4' energy: -42.173 flat angles P-C4'-P energy: -30.521 tors. eta vs tors. theta energy: -30.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -358.038652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.038652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.038652 (E_RNA) where: Base-Base interactions energy: -168.938 where: short stacking energy: -118.036 Base-Backbone interact. energy: 0.495 local terms energy: -189.596404 where: bonds (distance) C4'-P energy: -56.011 bonds (distance) P-C4' energy: -38.138 flat angles C4'-P-C4' energy: -52.937 flat angles P-C4'-P energy: -32.220 tors. eta vs tors. theta energy: -10.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -273.548206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.548206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.548206 (E_RNA) where: Base-Base interactions energy: -94.223 where: short stacking energy: -78.259 Base-Backbone interact. energy: -2.145 local terms energy: -177.179801 where: bonds (distance) C4'-P energy: -43.968 bonds (distance) P-C4' energy: -58.994 flat angles C4'-P-C4' energy: -38.141 flat angles P-C4'-P energy: -33.191 tors. eta vs tors. theta energy: -2.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -239.585425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.585425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.585425 (E_RNA) where: Base-Base interactions energy: -78.350 where: short stacking energy: -70.787 Base-Backbone interact. energy: -1.400 local terms energy: -159.835854 where: bonds (distance) C4'-P energy: -46.914 bonds (distance) P-C4' energy: -43.234 flat angles C4'-P-C4' energy: -52.228 flat angles P-C4'-P energy: -27.011 tors. eta vs tors. theta energy: 9.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1022.811304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.811304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.811304 (E_RNA) where: Base-Base interactions energy: -691.276 where: short stacking energy: -283.208 Base-Backbone interact. energy: -0.522 local terms energy: -331.013637 where: bonds (distance) C4'-P energy: -61.032 bonds (distance) P-C4' energy: -58.327 flat angles C4'-P-C4' energy: -66.570 flat angles P-C4'-P energy: -55.332 tors. eta vs tors. theta energy: -89.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -937.813510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.813510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.813510 (E_RNA) where: Base-Base interactions energy: -610.575 where: short stacking energy: -256.411 Base-Backbone interact. energy: -0.727 local terms energy: -326.512382 where: bonds (distance) C4'-P energy: -63.742 bonds (distance) P-C4' energy: -66.868 flat angles C4'-P-C4' energy: -69.722 flat angles P-C4'-P energy: -51.639 tors. eta vs tors. theta energy: -74.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -839.716377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.716377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.716377 (E_RNA) where: Base-Base interactions energy: -540.312 where: short stacking energy: -227.456 Base-Backbone interact. energy: -0.694 local terms energy: -298.709728 where: bonds (distance) C4'-P energy: -59.137 bonds (distance) P-C4' energy: -53.424 flat angles C4'-P-C4' energy: -67.294 flat angles P-C4'-P energy: -46.050 tors. eta vs tors. theta energy: -72.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -767.374789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.374789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.374789 (E_RNA) where: Base-Base interactions energy: -499.827 where: short stacking energy: -208.396 Base-Backbone interact. energy: 1.905 local terms energy: -269.453174 where: bonds (distance) C4'-P energy: -56.017 bonds (distance) P-C4' energy: -60.128 flat angles C4'-P-C4' energy: -57.707 flat angles P-C4'-P energy: -44.395 tors. eta vs tors. theta energy: -51.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -715.935400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.935400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.935400 (E_RNA) where: Base-Base interactions energy: -436.302 where: short stacking energy: -196.510 Base-Backbone interact. energy: -2.357 local terms energy: -277.276251 where: bonds (distance) C4'-P energy: -50.188 bonds (distance) P-C4' energy: -65.089 flat angles C4'-P-C4' energy: -60.616 flat angles P-C4'-P energy: -41.404 tors. eta vs tors. theta energy: -59.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -638.260202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.260202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.260202 (E_RNA) where: Base-Base interactions energy: -386.522 where: short stacking energy: -182.946 Base-Backbone interact. energy: -1.690 local terms energy: -250.047998 where: bonds (distance) C4'-P energy: -56.537 bonds (distance) P-C4' energy: -52.473 flat angles C4'-P-C4' energy: -67.282 flat angles P-C4'-P energy: -26.558 tors. eta vs tors. theta energy: -47.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -506.809699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.809699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.809699 (E_RNA) where: Base-Base interactions energy: -292.711 where: short stacking energy: -132.112 Base-Backbone interact. energy: -0.892 local terms energy: -213.206676 where: bonds (distance) C4'-P energy: -60.339 bonds (distance) P-C4' energy: -56.844 flat angles C4'-P-C4' energy: -47.152 flat angles P-C4'-P energy: -32.620 tors. eta vs tors. theta energy: -16.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -339.837144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.837144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.837144 (E_RNA) where: Base-Base interactions energy: -148.357 where: short stacking energy: -97.037 Base-Backbone interact. energy: -0.459 local terms energy: -191.021519 where: bonds (distance) C4'-P energy: -54.499 bonds (distance) P-C4' energy: -56.177 flat angles C4'-P-C4' energy: -42.132 flat angles P-C4'-P energy: -30.548 tors. eta vs tors. theta energy: -7.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -260.509465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.509465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.509465 (E_RNA) where: Base-Base interactions energy: -98.256 where: short stacking energy: -77.435 Base-Backbone interact. energy: 2.490 local terms energy: -164.742992 where: bonds (distance) C4'-P energy: -56.961 bonds (distance) P-C4' energy: -49.967 flat angles C4'-P-C4' energy: -39.577 flat angles P-C4'-P energy: -23.643 tors. eta vs tors. theta energy: 5.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -246.575763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.575763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.575763 (E_RNA) where: Base-Base interactions energy: -65.372 where: short stacking energy: -59.970 Base-Backbone interact. energy: 0.694 local terms energy: -181.898191 where: bonds (distance) C4'-P energy: -57.770 bonds (distance) P-C4' energy: -54.824 flat angles C4'-P-C4' energy: -42.748 flat angles P-C4'-P energy: -35.651 tors. eta vs tors. theta energy: 9.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1040.786605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.786605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.786605 (E_RNA) where: Base-Base interactions energy: -710.829 where: short stacking energy: -318.270 Base-Backbone interact. energy: -1.188 local terms energy: -328.769765 where: bonds (distance) C4'-P energy: -61.539 bonds (distance) P-C4' energy: -58.081 flat angles C4'-P-C4' energy: -64.475 flat angles P-C4'-P energy: -44.222 tors. eta vs tors. theta energy: -100.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -897.071943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.071943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.071943 (E_RNA) where: Base-Base interactions energy: -600.051 where: short stacking energy: -249.552 Base-Backbone interact. energy: -0.736 local terms energy: -296.285641 where: bonds (distance) C4'-P energy: -52.817 bonds (distance) P-C4' energy: -64.775 flat angles C4'-P-C4' energy: -67.581 flat angles P-C4'-P energy: -34.523 tors. eta vs tors. theta energy: -76.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -811.812646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.812646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.812646 (E_RNA) where: Base-Base interactions energy: -497.567 where: short stacking energy: -215.997 Base-Backbone interact. energy: 0.274 local terms energy: -314.519616 where: bonds (distance) C4'-P energy: -60.840 bonds (distance) P-C4' energy: -64.811 flat angles C4'-P-C4' energy: -71.921 flat angles P-C4'-P energy: -48.027 tors. eta vs tors. theta energy: -68.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -758.162892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.162892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.162892 (E_RNA) where: Base-Base interactions energy: -484.256 where: short stacking energy: -222.631 Base-Backbone interact. energy: -2.268 local terms energy: -271.638494 where: bonds (distance) C4'-P energy: -64.364 bonds (distance) P-C4' energy: -61.849 flat angles C4'-P-C4' energy: -51.513 flat angles P-C4'-P energy: -40.210 tors. eta vs tors. theta energy: -53.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -750.289213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.289213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.289213 (E_RNA) where: Base-Base interactions energy: -479.995 where: short stacking energy: -207.553 Base-Backbone interact. energy: 0.776 local terms energy: -271.070108 where: bonds (distance) C4'-P energy: -59.484 bonds (distance) P-C4' energy: -57.681 flat angles C4'-P-C4' energy: -66.591 flat angles P-C4'-P energy: -34.088 tors. eta vs tors. theta energy: -53.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -617.454605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.454605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.454605 (E_RNA) where: Base-Base interactions energy: -367.092 where: short stacking energy: -155.844 Base-Backbone interact. energy: -1.836 local terms energy: -248.526566 where: bonds (distance) C4'-P energy: -50.183 bonds (distance) P-C4' energy: -66.113 flat angles C4'-P-C4' energy: -64.589 flat angles P-C4'-P energy: -41.310 tors. eta vs tors. theta energy: -26.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -477.559132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.559132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.559132 (E_RNA) where: Base-Base interactions energy: -293.475 where: short stacking energy: -127.991 Base-Backbone interact. energy: 3.925 local terms energy: -188.009311 where: bonds (distance) C4'-P energy: -43.929 bonds (distance) P-C4' energy: -44.037 flat angles C4'-P-C4' energy: -52.832 flat angles P-C4'-P energy: -31.453 tors. eta vs tors. theta energy: -15.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -350.503136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.503136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.503136 (E_RNA) where: Base-Base interactions energy: -164.867 where: short stacking energy: -97.461 Base-Backbone interact. energy: -1.022 local terms energy: -184.614120 where: bonds (distance) C4'-P energy: -39.831 bonds (distance) P-C4' energy: -55.497 flat angles C4'-P-C4' energy: -53.299 flat angles P-C4'-P energy: -33.501 tors. eta vs tors. theta energy: -2.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -265.491278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.491278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.491278 (E_RNA) where: Base-Base interactions energy: -104.193 where: short stacking energy: -63.599 Base-Backbone interact. energy: -1.751 local terms energy: -159.547182 where: bonds (distance) C4'-P energy: -59.357 bonds (distance) P-C4' energy: -45.553 flat angles C4'-P-C4' energy: -33.874 flat angles P-C4'-P energy: -31.115 tors. eta vs tors. theta energy: 10.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -269.668802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.668802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.668802 (E_RNA) where: Base-Base interactions energy: -63.884 where: short stacking energy: -54.050 Base-Backbone interact. energy: 0.453 local terms energy: -206.237527 where: bonds (distance) C4'-P energy: -63.114 bonds (distance) P-C4' energy: -65.358 flat angles C4'-P-C4' energy: -49.371 flat angles P-C4'-P energy: -39.775 tors. eta vs tors. theta energy: 11.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1032.453740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.453740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.453740 (E_RNA) where: Base-Base interactions energy: -688.547 where: short stacking energy: -311.133 Base-Backbone interact. energy: 1.428 local terms energy: -345.334735 where: bonds (distance) C4'-P energy: -59.636 bonds (distance) P-C4' energy: -64.599 flat angles C4'-P-C4' energy: -69.955 flat angles P-C4'-P energy: -53.886 tors. eta vs tors. theta energy: -97.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -920.579094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.579094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.579094 (E_RNA) where: Base-Base interactions energy: -607.049 where: short stacking energy: -265.273 Base-Backbone interact. energy: -1.570 local terms energy: -311.960199 where: bonds (distance) C4'-P energy: -50.691 bonds (distance) P-C4' energy: -69.030 flat angles C4'-P-C4' energy: -65.254 flat angles P-C4'-P energy: -46.972 tors. eta vs tors. theta energy: -80.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -837.338675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.338675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.338675 (E_RNA) where: Base-Base interactions energy: -532.618 where: short stacking energy: -215.827 Base-Backbone interact. energy: -1.772 local terms energy: -302.948338 where: bonds (distance) C4'-P energy: -56.270 bonds (distance) P-C4' energy: -59.892 flat angles C4'-P-C4' energy: -68.310 flat angles P-C4'-P energy: -49.618 tors. eta vs tors. theta energy: -68.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -731.883203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.883203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.883203 (E_RNA) where: Base-Base interactions energy: -447.396 where: short stacking energy: -190.333 Base-Backbone interact. energy: -3.431 local terms energy: -281.055959 where: bonds (distance) C4'-P energy: -62.624 bonds (distance) P-C4' energy: -61.846 flat angles C4'-P-C4' energy: -64.992 flat angles P-C4'-P energy: -43.627 tors. eta vs tors. theta energy: -47.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -696.690832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.690832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.690832 (E_RNA) where: Base-Base interactions energy: -414.471 where: short stacking energy: -204.724 Base-Backbone interact. energy: -0.157 local terms energy: -282.063538 where: bonds (distance) C4'-P energy: -53.287 bonds (distance) P-C4' energy: -72.838 flat angles C4'-P-C4' energy: -52.225 flat angles P-C4'-P energy: -49.046 tors. eta vs tors. theta energy: -54.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -699.663555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.663555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.663555 (E_RNA) where: Base-Base interactions energy: -430.878 where: short stacking energy: -180.673 Base-Backbone interact. energy: -1.040 local terms energy: -267.746457 where: bonds (distance) C4'-P energy: -51.124 bonds (distance) P-C4' energy: -64.754 flat angles C4'-P-C4' energy: -60.680 flat angles P-C4'-P energy: -38.711 tors. eta vs tors. theta energy: -52.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -453.729631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.729631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.729631 (E_RNA) where: Base-Base interactions energy: -248.178 where: short stacking energy: -123.141 Base-Backbone interact. energy: 4.105 local terms energy: -209.655933 where: bonds (distance) C4'-P energy: -51.306 bonds (distance) P-C4' energy: -62.754 flat angles C4'-P-C4' energy: -56.717 flat angles P-C4'-P energy: -34.194 tors. eta vs tors. theta energy: -4.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -342.110604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.110604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.110604 (E_RNA) where: Base-Base interactions energy: -177.205 where: short stacking energy: -111.525 Base-Backbone interact. energy: 4.179 local terms energy: -169.084764 where: bonds (distance) C4'-P energy: -42.546 bonds (distance) P-C4' energy: -49.885 flat angles C4'-P-C4' energy: -41.922 flat angles P-C4'-P energy: -33.559 tors. eta vs tors. theta energy: -1.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -273.444327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.444327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.444327 (E_RNA) where: Base-Base interactions energy: -110.759 where: short stacking energy: -75.981 Base-Backbone interact. energy: -1.421 local terms energy: -161.263702 where: bonds (distance) C4'-P energy: -49.685 bonds (distance) P-C4' energy: -53.550 flat angles C4'-P-C4' energy: -41.115 flat angles P-C4'-P energy: -22.366 tors. eta vs tors. theta energy: 5.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -261.917285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.917285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.917285 (E_RNA) where: Base-Base interactions energy: -89.341 where: short stacking energy: -61.470 Base-Backbone interact. energy: 1.396 local terms energy: -173.972792 where: bonds (distance) C4'-P energy: -48.767 bonds (distance) P-C4' energy: -64.988 flat angles C4'-P-C4' energy: -43.759 flat angles P-C4'-P energy: -22.685 tors. eta vs tors. theta energy: 6.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1008.498651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.498651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.498651 (E_RNA) where: Base-Base interactions energy: -669.884 where: short stacking energy: -301.514 Base-Backbone interact. energy: -0.340 local terms energy: -338.274715 where: bonds (distance) C4'-P energy: -57.924 bonds (distance) P-C4' energy: -66.028 flat angles C4'-P-C4' energy: -72.969 flat angles P-C4'-P energy: -47.357 tors. eta vs tors. theta energy: -93.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -911.883696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.883696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.883696 (E_RNA) where: Base-Base interactions energy: -587.373 where: short stacking energy: -252.811 Base-Backbone interact. energy: -0.218 local terms energy: -324.293422 where: bonds (distance) C4'-P energy: -63.202 bonds (distance) P-C4' energy: -70.481 flat angles C4'-P-C4' energy: -68.487 flat angles P-C4'-P energy: -43.466 tors. eta vs tors. theta energy: -78.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -837.180336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.180336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.180336 (E_RNA) where: Base-Base interactions energy: -527.078 where: short stacking energy: -217.373 Base-Backbone interact. energy: -2.147 local terms energy: -307.955000 where: bonds (distance) C4'-P energy: -69.797 bonds (distance) P-C4' energy: -57.013 flat angles C4'-P-C4' energy: -65.644 flat angles P-C4'-P energy: -48.727 tors. eta vs tors. theta energy: -66.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -759.681117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.681117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.681117 (E_RNA) where: Base-Base interactions energy: -486.198 where: short stacking energy: -225.704 Base-Backbone interact. energy: 2.297 local terms energy: -275.780569 where: bonds (distance) C4'-P energy: -52.165 bonds (distance) P-C4' energy: -55.961 flat angles C4'-P-C4' energy: -70.675 flat angles P-C4'-P energy: -34.789 tors. eta vs tors. theta energy: -62.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -740.262597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.262597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.262597 (E_RNA) where: Base-Base interactions energy: -461.244 where: short stacking energy: -207.678 Base-Backbone interact. energy: 1.032 local terms energy: -280.050709 where: bonds (distance) C4'-P energy: -48.300 bonds (distance) P-C4' energy: -68.268 flat angles C4'-P-C4' energy: -63.082 flat angles P-C4'-P energy: -30.981 tors. eta vs tors. theta energy: -69.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -685.776917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.776917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.776917 (E_RNA) where: Base-Base interactions energy: -430.091 where: short stacking energy: -189.598 Base-Backbone interact. energy: -0.455 local terms energy: -255.231224 where: bonds (distance) C4'-P energy: -53.999 bonds (distance) P-C4' energy: -55.715 flat angles C4'-P-C4' energy: -59.229 flat angles P-C4'-P energy: -38.463 tors. eta vs tors. theta energy: -47.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -453.364592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.364592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.364592 (E_RNA) where: Base-Base interactions energy: -231.091 where: short stacking energy: -120.016 Base-Backbone interact. energy: 1.015 local terms energy: -223.288964 where: bonds (distance) C4'-P energy: -60.539 bonds (distance) P-C4' energy: -58.442 flat angles C4'-P-C4' energy: -56.117 flat angles P-C4'-P energy: -33.384 tors. eta vs tors. theta energy: -14.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -284.449878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.449878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.449878 (E_RNA) where: Base-Base interactions energy: -103.297 where: short stacking energy: -86.624 Base-Backbone interact. energy: -1.341 local terms energy: -179.812375 where: bonds (distance) C4'-P energy: -54.001 bonds (distance) P-C4' energy: -55.559 flat angles C4'-P-C4' energy: -39.999 flat angles P-C4'-P energy: -27.240 tors. eta vs tors. theta energy: -3.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -382.773302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.773302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.773302 (E_RNA) where: Base-Base interactions energy: -193.553 where: short stacking energy: -114.956 Base-Backbone interact. energy: -1.118 local terms energy: -188.102520 where: bonds (distance) C4'-P energy: -44.861 bonds (distance) P-C4' energy: -46.900 flat angles C4'-P-C4' energy: -51.496 flat angles P-C4'-P energy: -36.294 tors. eta vs tors. theta energy: -8.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -253.423987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.423987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.423987 (E_RNA) where: Base-Base interactions energy: -87.711 where: short stacking energy: -69.566 Base-Backbone interact. energy: 0.326 local terms energy: -166.039300 where: bonds (distance) C4'-P energy: -48.062 bonds (distance) P-C4' energy: -53.805 flat angles C4'-P-C4' energy: -40.400 flat angles P-C4'-P energy: -32.919 tors. eta vs tors. theta energy: 9.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1021.256340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.256340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.256340 (E_RNA) where: Base-Base interactions energy: -683.148 where: short stacking energy: -294.758 Base-Backbone interact. energy: -1.459 local terms energy: -336.649969 where: bonds (distance) C4'-P energy: -58.193 bonds (distance) P-C4' energy: -71.490 flat angles C4'-P-C4' energy: -71.360 flat angles P-C4'-P energy: -42.790 tors. eta vs tors. theta energy: -92.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -898.651570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.651570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.651570 (E_RNA) where: Base-Base interactions energy: -606.056 where: short stacking energy: -261.072 Base-Backbone interact. energy: 4.371 local terms energy: -296.967000 where: bonds (distance) C4'-P energy: -62.708 bonds (distance) P-C4' energy: -61.200 flat angles C4'-P-C4' energy: -58.204 flat angles P-C4'-P energy: -44.680 tors. eta vs tors. theta energy: -70.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -807.909385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.909385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.909385 (E_RNA) where: Base-Base interactions energy: -512.641 where: short stacking energy: -208.756 Base-Backbone interact. energy: -1.674 local terms energy: -293.594071 where: bonds (distance) C4'-P energy: -62.281 bonds (distance) P-C4' energy: -63.741 flat angles C4'-P-C4' energy: -69.164 flat angles P-C4'-P energy: -45.953 tors. eta vs tors. theta energy: -52.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -720.514746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.514746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.514746 (E_RNA) where: Base-Base interactions energy: -461.008 where: short stacking energy: -214.535 Base-Backbone interact. energy: 1.390 local terms energy: -260.896667 where: bonds (distance) C4'-P energy: -51.723 bonds (distance) P-C4' energy: -45.476 flat angles C4'-P-C4' energy: -66.322 flat angles P-C4'-P energy: -41.333 tors. eta vs tors. theta energy: -56.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -737.067656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.067656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.067656 (E_RNA) where: Base-Base interactions energy: -459.358 where: short stacking energy: -225.910 Base-Backbone interact. energy: 0.481 local terms energy: -278.190600 where: bonds (distance) C4'-P energy: -63.580 bonds (distance) P-C4' energy: -52.354 flat angles C4'-P-C4' energy: -59.804 flat angles P-C4'-P energy: -40.639 tors. eta vs tors. theta energy: -61.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -652.737774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.737774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.737774 (E_RNA) where: Base-Base interactions energy: -416.058 where: short stacking energy: -161.126 Base-Backbone interact. energy: -2.216 local terms energy: -234.463539 where: bonds (distance) C4'-P energy: -58.220 bonds (distance) P-C4' energy: -46.210 flat angles C4'-P-C4' energy: -66.124 flat angles P-C4'-P energy: -36.803 tors. eta vs tors. theta energy: -27.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -473.976254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.976254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.976254 (E_RNA) where: Base-Base interactions energy: -233.882 where: short stacking energy: -130.732 Base-Backbone interact. energy: -0.289 local terms energy: -239.805412 where: bonds (distance) C4'-P energy: -56.605 bonds (distance) P-C4' energy: -66.455 flat angles C4'-P-C4' energy: -55.372 flat angles P-C4'-P energy: -37.195 tors. eta vs tors. theta energy: -24.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -334.408079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.408079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.408079 (E_RNA) where: Base-Base interactions energy: -146.649 where: short stacking energy: -104.224 Base-Backbone interact. energy: 0.643 local terms energy: -188.402637 where: bonds (distance) C4'-P energy: -45.684 bonds (distance) P-C4' energy: -65.310 flat angles C4'-P-C4' energy: -50.547 flat angles P-C4'-P energy: -24.138 tors. eta vs tors. theta energy: -2.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -399.692124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.692124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.692124 (E_RNA) where: Base-Base interactions energy: -217.975 where: short stacking energy: -120.705 Base-Backbone interact. energy: -2.233 local terms energy: -179.484416 where: bonds (distance) C4'-P energy: -44.244 bonds (distance) P-C4' energy: -54.197 flat angles C4'-P-C4' energy: -45.975 flat angles P-C4'-P energy: -29.438 tors. eta vs tors. theta energy: -5.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -250.353281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.353281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.353281 (E_RNA) where: Base-Base interactions energy: -101.505 where: short stacking energy: -72.967 Base-Backbone interact. energy: -3.640 local terms energy: -145.208335 where: bonds (distance) C4'-P energy: -40.849 bonds (distance) P-C4' energy: -48.443 flat angles C4'-P-C4' energy: -54.123 flat angles P-C4'-P energy: -12.826 tors. eta vs tors. theta energy: 11.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1029.708696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.708696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.708696 (E_RNA) where: Base-Base interactions energy: -686.844 where: short stacking energy: -298.292 Base-Backbone interact. energy: -0.652 local terms energy: -342.213158 where: bonds (distance) C4'-P energy: -66.621 bonds (distance) P-C4' energy: -60.985 flat angles C4'-P-C4' energy: -72.151 flat angles P-C4'-P energy: -46.050 tors. eta vs tors. theta energy: -96.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -926.122930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.122930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.122930 (E_RNA) where: Base-Base interactions energy: -608.684 where: short stacking energy: -276.259 Base-Backbone interact. energy: 0.987 local terms energy: -318.425900 where: bonds (distance) C4'-P energy: -57.035 bonds (distance) P-C4' energy: -69.613 flat angles C4'-P-C4' energy: -72.861 flat angles P-C4'-P energy: -40.366 tors. eta vs tors. theta energy: -78.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -824.234235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.234235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.234235 (E_RNA) where: Base-Base interactions energy: -520.773 where: short stacking energy: -230.385 Base-Backbone interact. energy: 0.568 local terms energy: -304.029392 where: bonds (distance) C4'-P energy: -62.480 bonds (distance) P-C4' energy: -68.371 flat angles C4'-P-C4' energy: -63.923 flat angles P-C4'-P energy: -51.166 tors. eta vs tors. theta energy: -58.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -748.022269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.022269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.022269 (E_RNA) where: Base-Base interactions energy: -464.009 where: short stacking energy: -234.453 Base-Backbone interact. energy: -3.473 local terms energy: -280.540934 where: bonds (distance) C4'-P energy: -55.755 bonds (distance) P-C4' energy: -67.098 flat angles C4'-P-C4' energy: -58.170 flat angles P-C4'-P energy: -38.636 tors. eta vs tors. theta energy: -60.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -670.085422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.085422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.085422 (E_RNA) where: Base-Base interactions energy: -398.490 where: short stacking energy: -200.035 Base-Backbone interact. energy: -0.712 local terms energy: -270.882950 where: bonds (distance) C4'-P energy: -62.255 bonds (distance) P-C4' energy: -50.670 flat angles C4'-P-C4' energy: -65.200 flat angles P-C4'-P energy: -38.215 tors. eta vs tors. theta energy: -54.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -667.732190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.732190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.732190 (E_RNA) where: Base-Base interactions energy: -417.068 where: short stacking energy: -196.910 Base-Backbone interact. energy: -0.409 local terms energy: -250.255231 where: bonds (distance) C4'-P energy: -59.873 bonds (distance) P-C4' energy: -56.090 flat angles C4'-P-C4' energy: -62.692 flat angles P-C4'-P energy: -33.030 tors. eta vs tors. theta energy: -38.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -484.899974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.899974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.899974 (E_RNA) where: Base-Base interactions energy: -281.136 where: short stacking energy: -124.701 Base-Backbone interact. energy: -0.532 local terms energy: -203.232273 where: bonds (distance) C4'-P energy: -54.324 bonds (distance) P-C4' energy: -62.059 flat angles C4'-P-C4' energy: -62.163 flat angles P-C4'-P energy: -25.131 tors. eta vs tors. theta energy: 0.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -357.510703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.510703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.510703 (E_RNA) where: Base-Base interactions energy: -161.992 where: short stacking energy: -101.996 Base-Backbone interact. energy: -0.614 local terms energy: -194.904667 where: bonds (distance) C4'-P energy: -43.270 bonds (distance) P-C4' energy: -59.558 flat angles C4'-P-C4' energy: -50.805 flat angles P-C4'-P energy: -39.236 tors. eta vs tors. theta energy: -2.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -279.906509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.906509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.906509 (E_RNA) where: Base-Base interactions energy: -83.138 where: short stacking energy: -54.496 Base-Backbone interact. energy: 0.542 local terms energy: -197.311088 where: bonds (distance) C4'-P energy: -68.132 bonds (distance) P-C4' energy: -47.446 flat angles C4'-P-C4' energy: -49.472 flat angles P-C4'-P energy: -38.603 tors. eta vs tors. theta energy: 6.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -260.409603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.409603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.409603 (E_RNA) where: Base-Base interactions energy: -95.741 where: short stacking energy: -75.478 Base-Backbone interact. energy: 0.257 local terms energy: -164.925440 where: bonds (distance) C4'-P energy: -54.804 bonds (distance) P-C4' energy: -38.434 flat angles C4'-P-C4' energy: -43.937 flat angles P-C4'-P energy: -28.682 tors. eta vs tors. theta energy: 0.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1035.915051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.915051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.915051 (E_RNA) where: Base-Base interactions energy: -687.309 where: short stacking energy: -290.662 Base-Backbone interact. energy: -1.222 local terms energy: -347.383869 where: bonds (distance) C4'-P energy: -65.873 bonds (distance) P-C4' energy: -64.569 flat angles C4'-P-C4' energy: -75.952 flat angles P-C4'-P energy: -43.755 tors. eta vs tors. theta energy: -97.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -908.526091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.526091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.526091 (E_RNA) where: Base-Base interactions energy: -604.322 where: short stacking energy: -256.408 Base-Backbone interact. energy: -0.096 local terms energy: -304.107287 where: bonds (distance) C4'-P energy: -58.598 bonds (distance) P-C4' energy: -67.479 flat angles C4'-P-C4' energy: -71.233 flat angles P-C4'-P energy: -42.248 tors. eta vs tors. theta energy: -64.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -838.160847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.160847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.160847 (E_RNA) where: Base-Base interactions energy: -545.664 where: short stacking energy: -226.788 Base-Backbone interact. energy: -1.852 local terms energy: -290.645253 where: bonds (distance) C4'-P energy: -48.335 bonds (distance) P-C4' energy: -56.038 flat angles C4'-P-C4' energy: -66.362 flat angles P-C4'-P energy: -46.543 tors. eta vs tors. theta energy: -73.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -783.634807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.634807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.634807 (E_RNA) where: Base-Base interactions energy: -466.372 where: short stacking energy: -247.488 Base-Backbone interact. energy: -1.062 local terms energy: -316.201115 where: bonds (distance) C4'-P energy: -66.792 bonds (distance) P-C4' energy: -53.043 flat angles C4'-P-C4' energy: -65.641 flat angles P-C4'-P energy: -54.661 tors. eta vs tors. theta energy: -76.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -718.295881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.295881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.295881 (E_RNA) where: Base-Base interactions energy: -445.388 where: short stacking energy: -206.651 Base-Backbone interact. energy: -1.066 local terms energy: -271.841986 where: bonds (distance) C4'-P energy: -56.954 bonds (distance) P-C4' energy: -45.032 flat angles C4'-P-C4' energy: -59.716 flat angles P-C4'-P energy: -50.967 tors. eta vs tors. theta energy: -59.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -639.703312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.703312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.703312 (E_RNA) where: Base-Base interactions energy: -372.649 where: short stacking energy: -195.723 Base-Backbone interact. energy: 1.271 local terms energy: -268.325679 where: bonds (distance) C4'-P energy: -58.938 bonds (distance) P-C4' energy: -68.690 flat angles C4'-P-C4' energy: -62.228 flat angles P-C4'-P energy: -26.289 tors. eta vs tors. theta energy: -52.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -452.037173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.037173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.037173 (E_RNA) where: Base-Base interactions energy: -250.225 where: short stacking energy: -107.030 Base-Backbone interact. energy: 0.015 local terms energy: -201.828013 where: bonds (distance) C4'-P energy: -56.653 bonds (distance) P-C4' energy: -58.067 flat angles C4'-P-C4' energy: -55.323 flat angles P-C4'-P energy: -26.900 tors. eta vs tors. theta energy: -4.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -365.401132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.401132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.401132 (E_RNA) where: Base-Base interactions energy: -167.294 where: short stacking energy: -108.533 Base-Backbone interact. energy: 0.540 local terms energy: -198.646896 where: bonds (distance) C4'-P energy: -56.783 bonds (distance) P-C4' energy: -64.317 flat angles C4'-P-C4' energy: -59.379 flat angles P-C4'-P energy: -19.158 tors. eta vs tors. theta energy: 0.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -282.618782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.618782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.618782 (E_RNA) where: Base-Base interactions energy: -121.657 where: short stacking energy: -63.067 Base-Backbone interact. energy: 5.278 local terms energy: -166.239452 where: bonds (distance) C4'-P energy: -54.544 bonds (distance) P-C4' energy: -56.505 flat angles C4'-P-C4' energy: -35.824 flat angles P-C4'-P energy: -30.856 tors. eta vs tors. theta energy: 11.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -268.225806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.225806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.225806 (E_RNA) where: Base-Base interactions energy: -75.745 where: short stacking energy: -71.158 Base-Backbone interact. energy: -0.521 local terms energy: -191.959351 where: bonds (distance) C4'-P energy: -55.795 bonds (distance) P-C4' energy: -49.341 flat angles C4'-P-C4' energy: -57.464 flat angles P-C4'-P energy: -30.816 tors. eta vs tors. theta energy: 1.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1040.635781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.635781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.635781 (E_RNA) where: Base-Base interactions energy: -680.048 where: short stacking energy: -301.594 Base-Backbone interact. energy: -0.258 local terms energy: -360.329339 where: bonds (distance) C4'-P energy: -65.067 bonds (distance) P-C4' energy: -73.320 flat angles C4'-P-C4' energy: -68.553 flat angles P-C4'-P energy: -53.844 tors. eta vs tors. theta energy: -99.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -904.455698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.455698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.455698 (E_RNA) where: Base-Base interactions energy: -595.360 where: short stacking energy: -261.105 Base-Backbone interact. energy: -2.726 local terms energy: -306.369204 where: bonds (distance) C4'-P energy: -58.048 bonds (distance) P-C4' energy: -52.904 flat angles C4'-P-C4' energy: -70.654 flat angles P-C4'-P energy: -48.198 tors. eta vs tors. theta energy: -76.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -837.901658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.901658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.901658 (E_RNA) where: Base-Base interactions energy: -525.603 where: short stacking energy: -222.995 Base-Backbone interact. energy: -0.658 local terms energy: -311.640611 where: bonds (distance) C4'-P energy: -59.461 bonds (distance) P-C4' energy: -60.803 flat angles C4'-P-C4' energy: -68.329 flat angles P-C4'-P energy: -52.436 tors. eta vs tors. theta energy: -70.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -741.986011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.986011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.986011 (E_RNA) where: Base-Base interactions energy: -460.008 where: short stacking energy: -210.106 Base-Backbone interact. energy: -0.930 local terms energy: -281.047897 where: bonds (distance) C4'-P energy: -55.608 bonds (distance) P-C4' energy: -65.553 flat angles C4'-P-C4' energy: -61.951 flat angles P-C4'-P energy: -43.905 tors. eta vs tors. theta energy: -54.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -750.239893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.239893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.239893 (E_RNA) where: Base-Base interactions energy: -473.022 where: short stacking energy: -226.675 Base-Backbone interact. energy: -1.118 local terms energy: -276.099849 where: bonds (distance) C4'-P energy: -61.797 bonds (distance) P-C4' energy: -55.052 flat angles C4'-P-C4' energy: -55.873 flat angles P-C4'-P energy: -45.912 tors. eta vs tors. theta energy: -57.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -638.582730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.582730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.582730 (E_RNA) where: Base-Base interactions energy: -383.957 where: short stacking energy: -163.497 Base-Backbone interact. energy: -5.346 local terms energy: -249.279191 where: bonds (distance) C4'-P energy: -70.066 bonds (distance) P-C4' energy: -50.779 flat angles C4'-P-C4' energy: -43.156 flat angles P-C4'-P energy: -43.616 tors. eta vs tors. theta energy: -41.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -482.626859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.626859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.626859 (E_RNA) where: Base-Base interactions energy: -265.137 where: short stacking energy: -134.949 Base-Backbone interact. energy: -2.063 local terms energy: -215.426940 where: bonds (distance) C4'-P energy: -50.591 bonds (distance) P-C4' energy: -62.339 flat angles C4'-P-C4' energy: -52.536 flat angles P-C4'-P energy: -32.292 tors. eta vs tors. theta energy: -17.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -370.867244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.867244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.867244 (E_RNA) where: Base-Base interactions energy: -167.109 where: short stacking energy: -110.597 Base-Backbone interact. energy: -3.794 local terms energy: -199.964184 where: bonds (distance) C4'-P energy: -60.607 bonds (distance) P-C4' energy: -47.934 flat angles C4'-P-C4' energy: -54.507 flat angles P-C4'-P energy: -35.656 tors. eta vs tors. theta energy: -1.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -270.786807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.786807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.786807 (E_RNA) where: Base-Base interactions energy: -93.092 where: short stacking energy: -79.870 Base-Backbone interact. energy: 1.949 local terms energy: -179.644111 where: bonds (distance) C4'-P energy: -50.541 bonds (distance) P-C4' energy: -50.068 flat angles C4'-P-C4' energy: -51.653 flat angles P-C4'-P energy: -31.295 tors. eta vs tors. theta energy: 3.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -261.020081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.020081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.020081 (E_RNA) where: Base-Base interactions energy: -119.855 where: short stacking energy: -63.490 Base-Backbone interact. energy: 0.741 local terms energy: -141.906003 where: bonds (distance) C4'-P energy: -46.076 bonds (distance) P-C4' energy: -53.269 flat angles C4'-P-C4' energy: -42.591 flat angles P-C4'-P energy: -17.522 tors. eta vs tors. theta energy: 17.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1023.368252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.368252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.368252 (E_RNA) where: Base-Base interactions energy: -688.737 where: short stacking energy: -293.945 Base-Backbone interact. energy: 1.350 local terms energy: -335.981514 where: bonds (distance) C4'-P energy: -54.305 bonds (distance) P-C4' energy: -65.030 flat angles C4'-P-C4' energy: -74.967 flat angles P-C4'-P energy: -43.747 tors. eta vs tors. theta energy: -97.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -947.966962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.966962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.966962 (E_RNA) where: Base-Base interactions energy: -649.619 where: short stacking energy: -257.624 Base-Backbone interact. energy: 0.256 local terms energy: -298.603495 where: bonds (distance) C4'-P energy: -58.531 bonds (distance) P-C4' energy: -57.305 flat angles C4'-P-C4' energy: -64.103 flat angles P-C4'-P energy: -42.784 tors. eta vs tors. theta energy: -75.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -828.419127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.419127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.419127 (E_RNA) where: Base-Base interactions energy: -529.019 where: short stacking energy: -236.766 Base-Backbone interact. energy: -0.026 local terms energy: -299.374238 where: bonds (distance) C4'-P energy: -60.996 bonds (distance) P-C4' energy: -55.993 flat angles C4'-P-C4' energy: -64.866 flat angles P-C4'-P energy: -49.530 tors. eta vs tors. theta energy: -67.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -739.393909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.393909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.393909 (E_RNA) where: Base-Base interactions energy: -463.800 where: short stacking energy: -204.612 Base-Backbone interact. energy: -0.456 local terms energy: -275.137270 where: bonds (distance) C4'-P energy: -62.817 bonds (distance) P-C4' energy: -54.797 flat angles C4'-P-C4' energy: -63.342 flat angles P-C4'-P energy: -33.033 tors. eta vs tors. theta energy: -61.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -710.876026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.876026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.876026 (E_RNA) where: Base-Base interactions energy: -436.737 where: short stacking energy: -218.989 Base-Backbone interact. energy: -1.267 local terms energy: -272.872396 where: bonds (distance) C4'-P energy: -57.017 bonds (distance) P-C4' energy: -56.397 flat angles C4'-P-C4' energy: -56.055 flat angles P-C4'-P energy: -41.146 tors. eta vs tors. theta energy: -62.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -635.426495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.426495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.426495 (E_RNA) where: Base-Base interactions energy: -382.181 where: short stacking energy: -184.788 Base-Backbone interact. energy: -0.283 local terms energy: -252.962479 where: bonds (distance) C4'-P energy: -49.817 bonds (distance) P-C4' energy: -65.710 flat angles C4'-P-C4' energy: -55.492 flat angles P-C4'-P energy: -37.279 tors. eta vs tors. theta energy: -44.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -494.524490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.524490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.524490 (E_RNA) where: Base-Base interactions energy: -296.882 where: short stacking energy: -130.864 Base-Backbone interact. energy: 4.994 local terms energy: -202.636823 where: bonds (distance) C4'-P energy: -34.142 bonds (distance) P-C4' energy: -59.658 flat angles C4'-P-C4' energy: -50.884 flat angles P-C4'-P energy: -35.256 tors. eta vs tors. theta energy: -22.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -355.154671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.154671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.154671 (E_RNA) where: Base-Base interactions energy: -170.581 where: short stacking energy: -100.295 Base-Backbone interact. energy: 1.875 local terms energy: -186.448498 where: bonds (distance) C4'-P energy: -52.509 bonds (distance) P-C4' energy: -56.504 flat angles C4'-P-C4' energy: -44.608 flat angles P-C4'-P energy: -31.746 tors. eta vs tors. theta energy: -1.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -276.340399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.340399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.340399 (E_RNA) where: Base-Base interactions energy: -91.577 where: short stacking energy: -71.851 Base-Backbone interact. energy: 0.099 local terms energy: -184.862487 where: bonds (distance) C4'-P energy: -51.249 bonds (distance) P-C4' energy: -62.214 flat angles C4'-P-C4' energy: -43.745 flat angles P-C4'-P energy: -21.474 tors. eta vs tors. theta energy: -6.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -264.219160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.219160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.219160 (E_RNA) where: Base-Base interactions energy: -95.778 where: short stacking energy: -74.376 Base-Backbone interact. energy: -0.812 local terms energy: -167.629702 where: bonds (distance) C4'-P energy: -51.272 bonds (distance) P-C4' energy: -40.323 flat angles C4'-P-C4' energy: -49.965 flat angles P-C4'-P energy: -26.822 tors. eta vs tors. theta energy: 0.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1039.283089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.283089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.283089 (E_RNA) where: Base-Base interactions energy: -695.125 where: short stacking energy: -290.323 Base-Backbone interact. energy: -1.507 local terms energy: -342.651407 where: bonds (distance) C4'-P energy: -65.507 bonds (distance) P-C4' energy: -66.470 flat angles C4'-P-C4' energy: -67.212 flat angles P-C4'-P energy: -42.846 tors. eta vs tors. theta energy: -100.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -941.456054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.456054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.456054 (E_RNA) where: Base-Base interactions energy: -630.213 where: short stacking energy: -253.771 Base-Backbone interact. energy: -2.811 local terms energy: -308.432120 where: bonds (distance) C4'-P energy: -66.431 bonds (distance) P-C4' energy: -70.058 flat angles C4'-P-C4' energy: -63.522 flat angles P-C4'-P energy: -40.473 tors. eta vs tors. theta energy: -67.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -823.580369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.580369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.580369 (E_RNA) where: Base-Base interactions energy: -546.268 where: short stacking energy: -233.803 Base-Backbone interact. energy: 0.485 local terms energy: -277.797106 where: bonds (distance) C4'-P energy: -49.549 bonds (distance) P-C4' energy: -58.292 flat angles C4'-P-C4' energy: -66.523 flat angles P-C4'-P energy: -40.847 tors. eta vs tors. theta energy: -62.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -761.869579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.869579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.869579 (E_RNA) where: Base-Base interactions energy: -498.093 where: short stacking energy: -216.747 Base-Backbone interact. energy: -1.325 local terms energy: -262.451225 where: bonds (distance) C4'-P energy: -55.035 bonds (distance) P-C4' energy: -56.576 flat angles C4'-P-C4' energy: -65.522 flat angles P-C4'-P energy: -33.417 tors. eta vs tors. theta energy: -51.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -696.325845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.325845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.325845 (E_RNA) where: Base-Base interactions energy: -410.851 where: short stacking energy: -198.998 Base-Backbone interact. energy: -0.295 local terms energy: -285.180124 where: bonds (distance) C4'-P energy: -57.639 bonds (distance) P-C4' energy: -60.453 flat angles C4'-P-C4' energy: -61.263 flat angles P-C4'-P energy: -48.701 tors. eta vs tors. theta energy: -57.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -635.514211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.514211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.514211 (E_RNA) where: Base-Base interactions energy: -390.417 where: short stacking energy: -176.455 Base-Backbone interact. energy: -1.649 local terms energy: -243.448130 where: bonds (distance) C4'-P energy: -69.505 bonds (distance) P-C4' energy: -54.741 flat angles C4'-P-C4' energy: -43.786 flat angles P-C4'-P energy: -39.878 tors. eta vs tors. theta energy: -35.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -558.636174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.636174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.636174 (E_RNA) where: Base-Base interactions energy: -332.602 where: short stacking energy: -160.380 Base-Backbone interact. energy: -0.470 local terms energy: -225.563731 where: bonds (distance) C4'-P energy: -52.058 bonds (distance) P-C4' energy: -55.582 flat angles C4'-P-C4' energy: -58.142 flat angles P-C4'-P energy: -38.952 tors. eta vs tors. theta energy: -20.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -371.672493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.672493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.672493 (E_RNA) where: Base-Base interactions energy: -177.564 where: short stacking energy: -101.734 Base-Backbone interact. energy: -0.748 local terms energy: -193.360078 where: bonds (distance) C4'-P energy: -43.244 bonds (distance) P-C4' energy: -66.012 flat angles C4'-P-C4' energy: -48.583 flat angles P-C4'-P energy: -28.751 tors. eta vs tors. theta energy: -6.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -272.133623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.133623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.133623 (E_RNA) where: Base-Base interactions energy: -83.422 where: short stacking energy: -77.607 Base-Backbone interact. energy: -0.977 local terms energy: -187.734886 where: bonds (distance) C4'-P energy: -53.465 bonds (distance) P-C4' energy: -65.286 flat angles C4'-P-C4' energy: -31.793 flat angles P-C4'-P energy: -32.659 tors. eta vs tors. theta energy: -4.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -246.850042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.850042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.850042 (E_RNA) where: Base-Base interactions energy: -76.624 where: short stacking energy: -60.410 Base-Backbone interact. energy: -1.197 local terms energy: -169.029463 where: bonds (distance) C4'-P energy: -37.503 bonds (distance) P-C4' energy: -60.193 flat angles C4'-P-C4' energy: -53.854 flat angles P-C4'-P energy: -23.512 tors. eta vs tors. theta energy: 6.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1043.970902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.970902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.970902 (E_RNA) where: Base-Base interactions energy: -698.270 where: short stacking energy: -313.016 Base-Backbone interact. energy: -1.290 local terms energy: -344.410884 where: bonds (distance) C4'-P energy: -66.794 bonds (distance) P-C4' energy: -63.004 flat angles C4'-P-C4' energy: -67.219 flat angles P-C4'-P energy: -45.691 tors. eta vs tors. theta energy: -101.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -940.367185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.367185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.367185 (E_RNA) where: Base-Base interactions energy: -616.971 where: short stacking energy: -245.105 Base-Backbone interact. energy: 4.353 local terms energy: -327.748317 where: bonds (distance) C4'-P energy: -69.936 bonds (distance) P-C4' energy: -67.607 flat angles C4'-P-C4' energy: -68.527 flat angles P-C4'-P energy: -48.384 tors. eta vs tors. theta energy: -73.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -840.163567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.163567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.163567 (E_RNA) where: Base-Base interactions energy: -534.844 where: short stacking energy: -231.558 Base-Backbone interact. energy: -1.205 local terms energy: -304.114058 where: bonds (distance) C4'-P energy: -70.165 bonds (distance) P-C4' energy: -61.495 flat angles C4'-P-C4' energy: -58.904 flat angles P-C4'-P energy: -46.348 tors. eta vs tors. theta energy: -67.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -756.382740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.382740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.382740 (E_RNA) where: Base-Base interactions energy: -492.097 where: short stacking energy: -200.107 Base-Backbone interact. energy: -2.527 local terms energy: -261.758896 where: bonds (distance) C4'-P energy: -58.344 bonds (distance) P-C4' energy: -57.391 flat angles C4'-P-C4' energy: -53.366 flat angles P-C4'-P energy: -41.323 tors. eta vs tors. theta energy: -51.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -708.999389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.999389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.999389 (E_RNA) where: Base-Base interactions energy: -437.265 where: short stacking energy: -213.512 Base-Backbone interact. energy: 5.284 local terms energy: -277.018027 where: bonds (distance) C4'-P energy: -63.580 bonds (distance) P-C4' energy: -54.813 flat angles C4'-P-C4' energy: -63.312 flat angles P-C4'-P energy: -35.427 tors. eta vs tors. theta energy: -59.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -683.581513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.581513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.581513 (E_RNA) where: Base-Base interactions energy: -426.311 where: short stacking energy: -190.926 Base-Backbone interact. energy: -1.389 local terms energy: -255.881904 where: bonds (distance) C4'-P energy: -52.862 bonds (distance) P-C4' energy: -60.529 flat angles C4'-P-C4' energy: -60.811 flat angles P-C4'-P energy: -39.578 tors. eta vs tors. theta energy: -42.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -568.659108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.659108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.659108 (E_RNA) where: Base-Base interactions energy: -362.681 where: short stacking energy: -160.463 Base-Backbone interact. energy: 1.203 local terms energy: -207.180607 where: bonds (distance) C4'-P energy: -49.822 bonds (distance) P-C4' energy: -55.689 flat angles C4'-P-C4' energy: -53.785 flat angles P-C4'-P energy: -27.698 tors. eta vs tors. theta energy: -20.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -321.868764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.868764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.868764 (E_RNA) where: Base-Base interactions energy: -124.895 where: short stacking energy: -70.568 Base-Backbone interact. energy: -0.504 local terms energy: -196.469193 where: bonds (distance) C4'-P energy: -52.733 bonds (distance) P-C4' energy: -64.901 flat angles C4'-P-C4' energy: -50.935 flat angles P-C4'-P energy: -35.961 tors. eta vs tors. theta energy: 8.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -313.954560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.954560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.954560 (E_RNA) where: Base-Base interactions energy: -92.900 where: short stacking energy: -71.075 Base-Backbone interact. energy: -0.532 local terms energy: -220.522306 where: bonds (distance) C4'-P energy: -60.292 bonds (distance) P-C4' energy: -61.784 flat angles C4'-P-C4' energy: -60.070 flat angles P-C4'-P energy: -34.956 tors. eta vs tors. theta energy: -3.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -288.515907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.515907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.515907 (E_RNA) where: Base-Base interactions energy: -114.696 where: short stacking energy: -51.030 Base-Backbone interact. energy: 0.587 local terms energy: -174.406543 where: bonds (distance) C4'-P energy: -56.419 bonds (distance) P-C4' energy: -55.902 flat angles C4'-P-C4' energy: -48.199 flat angles P-C4'-P energy: -23.894 tors. eta vs tors. theta energy: 10.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1019.235252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.235252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.235252 (E_RNA) where: Base-Base interactions energy: -685.916 where: short stacking energy: -290.505 Base-Backbone interact. energy: -0.952 local terms energy: -332.367344 where: bonds (distance) C4'-P energy: -58.070 bonds (distance) P-C4' energy: -68.193 flat angles C4'-P-C4' energy: -70.300 flat angles P-C4'-P energy: -43.001 tors. eta vs tors. theta energy: -92.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -941.302613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.302613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.302613 (E_RNA) where: Base-Base interactions energy: -637.265 where: short stacking energy: -263.839 Base-Backbone interact. energy: -1.987 local terms energy: -302.050758 where: bonds (distance) C4'-P energy: -56.293 bonds (distance) P-C4' energy: -66.180 flat angles C4'-P-C4' energy: -73.568 flat angles P-C4'-P energy: -34.479 tors. eta vs tors. theta energy: -71.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -855.569112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.569112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.569112 (E_RNA) where: Base-Base interactions energy: -557.770 where: short stacking energy: -225.500 Base-Backbone interact. energy: -1.653 local terms energy: -296.145357 where: bonds (distance) C4'-P energy: -70.053 bonds (distance) P-C4' energy: -67.626 flat angles C4'-P-C4' energy: -67.453 flat angles P-C4'-P energy: -27.428 tors. eta vs tors. theta energy: -63.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -757.476891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.476891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.476891 (E_RNA) where: Base-Base interactions energy: -491.549 where: short stacking energy: -238.504 Base-Backbone interact. energy: -3.265 local terms energy: -262.663322 where: bonds (distance) C4'-P energy: -50.382 bonds (distance) P-C4' energy: -54.433 flat angles C4'-P-C4' energy: -58.096 flat angles P-C4'-P energy: -39.590 tors. eta vs tors. theta energy: -60.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -689.885063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.885063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.885063 (E_RNA) where: Base-Base interactions energy: -440.271 where: short stacking energy: -221.662 Base-Backbone interact. energy: 1.256 local terms energy: -250.869539 where: bonds (distance) C4'-P energy: -53.582 bonds (distance) P-C4' energy: -59.028 flat angles C4'-P-C4' energy: -57.290 flat angles P-C4'-P energy: -26.331 tors. eta vs tors. theta energy: -54.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -699.132139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.132139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.132139 (E_RNA) where: Base-Base interactions energy: -431.951 where: short stacking energy: -182.174 Base-Backbone interact. energy: 0.696 local terms energy: -267.877330 where: bonds (distance) C4'-P energy: -61.227 bonds (distance) P-C4' energy: -48.320 flat angles C4'-P-C4' energy: -59.294 flat angles P-C4'-P energy: -42.391 tors. eta vs tors. theta energy: -56.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -580.695483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.695483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.695483 (E_RNA) where: Base-Base interactions energy: -342.561 where: short stacking energy: -163.795 Base-Backbone interact. energy: -1.402 local terms energy: -236.731953 where: bonds (distance) C4'-P energy: -49.228 bonds (distance) P-C4' energy: -54.636 flat angles C4'-P-C4' energy: -60.581 flat angles P-C4'-P energy: -35.829 tors. eta vs tors. theta energy: -36.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -308.737223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.737223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.737223 (E_RNA) where: Base-Base interactions energy: -114.231 where: short stacking energy: -84.949 Base-Backbone interact. energy: -1.789 local terms energy: -192.717834 where: bonds (distance) C4'-P energy: -58.005 bonds (distance) P-C4' energy: -50.227 flat angles C4'-P-C4' energy: -57.790 flat angles P-C4'-P energy: -19.617 tors. eta vs tors. theta energy: -7.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -266.702497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.702497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.702497 (E_RNA) where: Base-Base interactions energy: -84.232 where: short stacking energy: -53.117 Base-Backbone interact. energy: 0.509 local terms energy: -182.980154 where: bonds (distance) C4'-P energy: -52.480 bonds (distance) P-C4' energy: -55.643 flat angles C4'-P-C4' energy: -50.808 flat angles P-C4'-P energy: -30.233 tors. eta vs tors. theta energy: 6.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -273.825177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.825177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.825177 (E_RNA) where: Base-Base interactions energy: -74.377 where: short stacking energy: -54.236 Base-Backbone interact. energy: -1.101 local terms energy: -198.347231 where: bonds (distance) C4'-P energy: -61.641 bonds (distance) P-C4' energy: -62.859 flat angles C4'-P-C4' energy: -47.213 flat angles P-C4'-P energy: -28.969 tors. eta vs tors. theta energy: 2.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1025.302073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.302073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.302073 (E_RNA) where: Base-Base interactions energy: -681.189 where: short stacking energy: -294.713 Base-Backbone interact. energy: -2.308 local terms energy: -341.804293 where: bonds (distance) C4'-P energy: -62.083 bonds (distance) P-C4' energy: -59.457 flat angles C4'-P-C4' energy: -72.278 flat angles P-C4'-P energy: -49.430 tors. eta vs tors. theta energy: -98.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -960.348864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.348864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.348864 (E_RNA) where: Base-Base interactions energy: -632.072 where: short stacking energy: -271.021 Base-Backbone interact. energy: -1.232 local terms energy: -327.044429 where: bonds (distance) C4'-P energy: -67.473 bonds (distance) P-C4' energy: -73.017 flat angles C4'-P-C4' energy: -72.489 flat angles P-C4'-P energy: -34.794 tors. eta vs tors. theta energy: -79.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -848.253758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.253758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.253758 (E_RNA) where: Base-Base interactions energy: -556.949 where: short stacking energy: -240.042 Base-Backbone interact. energy: -1.042 local terms energy: -290.262540 where: bonds (distance) C4'-P energy: -49.214 bonds (distance) P-C4' energy: -59.996 flat angles C4'-P-C4' energy: -71.257 flat angles P-C4'-P energy: -46.122 tors. eta vs tors. theta energy: -63.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -745.497103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.497103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.497103 (E_RNA) where: Base-Base interactions energy: -462.173 where: short stacking energy: -215.893 Base-Backbone interact. energy: 6.737 local terms energy: -290.060880 where: bonds (distance) C4'-P energy: -67.903 bonds (distance) P-C4' energy: -55.310 flat angles C4'-P-C4' energy: -60.955 flat angles P-C4'-P energy: -44.198 tors. eta vs tors. theta energy: -61.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -699.337128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.337128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.337128 (E_RNA) where: Base-Base interactions energy: -438.494 where: short stacking energy: -214.605 Base-Backbone interact. energy: -0.958 local terms energy: -259.884696 where: bonds (distance) C4'-P energy: -55.823 bonds (distance) P-C4' energy: -53.091 flat angles C4'-P-C4' energy: -62.489 flat angles P-C4'-P energy: -44.834 tors. eta vs tors. theta energy: -43.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -612.472164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.472164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.472164 (E_RNA) where: Base-Base interactions energy: -349.176 where: short stacking energy: -171.341 Base-Backbone interact. energy: -0.908 local terms energy: -262.388391 where: bonds (distance) C4'-P energy: -59.732 bonds (distance) P-C4' energy: -62.123 flat angles C4'-P-C4' energy: -57.359 flat angles P-C4'-P energy: -30.879 tors. eta vs tors. theta energy: -52.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -594.834723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.834723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.834723 (E_RNA) where: Base-Base interactions energy: -344.970 where: short stacking energy: -156.786 Base-Backbone interact. energy: -0.937 local terms energy: -248.927707 where: bonds (distance) C4'-P energy: -56.467 bonds (distance) P-C4' energy: -61.445 flat angles C4'-P-C4' energy: -56.847 flat angles P-C4'-P energy: -37.910 tors. eta vs tors. theta energy: -36.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -299.347345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.347345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.347345 (E_RNA) where: Base-Base interactions energy: -96.548 where: short stacking energy: -96.163 Base-Backbone interact. energy: 1.912 local terms energy: -204.711401 where: bonds (distance) C4'-P energy: -55.589 bonds (distance) P-C4' energy: -61.920 flat angles C4'-P-C4' energy: -53.518 flat angles P-C4'-P energy: -25.884 tors. eta vs tors. theta energy: -7.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -269.625213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.625213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.625213 (E_RNA) where: Base-Base interactions energy: -97.016 where: short stacking energy: -72.454 Base-Backbone interact. energy: -0.102 local terms energy: -172.507682 where: bonds (distance) C4'-P energy: -33.176 bonds (distance) P-C4' energy: -47.231 flat angles C4'-P-C4' energy: -60.903 flat angles P-C4'-P energy: -37.778 tors. eta vs tors. theta energy: 6.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -251.565950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.565950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.565950 (E_RNA) where: Base-Base interactions energy: -87.527 where: short stacking energy: -74.725 Base-Backbone interact. energy: 3.408 local terms energy: -167.446746 where: bonds (distance) C4'-P energy: -52.213 bonds (distance) P-C4' energy: -50.632 flat angles C4'-P-C4' energy: -45.036 flat angles P-C4'-P energy: -26.006 tors. eta vs tors. theta energy: 6.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1029.169610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.169610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.169610 (E_RNA) where: Base-Base interactions energy: -674.902 where: short stacking energy: -295.879 Base-Backbone interact. energy: -0.730 local terms energy: -353.537751 where: bonds (distance) C4'-P energy: -60.635 bonds (distance) P-C4' energy: -69.242 flat angles C4'-P-C4' energy: -77.361 flat angles P-C4'-P energy: -49.150 tors. eta vs tors. theta energy: -97.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -938.479166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.479166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.479166 (E_RNA) where: Base-Base interactions energy: -633.051 where: short stacking energy: -262.071 Base-Backbone interact. energy: -0.720 local terms energy: -304.708203 where: bonds (distance) C4'-P energy: -56.848 bonds (distance) P-C4' energy: -58.604 flat angles C4'-P-C4' energy: -75.294 flat angles P-C4'-P energy: -41.357 tors. eta vs tors. theta energy: -72.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -872.684195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.684195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.684195 (E_RNA) where: Base-Base interactions energy: -577.190 where: short stacking energy: -232.027 Base-Backbone interact. energy: -1.067 local terms energy: -294.426848 where: bonds (distance) C4'-P energy: -62.661 bonds (distance) P-C4' energy: -58.396 flat angles C4'-P-C4' energy: -64.859 flat angles P-C4'-P energy: -44.055 tors. eta vs tors. theta energy: -64.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -819.570026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.570026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.570026 (E_RNA) where: Base-Base interactions energy: -528.700 where: short stacking energy: -244.264 Base-Backbone interact. energy: -1.667 local terms energy: -289.202144 where: bonds (distance) C4'-P energy: -57.189 bonds (distance) P-C4' energy: -53.471 flat angles C4'-P-C4' energy: -58.715 flat angles P-C4'-P energy: -44.629 tors. eta vs tors. theta energy: -75.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -681.011430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.011430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.011430 (E_RNA) where: Base-Base interactions energy: -422.022 where: short stacking energy: -193.020 Base-Backbone interact. energy: 0.931 local terms energy: -259.920640 where: bonds (distance) C4'-P energy: -55.953 bonds (distance) P-C4' energy: -70.216 flat angles C4'-P-C4' energy: -53.780 flat angles P-C4'-P energy: -31.000 tors. eta vs tors. theta energy: -48.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -628.077501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.077501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.077501 (E_RNA) where: Base-Base interactions energy: -381.936 where: short stacking energy: -179.442 Base-Backbone interact. energy: -0.965 local terms energy: -245.176671 where: bonds (distance) C4'-P energy: -60.080 bonds (distance) P-C4' energy: -54.543 flat angles C4'-P-C4' energy: -58.641 flat angles P-C4'-P energy: -33.020 tors. eta vs tors. theta energy: -38.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -646.743898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.743898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.743898 (E_RNA) where: Base-Base interactions energy: -429.061 where: short stacking energy: -183.783 Base-Backbone interact. energy: -0.764 local terms energy: -216.918577 where: bonds (distance) C4'-P energy: -59.067 bonds (distance) P-C4' energy: -43.934 flat angles C4'-P-C4' energy: -44.962 flat angles P-C4'-P energy: -35.036 tors. eta vs tors. theta energy: -33.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -293.808731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.808731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.808731 (E_RNA) where: Base-Base interactions energy: -98.462 where: short stacking energy: -66.212 Base-Backbone interact. energy: -0.978 local terms energy: -194.367895 where: bonds (distance) C4'-P energy: -54.854 bonds (distance) P-C4' energy: -59.137 flat angles C4'-P-C4' energy: -38.083 flat angles P-C4'-P energy: -43.059 tors. eta vs tors. theta energy: 0.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -291.949012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.949012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.949012 (E_RNA) where: Base-Base interactions energy: -96.017 where: short stacking energy: -84.447 Base-Backbone interact. energy: -1.019 local terms energy: -194.912923 where: bonds (distance) C4'-P energy: -48.436 bonds (distance) P-C4' energy: -60.199 flat angles C4'-P-C4' energy: -52.151 flat angles P-C4'-P energy: -25.164 tors. eta vs tors. theta energy: -8.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -270.805475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.805475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.805475 (E_RNA) where: Base-Base interactions energy: -97.510 where: short stacking energy: -74.967 Base-Backbone interact. energy: 4.049 local terms energy: -177.344714 where: bonds (distance) C4'-P energy: -50.517 bonds (distance) P-C4' energy: -56.329 flat angles C4'-P-C4' energy: -43.683 flat angles P-C4'-P energy: -40.289 tors. eta vs tors. theta energy: 13.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1018.589706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.589706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.589706 (E_RNA) where: Base-Base interactions energy: -678.350 where: short stacking energy: -315.380 Base-Backbone interact. energy: -1.075 local terms energy: -339.164711 where: bonds (distance) C4'-P energy: -58.428 bonds (distance) P-C4' energy: -68.674 flat angles C4'-P-C4' energy: -67.202 flat angles P-C4'-P energy: -43.183 tors. eta vs tors. theta energy: -101.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -959.380985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.380985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.380985 (E_RNA) where: Base-Base interactions energy: -649.274 where: short stacking energy: -274.871 Base-Backbone interact. energy: -1.847 local terms energy: -308.259695 where: bonds (distance) C4'-P energy: -63.523 bonds (distance) P-C4' energy: -59.361 flat angles C4'-P-C4' energy: -61.466 flat angles P-C4'-P energy: -42.936 tors. eta vs tors. theta energy: -80.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -857.126297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.126297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.126297 (E_RNA) where: Base-Base interactions energy: -559.480 where: short stacking energy: -226.218 Base-Backbone interact. energy: -1.261 local terms energy: -296.384357 where: bonds (distance) C4'-P energy: -54.543 bonds (distance) P-C4' energy: -68.618 flat angles C4'-P-C4' energy: -63.735 flat angles P-C4'-P energy: -43.829 tors. eta vs tors. theta energy: -65.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -840.915594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.915594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.915594 (E_RNA) where: Base-Base interactions energy: -569.414 where: short stacking energy: -231.809 Base-Backbone interact. energy: -1.982 local terms energy: -269.519034 where: bonds (distance) C4'-P energy: -42.685 bonds (distance) P-C4' energy: -57.503 flat angles C4'-P-C4' energy: -62.706 flat angles P-C4'-P energy: -41.512 tors. eta vs tors. theta energy: -65.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -703.180292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.180292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.180292 (E_RNA) where: Base-Base interactions energy: -439.128 where: short stacking energy: -195.337 Base-Backbone interact. energy: -1.695 local terms energy: -262.358195 where: bonds (distance) C4'-P energy: -60.951 bonds (distance) P-C4' energy: -53.068 flat angles C4'-P-C4' energy: -59.086 flat angles P-C4'-P energy: -42.343 tors. eta vs tors. theta energy: -46.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -651.260917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.260917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.260917 (E_RNA) where: Base-Base interactions energy: -399.163 where: short stacking energy: -189.682 Base-Backbone interact. energy: -1.050 local terms energy: -251.047667 where: bonds (distance) C4'-P energy: -58.485 bonds (distance) P-C4' energy: -62.552 flat angles C4'-P-C4' energy: -55.585 flat angles P-C4'-P energy: -27.972 tors. eta vs tors. theta energy: -46.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -639.900041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.900041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.900041 (E_RNA) where: Base-Base interactions energy: -398.413 where: short stacking energy: -184.405 Base-Backbone interact. energy: 0.612 local terms energy: -242.099420 where: bonds (distance) C4'-P energy: -49.159 bonds (distance) P-C4' energy: -59.620 flat angles C4'-P-C4' energy: -49.227 flat angles P-C4'-P energy: -40.426 tors. eta vs tors. theta energy: -43.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -282.040595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.040595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.040595 (E_RNA) where: Base-Base interactions energy: -84.607 where: short stacking energy: -58.300 Base-Backbone interact. energy: 0.627 local terms energy: -198.060354 where: bonds (distance) C4'-P energy: -50.987 bonds (distance) P-C4' energy: -61.349 flat angles C4'-P-C4' energy: -48.035 flat angles P-C4'-P energy: -38.419 tors. eta vs tors. theta energy: 0.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -286.688957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.688957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.688957 (E_RNA) where: Base-Base interactions energy: -108.434 where: short stacking energy: -74.196 Base-Backbone interact. energy: 0.720 local terms energy: -178.975179 where: bonds (distance) C4'-P energy: -64.388 bonds (distance) P-C4' energy: -55.883 flat angles C4'-P-C4' energy: -52.008 flat angles P-C4'-P energy: -14.317 tors. eta vs tors. theta energy: 7.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -268.987975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.987975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.987975 (E_RNA) where: Base-Base interactions energy: -83.451 where: short stacking energy: -69.211 Base-Backbone interact. energy: 2.135 local terms energy: -187.671864 where: bonds (distance) C4'-P energy: -45.092 bonds (distance) P-C4' energy: -64.041 flat angles C4'-P-C4' energy: -50.233 flat angles P-C4'-P energy: -27.138 tors. eta vs tors. theta energy: -1.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1011.712814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.712814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.712814 (E_RNA) where: Base-Base interactions energy: -661.141 where: short stacking energy: -291.781 Base-Backbone interact. energy: -1.820 local terms energy: -348.751379 where: bonds (distance) C4'-P energy: -57.172 bonds (distance) P-C4' energy: -69.260 flat angles C4'-P-C4' energy: -70.413 flat angles P-C4'-P energy: -47.930 tors. eta vs tors. theta energy: -103.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -952.843095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.843095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.843095 (E_RNA) where: Base-Base interactions energy: -637.479 where: short stacking energy: -261.770 Base-Backbone interact. energy: 1.308 local terms energy: -316.672164 where: bonds (distance) C4'-P energy: -57.339 bonds (distance) P-C4' energy: -61.376 flat angles C4'-P-C4' energy: -65.193 flat angles P-C4'-P energy: -49.618 tors. eta vs tors. theta energy: -83.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -835.689701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.689701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.689701 (E_RNA) where: Base-Base interactions energy: -547.895 where: short stacking energy: -240.540 Base-Backbone interact. energy: 3.444 local terms energy: -291.238704 where: bonds (distance) C4'-P energy: -64.924 bonds (distance) P-C4' energy: -60.940 flat angles C4'-P-C4' energy: -59.598 flat angles P-C4'-P energy: -43.052 tors. eta vs tors. theta energy: -62.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -844.833266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.833266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.833266 (E_RNA) where: Base-Base interactions energy: -557.864 where: short stacking energy: -248.640 Base-Backbone interact. energy: -0.644 local terms energy: -286.325014 where: bonds (distance) C4'-P energy: -65.670 bonds (distance) P-C4' energy: -49.368 flat angles C4'-P-C4' energy: -64.437 flat angles P-C4'-P energy: -39.520 tors. eta vs tors. theta energy: -67.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -718.647645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.647645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.647645 (E_RNA) where: Base-Base interactions energy: -440.492 where: short stacking energy: -197.521 Base-Backbone interact. energy: -2.541 local terms energy: -275.614615 where: bonds (distance) C4'-P energy: -57.972 bonds (distance) P-C4' energy: -52.015 flat angles C4'-P-C4' energy: -62.967 flat angles P-C4'-P energy: -53.076 tors. eta vs tors. theta energy: -49.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -598.587492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.587492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.587492 (E_RNA) where: Base-Base interactions energy: -354.360 where: short stacking energy: -145.180 Base-Backbone interact. energy: 2.381 local terms energy: -246.608589 where: bonds (distance) C4'-P energy: -51.480 bonds (distance) P-C4' energy: -56.167 flat angles C4'-P-C4' energy: -69.731 flat angles P-C4'-P energy: -42.610 tors. eta vs tors. theta energy: -26.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -564.647620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.647620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.647620 (E_RNA) where: Base-Base interactions energy: -335.858 where: short stacking energy: -163.658 Base-Backbone interact. energy: -1.964 local terms energy: -226.826120 where: bonds (distance) C4'-P energy: -57.710 bonds (distance) P-C4' energy: -61.198 flat angles C4'-P-C4' energy: -43.814 flat angles P-C4'-P energy: -32.815 tors. eta vs tors. theta energy: -31.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -342.326908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.326908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.326908 (E_RNA) where: Base-Base interactions energy: -156.894 where: short stacking energy: -84.154 Base-Backbone interact. energy: -0.007 local terms energy: -185.426455 where: bonds (distance) C4'-P energy: -58.863 bonds (distance) P-C4' energy: -59.309 flat angles C4'-P-C4' energy: -39.540 flat angles P-C4'-P energy: -32.342 tors. eta vs tors. theta energy: 4.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -266.012033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.012033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.012033 (E_RNA) where: Base-Base interactions energy: -58.259 where: short stacking energy: -52.874 Base-Backbone interact. energy: -0.014 local terms energy: -207.739091 where: bonds (distance) C4'-P energy: -62.358 bonds (distance) P-C4' energy: -59.269 flat angles C4'-P-C4' energy: -55.540 flat angles P-C4'-P energy: -37.094 tors. eta vs tors. theta energy: 6.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -239.940787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.940787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.940787 (E_RNA) where: Base-Base interactions energy: -84.261 where: short stacking energy: -69.401 Base-Backbone interact. energy: -1.132 local terms energy: -154.547736 where: bonds (distance) C4'-P energy: -60.376 bonds (distance) P-C4' energy: -50.144 flat angles C4'-P-C4' energy: -43.842 flat angles P-C4'-P energy: -10.537 tors. eta vs tors. theta energy: 10.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1024.446124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.446124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.446124 (E_RNA) where: Base-Base interactions energy: -675.456 where: short stacking energy: -309.583 Base-Backbone interact. energy: -2.950 local terms energy: -346.040139 where: bonds (distance) C4'-P energy: -63.121 bonds (distance) P-C4' energy: -60.569 flat angles C4'-P-C4' energy: -67.810 flat angles P-C4'-P energy: -52.791 tors. eta vs tors. theta energy: -101.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -934.132472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.132472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.132472 (E_RNA) where: Base-Base interactions energy: -626.657 where: short stacking energy: -255.528 Base-Backbone interact. energy: -1.288 local terms energy: -306.187462 where: bonds (distance) C4'-P energy: -58.144 bonds (distance) P-C4' energy: -62.405 flat angles C4'-P-C4' energy: -68.597 flat angles P-C4'-P energy: -42.853 tors. eta vs tors. theta energy: -74.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -864.449154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.449154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.449154 (E_RNA) where: Base-Base interactions energy: -566.677 where: short stacking energy: -247.141 Base-Backbone interact. energy: 0.624 local terms energy: -298.396652 where: bonds (distance) C4'-P energy: -60.927 bonds (distance) P-C4' energy: -62.209 flat angles C4'-P-C4' energy: -68.240 flat angles P-C4'-P energy: -34.805 tors. eta vs tors. theta energy: -72.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -849.314912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.314912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.314912 (E_RNA) where: Base-Base interactions energy: -567.311 where: short stacking energy: -259.587 Base-Backbone interact. energy: -2.392 local terms energy: -279.611911 where: bonds (distance) C4'-P energy: -61.519 bonds (distance) P-C4' energy: -57.748 flat angles C4'-P-C4' energy: -53.953 flat angles P-C4'-P energy: -35.969 tors. eta vs tors. theta energy: -70.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -714.771084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.771084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.771084 (E_RNA) where: Base-Base interactions energy: -437.442 where: short stacking energy: -219.622 Base-Backbone interact. energy: -0.104 local terms energy: -277.224431 where: bonds (distance) C4'-P energy: -58.878 bonds (distance) P-C4' energy: -51.106 flat angles C4'-P-C4' energy: -66.916 flat angles P-C4'-P energy: -39.115 tors. eta vs tors. theta energy: -61.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -580.629207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.629207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.629207 (E_RNA) where: Base-Base interactions energy: -340.107 where: short stacking energy: -161.267 Base-Backbone interact. energy: 0.847 local terms energy: -241.369120 where: bonds (distance) C4'-P energy: -62.467 bonds (distance) P-C4' energy: -57.563 flat angles C4'-P-C4' energy: -61.570 flat angles P-C4'-P energy: -25.848 tors. eta vs tors. theta energy: -33.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -587.491700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.491700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.491700 (E_RNA) where: Base-Base interactions energy: -364.268 where: short stacking energy: -177.258 Base-Backbone interact. energy: -0.753 local terms energy: -222.471399 where: bonds (distance) C4'-P energy: -46.515 bonds (distance) P-C4' energy: -55.289 flat angles C4'-P-C4' energy: -45.053 flat angles P-C4'-P energy: -40.348 tors. eta vs tors. theta energy: -35.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -351.220011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.220011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.220011 (E_RNA) where: Base-Base interactions energy: -167.290 where: short stacking energy: -94.807 Base-Backbone interact. energy: -2.603 local terms energy: -181.326410 where: bonds (distance) C4'-P energy: -50.107 bonds (distance) P-C4' energy: -50.541 flat angles C4'-P-C4' energy: -44.791 flat angles P-C4'-P energy: -19.251 tors. eta vs tors. theta energy: -16.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -285.948083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.948083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.948083 (E_RNA) where: Base-Base interactions energy: -113.435 where: short stacking energy: -80.358 Base-Backbone interact. energy: -0.912 local terms energy: -171.601626 where: bonds (distance) C4'-P energy: -58.991 bonds (distance) P-C4' energy: -57.012 flat angles C4'-P-C4' energy: -34.223 flat angles P-C4'-P energy: -22.127 tors. eta vs tors. theta energy: 0.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -248.845551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.845551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.845551 (E_RNA) where: Base-Base interactions energy: -79.079 where: short stacking energy: -66.362 Base-Backbone interact. energy: -0.475 local terms energy: -169.291778 where: bonds (distance) C4'-P energy: -42.081 bonds (distance) P-C4' energy: -59.473 flat angles C4'-P-C4' energy: -58.139 flat angles P-C4'-P energy: -29.844 tors. eta vs tors. theta energy: 20.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1003.471710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.471710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.471710 (E_RNA) where: Base-Base interactions energy: -655.341 where: short stacking energy: -289.131 Base-Backbone interact. energy: -2.239 local terms energy: -345.891756 where: bonds (distance) C4'-P energy: -64.030 bonds (distance) P-C4' energy: -69.256 flat angles C4'-P-C4' energy: -75.007 flat angles P-C4'-P energy: -46.236 tors. eta vs tors. theta energy: -91.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -928.235514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.235514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.235514 (E_RNA) where: Base-Base interactions energy: -627.219 where: short stacking energy: -266.019 Base-Backbone interact. energy: 0.003 local terms energy: -301.019501 where: bonds (distance) C4'-P energy: -58.476 bonds (distance) P-C4' energy: -62.844 flat angles C4'-P-C4' energy: -58.763 flat angles P-C4'-P energy: -45.562 tors. eta vs tors. theta energy: -75.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -880.739383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.739383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.739383 (E_RNA) where: Base-Base interactions energy: -564.561 where: short stacking energy: -237.527 Base-Backbone interact. energy: -1.457 local terms energy: -314.721831 where: bonds (distance) C4'-P energy: -63.585 bonds (distance) P-C4' energy: -61.658 flat angles C4'-P-C4' energy: -71.227 flat angles P-C4'-P energy: -50.776 tors. eta vs tors. theta energy: -67.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -852.830511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.830511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.830511 (E_RNA) where: Base-Base interactions energy: -567.087 where: short stacking energy: -239.975 Base-Backbone interact. energy: -0.193 local terms energy: -285.550675 where: bonds (distance) C4'-P energy: -69.686 bonds (distance) P-C4' energy: -68.833 flat angles C4'-P-C4' energy: -49.310 flat angles P-C4'-P energy: -34.141 tors. eta vs tors. theta energy: -63.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -693.988886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.988886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.988886 (E_RNA) where: Base-Base interactions energy: -417.160 where: short stacking energy: -208.039 Base-Backbone interact. energy: -1.381 local terms energy: -275.447821 where: bonds (distance) C4'-P energy: -60.581 bonds (distance) P-C4' energy: -64.752 flat angles C4'-P-C4' energy: -57.633 flat angles P-C4'-P energy: -31.566 tors. eta vs tors. theta energy: -60.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -621.841634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.841634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.841634 (E_RNA) where: Base-Base interactions energy: -361.379 where: short stacking energy: -160.881 Base-Backbone interact. energy: -0.376 local terms energy: -260.086730 where: bonds (distance) C4'-P energy: -64.067 bonds (distance) P-C4' energy: -58.533 flat angles C4'-P-C4' energy: -59.891 flat angles P-C4'-P energy: -44.616 tors. eta vs tors. theta energy: -32.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -615.972898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.972898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.972898 (E_RNA) where: Base-Base interactions energy: -374.308 where: short stacking energy: -164.979 Base-Backbone interact. energy: 1.876 local terms energy: -243.540109 where: bonds (distance) C4'-P energy: -52.431 bonds (distance) P-C4' energy: -61.245 flat angles C4'-P-C4' energy: -47.388 flat angles P-C4'-P energy: -40.706 tors. eta vs tors. theta energy: -41.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -440.891189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.891189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.891189 (E_RNA) where: Base-Base interactions energy: -249.400 where: short stacking energy: -129.385 Base-Backbone interact. energy: -2.681 local terms energy: -188.809604 where: bonds (distance) C4'-P energy: -43.540 bonds (distance) P-C4' energy: -54.046 flat angles C4'-P-C4' energy: -52.172 flat angles P-C4'-P energy: -32.811 tors. eta vs tors. theta energy: -6.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -270.082226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -270.082226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.082226 (E_RNA) where: Base-Base interactions energy: -93.537 where: short stacking energy: -79.732 Base-Backbone interact. energy: -0.907 local terms energy: -175.638772 where: bonds (distance) C4'-P energy: -49.175 bonds (distance) P-C4' energy: -49.076 flat angles C4'-P-C4' energy: -57.923 flat angles P-C4'-P energy: -28.972 tors. eta vs tors. theta energy: 9.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -262.742036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.742036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.742036 (E_RNA) where: Base-Base interactions energy: -85.248 where: short stacking energy: -68.828 Base-Backbone interact. energy: -1.547 local terms energy: -175.947041 where: bonds (distance) C4'-P energy: -57.706 bonds (distance) P-C4' energy: -46.798 flat angles C4'-P-C4' energy: -57.375 flat angles P-C4'-P energy: -20.896 tors. eta vs tors. theta energy: 6.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1015.734867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.734867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.734867 (E_RNA) where: Base-Base interactions energy: -672.347 where: short stacking energy: -301.486 Base-Backbone interact. energy: -2.399 local terms energy: -340.988306 where: bonds (distance) C4'-P energy: -62.708 bonds (distance) P-C4' energy: -61.028 flat angles C4'-P-C4' energy: -69.110 flat angles P-C4'-P energy: -49.757 tors. eta vs tors. theta energy: -98.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -938.794571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.794571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.794571 (E_RNA) where: Base-Base interactions energy: -622.324 where: short stacking energy: -277.498 Base-Backbone interact. energy: -1.736 local terms energy: -314.734789 where: bonds (distance) C4'-P energy: -68.425 bonds (distance) P-C4' energy: -65.728 flat angles C4'-P-C4' energy: -66.124 flat angles P-C4'-P energy: -38.053 tors. eta vs tors. theta energy: -76.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -897.455886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.455886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.455886 (E_RNA) where: Base-Base interactions energy: -603.692 where: short stacking energy: -257.467 Base-Backbone interact. energy: -0.361 local terms energy: -293.403218 where: bonds (distance) C4'-P energy: -62.259 bonds (distance) P-C4' energy: -63.659 flat angles C4'-P-C4' energy: -63.733 flat angles P-C4'-P energy: -36.376 tors. eta vs tors. theta energy: -67.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -856.158105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.158105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.158105 (E_RNA) where: Base-Base interactions energy: -555.926 where: short stacking energy: -256.933 Base-Backbone interact. energy: -1.195 local terms energy: -299.037161 where: bonds (distance) C4'-P energy: -48.243 bonds (distance) P-C4' energy: -57.029 flat angles C4'-P-C4' energy: -74.907 flat angles P-C4'-P energy: -45.920 tors. eta vs tors. theta energy: -72.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -660.484603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.484603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.484603 (E_RNA) where: Base-Base interactions energy: -422.237 where: short stacking energy: -196.614 Base-Backbone interact. energy: -1.215 local terms energy: -237.032583 where: bonds (distance) C4'-P energy: -57.671 bonds (distance) P-C4' energy: -57.186 flat angles C4'-P-C4' energy: -42.748 flat angles P-C4'-P energy: -38.988 tors. eta vs tors. theta energy: -40.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -609.558871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.558871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.558871 (E_RNA) where: Base-Base interactions energy: -361.630 where: short stacking energy: -172.232 Base-Backbone interact. energy: -2.952 local terms energy: -244.977566 where: bonds (distance) C4'-P energy: -51.105 bonds (distance) P-C4' energy: -56.534 flat angles C4'-P-C4' energy: -55.366 flat angles P-C4'-P energy: -42.497 tors. eta vs tors. theta energy: -39.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -644.586784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.586784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.586784 (E_RNA) where: Base-Base interactions energy: -398.344 where: short stacking energy: -183.795 Base-Backbone interact. energy: -0.087 local terms energy: -246.155857 where: bonds (distance) C4'-P energy: -55.657 bonds (distance) P-C4' energy: -53.095 flat angles C4'-P-C4' energy: -63.204 flat angles P-C4'-P energy: -28.172 tors. eta vs tors. theta energy: -46.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -433.047170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.047170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.047170 (E_RNA) where: Base-Base interactions energy: -235.782 where: short stacking energy: -122.020 Base-Backbone interact. energy: 0.523 local terms energy: -197.787691 where: bonds (distance) C4'-P energy: -55.147 bonds (distance) P-C4' energy: -46.702 flat angles C4'-P-C4' energy: -55.513 flat angles P-C4'-P energy: -26.436 tors. eta vs tors. theta energy: -13.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -258.195877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.195877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.195877 (E_RNA) where: Base-Base interactions energy: -84.422 where: short stacking energy: -67.550 Base-Backbone interact. energy: -0.213 local terms energy: -173.561751 where: bonds (distance) C4'-P energy: -45.685 bonds (distance) P-C4' energy: -55.056 flat angles C4'-P-C4' energy: -46.198 flat angles P-C4'-P energy: -34.417 tors. eta vs tors. theta energy: 7.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -265.739508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.739508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.739508 (E_RNA) where: Base-Base interactions energy: -89.771 where: short stacking energy: -75.257 Base-Backbone interact. energy: -0.427 local terms energy: -175.541536 where: bonds (distance) C4'-P energy: -40.727 bonds (distance) P-C4' energy: -68.643 flat angles C4'-P-C4' energy: -43.185 flat angles P-C4'-P energy: -25.386 tors. eta vs tors. theta energy: 2.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1007.354172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.354172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.354172 (E_RNA) where: Base-Base interactions energy: -677.814 where: short stacking energy: -310.012 Base-Backbone interact. energy: -1.345 local terms energy: -328.195622 where: bonds (distance) C4'-P energy: -60.622 bonds (distance) P-C4' energy: -65.019 flat angles C4'-P-C4' energy: -70.356 flat angles P-C4'-P energy: -44.338 tors. eta vs tors. theta energy: -87.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -946.523596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.523596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.523596 (E_RNA) where: Base-Base interactions energy: -638.576 where: short stacking energy: -264.111 Base-Backbone interact. energy: -3.013 local terms energy: -304.934091 where: bonds (distance) C4'-P energy: -58.422 bonds (distance) P-C4' energy: -65.632 flat angles C4'-P-C4' energy: -55.781 flat angles P-C4'-P energy: -46.550 tors. eta vs tors. theta energy: -78.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -945.870549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.870549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.870549 (E_RNA) where: Base-Base interactions energy: -637.280 where: short stacking energy: -247.488 Base-Backbone interact. energy: -0.331 local terms energy: -308.260182 where: bonds (distance) C4'-P energy: -68.692 bonds (distance) P-C4' energy: -58.696 flat angles C4'-P-C4' energy: -62.159 flat angles P-C4'-P energy: -39.506 tors. eta vs tors. theta energy: -79.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -902.193299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.193299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.193299 (E_RNA) where: Base-Base interactions energy: -596.103 where: short stacking energy: -265.135 Base-Backbone interact. energy: 1.021 local terms energy: -307.111433 where: bonds (distance) C4'-P energy: -66.214 bonds (distance) P-C4' energy: -57.672 flat angles C4'-P-C4' energy: -65.877 flat angles P-C4'-P energy: -37.208 tors. eta vs tors. theta energy: -80.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -674.652946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.652946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.652946 (E_RNA) where: Base-Base interactions energy: -428.633 where: short stacking energy: -185.986 Base-Backbone interact. energy: -0.301 local terms energy: -245.718850 where: bonds (distance) C4'-P energy: -56.083 bonds (distance) P-C4' energy: -49.004 flat angles C4'-P-C4' energy: -59.287 flat angles P-C4'-P energy: -41.040 tors. eta vs tors. theta energy: -40.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -619.634821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -619.634821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.634821 (E_RNA) where: Base-Base interactions energy: -372.656 where: short stacking energy: -172.648 Base-Backbone interact. energy: -1.601 local terms energy: -245.377726 where: bonds (distance) C4'-P energy: -58.423 bonds (distance) P-C4' energy: -52.825 flat angles C4'-P-C4' energy: -58.744 flat angles P-C4'-P energy: -46.016 tors. eta vs tors. theta energy: -29.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -645.718846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.718846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.718846 (E_RNA) where: Base-Base interactions energy: -399.515 where: short stacking energy: -169.347 Base-Backbone interact. energy: -1.076 local terms energy: -245.128403 where: bonds (distance) C4'-P energy: -54.511 bonds (distance) P-C4' energy: -55.977 flat angles C4'-P-C4' energy: -54.806 flat angles P-C4'-P energy: -33.266 tors. eta vs tors. theta energy: -46.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -486.320243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.320243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.320243 (E_RNA) where: Base-Base interactions energy: -270.442 where: short stacking energy: -134.368 Base-Backbone interact. energy: 0.087 local terms energy: -215.965176 where: bonds (distance) C4'-P energy: -51.144 bonds (distance) P-C4' energy: -50.039 flat angles C4'-P-C4' energy: -58.973 flat angles P-C4'-P energy: -38.526 tors. eta vs tors. theta energy: -17.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -283.177531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.177531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.177531 (E_RNA) where: Base-Base interactions energy: -109.109 where: short stacking energy: -89.950 Base-Backbone interact. energy: -1.029 local terms energy: -173.038912 where: bonds (distance) C4'-P energy: -57.933 bonds (distance) P-C4' energy: -42.146 flat angles C4'-P-C4' energy: -45.502 flat angles P-C4'-P energy: -32.771 tors. eta vs tors. theta energy: 5.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -287.394129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.394129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.394129 (E_RNA) where: Base-Base interactions energy: -127.242 where: short stacking energy: -70.864 Base-Backbone interact. energy: -0.658 local terms energy: -159.493422 where: bonds (distance) C4'-P energy: -53.389 bonds (distance) P-C4' energy: -51.764 flat angles C4'-P-C4' energy: -45.406 flat angles P-C4'-P energy: -28.767 tors. eta vs tors. theta energy: 19.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1019.729742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.729742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.729742 (E_RNA) where: Base-Base interactions energy: -682.591 where: short stacking energy: -305.840 Base-Backbone interact. energy: -1.794 local terms energy: -335.345138 where: bonds (distance) C4'-P energy: -65.484 bonds (distance) P-C4' energy: -58.532 flat angles C4'-P-C4' energy: -67.974 flat angles P-C4'-P energy: -50.811 tors. eta vs tors. theta energy: -92.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -930.039335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.039335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.039335 (E_RNA) where: Base-Base interactions energy: -619.705 where: short stacking energy: -256.946 Base-Backbone interact. energy: 0.367 local terms energy: -310.700826 where: bonds (distance) C4'-P energy: -62.853 bonds (distance) P-C4' energy: -61.847 flat angles C4'-P-C4' energy: -67.095 flat angles P-C4'-P energy: -50.100 tors. eta vs tors. theta energy: -68.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -952.295046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.295046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.295046 (E_RNA) where: Base-Base interactions energy: -648.778 where: short stacking energy: -270.641 Base-Backbone interact. energy: -1.496 local terms energy: -302.020553 where: bonds (distance) C4'-P energy: -53.431 bonds (distance) P-C4' energy: -69.693 flat angles C4'-P-C4' energy: -59.189 flat angles P-C4'-P energy: -36.486 tors. eta vs tors. theta energy: -83.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -906.324620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.324620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.324620 (E_RNA) where: Base-Base interactions energy: -600.788 where: short stacking energy: -259.362 Base-Backbone interact. energy: -0.394 local terms energy: -305.142668 where: bonds (distance) C4'-P energy: -55.317 bonds (distance) P-C4' energy: -62.348 flat angles C4'-P-C4' energy: -59.179 flat angles P-C4'-P energy: -42.545 tors. eta vs tors. theta energy: -85.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -720.706679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.706679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.706679 (E_RNA) where: Base-Base interactions energy: -477.595 where: short stacking energy: -208.376 Base-Backbone interact. energy: -1.193 local terms energy: -241.919121 where: bonds (distance) C4'-P energy: -38.511 bonds (distance) P-C4' energy: -52.290 flat angles C4'-P-C4' energy: -61.761 flat angles P-C4'-P energy: -37.288 tors. eta vs tors. theta energy: -52.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -602.532873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.532873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.532873 (E_RNA) where: Base-Base interactions energy: -364.973 where: short stacking energy: -175.164 Base-Backbone interact. energy: -1.134 local terms energy: -236.425443 where: bonds (distance) C4'-P energy: -44.159 bonds (distance) P-C4' energy: -59.756 flat angles C4'-P-C4' energy: -62.300 flat angles P-C4'-P energy: -34.629 tors. eta vs tors. theta energy: -35.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -659.688377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.688377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.688377 (E_RNA) where: Base-Base interactions energy: -414.256 where: short stacking energy: -181.242 Base-Backbone interact. energy: -3.037 local terms energy: -242.395695 where: bonds (distance) C4'-P energy: -54.630 bonds (distance) P-C4' energy: -52.890 flat angles C4'-P-C4' energy: -52.112 flat angles P-C4'-P energy: -36.451 tors. eta vs tors. theta energy: -46.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -479.452272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.452272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.452272 (E_RNA) where: Base-Base interactions energy: -278.700 where: short stacking energy: -126.620 Base-Backbone interact. energy: -0.229 local terms energy: -200.523161 where: bonds (distance) C4'-P energy: -59.950 bonds (distance) P-C4' energy: -54.204 flat angles C4'-P-C4' energy: -54.174 flat angles P-C4'-P energy: -19.912 tors. eta vs tors. theta energy: -12.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -280.470007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.470007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.470007 (E_RNA) where: Base-Base interactions energy: -115.498 where: short stacking energy: -69.437 Base-Backbone interact. energy: 0.847 local terms energy: -165.818974 where: bonds (distance) C4'-P energy: -48.551 bonds (distance) P-C4' energy: -51.131 flat angles C4'-P-C4' energy: -41.236 flat angles P-C4'-P energy: -28.110 tors. eta vs tors. theta energy: 3.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -275.648728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.648728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.648728 (E_RNA) where: Base-Base interactions energy: -107.665 where: short stacking energy: -74.484 Base-Backbone interact. energy: -2.583 local terms energy: -165.400997 where: bonds (distance) C4'-P energy: -47.132 bonds (distance) P-C4' energy: -47.268 flat angles C4'-P-C4' energy: -59.298 flat angles P-C4'-P energy: -22.899 tors. eta vs tors. theta energy: 11.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1018.963639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.963639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.963639 (E_RNA) where: Base-Base interactions energy: -688.582 where: short stacking energy: -306.746 Base-Backbone interact. energy: 1.243 local terms energy: -331.624033 where: bonds (distance) C4'-P energy: -59.612 bonds (distance) P-C4' energy: -67.375 flat angles C4'-P-C4' energy: -65.970 flat angles P-C4'-P energy: -40.279 tors. eta vs tors. theta energy: -98.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -966.693168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.693168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.693168 (E_RNA) where: Base-Base interactions energy: -646.626 where: short stacking energy: -285.485 Base-Backbone interact. energy: 2.119 local terms energy: -322.186744 where: bonds (distance) C4'-P energy: -62.737 bonds (distance) P-C4' energy: -57.531 flat angles C4'-P-C4' energy: -73.586 flat angles P-C4'-P energy: -46.287 tors. eta vs tors. theta energy: -82.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -932.682974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.682974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.682974 (E_RNA) where: Base-Base interactions energy: -606.656 where: short stacking energy: -261.058 Base-Backbone interact. energy: -0.878 local terms energy: -325.149209 where: bonds (distance) C4'-P energy: -63.030 bonds (distance) P-C4' energy: -68.216 flat angles C4'-P-C4' energy: -73.519 flat angles P-C4'-P energy: -42.922 tors. eta vs tors. theta energy: -77.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -895.088273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.088273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.088273 (E_RNA) where: Base-Base interactions energy: -575.183 where: short stacking energy: -242.047 Base-Backbone interact. energy: -1.171 local terms energy: -318.733737 where: bonds (distance) C4'-P energy: -56.272 bonds (distance) P-C4' energy: -67.531 flat angles C4'-P-C4' energy: -74.708 flat angles P-C4'-P energy: -42.235 tors. eta vs tors. theta energy: -77.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -706.291993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.291993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.291993 (E_RNA) where: Base-Base interactions energy: -449.613 where: short stacking energy: -212.625 Base-Backbone interact. energy: -1.264 local terms energy: -255.415087 where: bonds (distance) C4'-P energy: -54.708 bonds (distance) P-C4' energy: -47.364 flat angles C4'-P-C4' energy: -60.234 flat angles P-C4'-P energy: -37.708 tors. eta vs tors. theta energy: -55.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -738.692847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.692847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.692847 (E_RNA) where: Base-Base interactions energy: -462.172 where: short stacking energy: -200.847 Base-Backbone interact. energy: -1.389 local terms energy: -275.132466 where: bonds (distance) C4'-P energy: -60.656 bonds (distance) P-C4' energy: -63.954 flat angles C4'-P-C4' energy: -50.052 flat angles P-C4'-P energy: -38.768 tors. eta vs tors. theta energy: -61.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -599.905493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.905493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.905493 (E_RNA) where: Base-Base interactions energy: -369.616 where: short stacking energy: -176.850 Base-Backbone interact. energy: -1.123 local terms energy: -229.166339 where: bonds (distance) C4'-P energy: -60.663 bonds (distance) P-C4' energy: -53.185 flat angles C4'-P-C4' energy: -46.974 flat angles P-C4'-P energy: -35.068 tors. eta vs tors. theta energy: -33.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -467.866924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.866924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.866924 (E_RNA) where: Base-Base interactions energy: -258.186 where: short stacking energy: -134.512 Base-Backbone interact. energy: 0.929 local terms energy: -210.610289 where: bonds (distance) C4'-P energy: -54.280 bonds (distance) P-C4' energy: -55.442 flat angles C4'-P-C4' energy: -47.916 flat angles P-C4'-P energy: -23.922 tors. eta vs tors. theta energy: -29.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -272.803632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.803632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.803632 (E_RNA) where: Base-Base interactions energy: -101.245 where: short stacking energy: -77.608 Base-Backbone interact. energy: -0.945 local terms energy: -170.613514 where: bonds (distance) C4'-P energy: -51.608 bonds (distance) P-C4' energy: -59.336 flat angles C4'-P-C4' energy: -45.854 flat angles P-C4'-P energy: -16.795 tors. eta vs tors. theta energy: 2.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -282.923599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.923599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.923599 (E_RNA) where: Base-Base interactions energy: -113.392 where: short stacking energy: -85.733 Base-Backbone interact. energy: -1.725 local terms energy: -167.806860 where: bonds (distance) C4'-P energy: -63.019 bonds (distance) P-C4' energy: -46.590 flat angles C4'-P-C4' energy: -38.380 flat angles P-C4'-P energy: -34.594 tors. eta vs tors. theta energy: 14.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1020.395724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.395724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.395724 (E_RNA) where: Base-Base interactions energy: -684.287 where: short stacking energy: -299.210 Base-Backbone interact. energy: -0.778 local terms energy: -335.330752 where: bonds (distance) C4'-P energy: -59.819 bonds (distance) P-C4' energy: -61.841 flat angles C4'-P-C4' energy: -72.232 flat angles P-C4'-P energy: -50.687 tors. eta vs tors. theta energy: -90.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -977.301831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.301831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.301831 (E_RNA) where: Base-Base interactions energy: -659.577 where: short stacking energy: -268.352 Base-Backbone interact. energy: -1.490 local terms energy: -316.234642 where: bonds (distance) C4'-P energy: -61.237 bonds (distance) P-C4' energy: -63.780 flat angles C4'-P-C4' energy: -70.496 flat angles P-C4'-P energy: -38.085 tors. eta vs tors. theta energy: -82.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -926.670806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.670806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.670806 (E_RNA) where: Base-Base interactions energy: -629.979 where: short stacking energy: -282.815 Base-Backbone interact. energy: -0.095 local terms energy: -296.596983 where: bonds (distance) C4'-P energy: -48.229 bonds (distance) P-C4' energy: -58.809 flat angles C4'-P-C4' energy: -61.933 flat angles P-C4'-P energy: -51.666 tors. eta vs tors. theta energy: -75.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -887.154113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.154113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.154113 (E_RNA) where: Base-Base interactions energy: -600.431 where: short stacking energy: -260.901 Base-Backbone interact. energy: -1.285 local terms energy: -285.438205 where: bonds (distance) C4'-P energy: -55.191 bonds (distance) P-C4' energy: -48.546 flat angles C4'-P-C4' energy: -65.495 flat angles P-C4'-P energy: -37.365 tors. eta vs tors. theta energy: -78.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -807.470598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.470598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.470598 (E_RNA) where: Base-Base interactions energy: -506.788 where: short stacking energy: -215.917 Base-Backbone interact. energy: -0.391 local terms energy: -300.291124 where: bonds (distance) C4'-P energy: -61.679 bonds (distance) P-C4' energy: -64.154 flat angles C4'-P-C4' energy: -69.960 flat angles P-C4'-P energy: -37.012 tors. eta vs tors. theta energy: -67.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -679.859030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.859030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.859030 (E_RNA) where: Base-Base interactions energy: -422.378 where: short stacking energy: -182.701 Base-Backbone interact. energy: -2.406 local terms energy: -255.075537 where: bonds (distance) C4'-P energy: -53.988 bonds (distance) P-C4' energy: -52.326 flat angles C4'-P-C4' energy: -59.195 flat angles P-C4'-P energy: -46.372 tors. eta vs tors. theta energy: -43.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -528.632387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.632387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.632387 (E_RNA) where: Base-Base interactions energy: -306.446 where: short stacking energy: -142.536 Base-Backbone interact. energy: 2.188 local terms energy: -224.373888 where: bonds (distance) C4'-P energy: -57.709 bonds (distance) P-C4' energy: -56.194 flat angles C4'-P-C4' energy: -59.335 flat angles P-C4'-P energy: -17.922 tors. eta vs tors. theta energy: -33.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -507.579733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.579733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.579733 (E_RNA) where: Base-Base interactions energy: -296.660 where: short stacking energy: -130.525 Base-Backbone interact. energy: 0.280 local terms energy: -211.199609 where: bonds (distance) C4'-P energy: -58.736 bonds (distance) P-C4' energy: -55.422 flat angles C4'-P-C4' energy: -49.688 flat angles P-C4'-P energy: -35.386 tors. eta vs tors. theta energy: -11.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -319.288621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.288621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.288621 (E_RNA) where: Base-Base interactions energy: -136.060 where: short stacking energy: -95.259 Base-Backbone interact. energy: 0.747 local terms energy: -183.975068 where: bonds (distance) C4'-P energy: -49.663 bonds (distance) P-C4' energy: -63.637 flat angles C4'-P-C4' energy: -56.241 flat angles P-C4'-P energy: -14.015 tors. eta vs tors. theta energy: -0.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -265.124998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.124998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.124998 (E_RNA) where: Base-Base interactions energy: -86.885 where: short stacking energy: -79.733 Base-Backbone interact. energy: -0.688 local terms energy: -177.551972 where: bonds (distance) C4'-P energy: -47.254 bonds (distance) P-C4' energy: -61.418 flat angles C4'-P-C4' energy: -45.629 flat angles P-C4'-P energy: -25.030 tors. eta vs tors. theta energy: 1.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -989.987077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.987077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.987077 (E_RNA) where: Base-Base interactions energy: -656.316 where: short stacking energy: -289.176 Base-Backbone interact. energy: -2.022 local terms energy: -331.649175 where: bonds (distance) C4'-P energy: -59.094 bonds (distance) P-C4' energy: -59.421 flat angles C4'-P-C4' energy: -71.865 flat angles P-C4'-P energy: -45.683 tors. eta vs tors. theta energy: -95.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -977.277662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.277662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.277662 (E_RNA) where: Base-Base interactions energy: -665.116 where: short stacking energy: -272.719 Base-Backbone interact. energy: -1.663 local terms energy: -310.498247 where: bonds (distance) C4'-P energy: -63.857 bonds (distance) P-C4' energy: -57.112 flat angles C4'-P-C4' energy: -61.349 flat angles P-C4'-P energy: -43.261 tors. eta vs tors. theta energy: -84.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -909.860082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.860082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.860082 (E_RNA) where: Base-Base interactions energy: -613.814 where: short stacking energy: -241.142 Base-Backbone interact. energy: 1.612 local terms energy: -297.657538 where: bonds (distance) C4'-P energy: -60.783 bonds (distance) P-C4' energy: -49.437 flat angles C4'-P-C4' energy: -68.820 flat angles P-C4'-P energy: -46.847 tors. eta vs tors. theta energy: -71.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -859.167134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.167134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.167134 (E_RNA) where: Base-Base interactions energy: -574.499 where: short stacking energy: -243.785 Base-Backbone interact. energy: 1.690 local terms energy: -286.358677 where: bonds (distance) C4'-P energy: -60.436 bonds (distance) P-C4' energy: -59.908 flat angles C4'-P-C4' energy: -61.588 flat angles P-C4'-P energy: -41.200 tors. eta vs tors. theta energy: -63.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -799.926110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.926110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.926110 (E_RNA) where: Base-Base interactions energy: -505.294 where: short stacking energy: -228.260 Base-Backbone interact. energy: -0.612 local terms energy: -294.020317 where: bonds (distance) C4'-P energy: -68.110 bonds (distance) P-C4' energy: -55.829 flat angles C4'-P-C4' energy: -63.847 flat angles P-C4'-P energy: -40.017 tors. eta vs tors. theta energy: -66.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -681.815008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.815008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.815008 (E_RNA) where: Base-Base interactions energy: -434.714 where: short stacking energy: -184.040 Base-Backbone interact. energy: 0.652 local terms energy: -247.753549 where: bonds (distance) C4'-P energy: -51.398 bonds (distance) P-C4' energy: -55.763 flat angles C4'-P-C4' energy: -56.478 flat angles P-C4'-P energy: -38.484 tors. eta vs tors. theta energy: -45.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -450.922181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.922181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.922181 (E_RNA) where: Base-Base interactions energy: -234.606 where: short stacking energy: -127.939 Base-Backbone interact. energy: -0.520 local terms energy: -215.795682 where: bonds (distance) C4'-P energy: -42.387 bonds (distance) P-C4' energy: -61.711 flat angles C4'-P-C4' energy: -47.676 flat angles P-C4'-P energy: -43.300 tors. eta vs tors. theta energy: -20.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -490.417420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.417420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.417420 (E_RNA) where: Base-Base interactions energy: -282.392 where: short stacking energy: -127.788 Base-Backbone interact. energy: -0.785 local terms energy: -207.241022 where: bonds (distance) C4'-P energy: -58.803 bonds (distance) P-C4' energy: -40.693 flat angles C4'-P-C4' energy: -56.329 flat angles P-C4'-P energy: -32.046 tors. eta vs tors. theta energy: -19.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -288.370716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.370716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.370716 (E_RNA) where: Base-Base interactions energy: -92.979 where: short stacking energy: -72.163 Base-Backbone interact. energy: 0.977 local terms energy: -196.369492 where: bonds (distance) C4'-P energy: -57.232 bonds (distance) P-C4' energy: -64.236 flat angles C4'-P-C4' energy: -55.148 flat angles P-C4'-P energy: -24.288 tors. eta vs tors. theta energy: 4.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -258.999518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.999518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.999518 (E_RNA) where: Base-Base interactions energy: -94.031 where: short stacking energy: -74.936 Base-Backbone interact. energy: -1.379 local terms energy: -163.589335 where: bonds (distance) C4'-P energy: -45.907 bonds (distance) P-C4' energy: -59.283 flat angles C4'-P-C4' energy: -39.167 flat angles P-C4'-P energy: -24.358 tors. eta vs tors. theta energy: 5.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -993.334202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.334202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.334202 (E_RNA) where: Base-Base interactions energy: -655.608 where: short stacking energy: -294.573 Base-Backbone interact. energy: 1.444 local terms energy: -339.169859 where: bonds (distance) C4'-P energy: -59.992 bonds (distance) P-C4' energy: -62.955 flat angles C4'-P-C4' energy: -72.781 flat angles P-C4'-P energy: -48.418 tors. eta vs tors. theta energy: -95.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -972.643443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.643443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.643443 (E_RNA) where: Base-Base interactions energy: -676.490 where: short stacking energy: -272.610 Base-Backbone interact. energy: -1.268 local terms energy: -294.885427 where: bonds (distance) C4'-P energy: -53.621 bonds (distance) P-C4' energy: -65.859 flat angles C4'-P-C4' energy: -58.473 flat angles P-C4'-P energy: -35.978 tors. eta vs tors. theta energy: -80.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -890.608719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.608719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.608719 (E_RNA) where: Base-Base interactions energy: -588.068 where: short stacking energy: -257.215 Base-Backbone interact. energy: -0.569 local terms energy: -301.971686 where: bonds (distance) C4'-P energy: -62.037 bonds (distance) P-C4' energy: -66.676 flat angles C4'-P-C4' energy: -63.768 flat angles P-C4'-P energy: -40.590 tors. eta vs tors. theta energy: -68.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -911.237654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.237654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.237654 (E_RNA) where: Base-Base interactions energy: -609.698 where: short stacking energy: -245.510 Base-Backbone interact. energy: -0.607 local terms energy: -300.933037 where: bonds (distance) C4'-P energy: -54.239 bonds (distance) P-C4' energy: -57.545 flat angles C4'-P-C4' energy: -67.621 flat angles P-C4'-P energy: -47.740 tors. eta vs tors. theta energy: -73.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -786.157868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.157868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.157868 (E_RNA) where: Base-Base interactions energy: -486.475 where: short stacking energy: -238.102 Base-Backbone interact. energy: -1.343 local terms energy: -298.339431 where: bonds (distance) C4'-P energy: -52.858 bonds (distance) P-C4' energy: -61.018 flat angles C4'-P-C4' energy: -60.362 flat angles P-C4'-P energy: -48.479 tors. eta vs tors. theta energy: -75.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -697.171720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.171720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.171720 (E_RNA) where: Base-Base interactions energy: -438.926 where: short stacking energy: -203.093 Base-Backbone interact. energy: -0.656 local terms energy: -257.589714 where: bonds (distance) C4'-P energy: -52.352 bonds (distance) P-C4' energy: -62.656 flat angles C4'-P-C4' energy: -57.645 flat angles P-C4'-P energy: -33.111 tors. eta vs tors. theta energy: -51.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -573.408285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.408285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.408285 (E_RNA) where: Base-Base interactions energy: -346.135 where: short stacking energy: -169.462 Base-Backbone interact. energy: 1.354 local terms energy: -228.627692 where: bonds (distance) C4'-P energy: -52.764 bonds (distance) P-C4' energy: -54.268 flat angles C4'-P-C4' energy: -50.059 flat angles P-C4'-P energy: -36.664 tors. eta vs tors. theta energy: -34.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -443.102250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.102250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.102250 (E_RNA) where: Base-Base interactions energy: -225.236 where: short stacking energy: -133.824 Base-Backbone interact. energy: 0.381 local terms energy: -218.247500 where: bonds (distance) C4'-P energy: -60.393 bonds (distance) P-C4' energy: -49.958 flat angles C4'-P-C4' energy: -56.236 flat angles P-C4'-P energy: -29.018 tors. eta vs tors. theta energy: -22.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -264.968133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.968133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.968133 (E_RNA) where: Base-Base interactions energy: -99.721 where: short stacking energy: -73.260 Base-Backbone interact. energy: 1.561 local terms energy: -166.807782 where: bonds (distance) C4'-P energy: -48.253 bonds (distance) P-C4' energy: -61.233 flat angles C4'-P-C4' energy: -49.316 flat angles P-C4'-P energy: -14.059 tors. eta vs tors. theta energy: 6.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -247.824400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.824400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.824400 (E_RNA) where: Base-Base interactions energy: -95.205 where: short stacking energy: -59.533 Base-Backbone interact. energy: -0.792 local terms energy: -151.826992 where: bonds (distance) C4'-P energy: -44.150 bonds (distance) P-C4' energy: -68.359 flat angles C4'-P-C4' energy: -27.008 flat angles P-C4'-P energy: -21.079 tors. eta vs tors. theta energy: 8.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1001.388529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.388529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.388529 (E_RNA) where: Base-Base interactions energy: -671.043 where: short stacking energy: -309.576 Base-Backbone interact. energy: 0.511 local terms energy: -330.856674 where: bonds (distance) C4'-P energy: -70.499 bonds (distance) P-C4' energy: -61.199 flat angles C4'-P-C4' energy: -64.467 flat angles P-C4'-P energy: -39.126 tors. eta vs tors. theta energy: -95.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -977.692457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.692457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.692457 (E_RNA) where: Base-Base interactions energy: -660.927 where: short stacking energy: -270.164 Base-Backbone interact. energy: -2.524 local terms energy: -314.242032 where: bonds (distance) C4'-P energy: -65.941 bonds (distance) P-C4' energy: -65.795 flat angles C4'-P-C4' energy: -66.155 flat angles P-C4'-P energy: -37.576 tors. eta vs tors. theta energy: -78.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -882.622643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.622643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.622643 (E_RNA) where: Base-Base interactions energy: -582.807 where: short stacking energy: -259.430 Base-Backbone interact. energy: -0.930 local terms energy: -298.885969 where: bonds (distance) C4'-P energy: -57.409 bonds (distance) P-C4' energy: -59.738 flat angles C4'-P-C4' energy: -65.718 flat angles P-C4'-P energy: -43.835 tors. eta vs tors. theta energy: -72.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -863.651950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.651950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.651950 (E_RNA) where: Base-Base interactions energy: -561.308 where: short stacking energy: -250.950 Base-Backbone interact. energy: -1.073 local terms energy: -301.270700 where: bonds (distance) C4'-P energy: -67.244 bonds (distance) P-C4' energy: -57.716 flat angles C4'-P-C4' energy: -57.307 flat angles P-C4'-P energy: -49.093 tors. eta vs tors. theta energy: -69.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -775.073973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.073973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.073973 (E_RNA) where: Base-Base interactions energy: -487.483 where: short stacking energy: -225.940 Base-Backbone interact. energy: -0.816 local terms energy: -286.774421 where: bonds (distance) C4'-P energy: -56.915 bonds (distance) P-C4' energy: -58.346 flat angles C4'-P-C4' energy: -60.381 flat angles P-C4'-P energy: -38.765 tors. eta vs tors. theta energy: -72.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -611.377943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.377943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.377943 (E_RNA) where: Base-Base interactions energy: -365.446 where: short stacking energy: -156.438 Base-Backbone interact. energy: -2.492 local terms energy: -243.439798 where: bonds (distance) C4'-P energy: -51.856 bonds (distance) P-C4' energy: -58.580 flat angles C4'-P-C4' energy: -54.228 flat angles P-C4'-P energy: -34.642 tors. eta vs tors. theta energy: -44.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -564.407355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.407355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.407355 (E_RNA) where: Base-Base interactions energy: -331.254 where: short stacking energy: -171.030 Base-Backbone interact. energy: -0.963 local terms energy: -232.190231 where: bonds (distance) C4'-P energy: -52.362 bonds (distance) P-C4' energy: -51.699 flat angles C4'-P-C4' energy: -60.062 flat angles P-C4'-P energy: -29.919 tors. eta vs tors. theta energy: -38.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -397.882446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.882446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.882446 (E_RNA) where: Base-Base interactions energy: -208.819 where: short stacking energy: -126.671 Base-Backbone interact. energy: 5.466 local terms energy: -194.529459 where: bonds (distance) C4'-P energy: -41.472 bonds (distance) P-C4' energy: -58.293 flat angles C4'-P-C4' energy: -48.435 flat angles P-C4'-P energy: -29.837 tors. eta vs tors. theta energy: -16.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -279.283674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.283674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.283674 (E_RNA) where: Base-Base interactions energy: -101.123 where: short stacking energy: -69.239 Base-Backbone interact. energy: -2.270 local terms energy: -175.890914 where: bonds (distance) C4'-P energy: -57.647 bonds (distance) P-C4' energy: -51.544 flat angles C4'-P-C4' energy: -48.509 flat angles P-C4'-P energy: -27.655 tors. eta vs tors. theta energy: 9.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -263.861045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.861045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.861045 (E_RNA) where: Base-Base interactions energy: -81.076 where: short stacking energy: -65.898 Base-Backbone interact. energy: 2.193 local terms energy: -184.977940 where: bonds (distance) C4'-P energy: -61.770 bonds (distance) P-C4' energy: -57.913 flat angles C4'-P-C4' energy: -39.711 flat angles P-C4'-P energy: -33.485 tors. eta vs tors. theta energy: 7.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1015.810546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.810546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.810546 (E_RNA) where: Base-Base interactions energy: -671.340 where: short stacking energy: -300.125 Base-Backbone interact. energy: -1.649 local terms energy: -342.822069 where: bonds (distance) C4'-P energy: -63.531 bonds (distance) P-C4' energy: -63.388 flat angles C4'-P-C4' energy: -72.093 flat angles P-C4'-P energy: -52.619 tors. eta vs tors. theta energy: -91.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -967.569576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.569576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.569576 (E_RNA) where: Base-Base interactions energy: -630.312 where: short stacking energy: -264.282 Base-Backbone interact. energy: 0.967 local terms energy: -338.224591 where: bonds (distance) C4'-P energy: -63.344 bonds (distance) P-C4' energy: -67.361 flat angles C4'-P-C4' energy: -73.472 flat angles P-C4'-P energy: -53.527 tors. eta vs tors. theta energy: -80.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -935.984269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.984269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.984269 (E_RNA) where: Base-Base interactions energy: -602.360 where: short stacking energy: -275.806 Base-Backbone interact. energy: -1.168 local terms energy: -332.456255 where: bonds (distance) C4'-P energy: -59.947 bonds (distance) P-C4' energy: -70.331 flat angles C4'-P-C4' energy: -68.920 flat angles P-C4'-P energy: -52.635 tors. eta vs tors. theta energy: -80.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -863.312384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.312384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.312384 (E_RNA) where: Base-Base interactions energy: -574.014 where: short stacking energy: -225.888 Base-Backbone interact. energy: -2.527 local terms energy: -286.771385 where: bonds (distance) C4'-P energy: -57.175 bonds (distance) P-C4' energy: -62.586 flat angles C4'-P-C4' energy: -58.850 flat angles P-C4'-P energy: -41.814 tors. eta vs tors. theta energy: -66.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -778.908453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.908453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.908453 (E_RNA) where: Base-Base interactions energy: -493.519 where: short stacking energy: -224.308 Base-Backbone interact. energy: 0.939 local terms energy: -286.328196 where: bonds (distance) C4'-P energy: -51.711 bonds (distance) P-C4' energy: -58.764 flat angles C4'-P-C4' energy: -62.202 flat angles P-C4'-P energy: -46.944 tors. eta vs tors. theta energy: -66.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -635.391906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.391906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.391906 (E_RNA) where: Base-Base interactions energy: -415.977 where: short stacking energy: -171.183 Base-Backbone interact. energy: -2.387 local terms energy: -217.027767 where: bonds (distance) C4'-P energy: -52.850 bonds (distance) P-C4' energy: -47.857 flat angles C4'-P-C4' energy: -52.918 flat angles P-C4'-P energy: -36.591 tors. eta vs tors. theta energy: -26.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -553.003147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.003147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.003147 (E_RNA) where: Base-Base interactions energy: -319.183 where: short stacking energy: -164.166 Base-Backbone interact. energy: 1.289 local terms energy: -235.109142 where: bonds (distance) C4'-P energy: -54.186 bonds (distance) P-C4' energy: -56.380 flat angles C4'-P-C4' energy: -55.413 flat angles P-C4'-P energy: -33.478 tors. eta vs tors. theta energy: -35.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -408.134348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.134348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.134348 (E_RNA) where: Base-Base interactions energy: -228.702 where: short stacking energy: -113.816 Base-Backbone interact. energy: 0.653 local terms energy: -180.085207 where: bonds (distance) C4'-P energy: -54.312 bonds (distance) P-C4' energy: -54.489 flat angles C4'-P-C4' energy: -45.691 flat angles P-C4'-P energy: -10.697 tors. eta vs tors. theta energy: -14.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -291.538322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.538322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.538322 (E_RNA) where: Base-Base interactions energy: -94.398 where: short stacking energy: -84.242 Base-Backbone interact. energy: -2.602 local terms energy: -194.537648 where: bonds (distance) C4'-P energy: -57.761 bonds (distance) P-C4' energy: -52.035 flat angles C4'-P-C4' energy: -48.638 flat angles P-C4'-P energy: -26.795 tors. eta vs tors. theta energy: -9.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -278.302063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.302063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.302063 (E_RNA) where: Base-Base interactions energy: -89.611 where: short stacking energy: -74.483 Base-Backbone interact. energy: -0.011 local terms energy: -188.680824 where: bonds (distance) C4'-P energy: -59.206 bonds (distance) P-C4' energy: -61.594 flat angles C4'-P-C4' energy: -45.946 flat angles P-C4'-P energy: -17.099 tors. eta vs tors. theta energy: -4.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1015.936893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.936893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.936893 (E_RNA) where: Base-Base interactions energy: -662.228 where: short stacking energy: -291.939 Base-Backbone interact. energy: -3.411 local terms energy: -350.298350 where: bonds (distance) C4'-P energy: -63.760 bonds (distance) P-C4' energy: -65.777 flat angles C4'-P-C4' energy: -70.666 flat angles P-C4'-P energy: -49.921 tors. eta vs tors. theta energy: -100.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -975.101640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.101640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.101640 (E_RNA) where: Base-Base interactions energy: -638.689 where: short stacking energy: -266.092 Base-Backbone interact. energy: -1.106 local terms energy: -335.307441 where: bonds (distance) C4'-P energy: -59.663 bonds (distance) P-C4' energy: -68.679 flat angles C4'-P-C4' energy: -72.779 flat angles P-C4'-P energy: -54.216 tors. eta vs tors. theta energy: -79.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -935.412720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.412720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.412720 (E_RNA) where: Base-Base interactions energy: -621.157 where: short stacking energy: -266.342 Base-Backbone interact. energy: -1.520 local terms energy: -312.735334 where: bonds (distance) C4'-P energy: -55.699 bonds (distance) P-C4' energy: -62.092 flat angles C4'-P-C4' energy: -77.094 flat angles P-C4'-P energy: -39.559 tors. eta vs tors. theta energy: -78.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -916.046299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.046299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.046299 (E_RNA) where: Base-Base interactions energy: -602.706 where: short stacking energy: -251.474 Base-Backbone interact. energy: -2.214 local terms energy: -311.125786 where: bonds (distance) C4'-P energy: -65.151 bonds (distance) P-C4' energy: -61.758 flat angles C4'-P-C4' energy: -63.066 flat angles P-C4'-P energy: -50.021 tors. eta vs tors. theta energy: -71.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -796.018396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.018396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.018396 (E_RNA) where: Base-Base interactions energy: -510.934 where: short stacking energy: -247.841 Base-Backbone interact. energy: -0.372 local terms energy: -284.712865 where: bonds (distance) C4'-P energy: -50.891 bonds (distance) P-C4' energy: -49.645 flat angles C4'-P-C4' energy: -65.552 flat angles P-C4'-P energy: -42.488 tors. eta vs tors. theta energy: -76.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -657.301537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.301537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.301537 (E_RNA) where: Base-Base interactions energy: -437.480 where: short stacking energy: -167.787 Base-Backbone interact. energy: 2.996 local terms energy: -222.817193 where: bonds (distance) C4'-P energy: -39.957 bonds (distance) P-C4' energy: -57.716 flat angles C4'-P-C4' energy: -45.046 flat angles P-C4'-P energy: -39.756 tors. eta vs tors. theta energy: -40.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -549.475065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.475065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.475065 (E_RNA) where: Base-Base interactions energy: -302.319 where: short stacking energy: -161.502 Base-Backbone interact. energy: 0.244 local terms energy: -247.399841 where: bonds (distance) C4'-P energy: -50.991 bonds (distance) P-C4' energy: -59.389 flat angles C4'-P-C4' energy: -56.177 flat angles P-C4'-P energy: -42.752 tors. eta vs tors. theta energy: -38.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -421.314453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.314453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.314453 (E_RNA) where: Base-Base interactions energy: -202.174 where: short stacking energy: -104.264 Base-Backbone interact. energy: -0.552 local terms energy: -218.588064 where: bonds (distance) C4'-P energy: -50.055 bonds (distance) P-C4' energy: -66.845 flat angles C4'-P-C4' energy: -39.933 flat angles P-C4'-P energy: -36.135 tors. eta vs tors. theta energy: -25.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -282.392628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.392628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.392628 (E_RNA) where: Base-Base interactions energy: -109.690 where: short stacking energy: -69.190 Base-Backbone interact. energy: -1.562 local terms energy: -171.140763 where: bonds (distance) C4'-P energy: -57.792 bonds (distance) P-C4' energy: -43.266 flat angles C4'-P-C4' energy: -45.563 flat angles P-C4'-P energy: -20.293 tors. eta vs tors. theta energy: -4.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -260.109261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.109261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.109261 (E_RNA) where: Base-Base interactions energy: -100.569 where: short stacking energy: -65.466 Base-Backbone interact. energy: 3.264 local terms energy: -162.803882 where: bonds (distance) C4'-P energy: -55.839 bonds (distance) P-C4' energy: -47.989 flat angles C4'-P-C4' energy: -49.047 flat angles P-C4'-P energy: -12.699 tors. eta vs tors. theta energy: 2.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1015.180796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.180796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.180796 (E_RNA) where: Base-Base interactions energy: -671.313 where: short stacking energy: -287.678 Base-Backbone interact. energy: -0.692 local terms energy: -343.176305 where: bonds (distance) C4'-P energy: -59.918 bonds (distance) P-C4' energy: -60.037 flat angles C4'-P-C4' energy: -70.586 flat angles P-C4'-P energy: -50.267 tors. eta vs tors. theta energy: -102.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -936.336369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.336369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.336369 (E_RNA) where: Base-Base interactions energy: -624.787 where: short stacking energy: -258.703 Base-Backbone interact. energy: -1.507 local terms energy: -310.043081 where: bonds (distance) C4'-P energy: -65.404 bonds (distance) P-C4' energy: -61.463 flat angles C4'-P-C4' energy: -67.714 flat angles P-C4'-P energy: -38.498 tors. eta vs tors. theta energy: -76.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -937.429523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.429523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.429523 (E_RNA) where: Base-Base interactions energy: -621.478 where: short stacking energy: -259.465 Base-Backbone interact. energy: -1.136 local terms energy: -314.815266 where: bonds (distance) C4'-P energy: -61.254 bonds (distance) P-C4' energy: -60.987 flat angles C4'-P-C4' energy: -68.771 flat angles P-C4'-P energy: -50.546 tors. eta vs tors. theta energy: -73.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -877.926057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.926057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.926057 (E_RNA) where: Base-Base interactions energy: -592.157 where: short stacking energy: -257.956 Base-Backbone interact. energy: -0.904 local terms energy: -284.865513 where: bonds (distance) C4'-P energy: -53.929 bonds (distance) P-C4' energy: -57.453 flat angles C4'-P-C4' energy: -58.386 flat angles P-C4'-P energy: -39.463 tors. eta vs tors. theta energy: -75.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -831.398262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.398262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.398262 (E_RNA) where: Base-Base interactions energy: -525.968 where: short stacking energy: -236.566 Base-Backbone interact. energy: -1.834 local terms energy: -303.595905 where: bonds (distance) C4'-P energy: -60.883 bonds (distance) P-C4' energy: -49.340 flat angles C4'-P-C4' energy: -66.841 flat angles P-C4'-P energy: -46.682 tors. eta vs tors. theta energy: -79.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -645.105275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.105275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.105275 (E_RNA) where: Base-Base interactions energy: -398.543 where: short stacking energy: -167.687 Base-Backbone interact. energy: -1.127 local terms energy: -245.434727 where: bonds (distance) C4'-P energy: -49.155 bonds (distance) P-C4' energy: -56.757 flat angles C4'-P-C4' energy: -49.738 flat angles P-C4'-P energy: -47.042 tors. eta vs tors. theta energy: -42.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -559.951063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.951063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.951063 (E_RNA) where: Base-Base interactions energy: -328.417 where: short stacking energy: -163.544 Base-Backbone interact. energy: 0.644 local terms energy: -232.178104 where: bonds (distance) C4'-P energy: -55.661 bonds (distance) P-C4' energy: -60.133 flat angles C4'-P-C4' energy: -47.205 flat angles P-C4'-P energy: -28.523 tors. eta vs tors. theta energy: -40.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -435.839802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.839802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.839802 (E_RNA) where: Base-Base interactions energy: -205.476 where: short stacking energy: -110.827 Base-Backbone interact. energy: -1.609 local terms energy: -228.754800 where: bonds (distance) C4'-P energy: -57.810 bonds (distance) P-C4' energy: -47.662 flat angles C4'-P-C4' energy: -63.662 flat angles P-C4'-P energy: -37.084 tors. eta vs tors. theta energy: -22.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -268.630651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.630651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.630651 (E_RNA) where: Base-Base interactions energy: -83.117 where: short stacking energy: -71.037 Base-Backbone interact. energy: -0.125 local terms energy: -185.387727 where: bonds (distance) C4'-P energy: -49.867 bonds (distance) P-C4' energy: -61.400 flat angles C4'-P-C4' energy: -59.943 flat angles P-C4'-P energy: -25.598 tors. eta vs tors. theta energy: 11.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -276.332405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.332405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.332405 (E_RNA) where: Base-Base interactions energy: -93.842 where: short stacking energy: -79.837 Base-Backbone interact. energy: -1.110 local terms energy: -181.380464 where: bonds (distance) C4'-P energy: -61.320 bonds (distance) P-C4' energy: -58.563 flat angles C4'-P-C4' energy: -44.393 flat angles P-C4'-P energy: -29.829 tors. eta vs tors. theta energy: 12.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1026.293247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.293247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.293247 (E_RNA) where: Base-Base interactions energy: -691.376 where: short stacking energy: -282.836 Base-Backbone interact. energy: -1.862 local terms energy: -333.055820 where: bonds (distance) C4'-P energy: -54.178 bonds (distance) P-C4' energy: -63.949 flat angles C4'-P-C4' energy: -71.171 flat angles P-C4'-P energy: -52.059 tors. eta vs tors. theta energy: -91.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -958.949499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.949499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.949499 (E_RNA) where: Base-Base interactions energy: -663.333 where: short stacking energy: -273.866 Base-Backbone interact. energy: -1.677 local terms energy: -293.939642 where: bonds (distance) C4'-P energy: -58.034 bonds (distance) P-C4' energy: -53.163 flat angles C4'-P-C4' energy: -56.457 flat angles P-C4'-P energy: -43.291 tors. eta vs tors. theta energy: -82.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -923.518677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.518677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.518677 (E_RNA) where: Base-Base interactions energy: -611.203 where: short stacking energy: -262.401 Base-Backbone interact. energy: -1.165 local terms energy: -311.151003 where: bonds (distance) C4'-P energy: -61.229 bonds (distance) P-C4' energy: -54.381 flat angles C4'-P-C4' energy: -61.575 flat angles P-C4'-P energy: -46.562 tors. eta vs tors. theta energy: -87.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -851.556852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.556852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.556852 (E_RNA) where: Base-Base interactions energy: -562.482 where: short stacking energy: -246.196 Base-Backbone interact. energy: -0.763 local terms energy: -288.311638 where: bonds (distance) C4'-P energy: -59.500 bonds (distance) P-C4' energy: -55.487 flat angles C4'-P-C4' energy: -63.690 flat angles P-C4'-P energy: -39.752 tors. eta vs tors. theta energy: -69.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -759.307957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.307957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.307957 (E_RNA) where: Base-Base interactions energy: -488.850 where: short stacking energy: -222.278 Base-Backbone interact. energy: -1.312 local terms energy: -269.146234 where: bonds (distance) C4'-P energy: -54.942 bonds (distance) P-C4' energy: -62.477 flat angles C4'-P-C4' energy: -55.398 flat angles P-C4'-P energy: -39.307 tors. eta vs tors. theta energy: -57.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -629.070544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.070544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.070544 (E_RNA) where: Base-Base interactions energy: -400.507 where: short stacking energy: -178.359 Base-Backbone interact. energy: -1.617 local terms energy: -226.947173 where: bonds (distance) C4'-P energy: -47.744 bonds (distance) P-C4' energy: -61.387 flat angles C4'-P-C4' energy: -44.891 flat angles P-C4'-P energy: -39.500 tors. eta vs tors. theta energy: -33.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -552.765959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.765959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.765959 (E_RNA) where: Base-Base interactions energy: -321.089 where: short stacking energy: -169.891 Base-Backbone interact. energy: 2.780 local terms energy: -234.456629 where: bonds (distance) C4'-P energy: -56.083 bonds (distance) P-C4' energy: -41.613 flat angles C4'-P-C4' energy: -59.337 flat angles P-C4'-P energy: -37.466 tors. eta vs tors. theta energy: -39.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -397.276222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.276222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.276222 (E_RNA) where: Base-Base interactions energy: -179.916 where: short stacking energy: -95.938 Base-Backbone interact. energy: -0.777 local terms energy: -216.583284 where: bonds (distance) C4'-P energy: -56.034 bonds (distance) P-C4' energy: -64.998 flat angles C4'-P-C4' energy: -50.199 flat angles P-C4'-P energy: -24.072 tors. eta vs tors. theta energy: -21.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -273.638495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.638495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.638495 (E_RNA) where: Base-Base interactions energy: -96.067 where: short stacking energy: -69.007 Base-Backbone interact. energy: 3.253 local terms energy: -180.823759 where: bonds (distance) C4'-P energy: -48.727 bonds (distance) P-C4' energy: -64.200 flat angles C4'-P-C4' energy: -45.317 flat angles P-C4'-P energy: -34.615 tors. eta vs tors. theta energy: 12.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -293.971414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.971414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.971414 (E_RNA) where: Base-Base interactions energy: -123.549 where: short stacking energy: -61.407 Base-Backbone interact. energy: 1.056 local terms energy: -171.478198 where: bonds (distance) C4'-P energy: -46.028 bonds (distance) P-C4' energy: -62.361 flat angles C4'-P-C4' energy: -40.851 flat angles P-C4'-P energy: -29.655 tors. eta vs tors. theta energy: 7.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1004.058913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.058913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.058913 (E_RNA) where: Base-Base interactions energy: -658.848 where: short stacking energy: -300.684 Base-Backbone interact. energy: -1.228 local terms energy: -343.983197 where: bonds (distance) C4'-P energy: -62.579 bonds (distance) P-C4' energy: -64.585 flat angles C4'-P-C4' energy: -75.285 flat angles P-C4'-P energy: -45.039 tors. eta vs tors. theta energy: -96.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -976.115815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.115815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.115815 (E_RNA) where: Base-Base interactions energy: -658.529 where: short stacking energy: -278.248 Base-Backbone interact. energy: -1.671 local terms energy: -315.916491 where: bonds (distance) C4'-P energy: -61.171 bonds (distance) P-C4' energy: -70.794 flat angles C4'-P-C4' energy: -66.025 flat angles P-C4'-P energy: -39.071 tors. eta vs tors. theta energy: -78.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -928.591987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.591987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.591987 (E_RNA) where: Base-Base interactions energy: -603.125 where: short stacking energy: -267.897 Base-Backbone interact. energy: -0.152 local terms energy: -325.314437 where: bonds (distance) C4'-P energy: -64.316 bonds (distance) P-C4' energy: -63.522 flat angles C4'-P-C4' energy: -70.707 flat angles P-C4'-P energy: -40.274 tors. eta vs tors. theta energy: -86.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -844.382570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.382570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.382570 (E_RNA) where: Base-Base interactions energy: -544.351 where: short stacking energy: -214.690 Base-Backbone interact. energy: -1.958 local terms energy: -298.073275 where: bonds (distance) C4'-P energy: -63.202 bonds (distance) P-C4' energy: -61.296 flat angles C4'-P-C4' energy: -67.621 flat angles P-C4'-P energy: -41.041 tors. eta vs tors. theta energy: -64.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -767.215114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.215114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.215114 (E_RNA) where: Base-Base interactions energy: -498.843 where: short stacking energy: -230.297 Base-Backbone interact. energy: -0.405 local terms energy: -267.966517 where: bonds (distance) C4'-P energy: -55.381 bonds (distance) P-C4' energy: -50.075 flat angles C4'-P-C4' energy: -49.564 flat angles P-C4'-P energy: -43.541 tors. eta vs tors. theta energy: -69.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -686.096368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.096368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.096368 (E_RNA) where: Base-Base interactions energy: -430.771 where: short stacking energy: -172.579 Base-Backbone interact. energy: -3.283 local terms energy: -252.042489 where: bonds (distance) C4'-P energy: -51.709 bonds (distance) P-C4' energy: -62.076 flat angles C4'-P-C4' energy: -64.062 flat angles P-C4'-P energy: -35.190 tors. eta vs tors. theta energy: -39.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -551.882649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.882649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.882649 (E_RNA) where: Base-Base interactions energy: -321.652 where: short stacking energy: -175.887 Base-Backbone interact. energy: -1.172 local terms energy: -229.058294 where: bonds (distance) C4'-P energy: -48.970 bonds (distance) P-C4' energy: -51.314 flat angles C4'-P-C4' energy: -52.756 flat angles P-C4'-P energy: -37.800 tors. eta vs tors. theta energy: -38.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -419.013905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.013905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.013905 (E_RNA) where: Base-Base interactions energy: -205.030 where: short stacking energy: -130.258 Base-Backbone interact. energy: -2.425 local terms energy: -211.559222 where: bonds (distance) C4'-P energy: -53.798 bonds (distance) P-C4' energy: -60.126 flat angles C4'-P-C4' energy: -44.127 flat angles P-C4'-P energy: -38.777 tors. eta vs tors. theta energy: -14.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -282.608853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.608853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.608853 (E_RNA) where: Base-Base interactions energy: -105.698 where: short stacking energy: -79.711 Base-Backbone interact. energy: -2.097 local terms energy: -174.813754 where: bonds (distance) C4'-P energy: -54.329 bonds (distance) P-C4' energy: -54.218 flat angles C4'-P-C4' energy: -45.626 flat angles P-C4'-P energy: -28.306 tors. eta vs tors. theta energy: 7.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -253.026414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.026414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.026414 (E_RNA) where: Base-Base interactions energy: -64.643 where: short stacking energy: -62.748 Base-Backbone interact. energy: -0.877 local terms energy: -187.505765 where: bonds (distance) C4'-P energy: -61.561 bonds (distance) P-C4' energy: -61.837 flat angles C4'-P-C4' energy: -45.853 flat angles P-C4'-P energy: -28.995 tors. eta vs tors. theta energy: 10.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -996.051665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.051665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.051665 (E_RNA) where: Base-Base interactions energy: -662.022 where: short stacking energy: -285.695 Base-Backbone interact. energy: -1.445 local terms energy: -332.584640 where: bonds (distance) C4'-P energy: -61.479 bonds (distance) P-C4' energy: -65.794 flat angles C4'-P-C4' energy: -64.946 flat angles P-C4'-P energy: -44.442 tors. eta vs tors. theta energy: -95.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -954.372338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.372338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.372338 (E_RNA) where: Base-Base interactions energy: -635.919 where: short stacking energy: -265.453 Base-Backbone interact. energy: 0.983 local terms energy: -319.437029 where: bonds (distance) C4'-P energy: -64.991 bonds (distance) P-C4' energy: -64.914 flat angles C4'-P-C4' energy: -73.247 flat angles P-C4'-P energy: -40.087 tors. eta vs tors. theta energy: -76.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -906.547061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.547061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.547061 (E_RNA) where: Base-Base interactions energy: -595.252 where: short stacking energy: -262.825 Base-Backbone interact. energy: -0.253 local terms energy: -311.042439 where: bonds (distance) C4'-P energy: -60.689 bonds (distance) P-C4' energy: -59.271 flat angles C4'-P-C4' energy: -69.380 flat angles P-C4'-P energy: -47.722 tors. eta vs tors. theta energy: -73.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -841.707356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.707356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.707356 (E_RNA) where: Base-Base interactions energy: -546.666 where: short stacking energy: -253.449 Base-Backbone interact. energy: -2.155 local terms energy: -292.886918 where: bonds (distance) C4'-P energy: -66.126 bonds (distance) P-C4' energy: -56.144 flat angles C4'-P-C4' energy: -56.632 flat angles P-C4'-P energy: -39.054 tors. eta vs tors. theta energy: -74.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -776.881046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.881046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.881046 (E_RNA) where: Base-Base interactions energy: -490.318 where: short stacking energy: -228.816 Base-Backbone interact. energy: 0.495 local terms energy: -287.057300 where: bonds (distance) C4'-P energy: -52.042 bonds (distance) P-C4' energy: -63.705 flat angles C4'-P-C4' energy: -63.793 flat angles P-C4'-P energy: -41.014 tors. eta vs tors. theta energy: -66.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -668.037977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.037977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.037977 (E_RNA) where: Base-Base interactions energy: -421.809 where: short stacking energy: -156.460 Base-Backbone interact. energy: -2.934 local terms energy: -243.294694 where: bonds (distance) C4'-P energy: -58.997 bonds (distance) P-C4' energy: -63.588 flat angles C4'-P-C4' energy: -50.480 flat angles P-C4'-P energy: -35.692 tors. eta vs tors. theta energy: -34.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -525.172836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.172836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.172836 (E_RNA) where: Base-Base interactions energy: -292.547 where: short stacking energy: -148.821 Base-Backbone interact. energy: -0.340 local terms energy: -232.285835 where: bonds (distance) C4'-P energy: -57.001 bonds (distance) P-C4' energy: -62.796 flat angles C4'-P-C4' energy: -58.828 flat angles P-C4'-P energy: -33.943 tors. eta vs tors. theta energy: -19.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -443.045541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.045541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.045541 (E_RNA) where: Base-Base interactions energy: -227.844 where: short stacking energy: -125.088 Base-Backbone interact. energy: -5.122 local terms energy: -210.079261 where: bonds (distance) C4'-P energy: -64.094 bonds (distance) P-C4' energy: -60.413 flat angles C4'-P-C4' energy: -55.003 flat angles P-C4'-P energy: -25.245 tors. eta vs tors. theta energy: -5.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -251.726482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.726482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.726482 (E_RNA) where: Base-Base interactions energy: -76.009 where: short stacking energy: -67.837 Base-Backbone interact. energy: -1.154 local terms energy: -174.564041 where: bonds (distance) C4'-P energy: -51.358 bonds (distance) P-C4' energy: -59.088 flat angles C4'-P-C4' energy: -55.675 flat angles P-C4'-P energy: -21.624 tors. eta vs tors. theta energy: 13.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -274.844122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.844122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.844122 (E_RNA) where: Base-Base interactions energy: -95.665 where: short stacking energy: -87.547 Base-Backbone interact. energy: -1.463 local terms energy: -177.715518 where: bonds (distance) C4'-P energy: -55.145 bonds (distance) P-C4' energy: -42.796 flat angles C4'-P-C4' energy: -42.857 flat angles P-C4'-P energy: -25.393 tors. eta vs tors. theta energy: -11.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1014.767930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.767930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.767930 (E_RNA) where: Base-Base interactions energy: -678.980 where: short stacking energy: -304.084 Base-Backbone interact. energy: -1.454 local terms energy: -334.334014 where: bonds (distance) C4'-P energy: -65.235 bonds (distance) P-C4' energy: -58.315 flat angles C4'-P-C4' energy: -72.706 flat angles P-C4'-P energy: -44.434 tors. eta vs tors. theta energy: -93.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -929.137047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.137047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.137047 (E_RNA) where: Base-Base interactions energy: -632.110 where: short stacking energy: -278.295 Base-Backbone interact. energy: -2.552 local terms energy: -294.475803 where: bonds (distance) C4'-P energy: -50.979 bonds (distance) P-C4' energy: -56.187 flat angles C4'-P-C4' energy: -69.113 flat angles P-C4'-P energy: -42.885 tors. eta vs tors. theta energy: -75.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -933.975554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.975554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.975554 (E_RNA) where: Base-Base interactions energy: -605.724 where: short stacking energy: -263.203 Base-Backbone interact. energy: -1.625 local terms energy: -326.626576 where: bonds (distance) C4'-P energy: -67.803 bonds (distance) P-C4' energy: -70.107 flat angles C4'-P-C4' energy: -69.104 flat angles P-C4'-P energy: -43.977 tors. eta vs tors. theta energy: -75.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -826.866693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.866693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.866693 (E_RNA) where: Base-Base interactions energy: -523.941 where: short stacking energy: -235.065 Base-Backbone interact. energy: -1.430 local terms energy: -301.495729 where: bonds (distance) C4'-P energy: -55.176 bonds (distance) P-C4' energy: -64.905 flat angles C4'-P-C4' energy: -63.398 flat angles P-C4'-P energy: -46.540 tors. eta vs tors. theta energy: -71.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -804.233969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.233969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.233969 (E_RNA) where: Base-Base interactions energy: -503.103 where: short stacking energy: -234.504 Base-Backbone interact. energy: -0.768 local terms energy: -300.362827 where: bonds (distance) C4'-P energy: -65.631 bonds (distance) P-C4' energy: -57.547 flat angles C4'-P-C4' energy: -71.615 flat angles P-C4'-P energy: -35.991 tors. eta vs tors. theta energy: -69.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -670.793879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.793879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.793879 (E_RNA) where: Base-Base interactions energy: -424.120 where: short stacking energy: -182.105 Base-Backbone interact. energy: 0.654 local terms energy: -247.327651 where: bonds (distance) C4'-P energy: -58.898 bonds (distance) P-C4' energy: -51.740 flat angles C4'-P-C4' energy: -55.017 flat angles P-C4'-P energy: -25.851 tors. eta vs tors. theta energy: -55.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -541.364852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.364852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.364852 (E_RNA) where: Base-Base interactions energy: -325.289 where: short stacking energy: -157.888 Base-Backbone interact. energy: 0.596 local terms energy: -216.671985 where: bonds (distance) C4'-P energy: -54.444 bonds (distance) P-C4' energy: -54.918 flat angles C4'-P-C4' energy: -47.193 flat angles P-C4'-P energy: -36.942 tors. eta vs tors. theta energy: -23.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -426.133651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.133651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.133651 (E_RNA) where: Base-Base interactions energy: -214.279 where: short stacking energy: -111.589 Base-Backbone interact. energy: 0.775 local terms energy: -212.628861 where: bonds (distance) C4'-P energy: -54.549 bonds (distance) P-C4' energy: -50.833 flat angles C4'-P-C4' energy: -61.361 flat angles P-C4'-P energy: -32.508 tors. eta vs tors. theta energy: -13.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -260.042424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.042424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.042424 (E_RNA) where: Base-Base interactions energy: -89.738 where: short stacking energy: -67.963 Base-Backbone interact. energy: 1.096 local terms energy: -171.401180 where: bonds (distance) C4'-P energy: -64.246 bonds (distance) P-C4' energy: -50.067 flat angles C4'-P-C4' energy: -40.108 flat angles P-C4'-P energy: -26.599 tors. eta vs tors. theta energy: 9.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -232.796568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.796568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.796568 (E_RNA) where: Base-Base interactions energy: -83.952 where: short stacking energy: -59.245 Base-Backbone interact. energy: 8.544 local terms energy: -157.389112 where: bonds (distance) C4'-P energy: -52.097 bonds (distance) P-C4' energy: -54.161 flat angles C4'-P-C4' energy: -38.683 flat angles P-C4'-P energy: -30.294 tors. eta vs tors. theta energy: 17.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -998.615804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.615804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.615804 (E_RNA) where: Base-Base interactions energy: -669.416 where: short stacking energy: -298.689 Base-Backbone interact. energy: -0.666 local terms energy: -328.534735 where: bonds (distance) C4'-P energy: -55.615 bonds (distance) P-C4' energy: -64.555 flat angles C4'-P-C4' energy: -77.329 flat angles P-C4'-P energy: -41.483 tors. eta vs tors. theta energy: -89.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -935.435083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.435083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.435083 (E_RNA) where: Base-Base interactions energy: -646.656 where: short stacking energy: -250.056 Base-Backbone interact. energy: -1.610 local terms energy: -287.170072 where: bonds (distance) C4'-P energy: -55.864 bonds (distance) P-C4' energy: -64.461 flat angles C4'-P-C4' energy: -56.354 flat angles P-C4'-P energy: -41.169 tors. eta vs tors. theta energy: -69.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -906.374926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.374926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.374926 (E_RNA) where: Base-Base interactions energy: -580.589 where: short stacking energy: -259.933 Base-Backbone interact. energy: -1.110 local terms energy: -324.675361 where: bonds (distance) C4'-P energy: -69.565 bonds (distance) P-C4' energy: -59.962 flat angles C4'-P-C4' energy: -66.355 flat angles P-C4'-P energy: -49.257 tors. eta vs tors. theta energy: -79.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -842.945614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.945614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.945614 (E_RNA) where: Base-Base interactions energy: -525.810 where: short stacking energy: -233.634 Base-Backbone interact. energy: -0.725 local terms energy: -316.410354 where: bonds (distance) C4'-P energy: -64.412 bonds (distance) P-C4' energy: -73.376 flat angles C4'-P-C4' energy: -64.593 flat angles P-C4'-P energy: -42.848 tors. eta vs tors. theta energy: -71.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -793.693201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.693201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.693201 (E_RNA) where: Base-Base interactions energy: -523.675 where: short stacking energy: -213.055 Base-Backbone interact. energy: -2.264 local terms energy: -267.754535 where: bonds (distance) C4'-P energy: -53.287 bonds (distance) P-C4' energy: -57.282 flat angles C4'-P-C4' energy: -58.164 flat angles P-C4'-P energy: -40.934 tors. eta vs tors. theta energy: -58.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -650.393783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.393783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.393783 (E_RNA) where: Base-Base interactions energy: -411.729 where: short stacking energy: -161.986 Base-Backbone interact. energy: -0.453 local terms energy: -238.212511 where: bonds (distance) C4'-P energy: -41.373 bonds (distance) P-C4' energy: -62.131 flat angles C4'-P-C4' energy: -55.075 flat angles P-C4'-P energy: -33.132 tors. eta vs tors. theta energy: -46.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -605.116437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.116437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.116437 (E_RNA) where: Base-Base interactions energy: -364.636 where: short stacking energy: -189.091 Base-Backbone interact. energy: -0.655 local terms energy: -239.825181 where: bonds (distance) C4'-P energy: -48.870 bonds (distance) P-C4' energy: -56.256 flat angles C4'-P-C4' energy: -56.553 flat angles P-C4'-P energy: -36.201 tors. eta vs tors. theta energy: -41.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -408.248989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.248989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.248989 (E_RNA) where: Base-Base interactions energy: -203.753 where: short stacking energy: -105.735 Base-Backbone interact. energy: -1.702 local terms energy: -202.794541 where: bonds (distance) C4'-P energy: -67.080 bonds (distance) P-C4' energy: -49.704 flat angles C4'-P-C4' energy: -45.526 flat angles P-C4'-P energy: -26.997 tors. eta vs tors. theta energy: -13.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -281.952359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.952359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.952359 (E_RNA) where: Base-Base interactions energy: -88.748 where: short stacking energy: -82.264 Base-Backbone interact. energy: 1.113 local terms energy: -194.316700 where: bonds (distance) C4'-P energy: -57.205 bonds (distance) P-C4' energy: -65.500 flat angles C4'-P-C4' energy: -53.600 flat angles P-C4'-P energy: -30.087 tors. eta vs tors. theta energy: 12.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -330.933372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.933372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.933372 (E_RNA) where: Base-Base interactions energy: -153.842 where: short stacking energy: -64.466 Base-Backbone interact. energy: -2.387 local terms energy: -174.704183 where: bonds (distance) C4'-P energy: -44.442 bonds (distance) P-C4' energy: -55.930 flat angles C4'-P-C4' energy: -42.501 flat angles P-C4'-P energy: -35.316 tors. eta vs tors. theta energy: 3.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -983.950521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.950521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.950521 (E_RNA) where: Base-Base interactions energy: -653.373 where: short stacking energy: -280.202 Base-Backbone interact. energy: -1.608 local terms energy: -328.969684 where: bonds (distance) C4'-P energy: -64.901 bonds (distance) P-C4' energy: -66.776 flat angles C4'-P-C4' energy: -68.266 flat angles P-C4'-P energy: -39.551 tors. eta vs tors. theta energy: -89.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -931.118527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.118527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.118527 (E_RNA) where: Base-Base interactions energy: -616.763 where: short stacking energy: -263.465 Base-Backbone interact. energy: -2.366 local terms energy: -311.989163 where: bonds (distance) C4'-P energy: -54.525 bonds (distance) P-C4' energy: -55.788 flat angles C4'-P-C4' energy: -73.152 flat angles P-C4'-P energy: -42.907 tors. eta vs tors. theta energy: -85.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -903.972198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.972198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.972198 (E_RNA) where: Base-Base interactions energy: -598.770 where: short stacking energy: -254.003 Base-Backbone interact. energy: -0.254 local terms energy: -304.947716 where: bonds (distance) C4'-P energy: -55.407 bonds (distance) P-C4' energy: -59.318 flat angles C4'-P-C4' energy: -63.907 flat angles P-C4'-P energy: -48.960 tors. eta vs tors. theta energy: -77.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -834.674880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.674880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.674880 (E_RNA) where: Base-Base interactions energy: -522.129 where: short stacking energy: -228.798 Base-Backbone interact. energy: -1.862 local terms energy: -310.683274 where: bonds (distance) C4'-P energy: -50.445 bonds (distance) P-C4' energy: -60.783 flat angles C4'-P-C4' energy: -74.513 flat angles P-C4'-P energy: -50.331 tors. eta vs tors. theta energy: -74.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -807.163070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.163070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.163070 (E_RNA) where: Base-Base interactions energy: -508.507 where: short stacking energy: -208.263 Base-Backbone interact. energy: 0.226 local terms energy: -298.881940 where: bonds (distance) C4'-P energy: -52.152 bonds (distance) P-C4' energy: -68.311 flat angles C4'-P-C4' energy: -76.461 flat angles P-C4'-P energy: -44.319 tors. eta vs tors. theta energy: -57.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -657.336107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.336107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.336107 (E_RNA) where: Base-Base interactions energy: -404.992 where: short stacking energy: -169.612 Base-Backbone interact. energy: -0.594 local terms energy: -251.749961 where: bonds (distance) C4'-P energy: -56.021 bonds (distance) P-C4' energy: -66.884 flat angles C4'-P-C4' energy: -58.151 flat angles P-C4'-P energy: -30.430 tors. eta vs tors. theta energy: -40.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -578.764645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.764645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.764645 (E_RNA) where: Base-Base interactions energy: -340.237 where: short stacking energy: -155.170 Base-Backbone interact. energy: -0.441 local terms energy: -238.086048 where: bonds (distance) C4'-P energy: -50.080 bonds (distance) P-C4' energy: -59.285 flat angles C4'-P-C4' energy: -59.972 flat angles P-C4'-P energy: -30.647 tors. eta vs tors. theta energy: -38.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -423.768582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.768582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.768582 (E_RNA) where: Base-Base interactions energy: -212.085 where: short stacking energy: -104.738 Base-Backbone interact. energy: -1.302 local terms energy: -210.381188 where: bonds (distance) C4'-P energy: -56.705 bonds (distance) P-C4' energy: -60.325 flat angles C4'-P-C4' energy: -46.716 flat angles P-C4'-P energy: -31.211 tors. eta vs tors. theta energy: -15.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -364.203471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.203471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.203471 (E_RNA) where: Base-Base interactions energy: -173.080 where: short stacking energy: -91.868 Base-Backbone interact. energy: -0.675 local terms energy: -190.448730 where: bonds (distance) C4'-P energy: -56.411 bonds (distance) P-C4' energy: -46.037 flat angles C4'-P-C4' energy: -45.944 flat angles P-C4'-P energy: -32.388 tors. eta vs tors. theta energy: -9.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -276.099231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.099231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.099231 (E_RNA) where: Base-Base interactions energy: -91.799 where: short stacking energy: -62.136 Base-Backbone interact. energy: -1.113 local terms energy: -183.187742 where: bonds (distance) C4'-P energy: -57.780 bonds (distance) P-C4' energy: -50.773 flat angles C4'-P-C4' energy: -41.233 flat angles P-C4'-P energy: -31.050 tors. eta vs tors. theta energy: -2.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -985.633361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.633361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.633361 (E_RNA) where: Base-Base interactions energy: -648.243 where: short stacking energy: -275.996 Base-Backbone interact. energy: -1.292 local terms energy: -336.099082 where: bonds (distance) C4'-P energy: -61.186 bonds (distance) P-C4' energy: -62.005 flat angles C4'-P-C4' energy: -69.400 flat angles P-C4'-P energy: -51.212 tors. eta vs tors. theta energy: -92.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -941.263061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.263061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.263061 (E_RNA) where: Base-Base interactions energy: -609.827 where: short stacking energy: -276.380 Base-Backbone interact. energy: 0.235 local terms energy: -331.670383 where: bonds (distance) C4'-P energy: -66.199 bonds (distance) P-C4' energy: -63.223 flat angles C4'-P-C4' energy: -69.774 flat angles P-C4'-P energy: -50.761 tors. eta vs tors. theta energy: -81.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -907.629125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.629125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.629125 (E_RNA) where: Base-Base interactions energy: -611.387 where: short stacking energy: -250.259 Base-Backbone interact. energy: -2.081 local terms energy: -294.161824 where: bonds (distance) C4'-P energy: -49.764 bonds (distance) P-C4' energy: -57.024 flat angles C4'-P-C4' energy: -68.457 flat angles P-C4'-P energy: -45.220 tors. eta vs tors. theta energy: -73.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -858.828713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.828713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.828713 (E_RNA) where: Base-Base interactions energy: -548.502 where: short stacking energy: -232.223 Base-Backbone interact. energy: -0.116 local terms energy: -310.210695 where: bonds (distance) C4'-P energy: -64.164 bonds (distance) P-C4' energy: -59.612 flat angles C4'-P-C4' energy: -63.700 flat angles P-C4'-P energy: -49.373 tors. eta vs tors. theta energy: -73.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -759.514238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.514238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.514238 (E_RNA) where: Base-Base interactions energy: -510.198 where: short stacking energy: -224.873 Base-Backbone interact. energy: 1.962 local terms energy: -251.277757 where: bonds (distance) C4'-P energy: -55.298 bonds (distance) P-C4' energy: -50.555 flat angles C4'-P-C4' energy: -56.170 flat angles P-C4'-P energy: -32.898 tors. eta vs tors. theta energy: -56.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -659.622597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.622597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.622597 (E_RNA) where: Base-Base interactions energy: -403.595 where: short stacking energy: -166.273 Base-Backbone interact. energy: -2.269 local terms energy: -253.758510 where: bonds (distance) C4'-P energy: -66.864 bonds (distance) P-C4' energy: -50.776 flat angles C4'-P-C4' energy: -57.344 flat angles P-C4'-P energy: -36.383 tors. eta vs tors. theta energy: -42.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -553.916585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.916585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.916585 (E_RNA) where: Base-Base interactions energy: -305.471 where: short stacking energy: -150.395 Base-Backbone interact. energy: -0.604 local terms energy: -247.841450 where: bonds (distance) C4'-P energy: -61.635 bonds (distance) P-C4' energy: -55.517 flat angles C4'-P-C4' energy: -60.615 flat angles P-C4'-P energy: -36.977 tors. eta vs tors. theta energy: -33.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -453.933949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.933949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.933949 (E_RNA) where: Base-Base interactions energy: -237.123 where: short stacking energy: -127.394 Base-Backbone interact. energy: 0.189 local terms energy: -217.000769 where: bonds (distance) C4'-P energy: -64.126 bonds (distance) P-C4' energy: -60.413 flat angles C4'-P-C4' energy: -47.935 flat angles P-C4'-P energy: -27.099 tors. eta vs tors. theta energy: -17.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -354.000381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.000381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.000381 (E_RNA) where: Base-Base interactions energy: -169.978 where: short stacking energy: -105.720 Base-Backbone interact. energy: -1.630 local terms energy: -182.392223 where: bonds (distance) C4'-P energy: -51.467 bonds (distance) P-C4' energy: -47.114 flat angles C4'-P-C4' energy: -57.406 flat angles P-C4'-P energy: -19.383 tors. eta vs tors. theta energy: -7.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -261.541208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.541208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.541208 (E_RNA) where: Base-Base interactions energy: -89.565 where: short stacking energy: -86.434 Base-Backbone interact. energy: 2.318 local terms energy: -174.294354 where: bonds (distance) C4'-P energy: -40.487 bonds (distance) P-C4' energy: -51.717 flat angles C4'-P-C4' energy: -47.464 flat angles P-C4'-P energy: -36.660 tors. eta vs tors. theta energy: 2.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -983.657212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.657212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.657212 (E_RNA) where: Base-Base interactions energy: -658.022 where: short stacking energy: -291.548 Base-Backbone interact. energy: 1.191 local terms energy: -326.827036 where: bonds (distance) C4'-P energy: -61.822 bonds (distance) P-C4' energy: -60.937 flat angles C4'-P-C4' energy: -69.255 flat angles P-C4'-P energy: -46.102 tors. eta vs tors. theta energy: -88.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -950.277056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.277056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.277056 (E_RNA) where: Base-Base interactions energy: -623.788 where: short stacking energy: -287.433 Base-Backbone interact. energy: -1.513 local terms energy: -324.975420 where: bonds (distance) C4'-P energy: -61.817 bonds (distance) P-C4' energy: -63.442 flat angles C4'-P-C4' energy: -71.254 flat angles P-C4'-P energy: -45.906 tors. eta vs tors. theta energy: -82.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -938.805132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.805132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.805132 (E_RNA) where: Base-Base interactions energy: -610.697 where: short stacking energy: -240.814 Base-Backbone interact. energy: -1.894 local terms energy: -326.214491 where: bonds (distance) C4'-P energy: -54.375 bonds (distance) P-C4' energy: -70.683 flat angles C4'-P-C4' energy: -72.542 flat angles P-C4'-P energy: -47.132 tors. eta vs tors. theta energy: -81.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -871.248297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.248297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.248297 (E_RNA) where: Base-Base interactions energy: -560.582 where: short stacking energy: -269.458 Base-Backbone interact. energy: -2.032 local terms energy: -308.634019 where: bonds (distance) C4'-P energy: -59.928 bonds (distance) P-C4' energy: -59.825 flat angles C4'-P-C4' energy: -64.697 flat angles P-C4'-P energy: -44.405 tors. eta vs tors. theta energy: -79.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -807.031651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.031651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.031651 (E_RNA) where: Base-Base interactions energy: -530.005 where: short stacking energy: -210.023 Base-Backbone interact. energy: -1.648 local terms energy: -275.378515 where: bonds (distance) C4'-P energy: -44.873 bonds (distance) P-C4' energy: -65.014 flat angles C4'-P-C4' energy: -68.422 flat angles P-C4'-P energy: -43.647 tors. eta vs tors. theta energy: -53.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -634.612393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.612393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.612393 (E_RNA) where: Base-Base interactions energy: -380.015 where: short stacking energy: -162.857 Base-Backbone interact. energy: -1.899 local terms energy: -252.698495 where: bonds (distance) C4'-P energy: -50.509 bonds (distance) P-C4' energy: -57.776 flat angles C4'-P-C4' energy: -56.748 flat angles P-C4'-P energy: -42.261 tors. eta vs tors. theta energy: -45.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -531.895889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.895889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.895889 (E_RNA) where: Base-Base interactions energy: -313.713 where: short stacking energy: -159.530 Base-Backbone interact. energy: -1.020 local terms energy: -217.163304 where: bonds (distance) C4'-P energy: -59.542 bonds (distance) P-C4' energy: -49.898 flat angles C4'-P-C4' energy: -38.057 flat angles P-C4'-P energy: -39.270 tors. eta vs tors. theta energy: -30.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -447.058358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.058358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.058358 (E_RNA) where: Base-Base interactions energy: -241.128 where: short stacking energy: -111.033 Base-Backbone interact. energy: -0.482 local terms energy: -205.448413 where: bonds (distance) C4'-P energy: -52.916 bonds (distance) P-C4' energy: -62.007 flat angles C4'-P-C4' energy: -48.099 flat angles P-C4'-P energy: -29.920 tors. eta vs tors. theta energy: -12.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -352.640534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.640534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.640534 (E_RNA) where: Base-Base interactions energy: -182.124 where: short stacking energy: -108.680 Base-Backbone interact. energy: 0.008 local terms energy: -170.524365 where: bonds (distance) C4'-P energy: -47.514 bonds (distance) P-C4' energy: -58.057 flat angles C4'-P-C4' energy: -39.380 flat angles P-C4'-P energy: -24.032 tors. eta vs tors. theta energy: -1.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -244.466173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.466173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.466173 (E_RNA) where: Base-Base interactions energy: -92.012 where: short stacking energy: -67.304 Base-Backbone interact. energy: 4.491 local terms energy: -156.944981 where: bonds (distance) C4'-P energy: -45.108 bonds (distance) P-C4' energy: -46.934 flat angles C4'-P-C4' energy: -44.711 flat angles P-C4'-P energy: -25.676 tors. eta vs tors. theta energy: 5.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -982.187333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.187333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.187333 (E_RNA) where: Base-Base interactions energy: -642.286 where: short stacking energy: -296.036 Base-Backbone interact. energy: -1.192 local terms energy: -338.709170 where: bonds (distance) C4'-P energy: -68.346 bonds (distance) P-C4' energy: -60.171 flat angles C4'-P-C4' energy: -71.809 flat angles P-C4'-P energy: -49.716 tors. eta vs tors. theta energy: -88.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -942.448390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.448390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.448390 (E_RNA) where: Base-Base interactions energy: -618.378 where: short stacking energy: -285.062 Base-Backbone interact. energy: 0.974 local terms energy: -325.044749 where: bonds (distance) C4'-P energy: -59.108 bonds (distance) P-C4' energy: -64.190 flat angles C4'-P-C4' energy: -73.593 flat angles P-C4'-P energy: -46.898 tors. eta vs tors. theta energy: -81.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -929.848085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.848085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.848085 (E_RNA) where: Base-Base interactions energy: -630.911 where: short stacking energy: -262.608 Base-Backbone interact. energy: -2.368 local terms energy: -296.568792 where: bonds (distance) C4'-P energy: -54.171 bonds (distance) P-C4' energy: -64.080 flat angles C4'-P-C4' energy: -62.201 flat angles P-C4'-P energy: -38.491 tors. eta vs tors. theta energy: -77.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -877.139433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.139433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.139433 (E_RNA) where: Base-Base interactions energy: -572.891 where: short stacking energy: -251.529 Base-Backbone interact. energy: -1.640 local terms energy: -302.608605 where: bonds (distance) C4'-P energy: -60.134 bonds (distance) P-C4' energy: -56.506 flat angles C4'-P-C4' energy: -65.221 flat angles P-C4'-P energy: -34.656 tors. eta vs tors. theta energy: -86.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -824.671179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.671179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.671179 (E_RNA) where: Base-Base interactions energy: -532.503 where: short stacking energy: -208.662 Base-Backbone interact. energy: -1.694 local terms energy: -290.473752 where: bonds (distance) C4'-P energy: -61.974 bonds (distance) P-C4' energy: -54.506 flat angles C4'-P-C4' energy: -62.226 flat angles P-C4'-P energy: -45.707 tors. eta vs tors. theta energy: -66.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -694.687883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.687883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.687883 (E_RNA) where: Base-Base interactions energy: -432.560 where: short stacking energy: -167.709 Base-Backbone interact. energy: 3.262 local terms energy: -265.389483 where: bonds (distance) C4'-P energy: -49.338 bonds (distance) P-C4' energy: -69.900 flat angles C4'-P-C4' energy: -57.635 flat angles P-C4'-P energy: -33.703 tors. eta vs tors. theta energy: -54.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -574.017138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.017138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.017138 (E_RNA) where: Base-Base interactions energy: -345.530 where: short stacking energy: -167.258 Base-Backbone interact. energy: -2.920 local terms energy: -225.567457 where: bonds (distance) C4'-P energy: -52.299 bonds (distance) P-C4' energy: -57.023 flat angles C4'-P-C4' energy: -53.381 flat angles P-C4'-P energy: -23.744 tors. eta vs tors. theta energy: -39.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -385.135373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.135373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.135373 (E_RNA) where: Base-Base interactions energy: -184.086 where: short stacking energy: -98.841 Base-Backbone interact. energy: -0.990 local terms energy: -200.059713 where: bonds (distance) C4'-P energy: -62.415 bonds (distance) P-C4' energy: -55.263 flat angles C4'-P-C4' energy: -57.217 flat angles P-C4'-P energy: -24.570 tors. eta vs tors. theta energy: -0.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -385.052245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.052245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.052245 (E_RNA) where: Base-Base interactions energy: -208.539 where: short stacking energy: -99.531 Base-Backbone interact. energy: 3.642 local terms energy: -180.154868 where: bonds (distance) C4'-P energy: -38.781 bonds (distance) P-C4' energy: -46.957 flat angles C4'-P-C4' energy: -56.568 flat angles P-C4'-P energy: -37.546 tors. eta vs tors. theta energy: -0.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -255.285019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.285019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.285019 (E_RNA) where: Base-Base interactions energy: -89.355 where: short stacking energy: -72.485 Base-Backbone interact. energy: 0.500 local terms energy: -166.430388 where: bonds (distance) C4'-P energy: -59.374 bonds (distance) P-C4' energy: -51.636 flat angles C4'-P-C4' energy: -44.358 flat angles P-C4'-P energy: -23.271 tors. eta vs tors. theta energy: 12.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1004.724214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.724214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.724214 (E_RNA) where: Base-Base interactions energy: -649.523 where: short stacking energy: -297.226 Base-Backbone interact. energy: -0.891 local terms energy: -354.310529 where: bonds (distance) C4'-P energy: -68.075 bonds (distance) P-C4' energy: -66.110 flat angles C4'-P-C4' energy: -70.807 flat angles P-C4'-P energy: -47.188 tors. eta vs tors. theta energy: -102.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -962.199524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.199524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.199524 (E_RNA) where: Base-Base interactions energy: -639.073 where: short stacking energy: -280.410 Base-Backbone interact. energy: -0.354 local terms energy: -322.772808 where: bonds (distance) C4'-P energy: -66.252 bonds (distance) P-C4' energy: -57.052 flat angles C4'-P-C4' energy: -68.580 flat angles P-C4'-P energy: -48.537 tors. eta vs tors. theta energy: -82.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -920.570758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.570758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.570758 (E_RNA) where: Base-Base interactions energy: -612.729 where: short stacking energy: -266.937 Base-Backbone interact. energy: -0.948 local terms energy: -306.893724 where: bonds (distance) C4'-P energy: -61.428 bonds (distance) P-C4' energy: -62.349 flat angles C4'-P-C4' energy: -63.164 flat angles P-C4'-P energy: -43.133 tors. eta vs tors. theta energy: -76.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -885.978934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.978934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.978934 (E_RNA) where: Base-Base interactions energy: -584.124 where: short stacking energy: -241.621 Base-Backbone interact. energy: -0.938 local terms energy: -300.916696 where: bonds (distance) C4'-P energy: -61.130 bonds (distance) P-C4' energy: -67.043 flat angles C4'-P-C4' energy: -62.120 flat angles P-C4'-P energy: -41.431 tors. eta vs tors. theta energy: -69.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -813.880627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.880627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.880627 (E_RNA) where: Base-Base interactions energy: -524.491 where: short stacking energy: -229.326 Base-Backbone interact. energy: -1.125 local terms energy: -288.264582 where: bonds (distance) C4'-P energy: -52.408 bonds (distance) P-C4' energy: -68.453 flat angles C4'-P-C4' energy: -67.756 flat angles P-C4'-P energy: -36.764 tors. eta vs tors. theta energy: -62.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -662.061742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.061742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.061742 (E_RNA) where: Base-Base interactions energy: -417.165 where: short stacking energy: -152.063 Base-Backbone interact. energy: -0.329 local terms energy: -244.568065 where: bonds (distance) C4'-P energy: -59.439 bonds (distance) P-C4' energy: -48.600 flat angles C4'-P-C4' energy: -57.830 flat angles P-C4'-P energy: -31.040 tors. eta vs tors. theta energy: -47.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -551.274112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.274112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.274112 (E_RNA) where: Base-Base interactions energy: -338.743 where: short stacking energy: -153.270 Base-Backbone interact. energy: -1.484 local terms energy: -211.046554 where: bonds (distance) C4'-P energy: -47.780 bonds (distance) P-C4' energy: -51.855 flat angles C4'-P-C4' energy: -43.195 flat angles P-C4'-P energy: -34.240 tors. eta vs tors. theta energy: -33.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -379.346107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.346107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.346107 (E_RNA) where: Base-Base interactions energy: -196.809 where: short stacking energy: -82.304 Base-Backbone interact. energy: -0.175 local terms energy: -182.361410 where: bonds (distance) C4'-P energy: -63.825 bonds (distance) P-C4' energy: -57.583 flat angles C4'-P-C4' energy: -39.915 flat angles P-C4'-P energy: -27.340 tors. eta vs tors. theta energy: 6.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -399.052238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.052238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.052238 (E_RNA) where: Base-Base interactions energy: -209.766 where: short stacking energy: -128.112 Base-Backbone interact. energy: -2.708 local terms energy: -186.578740 where: bonds (distance) C4'-P energy: -39.348 bonds (distance) P-C4' energy: -47.847 flat angles C4'-P-C4' energy: -55.466 flat angles P-C4'-P energy: -25.474 tors. eta vs tors. theta energy: -18.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -246.571625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.571625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.571625 (E_RNA) where: Base-Base interactions energy: -93.269 where: short stacking energy: -77.795 Base-Backbone interact. energy: 5.475 local terms energy: -158.777643 where: bonds (distance) C4'-P energy: -44.913 bonds (distance) P-C4' energy: -58.274 flat angles C4'-P-C4' energy: -38.253 flat angles P-C4'-P energy: -26.940 tors. eta vs tors. theta energy: 9.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -998.002409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.002409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.002409 (E_RNA) where: Base-Base interactions energy: -648.228 where: short stacking energy: -301.411 Base-Backbone interact. energy: -1.161 local terms energy: -348.613227 where: bonds (distance) C4'-P energy: -59.703 bonds (distance) P-C4' energy: -61.002 flat angles C4'-P-C4' energy: -72.294 flat angles P-C4'-P energy: -56.503 tors. eta vs tors. theta energy: -99.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -939.305004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.305004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.305004 (E_RNA) where: Base-Base interactions energy: -611.263 where: short stacking energy: -273.945 Base-Backbone interact. energy: -1.393 local terms energy: -326.649178 where: bonds (distance) C4'-P energy: -67.105 bonds (distance) P-C4' energy: -60.223 flat angles C4'-P-C4' energy: -74.069 flat angles P-C4'-P energy: -48.841 tors. eta vs tors. theta energy: -76.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -917.004088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.004088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.004088 (E_RNA) where: Base-Base interactions energy: -592.161 where: short stacking energy: -273.116 Base-Backbone interact. energy: -1.692 local terms energy: -323.151415 where: bonds (distance) C4'-P energy: -60.999 bonds (distance) P-C4' energy: -67.774 flat angles C4'-P-C4' energy: -62.629 flat angles P-C4'-P energy: -47.391 tors. eta vs tors. theta energy: -84.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -889.703989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.703989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.703989 (E_RNA) where: Base-Base interactions energy: -602.884 where: short stacking energy: -267.324 Base-Backbone interact. energy: -0.100 local terms energy: -286.720010 where: bonds (distance) C4'-P energy: -58.333 bonds (distance) P-C4' energy: -52.134 flat angles C4'-P-C4' energy: -60.045 flat angles P-C4'-P energy: -37.571 tors. eta vs tors. theta energy: -78.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -814.892155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.892155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.892155 (E_RNA) where: Base-Base interactions energy: -516.304 where: short stacking energy: -228.197 Base-Backbone interact. energy: -0.817 local terms energy: -297.771143 where: bonds (distance) C4'-P energy: -47.524 bonds (distance) P-C4' energy: -67.701 flat angles C4'-P-C4' energy: -69.005 flat angles P-C4'-P energy: -43.834 tors. eta vs tors. theta energy: -69.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -638.250029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.250029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.250029 (E_RNA) where: Base-Base interactions energy: -410.735 where: short stacking energy: -157.922 Base-Backbone interact. energy: -1.172 local terms energy: -226.343368 where: bonds (distance) C4'-P energy: -47.173 bonds (distance) P-C4' energy: -61.262 flat angles C4'-P-C4' energy: -51.225 flat angles P-C4'-P energy: -28.436 tors. eta vs tors. theta energy: -38.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -549.655240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.655240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.655240 (E_RNA) where: Base-Base interactions energy: -312.927 where: short stacking energy: -143.297 Base-Backbone interact. energy: 0.918 local terms energy: -237.645852 where: bonds (distance) C4'-P energy: -69.220 bonds (distance) P-C4' energy: -51.244 flat angles C4'-P-C4' energy: -49.729 flat angles P-C4'-P energy: -30.342 tors. eta vs tors. theta energy: -37.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -392.020306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.020306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.020306 (E_RNA) where: Base-Base interactions energy: -176.424 where: short stacking energy: -79.247 Base-Backbone interact. energy: -2.591 local terms energy: -213.004749 where: bonds (distance) C4'-P energy: -64.784 bonds (distance) P-C4' energy: -49.697 flat angles C4'-P-C4' energy: -53.127 flat angles P-C4'-P energy: -39.686 tors. eta vs tors. theta energy: -5.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -353.882897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.882897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.882897 (E_RNA) where: Base-Base interactions energy: -186.363 where: short stacking energy: -106.317 Base-Backbone interact. energy: 1.277 local terms energy: -168.797662 where: bonds (distance) C4'-P energy: -47.964 bonds (distance) P-C4' energy: -51.738 flat angles C4'-P-C4' energy: -43.962 flat angles P-C4'-P energy: -18.370 tors. eta vs tors. theta energy: -6.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -243.532573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.532573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.532573 (E_RNA) where: Base-Base interactions energy: -89.446 where: short stacking energy: -73.393 Base-Backbone interact. energy: -1.144 local terms energy: -152.943024 where: bonds (distance) C4'-P energy: -43.718 bonds (distance) P-C4' energy: -54.148 flat angles C4'-P-C4' energy: -46.933 flat angles P-C4'-P energy: -28.003 tors. eta vs tors. theta energy: 19.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -992.498544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.498544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.498544 (E_RNA) where: Base-Base interactions energy: -672.711 where: short stacking energy: -286.233 Base-Backbone interact. energy: 1.613 local terms energy: -321.400951 where: bonds (distance) C4'-P energy: -53.965 bonds (distance) P-C4' energy: -59.201 flat angles C4'-P-C4' energy: -70.000 flat angles P-C4'-P energy: -45.887 tors. eta vs tors. theta energy: -92.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -945.932828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.932828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.932828 (E_RNA) where: Base-Base interactions energy: -630.147 where: short stacking energy: -266.426 Base-Backbone interact. energy: -1.502 local terms energy: -314.284606 where: bonds (distance) C4'-P energy: -63.425 bonds (distance) P-C4' energy: -69.131 flat angles C4'-P-C4' energy: -63.011 flat angles P-C4'-P energy: -41.412 tors. eta vs tors. theta energy: -77.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -939.620771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.620771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.620771 (E_RNA) where: Base-Base interactions energy: -643.160 where: short stacking energy: -273.019 Base-Backbone interact. energy: -1.068 local terms energy: -295.393431 where: bonds (distance) C4'-P energy: -58.202 bonds (distance) P-C4' energy: -59.368 flat angles C4'-P-C4' energy: -54.860 flat angles P-C4'-P energy: -36.184 tors. eta vs tors. theta energy: -86.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -910.484695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.484695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.484695 (E_RNA) where: Base-Base interactions energy: -591.134 where: short stacking energy: -257.044 Base-Backbone interact. energy: -1.691 local terms energy: -317.660295 where: bonds (distance) C4'-P energy: -62.620 bonds (distance) P-C4' energy: -64.151 flat angles C4'-P-C4' energy: -61.782 flat angles P-C4'-P energy: -44.255 tors. eta vs tors. theta energy: -84.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -786.971254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.971254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.971254 (E_RNA) where: Base-Base interactions energy: -508.649 where: short stacking energy: -225.924 Base-Backbone interact. energy: -0.320 local terms energy: -278.002915 where: bonds (distance) C4'-P energy: -50.879 bonds (distance) P-C4' energy: -49.132 flat angles C4'-P-C4' energy: -66.189 flat angles P-C4'-P energy: -43.774 tors. eta vs tors. theta energy: -68.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -656.692033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.692033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.692033 (E_RNA) where: Base-Base interactions energy: -392.457 where: short stacking energy: -178.226 Base-Backbone interact. energy: -0.508 local terms energy: -263.726956 where: bonds (distance) C4'-P energy: -60.364 bonds (distance) P-C4' energy: -63.399 flat angles C4'-P-C4' energy: -51.658 flat angles P-C4'-P energy: -35.472 tors. eta vs tors. theta energy: -52.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -539.343552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.343552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.343552 (E_RNA) where: Base-Base interactions energy: -310.096 where: short stacking energy: -155.230 Base-Backbone interact. energy: 3.082 local terms energy: -232.329565 where: bonds (distance) C4'-P energy: -60.114 bonds (distance) P-C4' energy: -66.191 flat angles C4'-P-C4' energy: -42.408 flat angles P-C4'-P energy: -30.267 tors. eta vs tors. theta energy: -33.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -385.714698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.714698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.714698 (E_RNA) where: Base-Base interactions energy: -193.440 where: short stacking energy: -108.158 Base-Backbone interact. energy: -0.283 local terms energy: -191.991762 where: bonds (distance) C4'-P energy: -57.478 bonds (distance) P-C4' energy: -47.084 flat angles C4'-P-C4' energy: -50.132 flat angles P-C4'-P energy: -28.729 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -282.949458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.949458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.949458 (E_RNA) where: Base-Base interactions energy: -98.821 where: short stacking energy: -85.741 Base-Backbone interact. energy: 1.180 local terms energy: -185.308462 where: bonds (distance) C4'-P energy: -58.182 bonds (distance) P-C4' energy: -61.755 flat angles C4'-P-C4' energy: -42.318 flat angles P-C4'-P energy: -28.263 tors. eta vs tors. theta energy: 5.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -341.299135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.299135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.299135 (E_RNA) where: Base-Base interactions energy: -161.093 where: short stacking energy: -85.532 Base-Backbone interact. energy: 2.549 local terms energy: -182.755507 where: bonds (distance) C4'-P energy: -55.674 bonds (distance) P-C4' energy: -54.908 flat angles C4'-P-C4' energy: -46.333 flat angles P-C4'-P energy: -23.687 tors. eta vs tors. theta energy: -2.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -994.770422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.770422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.770422 (E_RNA) where: Base-Base interactions energy: -645.164 where: short stacking energy: -278.741 Base-Backbone interact. energy: -2.502 local terms energy: -347.103994 where: bonds (distance) C4'-P energy: -70.860 bonds (distance) P-C4' energy: -62.028 flat angles C4'-P-C4' energy: -74.738 flat angles P-C4'-P energy: -53.790 tors. eta vs tors. theta energy: -85.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -956.614329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.614329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.614329 (E_RNA) where: Base-Base interactions energy: -640.662 where: short stacking energy: -262.664 Base-Backbone interact. energy: 1.769 local terms energy: -317.721682 where: bonds (distance) C4'-P energy: -55.265 bonds (distance) P-C4' energy: -63.118 flat angles C4'-P-C4' energy: -71.153 flat angles P-C4'-P energy: -44.320 tors. eta vs tors. theta energy: -83.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -936.312046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.312046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -936.312046 (E_RNA) where: Base-Base interactions energy: -630.705 where: short stacking energy: -264.104 Base-Backbone interact. energy: -1.643 local terms energy: -303.964099 where: bonds (distance) C4'-P energy: -47.685 bonds (distance) P-C4' energy: -60.635 flat angles C4'-P-C4' energy: -70.756 flat angles P-C4'-P energy: -43.218 tors. eta vs tors. theta energy: -81.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -883.016034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.016034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.016034 (E_RNA) where: Base-Base interactions energy: -578.854 where: short stacking energy: -254.230 Base-Backbone interact. energy: -0.806 local terms energy: -303.356403 where: bonds (distance) C4'-P energy: -56.149 bonds (distance) P-C4' energy: -59.606 flat angles C4'-P-C4' energy: -71.828 flat angles P-C4'-P energy: -36.079 tors. eta vs tors. theta energy: -79.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -791.534221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.534221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.534221 (E_RNA) where: Base-Base interactions energy: -512.374 where: short stacking energy: -209.246 Base-Backbone interact. energy: -1.283 local terms energy: -277.877740 where: bonds (distance) C4'-P energy: -65.226 bonds (distance) P-C4' energy: -66.028 flat angles C4'-P-C4' energy: -56.648 flat angles P-C4'-P energy: -30.157 tors. eta vs tors. theta energy: -59.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -615.023474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.023474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.023474 (E_RNA) where: Base-Base interactions energy: -359.428 where: short stacking energy: -189.333 Base-Backbone interact. energy: -3.778 local terms energy: -251.817813 where: bonds (distance) C4'-P energy: -38.812 bonds (distance) P-C4' energy: -54.435 flat angles C4'-P-C4' energy: -68.557 flat angles P-C4'-P energy: -35.740 tors. eta vs tors. theta energy: -54.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -584.966181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.966181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.966181 (E_RNA) where: Base-Base interactions energy: -340.260 where: short stacking energy: -143.922 Base-Backbone interact. energy: 2.868 local terms energy: -247.574623 where: bonds (distance) C4'-P energy: -57.341 bonds (distance) P-C4' energy: -61.568 flat angles C4'-P-C4' energy: -52.008 flat angles P-C4'-P energy: -33.213 tors. eta vs tors. theta energy: -43.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -383.035713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.035713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.035713 (E_RNA) where: Base-Base interactions energy: -185.959 where: short stacking energy: -122.207 Base-Backbone interact. energy: 0.022 local terms energy: -197.098603 where: bonds (distance) C4'-P energy: -51.471 bonds (distance) P-C4' energy: -60.104 flat angles C4'-P-C4' energy: -52.746 flat angles P-C4'-P energy: -19.849 tors. eta vs tors. theta energy: -12.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -275.874565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.874565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.874565 (E_RNA) where: Base-Base interactions energy: -85.327 where: short stacking energy: -66.811 Base-Backbone interact. energy: -1.750 local terms energy: -188.796960 where: bonds (distance) C4'-P energy: -53.948 bonds (distance) P-C4' energy: -49.344 flat angles C4'-P-C4' energy: -59.801 flat angles P-C4'-P energy: -32.136 tors. eta vs tors. theta energy: 6.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -366.512474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.512474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.512474 (E_RNA) where: Base-Base interactions energy: -166.593 where: short stacking energy: -89.377 Base-Backbone interact. energy: -0.847 local terms energy: -199.072967 where: bonds (distance) C4'-P energy: -56.154 bonds (distance) P-C4' energy: -55.087 flat angles C4'-P-C4' energy: -51.345 flat angles P-C4'-P energy: -34.843 tors. eta vs tors. theta energy: -1.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1000.612322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.612322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.612322 (E_RNA) where: Base-Base interactions energy: -656.314 where: short stacking energy: -304.996 Base-Backbone interact. energy: -1.249 local terms energy: -343.050113 where: bonds (distance) C4'-P energy: -66.466 bonds (distance) P-C4' energy: -65.915 flat angles C4'-P-C4' energy: -65.936 flat angles P-C4'-P energy: -49.923 tors. eta vs tors. theta energy: -94.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -961.707287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.707287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.707287 (E_RNA) where: Base-Base interactions energy: -660.862 where: short stacking energy: -273.210 Base-Backbone interact. energy: -1.150 local terms energy: -299.695172 where: bonds (distance) C4'-P energy: -65.278 bonds (distance) P-C4' energy: -48.610 flat angles C4'-P-C4' energy: -59.787 flat angles P-C4'-P energy: -42.086 tors. eta vs tors. theta energy: -83.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -942.819953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.819953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.819953 (E_RNA) where: Base-Base interactions energy: -627.000 where: short stacking energy: -271.913 Base-Backbone interact. energy: -0.890 local terms energy: -314.929260 where: bonds (distance) C4'-P energy: -63.044 bonds (distance) P-C4' energy: -48.718 flat angles C4'-P-C4' energy: -72.109 flat angles P-C4'-P energy: -47.094 tors. eta vs tors. theta energy: -83.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -869.856471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.856471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.856471 (E_RNA) where: Base-Base interactions energy: -562.837 where: short stacking energy: -254.852 Base-Backbone interact. energy: -1.756 local terms energy: -305.263520 where: bonds (distance) C4'-P energy: -55.887 bonds (distance) P-C4' energy: -56.242 flat angles C4'-P-C4' energy: -69.302 flat angles P-C4'-P energy: -42.864 tors. eta vs tors. theta energy: -80.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -815.972632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.972632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.972632 (E_RNA) where: Base-Base interactions energy: -515.643 where: short stacking energy: -231.553 Base-Backbone interact. energy: -0.860 local terms energy: -299.469689 where: bonds (distance) C4'-P energy: -61.324 bonds (distance) P-C4' energy: -65.521 flat angles C4'-P-C4' energy: -69.768 flat angles P-C4'-P energy: -41.798 tors. eta vs tors. theta energy: -61.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -657.297980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.297980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.297980 (E_RNA) where: Base-Base interactions energy: -396.976 where: short stacking energy: -185.517 Base-Backbone interact. energy: 3.255 local terms energy: -263.577257 where: bonds (distance) C4'-P energy: -63.787 bonds (distance) P-C4' energy: -65.001 flat angles C4'-P-C4' energy: -54.240 flat angles P-C4'-P energy: -34.372 tors. eta vs tors. theta energy: -46.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -519.923384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.923384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.923384 (E_RNA) where: Base-Base interactions energy: -297.409 where: short stacking energy: -147.684 Base-Backbone interact. energy: -1.137 local terms energy: -221.377288 where: bonds (distance) C4'-P energy: -54.262 bonds (distance) P-C4' energy: -53.603 flat angles C4'-P-C4' energy: -53.806 flat angles P-C4'-P energy: -21.384 tors. eta vs tors. theta energy: -38.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -412.231904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.231904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.231904 (E_RNA) where: Base-Base interactions energy: -207.040 where: short stacking energy: -120.440 Base-Backbone interact. energy: 4.457 local terms energy: -209.649359 where: bonds (distance) C4'-P energy: -48.032 bonds (distance) P-C4' energy: -56.166 flat angles C4'-P-C4' energy: -54.875 flat angles P-C4'-P energy: -36.364 tors. eta vs tors. theta energy: -14.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -387.716203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.716203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.716203 (E_RNA) where: Base-Base interactions energy: -185.122 where: short stacking energy: -103.100 Base-Backbone interact. energy: -0.744 local terms energy: -201.849799 where: bonds (distance) C4'-P energy: -55.980 bonds (distance) P-C4' energy: -60.796 flat angles C4'-P-C4' energy: -53.102 flat angles P-C4'-P energy: -22.919 tors. eta vs tors. theta energy: -9.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -300.144993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.144993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.144993 (E_RNA) where: Base-Base interactions energy: -124.821 where: short stacking energy: -82.065 Base-Backbone interact. energy: -1.785 local terms energy: -173.539788 where: bonds (distance) C4'-P energy: -58.337 bonds (distance) P-C4' energy: -55.737 flat angles C4'-P-C4' energy: -40.154 flat angles P-C4'-P energy: -20.641 tors. eta vs tors. theta energy: 1.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -998.605749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.605749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.605749 (E_RNA) where: Base-Base interactions energy: -665.137 where: short stacking energy: -299.043 Base-Backbone interact. energy: -0.595 local terms energy: -332.874352 where: bonds (distance) C4'-P energy: -63.568 bonds (distance) P-C4' energy: -65.880 flat angles C4'-P-C4' energy: -70.025 flat angles P-C4'-P energy: -47.837 tors. eta vs tors. theta energy: -85.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -978.570916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.570916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.570916 (E_RNA) where: Base-Base interactions energy: -648.555 where: short stacking energy: -268.754 Base-Backbone interact. energy: -2.569 local terms energy: -327.447324 where: bonds (distance) C4'-P energy: -61.067 bonds (distance) P-C4' energy: -68.320 flat angles C4'-P-C4' energy: -72.297 flat angles P-C4'-P energy: -42.481 tors. eta vs tors. theta energy: -83.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -905.839508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.839508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.839508 (E_RNA) where: Base-Base interactions energy: -591.478 where: short stacking energy: -257.094 Base-Backbone interact. energy: -2.698 local terms energy: -311.662965 where: bonds (distance) C4'-P energy: -53.060 bonds (distance) P-C4' energy: -66.631 flat angles C4'-P-C4' energy: -70.357 flat angles P-C4'-P energy: -49.704 tors. eta vs tors. theta energy: -71.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -911.632794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.632794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.632794 (E_RNA) where: Base-Base interactions energy: -614.272 where: short stacking energy: -262.415 Base-Backbone interact. energy: -2.258 local terms energy: -295.103125 where: bonds (distance) C4'-P energy: -59.638 bonds (distance) P-C4' energy: -51.491 flat angles C4'-P-C4' energy: -63.724 flat angles P-C4'-P energy: -39.712 tors. eta vs tors. theta energy: -80.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -812.082196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.082196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.082196 (E_RNA) where: Base-Base interactions energy: -523.036 where: short stacking energy: -201.464 Base-Backbone interact. energy: 2.642 local terms energy: -291.688118 where: bonds (distance) C4'-P energy: -66.653 bonds (distance) P-C4' energy: -60.835 flat angles C4'-P-C4' energy: -62.170 flat angles P-C4'-P energy: -45.974 tors. eta vs tors. theta energy: -56.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -625.417688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.417688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.417688 (E_RNA) where: Base-Base interactions energy: -385.555 where: short stacking energy: -180.052 Base-Backbone interact. energy: -1.218 local terms energy: -238.644558 where: bonds (distance) C4'-P energy: -49.513 bonds (distance) P-C4' energy: -59.724 flat angles C4'-P-C4' energy: -55.606 flat angles P-C4'-P energy: -33.802 tors. eta vs tors. theta energy: -39.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -515.144525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.144525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.144525 (E_RNA) where: Base-Base interactions energy: -304.579 where: short stacking energy: -147.027 Base-Backbone interact. energy: 0.846 local terms energy: -211.411075 where: bonds (distance) C4'-P energy: -51.443 bonds (distance) P-C4' energy: -56.889 flat angles C4'-P-C4' energy: -56.016 flat angles P-C4'-P energy: -23.326 tors. eta vs tors. theta energy: -23.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -429.970781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.970781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.970781 (E_RNA) where: Base-Base interactions energy: -218.656 where: short stacking energy: -133.490 Base-Backbone interact. energy: 2.317 local terms energy: -213.632126 where: bonds (distance) C4'-P energy: -47.570 bonds (distance) P-C4' energy: -62.984 flat angles C4'-P-C4' energy: -56.419 flat angles P-C4'-P energy: -21.772 tors. eta vs tors. theta energy: -24.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -397.549013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.549013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.549013 (E_RNA) where: Base-Base interactions energy: -205.682 where: short stacking energy: -121.134 Base-Backbone interact. energy: 1.947 local terms energy: -193.814280 where: bonds (distance) C4'-P energy: -59.685 bonds (distance) P-C4' energy: -49.564 flat angles C4'-P-C4' energy: -52.009 flat angles P-C4'-P energy: -19.076 tors. eta vs tors. theta energy: -13.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -336.618286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.618286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.618286 (E_RNA) where: Base-Base interactions energy: -176.253 where: short stacking energy: -93.395 Base-Backbone interact. energy: 6.103 local terms energy: -166.468254 where: bonds (distance) C4'-P energy: -39.230 bonds (distance) P-C4' energy: -57.018 flat angles C4'-P-C4' energy: -44.041 flat angles P-C4'-P energy: -27.931 tors. eta vs tors. theta energy: 1.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1000.135785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.135785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.135785 (E_RNA) where: Base-Base interactions energy: -679.598 where: short stacking energy: -289.040 Base-Backbone interact. energy: -1.667 local terms energy: -318.870664 where: bonds (distance) C4'-P energy: -60.695 bonds (distance) P-C4' energy: -61.775 flat angles C4'-P-C4' energy: -69.846 flat angles P-C4'-P energy: -47.096 tors. eta vs tors. theta energy: -79.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -978.105511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.105511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.105511 (E_RNA) where: Base-Base interactions energy: -655.827 where: short stacking energy: -289.004 Base-Backbone interact. energy: -1.279 local terms energy: -321.000036 where: bonds (distance) C4'-P energy: -56.590 bonds (distance) P-C4' energy: -62.910 flat angles C4'-P-C4' energy: -64.930 flat angles P-C4'-P energy: -42.485 tors. eta vs tors. theta energy: -94.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -944.307948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.307948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.307948 (E_RNA) where: Base-Base interactions energy: -630.734 where: short stacking energy: -278.592 Base-Backbone interact. energy: -0.744 local terms energy: -312.829688 where: bonds (distance) C4'-P energy: -59.368 bonds (distance) P-C4' energy: -59.540 flat angles C4'-P-C4' energy: -66.981 flat angles P-C4'-P energy: -38.957 tors. eta vs tors. theta energy: -87.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -896.232522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.232522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.232522 (E_RNA) where: Base-Base interactions energy: -587.548 where: short stacking energy: -264.126 Base-Backbone interact. energy: -0.999 local terms energy: -307.685656 where: bonds (distance) C4'-P energy: -51.218 bonds (distance) P-C4' energy: -58.178 flat angles C4'-P-C4' energy: -69.075 flat angles P-C4'-P energy: -45.484 tors. eta vs tors. theta energy: -83.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -745.342617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.342617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.342617 (E_RNA) where: Base-Base interactions energy: -486.819 where: short stacking energy: -192.508 Base-Backbone interact. energy: 0.008 local terms energy: -258.531761 where: bonds (distance) C4'-P energy: -59.212 bonds (distance) P-C4' energy: -53.245 flat angles C4'-P-C4' energy: -54.012 flat angles P-C4'-P energy: -34.189 tors. eta vs tors. theta energy: -57.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -569.987070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.987070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.987070 (E_RNA) where: Base-Base interactions energy: -338.922 where: short stacking energy: -160.403 Base-Backbone interact. energy: 2.443 local terms energy: -233.508286 where: bonds (distance) C4'-P energy: -55.568 bonds (distance) P-C4' energy: -47.233 flat angles C4'-P-C4' energy: -62.110 flat angles P-C4'-P energy: -36.264 tors. eta vs tors. theta energy: -32.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -464.982497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.982497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.982497 (E_RNA) where: Base-Base interactions energy: -247.903 where: short stacking energy: -143.807 Base-Backbone interact. energy: 1.155 local terms energy: -218.234106 where: bonds (distance) C4'-P energy: -31.983 bonds (distance) P-C4' energy: -70.322 flat angles C4'-P-C4' energy: -55.458 flat angles P-C4'-P energy: -35.672 tors. eta vs tors. theta energy: -24.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -503.672385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.672385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.672385 (E_RNA) where: Base-Base interactions energy: -320.195 where: short stacking energy: -145.464 Base-Backbone interact. energy: 2.056 local terms energy: -185.532827 where: bonds (distance) C4'-P energy: -47.485 bonds (distance) P-C4' energy: -48.954 flat angles C4'-P-C4' energy: -37.934 flat angles P-C4'-P energy: -33.694 tors. eta vs tors. theta energy: -17.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -441.639630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.639630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.639630 (E_RNA) where: Base-Base interactions energy: -216.703 where: short stacking energy: -113.544 Base-Backbone interact. energy: -2.127 local terms energy: -222.809145 where: bonds (distance) C4'-P energy: -54.440 bonds (distance) P-C4' energy: -67.409 flat angles C4'-P-C4' energy: -53.150 flat angles P-C4'-P energy: -29.423 tors. eta vs tors. theta energy: -18.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -316.974951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.974951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.974951 (E_RNA) where: Base-Base interactions energy: -123.169 where: short stacking energy: -74.896 Base-Backbone interact. energy: -1.603 local terms energy: -192.203500 where: bonds (distance) C4'-P energy: -58.247 bonds (distance) P-C4' energy: -46.623 flat angles C4'-P-C4' energy: -49.696 flat angles P-C4'-P energy: -29.284 tors. eta vs tors. theta energy: -8.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -996.480577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.480577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.480577 (E_RNA) where: Base-Base interactions energy: -691.601 where: short stacking energy: -286.527 Base-Backbone interact. energy: -0.468 local terms energy: -304.411698 where: bonds (distance) C4'-P energy: -62.351 bonds (distance) P-C4' energy: -53.320 flat angles C4'-P-C4' energy: -65.169 flat angles P-C4'-P energy: -39.659 tors. eta vs tors. theta energy: -83.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -953.691932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.691932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.691932 (E_RNA) where: Base-Base interactions energy: -624.606 where: short stacking energy: -288.265 Base-Backbone interact. energy: -1.770 local terms energy: -327.315538 where: bonds (distance) C4'-P energy: -65.740 bonds (distance) P-C4' energy: -61.030 flat angles C4'-P-C4' energy: -67.398 flat angles P-C4'-P energy: -44.547 tors. eta vs tors. theta energy: -88.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -961.783496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.783496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.783496 (E_RNA) where: Base-Base interactions energy: -621.473 where: short stacking energy: -276.846 Base-Backbone interact. energy: -1.372 local terms energy: -338.938818 where: bonds (distance) C4'-P energy: -66.718 bonds (distance) P-C4' energy: -66.500 flat angles C4'-P-C4' energy: -66.490 flat angles P-C4'-P energy: -44.767 tors. eta vs tors. theta energy: -94.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -896.487978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.487978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.487978 (E_RNA) where: Base-Base interactions energy: -606.208 where: short stacking energy: -258.968 Base-Backbone interact. energy: -0.342 local terms energy: -289.937827 where: bonds (distance) C4'-P energy: -57.939 bonds (distance) P-C4' energy: -47.824 flat angles C4'-P-C4' energy: -63.743 flat angles P-C4'-P energy: -34.991 tors. eta vs tors. theta energy: -85.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -777.005910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.005910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.005910 (E_RNA) where: Base-Base interactions energy: -519.412 where: short stacking energy: -222.442 Base-Backbone interact. energy: 3.924 local terms energy: -261.517587 where: bonds (distance) C4'-P energy: -60.431 bonds (distance) P-C4' energy: -59.277 flat angles C4'-P-C4' energy: -61.122 flat angles P-C4'-P energy: -35.609 tors. eta vs tors. theta energy: -45.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -632.555996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -632.555996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.555996 (E_RNA) where: Base-Base interactions energy: -385.426 where: short stacking energy: -173.764 Base-Backbone interact. energy: -0.148 local terms energy: -246.982295 where: bonds (distance) C4'-P energy: -47.897 bonds (distance) P-C4' energy: -61.306 flat angles C4'-P-C4' energy: -55.985 flat angles P-C4'-P energy: -33.118 tors. eta vs tors. theta energy: -48.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -460.741146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.741146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.741146 (E_RNA) where: Base-Base interactions energy: -235.003 where: short stacking energy: -129.563 Base-Backbone interact. energy: -1.022 local terms energy: -224.716354 where: bonds (distance) C4'-P energy: -56.403 bonds (distance) P-C4' energy: -56.251 flat angles C4'-P-C4' energy: -47.314 flat angles P-C4'-P energy: -39.824 tors. eta vs tors. theta energy: -24.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -376.443626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.443626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.443626 (E_RNA) where: Base-Base interactions energy: -173.491 where: short stacking energy: -96.229 Base-Backbone interact. energy: -1.043 local terms energy: -201.909140 where: bonds (distance) C4'-P energy: -54.628 bonds (distance) P-C4' energy: -66.557 flat angles C4'-P-C4' energy: -58.807 flat angles P-C4'-P energy: -23.278 tors. eta vs tors. theta energy: 1.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -433.564819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.564819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.564819 (E_RNA) where: Base-Base interactions energy: -230.780 where: short stacking energy: -122.408 Base-Backbone interact. energy: -0.774 local terms energy: -202.011380 where: bonds (distance) C4'-P energy: -50.065 bonds (distance) P-C4' energy: -61.715 flat angles C4'-P-C4' energy: -44.238 flat angles P-C4'-P energy: -25.880 tors. eta vs tors. theta energy: -20.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -269.211515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.211515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.211515 (E_RNA) where: Base-Base interactions energy: -97.539 where: short stacking energy: -84.934 Base-Backbone interact. energy: 0.274 local terms energy: -171.946995 where: bonds (distance) C4'-P energy: -56.019 bonds (distance) P-C4' energy: -47.681 flat angles C4'-P-C4' energy: -37.947 flat angles P-C4'-P energy: -31.487 tors. eta vs tors. theta energy: 1.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -993.105616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.105616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.105616 (E_RNA) where: Base-Base interactions energy: -687.156 where: short stacking energy: -280.397 Base-Backbone interact. energy: -1.286 local terms energy: -304.663364 where: bonds (distance) C4'-P energy: -58.190 bonds (distance) P-C4' energy: -63.798 flat angles C4'-P-C4' energy: -63.769 flat angles P-C4'-P energy: -40.417 tors. eta vs tors. theta energy: -78.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -946.651020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.651020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.651020 (E_RNA) where: Base-Base interactions energy: -629.262 where: short stacking energy: -269.816 Base-Backbone interact. energy: -0.362 local terms energy: -317.026235 where: bonds (distance) C4'-P energy: -58.645 bonds (distance) P-C4' energy: -56.001 flat angles C4'-P-C4' energy: -74.637 flat angles P-C4'-P energy: -37.035 tors. eta vs tors. theta energy: -90.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -945.809989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.809989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.809989 (E_RNA) where: Base-Base interactions energy: -623.705 where: short stacking energy: -271.666 Base-Backbone interact. energy: -2.253 local terms energy: -319.852042 where: bonds (distance) C4'-P energy: -61.737 bonds (distance) P-C4' energy: -68.688 flat angles C4'-P-C4' energy: -57.446 flat angles P-C4'-P energy: -40.266 tors. eta vs tors. theta energy: -91.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -914.019720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.019720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.019720 (E_RNA) where: Base-Base interactions energy: -602.373 where: short stacking energy: -268.947 Base-Backbone interact. energy: -1.512 local terms energy: -310.134288 where: bonds (distance) C4'-P energy: -55.127 bonds (distance) P-C4' energy: -63.882 flat angles C4'-P-C4' energy: -58.758 flat angles P-C4'-P energy: -46.658 tors. eta vs tors. theta energy: -85.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -771.505170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.505170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.505170 (E_RNA) where: Base-Base interactions energy: -507.869 where: short stacking energy: -224.400 Base-Backbone interact. energy: 1.255 local terms energy: -264.891069 where: bonds (distance) C4'-P energy: -58.564 bonds (distance) P-C4' energy: -51.867 flat angles C4'-P-C4' energy: -58.266 flat angles P-C4'-P energy: -40.560 tors. eta vs tors. theta energy: -55.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -621.463528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.463528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.463528 (E_RNA) where: Base-Base interactions energy: -372.703 where: short stacking energy: -180.513 Base-Backbone interact. energy: 0.556 local terms energy: -249.316542 where: bonds (distance) C4'-P energy: -56.803 bonds (distance) P-C4' energy: -43.716 flat angles C4'-P-C4' energy: -65.386 flat angles P-C4'-P energy: -31.766 tors. eta vs tors. theta energy: -51.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -485.328389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.328389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.328389 (E_RNA) where: Base-Base interactions energy: -264.290 where: short stacking energy: -120.013 Base-Backbone interact. energy: -1.525 local terms energy: -219.513213 where: bonds (distance) C4'-P energy: -47.346 bonds (distance) P-C4' energy: -57.665 flat angles C4'-P-C4' energy: -53.198 flat angles P-C4'-P energy: -38.851 tors. eta vs tors. theta energy: -22.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -409.005553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.005553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.005553 (E_RNA) where: Base-Base interactions energy: -201.512 where: short stacking energy: -103.974 Base-Backbone interact. energy: 0.444 local terms energy: -207.937448 where: bonds (distance) C4'-P energy: -54.556 bonds (distance) P-C4' energy: -49.580 flat angles C4'-P-C4' energy: -44.662 flat angles P-C4'-P energy: -34.043 tors. eta vs tors. theta energy: -25.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -343.586993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.586993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.586993 (E_RNA) where: Base-Base interactions energy: -134.214 where: short stacking energy: -94.681 Base-Backbone interact. energy: -1.024 local terms energy: -208.348530 where: bonds (distance) C4'-P energy: -63.396 bonds (distance) P-C4' energy: -58.039 flat angles C4'-P-C4' energy: -56.220 flat angles P-C4'-P energy: -30.994 tors. eta vs tors. theta energy: 0.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -255.872127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.872127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.872127 (E_RNA) where: Base-Base interactions energy: -88.187 where: short stacking energy: -82.414 Base-Backbone interact. energy: -1.068 local terms energy: -166.616746 where: bonds (distance) C4'-P energy: -48.096 bonds (distance) P-C4' energy: -64.772 flat angles C4'-P-C4' energy: -40.690 flat angles P-C4'-P energy: -23.257 tors. eta vs tors. theta energy: 10.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1007.140227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.140227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.140227 (E_RNA) where: Base-Base interactions energy: -685.745 where: short stacking energy: -298.596 Base-Backbone interact. energy: -3.296 local terms energy: -318.098964 where: bonds (distance) C4'-P energy: -61.701 bonds (distance) P-C4' energy: -60.594 flat angles C4'-P-C4' energy: -64.571 flat angles P-C4'-P energy: -42.959 tors. eta vs tors. theta energy: -88.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -984.970334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.970334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.970334 (E_RNA) where: Base-Base interactions energy: -653.081 where: short stacking energy: -277.281 Base-Backbone interact. energy: -0.636 local terms energy: -331.254031 where: bonds (distance) C4'-P energy: -68.019 bonds (distance) P-C4' energy: -59.098 flat angles C4'-P-C4' energy: -71.354 flat angles P-C4'-P energy: -38.004 tors. eta vs tors. theta energy: -94.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -937.077964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.077964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.077964 (E_RNA) where: Base-Base interactions energy: -618.640 where: short stacking energy: -267.056 Base-Backbone interact. energy: -0.312 local terms energy: -318.125805 where: bonds (distance) C4'-P energy: -64.228 bonds (distance) P-C4' energy: -59.496 flat angles C4'-P-C4' energy: -68.317 flat angles P-C4'-P energy: -40.105 tors. eta vs tors. theta energy: -85.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -889.808705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.808705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.808705 (E_RNA) where: Base-Base interactions energy: -582.247 where: short stacking energy: -241.462 Base-Backbone interact. energy: -1.607 local terms energy: -305.954690 where: bonds (distance) C4'-P energy: -71.685 bonds (distance) P-C4' energy: -63.474 flat angles C4'-P-C4' energy: -53.766 flat angles P-C4'-P energy: -43.716 tors. eta vs tors. theta energy: -73.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -782.410030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.410030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.410030 (E_RNA) where: Base-Base interactions energy: -518.318 where: short stacking energy: -226.178 Base-Backbone interact. energy: -0.174 local terms energy: -263.917995 where: bonds (distance) C4'-P energy: -49.889 bonds (distance) P-C4' energy: -55.251 flat angles C4'-P-C4' energy: -55.831 flat angles P-C4'-P energy: -41.274 tors. eta vs tors. theta energy: -61.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -593.440622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.440622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.440622 (E_RNA) where: Base-Base interactions energy: -365.077 where: short stacking energy: -170.916 Base-Backbone interact. energy: -0.282 local terms energy: -228.081199 where: bonds (distance) C4'-P energy: -63.654 bonds (distance) P-C4' energy: -54.373 flat angles C4'-P-C4' energy: -60.858 flat angles P-C4'-P energy: -17.227 tors. eta vs tors. theta energy: -31.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -448.838913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.838913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.838913 (E_RNA) where: Base-Base interactions energy: -236.939 where: short stacking energy: -130.671 Base-Backbone interact. energy: -2.657 local terms energy: -209.242436 where: bonds (distance) C4'-P energy: -48.167 bonds (distance) P-C4' energy: -51.411 flat angles C4'-P-C4' energy: -57.018 flat angles P-C4'-P energy: -33.485 tors. eta vs tors. theta energy: -19.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -466.506251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.506251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.506251 (E_RNA) where: Base-Base interactions energy: -246.306 where: short stacking energy: -108.120 Base-Backbone interact. energy: -1.505 local terms energy: -218.695786 where: bonds (distance) C4'-P energy: -53.117 bonds (distance) P-C4' energy: -53.687 flat angles C4'-P-C4' energy: -62.562 flat angles P-C4'-P energy: -28.164 tors. eta vs tors. theta energy: -21.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -327.807252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.807252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.807252 (E_RNA) where: Base-Base interactions energy: -157.451 where: short stacking energy: -116.606 Base-Backbone interact. energy: -1.137 local terms energy: -169.219572 where: bonds (distance) C4'-P energy: -42.644 bonds (distance) P-C4' energy: -45.610 flat angles C4'-P-C4' energy: -50.387 flat angles P-C4'-P energy: -18.734 tors. eta vs tors. theta energy: -11.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -262.750752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.750752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.750752 (E_RNA) where: Base-Base interactions energy: -95.185 where: short stacking energy: -74.413 Base-Backbone interact. energy: -1.400 local terms energy: -166.166128 where: bonds (distance) C4'-P energy: -50.903 bonds (distance) P-C4' energy: -62.581 flat angles C4'-P-C4' energy: -40.120 flat angles P-C4'-P energy: -23.374 tors. eta vs tors. theta energy: 10.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1026.653056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.653056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.653056 (E_RNA) where: Base-Base interactions energy: -679.518 where: short stacking energy: -309.059 Base-Backbone interact. energy: -0.743 local terms energy: -346.392441 where: bonds (distance) C4'-P energy: -61.475 bonds (distance) P-C4' energy: -59.711 flat angles C4'-P-C4' energy: -76.143 flat angles P-C4'-P energy: -49.648 tors. eta vs tors. theta energy: -99.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -974.093192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.093192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.093192 (E_RNA) where: Base-Base interactions energy: -653.937 where: short stacking energy: -270.722 Base-Backbone interact. energy: -3.465 local terms energy: -316.691175 where: bonds (distance) C4'-P energy: -58.327 bonds (distance) P-C4' energy: -67.029 flat angles C4'-P-C4' energy: -61.707 flat angles P-C4'-P energy: -43.352 tors. eta vs tors. theta energy: -86.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -940.767875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.767875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.767875 (E_RNA) where: Base-Base interactions energy: -629.038 where: short stacking energy: -267.888 Base-Backbone interact. energy: 0.829 local terms energy: -312.558689 where: bonds (distance) C4'-P energy: -60.604 bonds (distance) P-C4' energy: -51.887 flat angles C4'-P-C4' energy: -66.077 flat angles P-C4'-P energy: -48.230 tors. eta vs tors. theta energy: -85.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -885.207320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.207320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.207320 (E_RNA) where: Base-Base interactions energy: -596.210 where: short stacking energy: -235.534 Base-Backbone interact. energy: -1.266 local terms energy: -287.730476 where: bonds (distance) C4'-P energy: -58.090 bonds (distance) P-C4' energy: -55.424 flat angles C4'-P-C4' energy: -63.111 flat angles P-C4'-P energy: -35.093 tors. eta vs tors. theta energy: -76.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -802.350484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.350484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.350484 (E_RNA) where: Base-Base interactions energy: -523.412 where: short stacking energy: -229.500 Base-Backbone interact. energy: 3.000 local terms energy: -281.938567 where: bonds (distance) C4'-P energy: -55.041 bonds (distance) P-C4' energy: -60.751 flat angles C4'-P-C4' energy: -65.649 flat angles P-C4'-P energy: -42.402 tors. eta vs tors. theta energy: -58.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -612.322471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.322471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.322471 (E_RNA) where: Base-Base interactions energy: -359.106 where: short stacking energy: -181.781 Base-Backbone interact. energy: -0.991 local terms energy: -252.225696 where: bonds (distance) C4'-P energy: -55.985 bonds (distance) P-C4' energy: -58.253 flat angles C4'-P-C4' energy: -56.108 flat angles P-C4'-P energy: -38.362 tors. eta vs tors. theta energy: -43.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -520.865328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.865328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.865328 (E_RNA) where: Base-Base interactions energy: -286.157 where: short stacking energy: -143.286 Base-Backbone interact. energy: -0.134 local terms energy: -234.573957 where: bonds (distance) C4'-P energy: -54.090 bonds (distance) P-C4' energy: -58.921 flat angles C4'-P-C4' energy: -54.634 flat angles P-C4'-P energy: -37.618 tors. eta vs tors. theta energy: -29.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -431.918808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.918808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.918808 (E_RNA) where: Base-Base interactions energy: -231.939 where: short stacking energy: -135.594 Base-Backbone interact. energy: -0.381 local terms energy: -199.599268 where: bonds (distance) C4'-P energy: -37.469 bonds (distance) P-C4' energy: -65.573 flat angles C4'-P-C4' energy: -51.569 flat angles P-C4'-P energy: -20.013 tors. eta vs tors. theta energy: -24.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -273.864256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.864256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.864256 (E_RNA) where: Base-Base interactions energy: -102.023 where: short stacking energy: -85.077 Base-Backbone interact. energy: 2.955 local terms energy: -174.796279 where: bonds (distance) C4'-P energy: -38.739 bonds (distance) P-C4' energy: -55.304 flat angles C4'-P-C4' energy: -59.791 flat angles P-C4'-P energy: -31.884 tors. eta vs tors. theta energy: 10.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -261.416568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.416568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.416568 (E_RNA) where: Base-Base interactions energy: -49.818 where: short stacking energy: -39.664 Base-Backbone interact. energy: -0.898 local terms energy: -210.701121 where: bonds (distance) C4'-P energy: -64.018 bonds (distance) P-C4' energy: -61.373 flat angles C4'-P-C4' energy: -55.267 flat angles P-C4'-P energy: -45.451 tors. eta vs tors. theta energy: 15.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -997.127344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.127344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.127344 (E_RNA) where: Base-Base interactions energy: -651.487 where: short stacking energy: -293.072 Base-Backbone interact. energy: -1.345 local terms energy: -344.295269 where: bonds (distance) C4'-P energy: -71.570 bonds (distance) P-C4' energy: -66.552 flat angles C4'-P-C4' energy: -66.824 flat angles P-C4'-P energy: -48.174 tors. eta vs tors. theta energy: -91.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -982.948213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.948213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.948213 (E_RNA) where: Base-Base interactions energy: -680.361 where: short stacking energy: -298.158 Base-Backbone interact. energy: -2.636 local terms energy: -299.951162 where: bonds (distance) C4'-P energy: -54.055 bonds (distance) P-C4' energy: -52.441 flat angles C4'-P-C4' energy: -63.978 flat angles P-C4'-P energy: -39.192 tors. eta vs tors. theta energy: -90.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -977.251515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.251515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.251515 (E_RNA) where: Base-Base interactions energy: -652.893 where: short stacking energy: -274.903 Base-Backbone interact. energy: -1.078 local terms energy: -323.280593 where: bonds (distance) C4'-P energy: -51.638 bonds (distance) P-C4' energy: -56.910 flat angles C4'-P-C4' energy: -68.906 flat angles P-C4'-P energy: -50.843 tors. eta vs tors. theta energy: -94.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -875.234495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.234495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.234495 (E_RNA) where: Base-Base interactions energy: -582.623 where: short stacking energy: -241.333 Base-Backbone interact. energy: -0.795 local terms energy: -291.816554 where: bonds (distance) C4'-P energy: -52.847 bonds (distance) P-C4' energy: -56.806 flat angles C4'-P-C4' energy: -66.761 flat angles P-C4'-P energy: -45.640 tors. eta vs tors. theta energy: -69.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -835.541979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.541979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.541979 (E_RNA) where: Base-Base interactions energy: -544.352 where: short stacking energy: -236.911 Base-Backbone interact. energy: -1.671 local terms energy: -289.518992 where: bonds (distance) C4'-P energy: -54.076 bonds (distance) P-C4' energy: -59.776 flat angles C4'-P-C4' energy: -68.725 flat angles P-C4'-P energy: -37.010 tors. eta vs tors. theta energy: -69.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -567.523068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.523068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.523068 (E_RNA) where: Base-Base interactions energy: -332.609 where: short stacking energy: -148.344 Base-Backbone interact. energy: -1.920 local terms energy: -232.993897 where: bonds (distance) C4'-P energy: -57.874 bonds (distance) P-C4' energy: -55.743 flat angles C4'-P-C4' energy: -56.267 flat angles P-C4'-P energy: -32.241 tors. eta vs tors. theta energy: -30.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -507.313777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.313777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.313777 (E_RNA) where: Base-Base interactions energy: -292.883 where: short stacking energy: -148.242 Base-Backbone interact. energy: 1.581 local terms energy: -216.011812 where: bonds (distance) C4'-P energy: -40.816 bonds (distance) P-C4' energy: -50.753 flat angles C4'-P-C4' energy: -45.524 flat angles P-C4'-P energy: -43.965 tors. eta vs tors. theta energy: -34.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -279.925886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.925886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.925886 (E_RNA) where: Base-Base interactions energy: -88.878 where: short stacking energy: -76.552 Base-Backbone interact. energy: -0.550 local terms energy: -190.498251 where: bonds (distance) C4'-P energy: -47.114 bonds (distance) P-C4' energy: -63.194 flat angles C4'-P-C4' energy: -37.902 flat angles P-C4'-P energy: -38.533 tors. eta vs tors. theta energy: -3.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -398.599646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.599646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.599646 (E_RNA) where: Base-Base interactions energy: -200.277 where: short stacking energy: -103.591 Base-Backbone interact. energy: 0.168 local terms energy: -198.490363 where: bonds (distance) C4'-P energy: -51.254 bonds (distance) P-C4' energy: -59.472 flat angles C4'-P-C4' energy: -58.910 flat angles P-C4'-P energy: -20.779 tors. eta vs tors. theta energy: -8.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -254.601320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.601320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.601320 (E_RNA) where: Base-Base interactions energy: -93.261 where: short stacking energy: -47.768 Base-Backbone interact. energy: -0.418 local terms energy: -160.922594 where: bonds (distance) C4'-P energy: -45.062 bonds (distance) P-C4' energy: -60.345 flat angles C4'-P-C4' energy: -54.608 flat angles P-C4'-P energy: -24.889 tors. eta vs tors. theta energy: 23.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -999.358540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.358540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.358540 (E_RNA) where: Base-Base interactions energy: -665.496 where: short stacking energy: -297.378 Base-Backbone interact. energy: -1.675 local terms energy: -332.186865 where: bonds (distance) C4'-P energy: -62.297 bonds (distance) P-C4' energy: -64.616 flat angles C4'-P-C4' energy: -66.923 flat angles P-C4'-P energy: -50.732 tors. eta vs tors. theta energy: -87.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -977.080275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.080275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.080275 (E_RNA) where: Base-Base interactions energy: -629.964 where: short stacking energy: -278.012 Base-Backbone interact. energy: -0.325 local terms energy: -346.791213 where: bonds (distance) C4'-P energy: -64.342 bonds (distance) P-C4' energy: -63.455 flat angles C4'-P-C4' energy: -69.486 flat angles P-C4'-P energy: -56.786 tors. eta vs tors. theta energy: -92.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -973.576288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.576288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.576288 (E_RNA) where: Base-Base interactions energy: -636.348 where: short stacking energy: -277.215 Base-Backbone interact. energy: -1.506 local terms energy: -335.722600 where: bonds (distance) C4'-P energy: -65.969 bonds (distance) P-C4' energy: -61.918 flat angles C4'-P-C4' energy: -71.489 flat angles P-C4'-P energy: -49.528 tors. eta vs tors. theta energy: -86.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -879.551957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.551957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.551957 (E_RNA) where: Base-Base interactions energy: -576.603 where: short stacking energy: -254.985 Base-Backbone interact. energy: -1.120 local terms energy: -301.828806 where: bonds (distance) C4'-P energy: -58.664 bonds (distance) P-C4' energy: -64.897 flat angles C4'-P-C4' energy: -60.939 flat angles P-C4'-P energy: -40.108 tors. eta vs tors. theta energy: -77.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -798.022565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.022565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.022565 (E_RNA) where: Base-Base interactions energy: -524.897 where: short stacking energy: -213.633 Base-Backbone interact. energy: -2.258 local terms energy: -270.868380 where: bonds (distance) C4'-P energy: -68.597 bonds (distance) P-C4' energy: -57.696 flat angles C4'-P-C4' energy: -56.173 flat angles P-C4'-P energy: -29.957 tors. eta vs tors. theta energy: -58.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -560.555011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.555011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.555011 (E_RNA) where: Base-Base interactions energy: -317.187 where: short stacking energy: -180.512 Base-Backbone interact. energy: 1.782 local terms energy: -245.150149 where: bonds (distance) C4'-P energy: -67.375 bonds (distance) P-C4' energy: -54.228 flat angles C4'-P-C4' energy: -49.361 flat angles P-C4'-P energy: -25.048 tors. eta vs tors. theta energy: -49.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -464.543414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.543414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.543414 (E_RNA) where: Base-Base interactions energy: -232.091 where: short stacking energy: -138.902 Base-Backbone interact. energy: -2.372 local terms energy: -230.080354 where: bonds (distance) C4'-P energy: -54.333 bonds (distance) P-C4' energy: -49.097 flat angles C4'-P-C4' energy: -54.904 flat angles P-C4'-P energy: -36.473 tors. eta vs tors. theta energy: -35.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -291.937595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.937595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.937595 (E_RNA) where: Base-Base interactions energy: -94.704 where: short stacking energy: -87.023 Base-Backbone interact. energy: 0.952 local terms energy: -198.185708 where: bonds (distance) C4'-P energy: -45.208 bonds (distance) P-C4' energy: -61.213 flat angles C4'-P-C4' energy: -62.948 flat angles P-C4'-P energy: -30.933 tors. eta vs tors. theta energy: 2.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -371.526838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.526838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.526838 (E_RNA) where: Base-Base interactions energy: -187.309 where: short stacking energy: -104.331 Base-Backbone interact. energy: 3.569 local terms energy: -187.786907 where: bonds (distance) C4'-P energy: -51.555 bonds (distance) P-C4' energy: -55.364 flat angles C4'-P-C4' energy: -48.444 flat angles P-C4'-P energy: -32.874 tors. eta vs tors. theta energy: 0.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -244.166349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.166349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.166349 (E_RNA) where: Base-Base interactions energy: -73.796 where: short stacking energy: -56.591 Base-Backbone interact. energy: -1.752 local terms energy: -168.618703 where: bonds (distance) C4'-P energy: -65.120 bonds (distance) P-C4' energy: -40.283 flat angles C4'-P-C4' energy: -48.103 flat angles P-C4'-P energy: -26.953 tors. eta vs tors. theta energy: 11.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1009.878301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.878301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.878301 (E_RNA) where: Base-Base interactions energy: -675.292 where: short stacking energy: -290.216 Base-Backbone interact. energy: -1.957 local terms energy: -332.629696 where: bonds (distance) C4'-P energy: -68.197 bonds (distance) P-C4' energy: -59.101 flat angles C4'-P-C4' energy: -70.642 flat angles P-C4'-P energy: -46.401 tors. eta vs tors. theta energy: -88.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -999.275778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.275778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.275778 (E_RNA) where: Base-Base interactions energy: -651.826 where: short stacking energy: -272.804 Base-Backbone interact. energy: -1.038 local terms energy: -346.411599 where: bonds (distance) C4'-P energy: -58.810 bonds (distance) P-C4' energy: -69.204 flat angles C4'-P-C4' energy: -69.477 flat angles P-C4'-P energy: -47.724 tors. eta vs tors. theta energy: -101.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -965.207546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.207546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.207546 (E_RNA) where: Base-Base interactions energy: -636.963 where: short stacking energy: -286.396 Base-Backbone interact. energy: 1.244 local terms energy: -329.488594 where: bonds (distance) C4'-P energy: -64.544 bonds (distance) P-C4' energy: -57.874 flat angles C4'-P-C4' energy: -72.554 flat angles P-C4'-P energy: -48.935 tors. eta vs tors. theta energy: -85.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -909.966772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.966772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.966772 (E_RNA) where: Base-Base interactions energy: -594.861 where: short stacking energy: -261.356 Base-Backbone interact. energy: -1.368 local terms energy: -313.738197 where: bonds (distance) C4'-P energy: -64.207 bonds (distance) P-C4' energy: -63.143 flat angles C4'-P-C4' energy: -68.652 flat angles P-C4'-P energy: -36.519 tors. eta vs tors. theta energy: -81.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -849.386500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.386500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.386500 (E_RNA) where: Base-Base interactions energy: -563.752 where: short stacking energy: -222.017 Base-Backbone interact. energy: -1.937 local terms energy: -283.697720 where: bonds (distance) C4'-P energy: -56.802 bonds (distance) P-C4' energy: -51.421 flat angles C4'-P-C4' energy: -62.310 flat angles P-C4'-P energy: -42.809 tors. eta vs tors. theta energy: -70.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -560.624364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.624364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.624364 (E_RNA) where: Base-Base interactions energy: -305.291 where: short stacking energy: -171.141 Base-Backbone interact. energy: -0.756 local terms energy: -254.577365 where: bonds (distance) C4'-P energy: -41.940 bonds (distance) P-C4' energy: -67.397 flat angles C4'-P-C4' energy: -59.981 flat angles P-C4'-P energy: -39.993 tors. eta vs tors. theta energy: -45.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -435.659155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.659155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.659155 (E_RNA) where: Base-Base interactions energy: -241.224 where: short stacking energy: -135.692 Base-Backbone interact. energy: 2.558 local terms energy: -196.993081 where: bonds (distance) C4'-P energy: -45.771 bonds (distance) P-C4' energy: -49.515 flat angles C4'-P-C4' energy: -52.846 flat angles P-C4'-P energy: -31.116 tors. eta vs tors. theta energy: -17.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -410.938714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.938714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.938714 (E_RNA) where: Base-Base interactions energy: -212.449 where: short stacking energy: -126.273 Base-Backbone interact. energy: -1.099 local terms energy: -197.390809 where: bonds (distance) C4'-P energy: -47.046 bonds (distance) P-C4' energy: -49.780 flat angles C4'-P-C4' energy: -55.661 flat angles P-C4'-P energy: -34.357 tors. eta vs tors. theta energy: -10.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -276.663676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.663676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.663676 (E_RNA) where: Base-Base interactions energy: -84.060 where: short stacking energy: -63.486 Base-Backbone interact. energy: 1.388 local terms energy: -193.992076 where: bonds (distance) C4'-P energy: -53.393 bonds (distance) P-C4' energy: -60.050 flat angles C4'-P-C4' energy: -46.084 flat angles P-C4'-P energy: -40.719 tors. eta vs tors. theta energy: 6.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -243.231990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.231990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.231990 (E_RNA) where: Base-Base interactions energy: -60.547 where: short stacking energy: -46.816 Base-Backbone interact. energy: 0.956 local terms energy: -183.641014 where: bonds (distance) C4'-P energy: -59.153 bonds (distance) P-C4' energy: -60.526 flat angles C4'-P-C4' energy: -50.091 flat angles P-C4'-P energy: -28.657 tors. eta vs tors. theta energy: 14.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -982.530611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.530611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.530611 (E_RNA) where: Base-Base interactions energy: -654.181 where: short stacking energy: -260.458 Base-Backbone interact. energy: -0.991 local terms energy: -327.358883 where: bonds (distance) C4'-P energy: -63.868 bonds (distance) P-C4' energy: -75.600 flat angles C4'-P-C4' energy: -66.368 flat angles P-C4'-P energy: -41.825 tors. eta vs tors. theta energy: -79.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -965.542179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.542179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.542179 (E_RNA) where: Base-Base interactions energy: -636.476 where: short stacking energy: -273.211 Base-Backbone interact. energy: -1.167 local terms energy: -327.900019 where: bonds (distance) C4'-P energy: -59.173 bonds (distance) P-C4' energy: -69.176 flat angles C4'-P-C4' energy: -67.882 flat angles P-C4'-P energy: -38.301 tors. eta vs tors. theta energy: -93.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -964.160445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.160445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.160445 (E_RNA) where: Base-Base interactions energy: -648.077 where: short stacking energy: -282.917 Base-Backbone interact. energy: -1.365 local terms energy: -314.718422 where: bonds (distance) C4'-P energy: -53.946 bonds (distance) P-C4' energy: -60.364 flat angles C4'-P-C4' energy: -65.236 flat angles P-C4'-P energy: -49.962 tors. eta vs tors. theta energy: -85.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -900.709844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.709844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.709844 (E_RNA) where: Base-Base interactions energy: -588.660 where: short stacking energy: -263.913 Base-Backbone interact. energy: -0.771 local terms energy: -311.279647 where: bonds (distance) C4'-P energy: -54.831 bonds (distance) P-C4' energy: -60.137 flat angles C4'-P-C4' energy: -72.168 flat angles P-C4'-P energy: -39.977 tors. eta vs tors. theta energy: -84.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -804.795915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.795915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.795915 (E_RNA) where: Base-Base interactions energy: -524.130 where: short stacking energy: -207.820 Base-Backbone interact. energy: 1.185 local terms energy: -281.850968 where: bonds (distance) C4'-P energy: -64.932 bonds (distance) P-C4' energy: -57.801 flat angles C4'-P-C4' energy: -63.766 flat angles P-C4'-P energy: -34.233 tors. eta vs tors. theta energy: -61.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -519.362176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.362176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.362176 (E_RNA) where: Base-Base interactions energy: -305.496 where: short stacking energy: -135.277 Base-Backbone interact. energy: 0.969 local terms energy: -214.835849 where: bonds (distance) C4'-P energy: -57.504 bonds (distance) P-C4' energy: -54.056 flat angles C4'-P-C4' energy: -58.225 flat angles P-C4'-P energy: -28.931 tors. eta vs tors. theta energy: -16.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -450.746428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.746428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.746428 (E_RNA) where: Base-Base interactions energy: -252.689 where: short stacking energy: -127.002 Base-Backbone interact. energy: -0.390 local terms energy: -197.667718 where: bonds (distance) C4'-P energy: -49.244 bonds (distance) P-C4' energy: -46.643 flat angles C4'-P-C4' energy: -56.101 flat angles P-C4'-P energy: -29.176 tors. eta vs tors. theta energy: -16.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -396.082253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.082253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.082253 (E_RNA) where: Base-Base interactions energy: -190.206 where: short stacking energy: -118.671 Base-Backbone interact. energy: -0.653 local terms energy: -205.222558 where: bonds (distance) C4'-P energy: -44.968 bonds (distance) P-C4' energy: -60.313 flat angles C4'-P-C4' energy: -44.384 flat angles P-C4'-P energy: -30.678 tors. eta vs tors. theta energy: -24.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -274.426020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.426020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.426020 (E_RNA) where: Base-Base interactions energy: -95.079 where: short stacking energy: -68.785 Base-Backbone interact. energy: -1.120 local terms energy: -178.227120 where: bonds (distance) C4'-P energy: -53.863 bonds (distance) P-C4' energy: -63.174 flat angles C4'-P-C4' energy: -43.687 flat angles P-C4'-P energy: -28.269 tors. eta vs tors. theta energy: 10.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -246.145990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.145990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.145990 (E_RNA) where: Base-Base interactions energy: -101.951 where: short stacking energy: -81.501 Base-Backbone interact. energy: 0.480 local terms energy: -144.675828 where: bonds (distance) C4'-P energy: -34.149 bonds (distance) P-C4' energy: -54.407 flat angles C4'-P-C4' energy: -45.848 flat angles P-C4'-P energy: -23.370 tors. eta vs tors. theta energy: 13.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1016.891962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.891962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.891962 (E_RNA) where: Base-Base interactions energy: -696.046 where: short stacking energy: -299.393 Base-Backbone interact. energy: -1.691 local terms energy: -319.154402 where: bonds (distance) C4'-P energy: -66.758 bonds (distance) P-C4' energy: -58.025 flat angles C4'-P-C4' energy: -79.135 flat angles P-C4'-P energy: -30.109 tors. eta vs tors. theta energy: -85.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -973.151779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.151779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.151779 (E_RNA) where: Base-Base interactions energy: -643.551 where: short stacking energy: -296.976 Base-Backbone interact. energy: 0.411 local terms energy: -330.011601 where: bonds (distance) C4'-P energy: -61.889 bonds (distance) P-C4' energy: -58.064 flat angles C4'-P-C4' energy: -65.457 flat angles P-C4'-P energy: -46.464 tors. eta vs tors. theta energy: -98.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -944.657729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.657729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.657729 (E_RNA) where: Base-Base interactions energy: -637.222 where: short stacking energy: -280.845 Base-Backbone interact. energy: 0.989 local terms energy: -308.425102 where: bonds (distance) C4'-P energy: -56.582 bonds (distance) P-C4' energy: -51.273 flat angles C4'-P-C4' energy: -65.115 flat angles P-C4'-P energy: -42.103 tors. eta vs tors. theta energy: -93.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -862.876732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.876732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.876732 (E_RNA) where: Base-Base interactions energy: -577.428 where: short stacking energy: -251.900 Base-Backbone interact. energy: 1.005 local terms energy: -286.454001 where: bonds (distance) C4'-P energy: -57.443 bonds (distance) P-C4' energy: -49.404 flat angles C4'-P-C4' energy: -59.756 flat angles P-C4'-P energy: -34.030 tors. eta vs tors. theta energy: -85.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -827.258784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.258784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.258784 (E_RNA) where: Base-Base interactions energy: -546.289 where: short stacking energy: -220.413 Base-Backbone interact. energy: 0.737 local terms energy: -281.706793 where: bonds (distance) C4'-P energy: -53.758 bonds (distance) P-C4' energy: -52.135 flat angles C4'-P-C4' energy: -65.912 flat angles P-C4'-P energy: -38.272 tors. eta vs tors. theta energy: -71.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -533.689257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.689257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.689257 (E_RNA) where: Base-Base interactions energy: -319.966 where: short stacking energy: -164.400 Base-Backbone interact. energy: -1.061 local terms energy: -212.662808 where: bonds (distance) C4'-P energy: -46.244 bonds (distance) P-C4' energy: -56.887 flat angles C4'-P-C4' energy: -56.211 flat angles P-C4'-P energy: -18.738 tors. eta vs tors. theta energy: -34.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -424.780117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.780117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.780117 (E_RNA) where: Base-Base interactions energy: -217.989 where: short stacking energy: -122.378 Base-Backbone interact. energy: 0.350 local terms energy: -207.141369 where: bonds (distance) C4'-P energy: -43.826 bonds (distance) P-C4' energy: -60.944 flat angles C4'-P-C4' energy: -52.459 flat angles P-C4'-P energy: -36.429 tors. eta vs tors. theta energy: -13.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -406.707433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.707433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.707433 (E_RNA) where: Base-Base interactions energy: -209.671 where: short stacking energy: -128.210 Base-Backbone interact. energy: -0.648 local terms energy: -196.388345 where: bonds (distance) C4'-P energy: -50.099 bonds (distance) P-C4' energy: -52.829 flat angles C4'-P-C4' energy: -37.420 flat angles P-C4'-P energy: -29.276 tors. eta vs tors. theta energy: -26.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -302.572329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.572329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.572329 (E_RNA) where: Base-Base interactions energy: -114.687 where: short stacking energy: -88.440 Base-Backbone interact. energy: -1.498 local terms energy: -186.387214 where: bonds (distance) C4'-P energy: -63.549 bonds (distance) P-C4' energy: -61.437 flat angles C4'-P-C4' energy: -44.557 flat angles P-C4'-P energy: -27.011 tors. eta vs tors. theta energy: 10.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -268.646242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.646242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.646242 (E_RNA) where: Base-Base interactions energy: -89.521 where: short stacking energy: -76.258 Base-Backbone interact. energy: -0.266 local terms energy: -178.858828 where: bonds (distance) C4'-P energy: -55.444 bonds (distance) P-C4' energy: -53.306 flat angles C4'-P-C4' energy: -42.841 flat angles P-C4'-P energy: -27.235 tors. eta vs tors. theta energy: -0.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 5 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 11742642 moves confirmed later: 13098893 all moves confirmed: 24841535 percent of confirmed moves: 15.525959 current total energy: -926.177028 recalc. total energy: -926.177028 replica 6 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 11794560 moves confirmed later: 13113879 all moves confirmed: 24908439 percent of confirmed moves: 15.567774 current total energy: -889.662778 recalc. total energy: -889.662778 replica 8 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 17147763 moves confirmed later: 20070758 all moves confirmed: 37218521 percent of confirmed moves: 23.261576 current total energy: -930.242788 recalc. total energy: -930.242788 replica 2 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 13911085 moves confirmed later: 15893312 all moves confirmed: 29804397 percent of confirmed moves: 18.627748 current total energy: -819.843860 recalc. total energy: -819.843860 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 12601505 moves confirmed later: 14126835 all moves confirmed: 26728340 percent of confirmed moves: 16.705212 current total energy: -744.375775 recalc. total energy: -744.375775 replica 4 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 18122042 moves confirmed later: 21407578 all moves confirmed: 39529620 percent of confirmed moves: 24.706012 current total energy: -416.967181 recalc. total energy: -416.967181 replica 9 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 23982084 moves confirmed later: 29011399 all moves confirmed: 52993483 percent of confirmed moves: 33.120927 current total energy: -344.352956 recalc. total energy: -344.352956 replica 1 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 14629312 moves confirmed later: 16787101 all moves confirmed: 31416413 percent of confirmed moves: 19.635258 current total energy: -346.092661 recalc. total energy: -346.092661 replica 10 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 24467558 moves confirmed later: 29735028 all moves confirmed: 54202586 percent of confirmed moves: 33.876616 current total energy: -163.451036 recalc. total energy: -163.451036 replica 7 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 23178720 moves confirmed later: 28069211 all moves confirmed: 51247931 percent of confirmed moves: 32.029957 current total energy: -189.679558 recalc. total energy: -189.679558 out arg RESULTS//1/1-baec8c77_01 Time of doing 1600000 iterations: 3115.475 seconds