SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-ad9a3525/inputs/seq.fa: 1 curr_seq: _UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAGGAAUCGUGCAGGGGGAGAAAUCCUUGAGCCAGGGCUGCCAUAUAACCUGACAGGAACAUGCUACUGAAGUUUAUUUUACCAUUGACUGCUGCCCUCAAUCUAGAACGCUACACAAGAAAUAUUUGUUUUACUCAGCAGGUGUGCCUUAACCUCCCUAUUCAGAAAGCUCCACAUCAAUAAACAUGACACUCUGAAGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 200 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1005 n_atoms_counter: 1005 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 200.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -812.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.514652 (E_RNA) where: Base-Base interactions energy: -34.067 where: short stacking energy: -34.067 Base-Backbone interact. energy: -0.000 local terms energy: -778.447838 where: bonds (distance) C4'-P energy: -194.316 bonds (distance) P-C4' energy: -179.825 flat angles C4'-P-C4' energy: -146.845 flat angles P-C4'-P energy: -167.975 tors. eta vs tors. theta energy: -89.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -956.295323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.295323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.295323 (E_RNA) where: Base-Base interactions energy: -399.483 where: short stacking energy: -393.322 Base-Backbone interact. energy: -0.111 local terms energy: -556.700499 where: bonds (distance) C4'-P energy: -124.781 bonds (distance) P-C4' energy: -120.741 flat angles C4'-P-C4' energy: -129.673 flat angles P-C4'-P energy: -75.777 tors. eta vs tors. theta energy: -105.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -898.994009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.994009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.994009 (E_RNA) where: Base-Base interactions energy: -343.704 where: short stacking energy: -343.659 Base-Backbone interact. energy: -0.008 local terms energy: -555.282556 where: bonds (distance) C4'-P energy: -130.622 bonds (distance) P-C4' energy: -130.596 flat angles C4'-P-C4' energy: -125.737 flat angles P-C4'-P energy: -79.274 tors. eta vs tors. theta energy: -89.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -858.429988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.429988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.429988 (E_RNA) where: Base-Base interactions energy: -334.210 where: short stacking energy: -319.809 Base-Backbone interact. energy: -0.849 local terms energy: -523.370985 where: bonds (distance) C4'-P energy: -115.320 bonds (distance) P-C4' energy: -127.813 flat angles C4'-P-C4' energy: -120.564 flat angles P-C4'-P energy: -71.648 tors. eta vs tors. theta energy: -88.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -813.165742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.165742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.165742 (E_RNA) where: Base-Base interactions energy: -35.058 where: short stacking energy: -35.058 Base-Backbone interact. energy: -0.000 local terms energy: -778.107681 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.548 flat angles P-C4'-P energy: -167.901 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -813.165329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.165329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.165329 (E_RNA) where: Base-Base interactions energy: -35.057 where: short stacking energy: -35.057 Base-Backbone interact. energy: -0.000 local terms energy: -778.107681 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.548 flat angles P-C4'-P energy: -167.901 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -813.164919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.164919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.164919 (E_RNA) where: Base-Base interactions energy: -35.057 where: short stacking energy: -35.057 Base-Backbone interact. energy: -0.000 local terms energy: -778.107681 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.548 flat angles P-C4'-P energy: -167.901 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -814.842267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.842267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.842267 (E_RNA) where: Base-Base interactions energy: -56.505 where: short stacking energy: -56.505 Base-Backbone interact. energy: -0.000 local terms energy: -758.336646 where: bonds (distance) C4'-P energy: -183.855 bonds (distance) P-C4' energy: -169.514 flat angles C4'-P-C4' energy: -146.911 flat angles P-C4'-P energy: -164.522 tors. eta vs tors. theta energy: -93.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -812.913192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.913192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.913192 (E_RNA) where: Base-Base interactions energy: -35.056 where: short stacking energy: -35.056 Base-Backbone interact. energy: -0.000 local terms energy: -777.856770 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.260 flat angles P-C4'-P energy: -167.938 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -812.912787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.912787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.912787 (E_RNA) where: Base-Base interactions energy: -35.056 where: short stacking energy: -35.056 Base-Backbone interact. energy: -0.000 local terms energy: -777.856770 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.260 flat angles P-C4'-P energy: -167.938 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -812.912384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.912384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.912384 (E_RNA) where: Base-Base interactions energy: -35.055 where: short stacking energy: -35.055 Base-Backbone interact. energy: -0.000 local terms energy: -777.856770 where: bonds (distance) C4'-P energy: -194.200 bonds (distance) P-C4' energy: -179.818 flat angles C4'-P-C4' energy: -146.260 flat angles P-C4'-P energy: -167.938 tors. eta vs tors. theta energy: -89.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -984.426740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.426740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.426740 (E_RNA) where: Base-Base interactions energy: -435.993 where: short stacking energy: -431.654 Base-Backbone interact. energy: -0.453 local terms energy: -547.981518 where: bonds (distance) C4'-P energy: -120.807 bonds (distance) P-C4' energy: -118.467 flat angles C4'-P-C4' energy: -123.911 flat angles P-C4'-P energy: -82.701 tors. eta vs tors. theta energy: -102.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -920.179059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.179059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.179059 (E_RNA) where: Base-Base interactions energy: -368.910 where: short stacking energy: -324.128 Base-Backbone interact. energy: -0.775 local terms energy: -550.494302 where: bonds (distance) C4'-P energy: -125.919 bonds (distance) P-C4' energy: -136.165 flat angles C4'-P-C4' energy: -130.006 flat angles P-C4'-P energy: -80.696 tors. eta vs tors. theta energy: -77.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -873.051292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.051292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.051292 (E_RNA) where: Base-Base interactions energy: -356.959 where: short stacking energy: -339.350 Base-Backbone interact. energy: 1.313 local terms energy: -517.405017 where: bonds (distance) C4'-P energy: -111.570 bonds (distance) P-C4' energy: -129.446 flat angles C4'-P-C4' energy: -114.669 flat angles P-C4'-P energy: -81.441 tors. eta vs tors. theta energy: -80.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -762.020636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.020636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.020636 (E_RNA) where: Base-Base interactions energy: -294.709 where: short stacking energy: -267.689 Base-Backbone interact. energy: 0.152 local terms energy: -467.464087 where: bonds (distance) C4'-P energy: -114.274 bonds (distance) P-C4' energy: -124.040 flat angles C4'-P-C4' energy: -128.905 flat angles P-C4'-P energy: -68.395 tors. eta vs tors. theta energy: -31.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -741.068273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.068273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.068273 (E_RNA) where: Base-Base interactions energy: -317.883 where: short stacking energy: -254.053 Base-Backbone interact. energy: 0.300 local terms energy: -423.484500 where: bonds (distance) C4'-P energy: -110.682 bonds (distance) P-C4' energy: -111.111 flat angles C4'-P-C4' energy: -99.082 flat angles P-C4'-P energy: -62.782 tors. eta vs tors. theta energy: -39.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -673.235759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.235759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.235759 (E_RNA) where: Base-Base interactions energy: -268.779 where: short stacking energy: -258.714 Base-Backbone interact. energy: 3.062 local terms energy: -407.518951 where: bonds (distance) C4'-P energy: -112.388 bonds (distance) P-C4' energy: -86.981 flat angles C4'-P-C4' energy: -118.553 flat angles P-C4'-P energy: -59.162 tors. eta vs tors. theta energy: -30.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -592.238257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.238257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.238257 (E_RNA) where: Base-Base interactions energy: -208.025 where: short stacking energy: -195.430 Base-Backbone interact. energy: 2.417 local terms energy: -386.630520 where: bonds (distance) C4'-P energy: -107.711 bonds (distance) P-C4' energy: -114.258 flat angles C4'-P-C4' energy: -101.851 flat angles P-C4'-P energy: -49.371 tors. eta vs tors. theta energy: -13.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -570.598708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.598708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.598708 (E_RNA) where: Base-Base interactions energy: -217.433 where: short stacking energy: -173.896 Base-Backbone interact. energy: -2.321 local terms energy: -350.844718 where: bonds (distance) C4'-P energy: -96.689 bonds (distance) P-C4' energy: -109.966 flat angles C4'-P-C4' energy: -80.470 flat angles P-C4'-P energy: -63.339 tors. eta vs tors. theta energy: -0.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -513.994365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.994365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.994365 (E_RNA) where: Base-Base interactions energy: -178.531 where: short stacking energy: -146.039 Base-Backbone interact. energy: 4.606 local terms energy: -340.070109 where: bonds (distance) C4'-P energy: -107.563 bonds (distance) P-C4' energy: -112.574 flat angles C4'-P-C4' energy: -70.084 flat angles P-C4'-P energy: -54.022 tors. eta vs tors. theta energy: 4.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -509.660327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.660327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.660327 (E_RNA) where: Base-Base interactions energy: -184.084 where: short stacking energy: -168.303 Base-Backbone interact. energy: 4.229 local terms energy: -329.805020 where: bonds (distance) C4'-P energy: -91.526 bonds (distance) P-C4' energy: -98.936 flat angles C4'-P-C4' energy: -82.817 flat angles P-C4'-P energy: -58.723 tors. eta vs tors. theta energy: 2.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1009.070799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.070799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.070799 (E_RNA) where: Base-Base interactions energy: -448.867 where: short stacking energy: -430.556 Base-Backbone interact. energy: -0.441 local terms energy: -559.762819 where: bonds (distance) C4'-P energy: -120.380 bonds (distance) P-C4' energy: -120.927 flat angles C4'-P-C4' energy: -121.348 flat angles P-C4'-P energy: -85.512 tors. eta vs tors. theta energy: -111.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -991.076838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.076838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.076838 (E_RNA) where: Base-Base interactions energy: -487.153 where: short stacking energy: -401.045 Base-Backbone interact. energy: -1.340 local terms energy: -502.584244 where: bonds (distance) C4'-P energy: -117.544 bonds (distance) P-C4' energy: -112.469 flat angles C4'-P-C4' energy: -116.737 flat angles P-C4'-P energy: -83.522 tors. eta vs tors. theta energy: -72.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -937.819286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.819286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.819286 (E_RNA) where: Base-Base interactions energy: -398.746 where: short stacking energy: -334.435 Base-Backbone interact. energy: -0.853 local terms energy: -538.219941 where: bonds (distance) C4'-P energy: -129.949 bonds (distance) P-C4' energy: -132.446 flat angles C4'-P-C4' energy: -119.999 flat angles P-C4'-P energy: -77.900 tors. eta vs tors. theta energy: -77.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -820.880932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.880932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.880932 (E_RNA) where: Base-Base interactions energy: -312.994 where: short stacking energy: -285.437 Base-Backbone interact. energy: -3.098 local terms energy: -504.789252 where: bonds (distance) C4'-P energy: -120.886 bonds (distance) P-C4' energy: -131.885 flat angles C4'-P-C4' energy: -121.347 flat angles P-C4'-P energy: -69.184 tors. eta vs tors. theta energy: -61.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -746.489567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.489567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.489567 (E_RNA) where: Base-Base interactions energy: -305.543 where: short stacking energy: -273.934 Base-Backbone interact. energy: 0.091 local terms energy: -441.037778 where: bonds (distance) C4'-P energy: -101.080 bonds (distance) P-C4' energy: -112.490 flat angles C4'-P-C4' energy: -115.690 flat angles P-C4'-P energy: -66.312 tors. eta vs tors. theta energy: -45.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -654.879435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.879435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.879435 (E_RNA) where: Base-Base interactions energy: -270.480 where: short stacking energy: -231.122 Base-Backbone interact. energy: 2.800 local terms energy: -387.199986 where: bonds (distance) C4'-P energy: -101.105 bonds (distance) P-C4' energy: -99.029 flat angles C4'-P-C4' energy: -94.676 flat angles P-C4'-P energy: -64.740 tors. eta vs tors. theta energy: -27.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -724.031773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.031773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.031773 (E_RNA) where: Base-Base interactions energy: -315.152 where: short stacking energy: -226.217 Base-Backbone interact. energy: 0.043 local terms energy: -408.922595 where: bonds (distance) C4'-P energy: -107.210 bonds (distance) P-C4' energy: -110.659 flat angles C4'-P-C4' energy: -104.276 flat angles P-C4'-P energy: -70.839 tors. eta vs tors. theta energy: -15.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -576.823984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.823984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.823984 (E_RNA) where: Base-Base interactions energy: -217.232 where: short stacking energy: -192.470 Base-Backbone interact. energy: 1.576 local terms energy: -361.168328 where: bonds (distance) C4'-P energy: -108.242 bonds (distance) P-C4' energy: -107.420 flat angles C4'-P-C4' energy: -100.494 flat angles P-C4'-P energy: -45.877 tors. eta vs tors. theta energy: 0.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -519.257223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.257223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.257223 (E_RNA) where: Base-Base interactions energy: -185.960 where: short stacking energy: -128.309 Base-Backbone interact. energy: -2.086 local terms energy: -331.211535 where: bonds (distance) C4'-P energy: -106.556 bonds (distance) P-C4' energy: -118.602 flat angles C4'-P-C4' energy: -60.398 flat angles P-C4'-P energy: -68.099 tors. eta vs tors. theta energy: 22.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -500.985228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.985228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.985228 (E_RNA) where: Base-Base interactions energy: -194.007 where: short stacking energy: -150.236 Base-Backbone interact. energy: 0.318 local terms energy: -307.295760 where: bonds (distance) C4'-P energy: -89.950 bonds (distance) P-C4' energy: -102.668 flat angles C4'-P-C4' energy: -75.108 flat angles P-C4'-P energy: -36.915 tors. eta vs tors. theta energy: -2.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1087.376859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.376859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.376859 (E_RNA) where: Base-Base interactions energy: -495.119 where: short stacking energy: -481.131 Base-Backbone interact. energy: -0.249 local terms energy: -592.009157 where: bonds (distance) C4'-P energy: -134.398 bonds (distance) P-C4' energy: -123.103 flat angles C4'-P-C4' energy: -123.991 flat angles P-C4'-P energy: -82.473 tors. eta vs tors. theta energy: -128.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1012.374474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.374474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.374474 (E_RNA) where: Base-Base interactions energy: -461.400 where: short stacking energy: -377.167 Base-Backbone interact. energy: 0.744 local terms energy: -551.719184 where: bonds (distance) C4'-P energy: -120.270 bonds (distance) P-C4' energy: -132.308 flat angles C4'-P-C4' energy: -113.954 flat angles P-C4'-P energy: -88.332 tors. eta vs tors. theta energy: -96.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -993.784876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.784876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.784876 (E_RNA) where: Base-Base interactions energy: -479.827 where: short stacking energy: -330.035 Base-Backbone interact. energy: -2.030 local terms energy: -511.928391 where: bonds (distance) C4'-P energy: -126.619 bonds (distance) P-C4' energy: -124.688 flat angles C4'-P-C4' energy: -125.817 flat angles P-C4'-P energy: -66.439 tors. eta vs tors. theta energy: -68.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -827.633056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.633056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.633056 (E_RNA) where: Base-Base interactions energy: -340.133 where: short stacking energy: -290.394 Base-Backbone interact. energy: -2.098 local terms energy: -485.402199 where: bonds (distance) C4'-P energy: -124.386 bonds (distance) P-C4' energy: -104.590 flat angles C4'-P-C4' energy: -114.801 flat angles P-C4'-P energy: -73.378 tors. eta vs tors. theta energy: -68.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -732.885990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.885990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.885990 (E_RNA) where: Base-Base interactions energy: -267.152 where: short stacking energy: -227.360 Base-Backbone interact. energy: -2.523 local terms energy: -463.211146 where: bonds (distance) C4'-P energy: -121.375 bonds (distance) P-C4' energy: -133.506 flat angles C4'-P-C4' energy: -124.385 flat angles P-C4'-P energy: -75.285 tors. eta vs tors. theta energy: -8.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -729.838184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.838184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.838184 (E_RNA) where: Base-Base interactions energy: -328.796 where: short stacking energy: -221.507 Base-Backbone interact. energy: 0.061 local terms energy: -401.103586 where: bonds (distance) C4'-P energy: -109.353 bonds (distance) P-C4' energy: -122.673 flat angles C4'-P-C4' energy: -96.199 flat angles P-C4'-P energy: -64.587 tors. eta vs tors. theta energy: -8.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -618.034842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.034842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.034842 (E_RNA) where: Base-Base interactions energy: -248.659 where: short stacking energy: -191.100 Base-Backbone interact. energy: -3.500 local terms energy: -365.875469 where: bonds (distance) C4'-P energy: -104.510 bonds (distance) P-C4' energy: -101.129 flat angles C4'-P-C4' energy: -108.220 flat angles P-C4'-P energy: -62.133 tors. eta vs tors. theta energy: 10.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -552.125608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.125608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.125608 (E_RNA) where: Base-Base interactions energy: -182.524 where: short stacking energy: -168.845 Base-Backbone interact. energy: 2.473 local terms energy: -372.074498 where: bonds (distance) C4'-P energy: -98.171 bonds (distance) P-C4' energy: -118.875 flat angles C4'-P-C4' energy: -97.985 flat angles P-C4'-P energy: -47.399 tors. eta vs tors. theta energy: -9.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -500.042436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.042436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.042436 (E_RNA) where: Base-Base interactions energy: -161.098 where: short stacking energy: -143.274 Base-Backbone interact. energy: 0.101 local terms energy: -339.045752 where: bonds (distance) C4'-P energy: -110.093 bonds (distance) P-C4' energy: -89.665 flat angles C4'-P-C4' energy: -87.139 flat angles P-C4'-P energy: -67.028 tors. eta vs tors. theta energy: 14.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -458.364457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.364457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.364457 (E_RNA) where: Base-Base interactions energy: -128.451 where: short stacking energy: -105.641 Base-Backbone interact. energy: 3.270 local terms energy: -333.182776 where: bonds (distance) C4'-P energy: -104.623 bonds (distance) P-C4' energy: -106.515 flat angles C4'-P-C4' energy: -91.587 flat angles P-C4'-P energy: -66.777 tors. eta vs tors. theta energy: 36.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1169.458373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.458373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.458373 (E_RNA) where: Base-Base interactions energy: -557.566 where: short stacking energy: -458.404 Base-Backbone interact. energy: -2.093 local terms energy: -609.799471 where: bonds (distance) C4'-P energy: -125.758 bonds (distance) P-C4' energy: -130.410 flat angles C4'-P-C4' energy: -136.905 flat angles P-C4'-P energy: -95.917 tors. eta vs tors. theta energy: -120.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1007.259612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.259612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.259612 (E_RNA) where: Base-Base interactions energy: -476.729 where: short stacking energy: -373.915 Base-Backbone interact. energy: 0.445 local terms energy: -530.976038 where: bonds (distance) C4'-P energy: -119.748 bonds (distance) P-C4' energy: -111.902 flat angles C4'-P-C4' energy: -136.348 flat angles P-C4'-P energy: -79.506 tors. eta vs tors. theta energy: -83.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1035.252444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.252444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.252444 (E_RNA) where: Base-Base interactions energy: -550.029 where: short stacking energy: -357.834 Base-Backbone interact. energy: -0.934 local terms energy: -484.290004 where: bonds (distance) C4'-P energy: -122.061 bonds (distance) P-C4' energy: -111.271 flat angles C4'-P-C4' energy: -114.451 flat angles P-C4'-P energy: -63.180 tors. eta vs tors. theta energy: -73.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -843.605934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.605934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.605934 (E_RNA) where: Base-Base interactions energy: -370.473 where: short stacking energy: -296.837 Base-Backbone interact. energy: 0.973 local terms energy: -474.106806 where: bonds (distance) C4'-P energy: -112.179 bonds (distance) P-C4' energy: -119.871 flat angles C4'-P-C4' energy: -112.917 flat angles P-C4'-P energy: -82.698 tors. eta vs tors. theta energy: -46.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -839.161905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.161905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.161905 (E_RNA) where: Base-Base interactions energy: -386.023 where: short stacking energy: -282.747 Base-Backbone interact. energy: -2.027 local terms energy: -451.111323 where: bonds (distance) C4'-P energy: -92.041 bonds (distance) P-C4' energy: -130.942 flat angles C4'-P-C4' energy: -109.612 flat angles P-C4'-P energy: -62.489 tors. eta vs tors. theta energy: -56.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -697.307658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.307658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.307658 (E_RNA) where: Base-Base interactions energy: -276.308 where: short stacking energy: -206.493 Base-Backbone interact. energy: 1.985 local terms energy: -422.984862 where: bonds (distance) C4'-P energy: -119.416 bonds (distance) P-C4' energy: -127.175 flat angles C4'-P-C4' energy: -91.304 flat angles P-C4'-P energy: -68.365 tors. eta vs tors. theta energy: -16.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -644.514249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.514249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.514249 (E_RNA) where: Base-Base interactions energy: -255.790 where: short stacking energy: -221.979 Base-Backbone interact. energy: -1.365 local terms energy: -387.358861 where: bonds (distance) C4'-P energy: -101.535 bonds (distance) P-C4' energy: -108.071 flat angles C4'-P-C4' energy: -78.281 flat angles P-C4'-P energy: -68.445 tors. eta vs tors. theta energy: -31.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -586.570795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.570795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.570795 (E_RNA) where: Base-Base interactions energy: -247.905 where: short stacking energy: -163.558 Base-Backbone interact. energy: 1.216 local terms energy: -339.881730 where: bonds (distance) C4'-P energy: -98.485 bonds (distance) P-C4' energy: -97.924 flat angles C4'-P-C4' energy: -77.952 flat angles P-C4'-P energy: -64.016 tors. eta vs tors. theta energy: -1.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -505.338789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.338789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.338789 (E_RNA) where: Base-Base interactions energy: -198.782 where: short stacking energy: -154.346 Base-Backbone interact. energy: 5.350 local terms energy: -311.907507 where: bonds (distance) C4'-P energy: -100.195 bonds (distance) P-C4' energy: -89.519 flat angles C4'-P-C4' energy: -90.645 flat angles P-C4'-P energy: -56.390 tors. eta vs tors. theta energy: 24.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -475.799939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.799939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.799939 (E_RNA) where: Base-Base interactions energy: -192.525 where: short stacking energy: -117.462 Base-Backbone interact. energy: -3.955 local terms energy: -279.319868 where: bonds (distance) C4'-P energy: -107.369 bonds (distance) P-C4' energy: -98.357 flat angles C4'-P-C4' energy: -82.331 flat angles P-C4'-P energy: -41.544 tors. eta vs tors. theta energy: 50.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1189.630950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.630950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1189.630950 (E_RNA) where: Base-Base interactions energy: -594.999 where: short stacking energy: -455.917 Base-Backbone interact. energy: -1.139 local terms energy: -593.492298 where: bonds (distance) C4'-P energy: -106.987 bonds (distance) P-C4' energy: -130.250 flat angles C4'-P-C4' energy: -143.500 flat angles P-C4'-P energy: -81.061 tors. eta vs tors. theta energy: -131.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1166.015286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.015286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.015286 (E_RNA) where: Base-Base interactions energy: -636.115 where: short stacking energy: -396.872 Base-Backbone interact. energy: 0.992 local terms energy: -530.891949 where: bonds (distance) C4'-P energy: -121.164 bonds (distance) P-C4' energy: -117.962 flat angles C4'-P-C4' energy: -131.364 flat angles P-C4'-P energy: -78.268 tors. eta vs tors. theta energy: -82.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -992.826630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.826630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.826630 (E_RNA) where: Base-Base interactions energy: -501.712 where: short stacking energy: -358.322 Base-Backbone interact. energy: -0.481 local terms energy: -490.633696 where: bonds (distance) C4'-P energy: -116.113 bonds (distance) P-C4' energy: -131.555 flat angles C4'-P-C4' energy: -101.101 flat angles P-C4'-P energy: -62.041 tors. eta vs tors. theta energy: -79.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -997.937341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.937341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.937341 (E_RNA) where: Base-Base interactions energy: -484.509 where: short stacking energy: -337.642 Base-Backbone interact. energy: -0.716 local terms energy: -512.712325 where: bonds (distance) C4'-P energy: -103.199 bonds (distance) P-C4' energy: -123.193 flat angles C4'-P-C4' energy: -135.847 flat angles P-C4'-P energy: -77.289 tors. eta vs tors. theta energy: -73.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -796.093672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.093672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.093672 (E_RNA) where: Base-Base interactions energy: -312.630 where: short stacking energy: -253.522 Base-Backbone interact. energy: -0.837 local terms energy: -482.626503 where: bonds (distance) C4'-P energy: -114.195 bonds (distance) P-C4' energy: -127.156 flat angles C4'-P-C4' energy: -130.484 flat angles P-C4'-P energy: -62.040 tors. eta vs tors. theta energy: -48.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -769.257461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.257461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.257461 (E_RNA) where: Base-Base interactions energy: -359.520 where: short stacking energy: -244.456 Base-Backbone interact. energy: 4.748 local terms energy: -414.485323 where: bonds (distance) C4'-P energy: -107.911 bonds (distance) P-C4' energy: -118.493 flat angles C4'-P-C4' energy: -85.787 flat angles P-C4'-P energy: -66.523 tors. eta vs tors. theta energy: -35.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -607.307868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.307868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.307868 (E_RNA) where: Base-Base interactions energy: -222.764 where: short stacking energy: -176.034 Base-Backbone interact. energy: 3.714 local terms energy: -388.257887 where: bonds (distance) C4'-P energy: -107.818 bonds (distance) P-C4' energy: -115.273 flat angles C4'-P-C4' energy: -85.499 flat angles P-C4'-P energy: -72.901 tors. eta vs tors. theta energy: -6.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -607.104628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.104628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.104628 (E_RNA) where: Base-Base interactions energy: -245.587 where: short stacking energy: -181.353 Base-Backbone interact. energy: 5.714 local terms energy: -367.231111 where: bonds (distance) C4'-P energy: -98.220 bonds (distance) P-C4' energy: -108.637 flat angles C4'-P-C4' energy: -97.028 flat angles P-C4'-P energy: -58.656 tors. eta vs tors. theta energy: -4.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -573.255349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.255349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.255349 (E_RNA) where: Base-Base interactions energy: -225.085 where: short stacking energy: -160.266 Base-Backbone interact. energy: 7.068 local terms energy: -355.238589 where: bonds (distance) C4'-P energy: -84.116 bonds (distance) P-C4' energy: -113.319 flat angles C4'-P-C4' energy: -92.410 flat angles P-C4'-P energy: -62.840 tors. eta vs tors. theta energy: -2.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -502.666521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.666521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.666521 (E_RNA) where: Base-Base interactions energy: -183.180 where: short stacking energy: -119.546 Base-Backbone interact. energy: -1.301 local terms energy: -318.186244 where: bonds (distance) C4'-P energy: -100.803 bonds (distance) P-C4' energy: -92.265 flat angles C4'-P-C4' energy: -86.101 flat angles P-C4'-P energy: -57.740 tors. eta vs tors. theta energy: 18.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1288.102032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.102032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.102032 (E_RNA) where: Base-Base interactions energy: -705.860 where: short stacking energy: -460.273 Base-Backbone interact. energy: -1.984 local terms energy: -580.257797 where: bonds (distance) C4'-P energy: -126.990 bonds (distance) P-C4' energy: -134.754 flat angles C4'-P-C4' energy: -129.974 flat angles P-C4'-P energy: -74.301 tors. eta vs tors. theta energy: -114.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1115.436228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.436228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.436228 (E_RNA) where: Base-Base interactions energy: -569.610 where: short stacking energy: -433.163 Base-Backbone interact. energy: -2.542 local terms energy: -543.284159 where: bonds (distance) C4'-P energy: -116.288 bonds (distance) P-C4' energy: -125.654 flat angles C4'-P-C4' energy: -117.156 flat angles P-C4'-P energy: -87.568 tors. eta vs tors. theta energy: -96.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -948.474768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.474768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.474768 (E_RNA) where: Base-Base interactions energy: -456.009 where: short stacking energy: -308.277 Base-Backbone interact. energy: -2.161 local terms energy: -490.304194 where: bonds (distance) C4'-P energy: -117.040 bonds (distance) P-C4' energy: -128.919 flat angles C4'-P-C4' energy: -127.076 flat angles P-C4'-P energy: -74.551 tors. eta vs tors. theta energy: -42.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1020.851363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.851363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.851363 (E_RNA) where: Base-Base interactions energy: -534.267 where: short stacking energy: -307.783 Base-Backbone interact. energy: 1.019 local terms energy: -487.602836 where: bonds (distance) C4'-P energy: -109.893 bonds (distance) P-C4' energy: -117.147 flat angles C4'-P-C4' energy: -114.637 flat angles P-C4'-P energy: -71.988 tors. eta vs tors. theta energy: -73.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -884.326686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.326686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.326686 (E_RNA) where: Base-Base interactions energy: -463.444 where: short stacking energy: -313.427 Base-Backbone interact. energy: 0.553 local terms energy: -421.435268 where: bonds (distance) C4'-P energy: -94.272 bonds (distance) P-C4' energy: -107.817 flat angles C4'-P-C4' energy: -111.624 flat angles P-C4'-P energy: -78.172 tors. eta vs tors. theta energy: -29.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -682.290529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.290529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.290529 (E_RNA) where: Base-Base interactions energy: -274.331 where: short stacking energy: -229.356 Base-Backbone interact. energy: -0.304 local terms energy: -407.656014 where: bonds (distance) C4'-P energy: -112.235 bonds (distance) P-C4' energy: -116.791 flat angles C4'-P-C4' energy: -88.165 flat angles P-C4'-P energy: -69.846 tors. eta vs tors. theta energy: -20.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -604.064633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.064633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.064633 (E_RNA) where: Base-Base interactions energy: -256.235 where: short stacking energy: -196.899 Base-Backbone interact. energy: 2.901 local terms energy: -350.730797 where: bonds (distance) C4'-P energy: -110.547 bonds (distance) P-C4' energy: -109.085 flat angles C4'-P-C4' energy: -81.534 flat angles P-C4'-P energy: -51.638 tors. eta vs tors. theta energy: 2.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -586.445087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.445087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.445087 (E_RNA) where: Base-Base interactions energy: -257.538 where: short stacking energy: -182.253 Base-Backbone interact. energy: 0.145 local terms energy: -329.052135 where: bonds (distance) C4'-P energy: -82.111 bonds (distance) P-C4' energy: -106.541 flat angles C4'-P-C4' energy: -98.513 flat angles P-C4'-P energy: -40.184 tors. eta vs tors. theta energy: -1.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -567.597702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.597702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.597702 (E_RNA) where: Base-Base interactions energy: -256.734 where: short stacking energy: -196.473 Base-Backbone interact. energy: 13.068 local terms energy: -323.931733 where: bonds (distance) C4'-P energy: -81.034 bonds (distance) P-C4' energy: -106.684 flat angles C4'-P-C4' energy: -105.493 flat angles P-C4'-P energy: -32.365 tors. eta vs tors. theta energy: 1.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -462.314219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.314219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.314219 (E_RNA) where: Base-Base interactions energy: -157.998 where: short stacking energy: -118.495 Base-Backbone interact. energy: -3.113 local terms energy: -301.203992 where: bonds (distance) C4'-P energy: -106.154 bonds (distance) P-C4' energy: -96.182 flat angles C4'-P-C4' energy: -83.336 flat angles P-C4'-P energy: -49.783 tors. eta vs tors. theta energy: 34.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1289.573880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.573880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.573880 (E_RNA) where: Base-Base interactions energy: -693.407 where: short stacking energy: -442.512 Base-Backbone interact. energy: -4.293 local terms energy: -591.873486 where: bonds (distance) C4'-P energy: -129.535 bonds (distance) P-C4' energy: -142.571 flat angles C4'-P-C4' energy: -136.247 flat angles P-C4'-P energy: -82.489 tors. eta vs tors. theta energy: -101.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1190.729727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.729727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.729727 (E_RNA) where: Base-Base interactions energy: -642.165 where: short stacking energy: -407.413 Base-Backbone interact. energy: -2.399 local terms energy: -546.165649 where: bonds (distance) C4'-P energy: -117.130 bonds (distance) P-C4' energy: -118.280 flat angles C4'-P-C4' energy: -127.320 flat angles P-C4'-P energy: -82.567 tors. eta vs tors. theta energy: -100.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1052.383976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.383976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.383976 (E_RNA) where: Base-Base interactions energy: -533.635 where: short stacking energy: -355.275 Base-Backbone interact. energy: -2.275 local terms energy: -516.473761 where: bonds (distance) C4'-P energy: -125.011 bonds (distance) P-C4' energy: -130.906 flat angles C4'-P-C4' energy: -109.339 flat angles P-C4'-P energy: -79.853 tors. eta vs tors. theta energy: -71.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1064.227932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.227932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.227932 (E_RNA) where: Base-Base interactions energy: -597.156 where: short stacking energy: -347.790 Base-Backbone interact. energy: -4.073 local terms energy: -462.998937 where: bonds (distance) C4'-P energy: -99.130 bonds (distance) P-C4' energy: -113.196 flat angles C4'-P-C4' energy: -110.751 flat angles P-C4'-P energy: -68.955 tors. eta vs tors. theta energy: -70.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -921.802896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.802896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.802896 (E_RNA) where: Base-Base interactions energy: -458.355 where: short stacking energy: -267.489 Base-Backbone interact. energy: -0.836 local terms energy: -462.612486 where: bonds (distance) C4'-P energy: -111.839 bonds (distance) P-C4' energy: -112.382 flat angles C4'-P-C4' energy: -111.003 flat angles P-C4'-P energy: -78.628 tors. eta vs tors. theta energy: -48.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -766.105285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.105285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.105285 (E_RNA) where: Base-Base interactions energy: -357.493 where: short stacking energy: -241.091 Base-Backbone interact. energy: -3.490 local terms energy: -405.122194 where: bonds (distance) C4'-P energy: -97.961 bonds (distance) P-C4' energy: -117.243 flat angles C4'-P-C4' energy: -92.100 flat angles P-C4'-P energy: -80.541 tors. eta vs tors. theta energy: -17.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -609.414047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.414047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.414047 (E_RNA) where: Base-Base interactions energy: -224.174 where: short stacking energy: -193.901 Base-Backbone interact. energy: -0.895 local terms energy: -384.345338 where: bonds (distance) C4'-P energy: -119.012 bonds (distance) P-C4' energy: -121.024 flat angles C4'-P-C4' energy: -90.940 flat angles P-C4'-P energy: -52.673 tors. eta vs tors. theta energy: -0.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -643.082819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.082819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.082819 (E_RNA) where: Base-Base interactions energy: -279.373 where: short stacking energy: -194.143 Base-Backbone interact. energy: 0.548 local terms energy: -364.257270 where: bonds (distance) C4'-P energy: -105.326 bonds (distance) P-C4' energy: -110.036 flat angles C4'-P-C4' energy: -87.629 flat angles P-C4'-P energy: -51.199 tors. eta vs tors. theta energy: -10.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -529.332539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.332539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.332539 (E_RNA) where: Base-Base interactions energy: -220.510 where: short stacking energy: -178.087 Base-Backbone interact. energy: 7.996 local terms energy: -316.818831 where: bonds (distance) C4'-P energy: -100.505 bonds (distance) P-C4' energy: -106.438 flat angles C4'-P-C4' energy: -74.627 flat angles P-C4'-P energy: -37.647 tors. eta vs tors. theta energy: 2.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -469.367218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.367218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.367218 (E_RNA) where: Base-Base interactions energy: -159.154 where: short stacking energy: -137.686 Base-Backbone interact. energy: -2.954 local terms energy: -307.259075 where: bonds (distance) C4'-P energy: -101.309 bonds (distance) P-C4' energy: -114.635 flat angles C4'-P-C4' energy: -79.180 flat angles P-C4'-P energy: -41.036 tors. eta vs tors. theta energy: 28.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1343.070171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.070171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.070171 (E_RNA) where: Base-Base interactions energy: -753.807 where: short stacking energy: -448.037 Base-Backbone interact. energy: -4.052 local terms energy: -585.210722 where: bonds (distance) C4'-P energy: -123.899 bonds (distance) P-C4' energy: -122.669 flat angles C4'-P-C4' energy: -129.515 flat angles P-C4'-P energy: -82.352 tors. eta vs tors. theta energy: -126.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1211.356727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.356727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.356727 (E_RNA) where: Base-Base interactions energy: -662.271 where: short stacking energy: -431.186 Base-Backbone interact. energy: 0.070 local terms energy: -549.155255 where: bonds (distance) C4'-P energy: -121.190 bonds (distance) P-C4' energy: -128.401 flat angles C4'-P-C4' energy: -124.020 flat angles P-C4'-P energy: -74.252 tors. eta vs tors. theta energy: -101.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1077.013319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.013319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.013319 (E_RNA) where: Base-Base interactions energy: -570.209 where: short stacking energy: -328.535 Base-Backbone interact. energy: -0.741 local terms energy: -506.063617 where: bonds (distance) C4'-P energy: -119.281 bonds (distance) P-C4' energy: -129.347 flat angles C4'-P-C4' energy: -115.881 flat angles P-C4'-P energy: -76.083 tors. eta vs tors. theta energy: -65.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1089.579118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.579118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.579118 (E_RNA) where: Base-Base interactions energy: -621.304 where: short stacking energy: -363.115 Base-Backbone interact. energy: 0.461 local terms energy: -468.736255 where: bonds (distance) C4'-P energy: -117.023 bonds (distance) P-C4' energy: -92.767 flat angles C4'-P-C4' energy: -122.106 flat angles P-C4'-P energy: -69.989 tors. eta vs tors. theta energy: -66.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -945.671253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.671253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.671253 (E_RNA) where: Base-Base interactions energy: -519.975 where: short stacking energy: -306.332 Base-Backbone interact. energy: 4.052 local terms energy: -429.748622 where: bonds (distance) C4'-P energy: -97.061 bonds (distance) P-C4' energy: -115.234 flat angles C4'-P-C4' energy: -91.189 flat angles P-C4'-P energy: -77.447 tors. eta vs tors. theta energy: -48.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -762.593443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.593443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.593443 (E_RNA) where: Base-Base interactions energy: -356.475 where: short stacking energy: -242.272 Base-Backbone interact. energy: -0.566 local terms energy: -405.552058 where: bonds (distance) C4'-P energy: -116.106 bonds (distance) P-C4' energy: -91.596 flat angles C4'-P-C4' energy: -102.531 flat angles P-C4'-P energy: -68.718 tors. eta vs tors. theta energy: -26.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -671.588221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.588221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.588221 (E_RNA) where: Base-Base interactions energy: -275.588 where: short stacking energy: -186.959 Base-Backbone interact. energy: -2.323 local terms energy: -393.677527 where: bonds (distance) C4'-P energy: -116.540 bonds (distance) P-C4' energy: -116.967 flat angles C4'-P-C4' energy: -98.435 flat angles P-C4'-P energy: -63.737 tors. eta vs tors. theta energy: 2.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -566.226424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.226424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.226424 (E_RNA) where: Base-Base interactions energy: -226.616 where: short stacking energy: -189.016 Base-Backbone interact. energy: 6.026 local terms energy: -345.636820 where: bonds (distance) C4'-P energy: -100.859 bonds (distance) P-C4' energy: -104.355 flat angles C4'-P-C4' energy: -93.726 flat angles P-C4'-P energy: -52.967 tors. eta vs tors. theta energy: 6.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -537.275129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.275129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.275129 (E_RNA) where: Base-Base interactions energy: -200.834 where: short stacking energy: -167.793 Base-Backbone interact. energy: 0.108 local terms energy: -336.549036 where: bonds (distance) C4'-P energy: -92.038 bonds (distance) P-C4' energy: -101.589 flat angles C4'-P-C4' energy: -93.619 flat angles P-C4'-P energy: -54.246 tors. eta vs tors. theta energy: 4.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -457.026111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.026111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.026111 (E_RNA) where: Base-Base interactions energy: -161.584 where: short stacking energy: -124.402 Base-Backbone interact. energy: 6.430 local terms energy: -301.871406 where: bonds (distance) C4'-P energy: -119.260 bonds (distance) P-C4' energy: -109.388 flat angles C4'-P-C4' energy: -64.861 flat angles P-C4'-P energy: -34.297 tors. eta vs tors. theta energy: 25.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1322.699055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.699055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.699055 (E_RNA) where: Base-Base interactions energy: -737.789 where: short stacking energy: -455.300 Base-Backbone interact. energy: -0.839 local terms energy: -584.071423 where: bonds (distance) C4'-P energy: -121.592 bonds (distance) P-C4' energy: -121.469 flat angles C4'-P-C4' energy: -127.591 flat angles P-C4'-P energy: -87.740 tors. eta vs tors. theta energy: -125.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1232.933573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.933573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.933573 (E_RNA) where: Base-Base interactions energy: -675.249 where: short stacking energy: -433.399 Base-Backbone interact. energy: -2.206 local terms energy: -555.478496 where: bonds (distance) C4'-P energy: -125.945 bonds (distance) P-C4' energy: -128.526 flat angles C4'-P-C4' energy: -114.216 flat angles P-C4'-P energy: -66.689 tors. eta vs tors. theta energy: -120.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1126.198686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.198686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.198686 (E_RNA) where: Base-Base interactions energy: -643.963 where: short stacking energy: -350.279 Base-Backbone interact. energy: -0.591 local terms energy: -481.645320 where: bonds (distance) C4'-P energy: -125.634 bonds (distance) P-C4' energy: -107.774 flat angles C4'-P-C4' energy: -110.019 flat angles P-C4'-P energy: -80.480 tors. eta vs tors. theta energy: -57.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1044.088740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.088740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.088740 (E_RNA) where: Base-Base interactions energy: -558.190 where: short stacking energy: -319.831 Base-Backbone interact. energy: 1.073 local terms energy: -486.971413 where: bonds (distance) C4'-P energy: -117.460 bonds (distance) P-C4' energy: -120.585 flat angles C4'-P-C4' energy: -118.135 flat angles P-C4'-P energy: -83.627 tors. eta vs tors. theta energy: -47.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1028.961422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.961422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.961422 (E_RNA) where: Base-Base interactions energy: -548.190 where: short stacking energy: -300.062 Base-Backbone interact. energy: -1.201 local terms energy: -479.570557 where: bonds (distance) C4'-P energy: -129.082 bonds (distance) P-C4' energy: -111.754 flat angles C4'-P-C4' energy: -96.562 flat angles P-C4'-P energy: -71.626 tors. eta vs tors. theta energy: -70.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -803.063135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.063135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.063135 (E_RNA) where: Base-Base interactions energy: -382.387 where: short stacking energy: -236.723 Base-Backbone interact. energy: 3.160 local terms energy: -423.836254 where: bonds (distance) C4'-P energy: -110.343 bonds (distance) P-C4' energy: -119.197 flat angles C4'-P-C4' energy: -112.038 flat angles P-C4'-P energy: -55.526 tors. eta vs tors. theta energy: -26.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -703.145242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.145242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.145242 (E_RNA) where: Base-Base interactions energy: -286.225 where: short stacking energy: -240.179 Base-Backbone interact. energy: 0.486 local terms energy: -417.405590 where: bonds (distance) C4'-P energy: -105.069 bonds (distance) P-C4' energy: -112.866 flat angles C4'-P-C4' energy: -101.572 flat angles P-C4'-P energy: -63.958 tors. eta vs tors. theta energy: -33.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -604.327212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.327212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.327212 (E_RNA) where: Base-Base interactions energy: -221.888 where: short stacking energy: -150.165 Base-Backbone interact. energy: -5.312 local terms energy: -377.127244 where: bonds (distance) C4'-P energy: -97.110 bonds (distance) P-C4' energy: -121.944 flat angles C4'-P-C4' energy: -101.643 flat angles P-C4'-P energy: -47.049 tors. eta vs tors. theta energy: -9.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -570.277966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.277966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.277966 (E_RNA) where: Base-Base interactions energy: -250.071 where: short stacking energy: -150.209 Base-Backbone interact. energy: -1.144 local terms energy: -319.062686 where: bonds (distance) C4'-P energy: -95.546 bonds (distance) P-C4' energy: -107.229 flat angles C4'-P-C4' energy: -82.698 flat angles P-C4'-P energy: -49.363 tors. eta vs tors. theta energy: 15.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -517.471961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.471961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.471961 (E_RNA) where: Base-Base interactions energy: -194.421 where: short stacking energy: -154.944 Base-Backbone interact. energy: 1.054 local terms energy: -324.105592 where: bonds (distance) C4'-P energy: -99.832 bonds (distance) P-C4' energy: -100.494 flat angles C4'-P-C4' energy: -87.667 flat angles P-C4'-P energy: -36.599 tors. eta vs tors. theta energy: 0.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1317.885546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.885546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.885546 (E_RNA) where: Base-Base interactions energy: -761.680 where: short stacking energy: -454.288 Base-Backbone interact. energy: -0.710 local terms energy: -555.494648 where: bonds (distance) C4'-P energy: -118.276 bonds (distance) P-C4' energy: -125.500 flat angles C4'-P-C4' energy: -131.392 flat angles P-C4'-P energy: -71.359 tors. eta vs tors. theta energy: -108.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1267.649018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.649018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.649018 (E_RNA) where: Base-Base interactions energy: -747.618 where: short stacking energy: -411.340 Base-Backbone interact. energy: -2.727 local terms energy: -517.303869 where: bonds (distance) C4'-P energy: -125.207 bonds (distance) P-C4' energy: -120.895 flat angles C4'-P-C4' energy: -117.229 flat angles P-C4'-P energy: -75.072 tors. eta vs tors. theta energy: -78.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1204.128214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.128214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.128214 (E_RNA) where: Base-Base interactions energy: -660.445 where: short stacking energy: -385.107 Base-Backbone interact. energy: -1.201 local terms energy: -542.481653 where: bonds (distance) C4'-P energy: -108.223 bonds (distance) P-C4' energy: -124.295 flat angles C4'-P-C4' energy: -136.672 flat angles P-C4'-P energy: -82.116 tors. eta vs tors. theta energy: -91.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1135.680962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.680962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.680962 (E_RNA) where: Base-Base interactions energy: -616.998 where: short stacking energy: -359.360 Base-Backbone interact. energy: 0.756 local terms energy: -519.439593 where: bonds (distance) C4'-P energy: -123.789 bonds (distance) P-C4' energy: -112.583 flat angles C4'-P-C4' energy: -116.071 flat angles P-C4'-P energy: -71.469 tors. eta vs tors. theta energy: -95.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1086.216828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.216828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.216828 (E_RNA) where: Base-Base interactions energy: -618.959 where: short stacking energy: -341.725 Base-Backbone interact. energy: 1.237 local terms energy: -468.494456 where: bonds (distance) C4'-P energy: -100.539 bonds (distance) P-C4' energy: -120.865 flat angles C4'-P-C4' energy: -115.111 flat angles P-C4'-P energy: -59.579 tors. eta vs tors. theta energy: -72.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -923.080746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.080746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.080746 (E_RNA) where: Base-Base interactions energy: -478.220 where: short stacking energy: -283.383 Base-Backbone interact. energy: 3.018 local terms energy: -447.879323 where: bonds (distance) C4'-P energy: -109.286 bonds (distance) P-C4' energy: -124.794 flat angles C4'-P-C4' energy: -100.507 flat angles P-C4'-P energy: -68.007 tors. eta vs tors. theta energy: -45.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -654.545239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.545239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.545239 (E_RNA) where: Base-Base interactions energy: -278.290 where: short stacking energy: -195.440 Base-Backbone interact. energy: 7.075 local terms energy: -383.329912 where: bonds (distance) C4'-P energy: -119.518 bonds (distance) P-C4' energy: -103.420 flat angles C4'-P-C4' energy: -88.678 flat angles P-C4'-P energy: -65.272 tors. eta vs tors. theta energy: -6.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -613.562937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.562937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.562937 (E_RNA) where: Base-Base interactions energy: -256.889 where: short stacking energy: -178.761 Base-Backbone interact. energy: 1.631 local terms energy: -358.305188 where: bonds (distance) C4'-P energy: -105.983 bonds (distance) P-C4' energy: -113.506 flat angles C4'-P-C4' energy: -97.749 flat angles P-C4'-P energy: -60.838 tors. eta vs tors. theta energy: 19.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -567.554662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.554662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.554662 (E_RNA) where: Base-Base interactions energy: -283.404 where: short stacking energy: -200.434 Base-Backbone interact. energy: -2.034 local terms energy: -282.117100 where: bonds (distance) C4'-P energy: -84.496 bonds (distance) P-C4' energy: -108.910 flat angles C4'-P-C4' energy: -77.624 flat angles P-C4'-P energy: -18.219 tors. eta vs tors. theta energy: 7.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -554.763128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.763128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.763128 (E_RNA) where: Base-Base interactions energy: -232.370 where: short stacking energy: -155.135 Base-Backbone interact. energy: -0.898 local terms energy: -321.494894 where: bonds (distance) C4'-P energy: -98.881 bonds (distance) P-C4' energy: -99.915 flat angles C4'-P-C4' energy: -76.745 flat angles P-C4'-P energy: -49.168 tors. eta vs tors. theta energy: 3.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1298.329977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.329977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.329977 (E_RNA) where: Base-Base interactions energy: -718.712 where: short stacking energy: -417.208 Base-Backbone interact. energy: -0.369 local terms energy: -579.248566 where: bonds (distance) C4'-P energy: -120.778 bonds (distance) P-C4' energy: -121.445 flat angles C4'-P-C4' energy: -134.983 flat angles P-C4'-P energy: -97.421 tors. eta vs tors. theta energy: -104.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1266.760993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.760993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.760993 (E_RNA) where: Base-Base interactions energy: -739.427 where: short stacking energy: -398.210 Base-Backbone interact. energy: -6.643 local terms energy: -520.690689 where: bonds (distance) C4'-P energy: -111.375 bonds (distance) P-C4' energy: -115.402 flat angles C4'-P-C4' energy: -124.742 flat angles P-C4'-P energy: -79.667 tors. eta vs tors. theta energy: -89.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1216.087156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.087156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.087156 (E_RNA) where: Base-Base interactions energy: -680.389 where: short stacking energy: -380.081 Base-Backbone interact. energy: -2.138 local terms energy: -533.560533 where: bonds (distance) C4'-P energy: -128.397 bonds (distance) P-C4' energy: -118.369 flat angles C4'-P-C4' energy: -121.533 flat angles P-C4'-P energy: -76.766 tors. eta vs tors. theta energy: -88.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1297.656392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.656392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1297.656392 (E_RNA) where: Base-Base interactions energy: -794.869 where: short stacking energy: -400.190 Base-Backbone interact. energy: 2.894 local terms energy: -505.681201 where: bonds (distance) C4'-P energy: -103.764 bonds (distance) P-C4' energy: -108.429 flat angles C4'-P-C4' energy: -133.249 flat angles P-C4'-P energy: -68.067 tors. eta vs tors. theta energy: -92.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1081.566631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.566631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.566631 (E_RNA) where: Base-Base interactions energy: -607.249 where: short stacking energy: -335.133 Base-Backbone interact. energy: -5.638 local terms energy: -468.680092 where: bonds (distance) C4'-P energy: -110.619 bonds (distance) P-C4' energy: -103.826 flat angles C4'-P-C4' energy: -100.040 flat angles P-C4'-P energy: -74.480 tors. eta vs tors. theta energy: -79.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -869.343209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.343209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.343209 (E_RNA) where: Base-Base interactions energy: -464.156 where: short stacking energy: -252.025 Base-Backbone interact. energy: -2.355 local terms energy: -402.832559 where: bonds (distance) C4'-P energy: -104.287 bonds (distance) P-C4' energy: -109.812 flat angles C4'-P-C4' energy: -99.152 flat angles P-C4'-P energy: -58.564 tors. eta vs tors. theta energy: -31.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -674.809766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.809766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.809766 (E_RNA) where: Base-Base interactions energy: -295.610 where: short stacking energy: -208.192 Base-Backbone interact. energy: 2.105 local terms energy: -381.304869 where: bonds (distance) C4'-P energy: -97.563 bonds (distance) P-C4' energy: -109.479 flat angles C4'-P-C4' energy: -87.237 flat angles P-C4'-P energy: -67.443 tors. eta vs tors. theta energy: -19.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -624.771442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.771442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.771442 (E_RNA) where: Base-Base interactions energy: -260.501 where: short stacking energy: -177.497 Base-Backbone interact. energy: -2.598 local terms energy: -361.671833 where: bonds (distance) C4'-P energy: -103.739 bonds (distance) P-C4' energy: -121.199 flat angles C4'-P-C4' energy: -83.103 flat angles P-C4'-P energy: -60.343 tors. eta vs tors. theta energy: 6.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -533.959587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.959587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.959587 (E_RNA) where: Base-Base interactions energy: -197.525 where: short stacking energy: -144.308 Base-Backbone interact. energy: 2.514 local terms energy: -338.948048 where: bonds (distance) C4'-P energy: -85.836 bonds (distance) P-C4' energy: -111.946 flat angles C4'-P-C4' energy: -94.478 flat angles P-C4'-P energy: -49.334 tors. eta vs tors. theta energy: 2.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -517.000587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.000587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.000587 (E_RNA) where: Base-Base interactions energy: -221.142 where: short stacking energy: -142.786 Base-Backbone interact. energy: -2.915 local terms energy: -292.943051 where: bonds (distance) C4'-P energy: -92.321 bonds (distance) P-C4' energy: -94.641 flat angles C4'-P-C4' energy: -92.514 flat angles P-C4'-P energy: -50.611 tors. eta vs tors. theta energy: 37.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1367.390589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.390589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.390589 (E_RNA) where: Base-Base interactions energy: -786.481 where: short stacking energy: -422.958 Base-Backbone interact. energy: 1.275 local terms energy: -582.184644 where: bonds (distance) C4'-P energy: -125.260 bonds (distance) P-C4' energy: -129.160 flat angles C4'-P-C4' energy: -137.913 flat angles P-C4'-P energy: -73.046 tors. eta vs tors. theta energy: -116.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1345.435048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.435048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.435048 (E_RNA) where: Base-Base interactions energy: -820.627 where: short stacking energy: -430.435 Base-Backbone interact. energy: -4.028 local terms energy: -520.779938 where: bonds (distance) C4'-P energy: -111.371 bonds (distance) P-C4' energy: -123.495 flat angles C4'-P-C4' energy: -120.539 flat angles P-C4'-P energy: -69.857 tors. eta vs tors. theta energy: -95.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1315.848147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.848147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.848147 (E_RNA) where: Base-Base interactions energy: -762.930 where: short stacking energy: -392.755 Base-Backbone interact. energy: -2.710 local terms energy: -550.208488 where: bonds (distance) C4'-P energy: -121.327 bonds (distance) P-C4' energy: -110.665 flat angles C4'-P-C4' energy: -130.377 flat angles P-C4'-P energy: -99.683 tors. eta vs tors. theta energy: -88.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1150.511527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.511527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.511527 (E_RNA) where: Base-Base interactions energy: -659.685 where: short stacking energy: -349.748 Base-Backbone interact. energy: 0.520 local terms energy: -491.346179 where: bonds (distance) C4'-P energy: -106.415 bonds (distance) P-C4' energy: -124.750 flat angles C4'-P-C4' energy: -114.242 flat angles P-C4'-P energy: -71.826 tors. eta vs tors. theta energy: -74.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1095.726532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.726532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.726532 (E_RNA) where: Base-Base interactions energy: -633.312 where: short stacking energy: -323.932 Base-Backbone interact. energy: -5.721 local terms energy: -456.693603 where: bonds (distance) C4'-P energy: -97.698 bonds (distance) P-C4' energy: -105.750 flat angles C4'-P-C4' energy: -114.138 flat angles P-C4'-P energy: -78.954 tors. eta vs tors. theta energy: -60.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -933.737672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.737672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.737672 (E_RNA) where: Base-Base interactions energy: -486.058 where: short stacking energy: -259.187 Base-Backbone interact. energy: -2.341 local terms energy: -445.339139 where: bonds (distance) C4'-P energy: -104.525 bonds (distance) P-C4' energy: -116.202 flat angles C4'-P-C4' energy: -125.397 flat angles P-C4'-P energy: -60.993 tors. eta vs tors. theta energy: -38.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -663.571546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.571546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.571546 (E_RNA) where: Base-Base interactions energy: -251.942 where: short stacking energy: -198.193 Base-Backbone interact. energy: -1.071 local terms energy: -410.558928 where: bonds (distance) C4'-P energy: -130.105 bonds (distance) P-C4' energy: -115.913 flat angles C4'-P-C4' energy: -85.629 flat angles P-C4'-P energy: -65.245 tors. eta vs tors. theta energy: -13.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -611.729967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.729967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.729967 (E_RNA) where: Base-Base interactions energy: -259.980 where: short stacking energy: -157.960 Base-Backbone interact. energy: 0.914 local terms energy: -352.663730 where: bonds (distance) C4'-P energy: -109.158 bonds (distance) P-C4' energy: -112.620 flat angles C4'-P-C4' energy: -87.807 flat angles P-C4'-P energy: -45.617 tors. eta vs tors. theta energy: 2.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -622.544398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.544398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.544398 (E_RNA) where: Base-Base interactions energy: -294.534 where: short stacking energy: -179.460 Base-Backbone interact. energy: -3.060 local terms energy: -324.949916 where: bonds (distance) C4'-P energy: -84.127 bonds (distance) P-C4' energy: -107.073 flat angles C4'-P-C4' energy: -72.514 flat angles P-C4'-P energy: -61.399 tors. eta vs tors. theta energy: 0.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -474.301348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.301348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.301348 (E_RNA) where: Base-Base interactions energy: -165.215 where: short stacking energy: -133.998 Base-Backbone interact. energy: 0.434 local terms energy: -309.520276 where: bonds (distance) C4'-P energy: -99.655 bonds (distance) P-C4' energy: -98.285 flat angles C4'-P-C4' energy: -84.156 flat angles P-C4'-P energy: -54.374 tors. eta vs tors. theta energy: 26.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1431.796134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.796134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.796134 (E_RNA) where: Base-Base interactions energy: -846.668 where: short stacking energy: -454.173 Base-Backbone interact. energy: -2.036 local terms energy: -583.091851 where: bonds (distance) C4'-P energy: -130.587 bonds (distance) P-C4' energy: -136.960 flat angles C4'-P-C4' energy: -121.457 flat angles P-C4'-P energy: -77.633 tors. eta vs tors. theta energy: -116.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1381.267785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.267785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.267785 (E_RNA) where: Base-Base interactions energy: -817.919 where: short stacking energy: -355.744 Base-Backbone interact. energy: -4.193 local terms energy: -559.156612 where: bonds (distance) C4'-P energy: -128.603 bonds (distance) P-C4' energy: -123.405 flat angles C4'-P-C4' energy: -135.387 flat angles P-C4'-P energy: -64.268 tors. eta vs tors. theta energy: -107.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1411.744516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.744516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.744516 (E_RNA) where: Base-Base interactions energy: -877.605 where: short stacking energy: -453.103 Base-Backbone interact. energy: 0.525 local terms energy: -534.664980 where: bonds (distance) C4'-P energy: -114.966 bonds (distance) P-C4' energy: -109.848 flat angles C4'-P-C4' energy: -126.692 flat angles P-C4'-P energy: -74.548 tors. eta vs tors. theta energy: -108.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1159.320479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.320479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.320479 (E_RNA) where: Base-Base interactions energy: -670.635 where: short stacking energy: -332.656 Base-Backbone interact. energy: -0.582 local terms energy: -488.103491 where: bonds (distance) C4'-P energy: -109.990 bonds (distance) P-C4' energy: -121.197 flat angles C4'-P-C4' energy: -122.633 flat angles P-C4'-P energy: -77.871 tors. eta vs tors. theta energy: -56.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1126.088413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.088413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.088413 (E_RNA) where: Base-Base interactions energy: -627.953 where: short stacking energy: -342.007 Base-Backbone interact. energy: 6.280 local terms energy: -504.415754 where: bonds (distance) C4'-P energy: -119.385 bonds (distance) P-C4' energy: -129.628 flat angles C4'-P-C4' energy: -118.379 flat angles P-C4'-P energy: -76.287 tors. eta vs tors. theta energy: -60.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -906.983585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.983585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -906.983585 (E_RNA) where: Base-Base interactions energy: -484.161 where: short stacking energy: -252.877 Base-Backbone interact. energy: -3.326 local terms energy: -419.496506 where: bonds (distance) C4'-P energy: -110.844 bonds (distance) P-C4' energy: -106.930 flat angles C4'-P-C4' energy: -108.495 flat angles P-C4'-P energy: -65.154 tors. eta vs tors. theta energy: -28.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -628.765639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.765639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.765639 (E_RNA) where: Base-Base interactions energy: -233.177 where: short stacking energy: -197.609 Base-Backbone interact. energy: -0.539 local terms energy: -395.049689 where: bonds (distance) C4'-P energy: -99.873 bonds (distance) P-C4' energy: -111.103 flat angles C4'-P-C4' energy: -109.322 flat angles P-C4'-P energy: -53.209 tors. eta vs tors. theta energy: -21.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -677.330236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.330236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.330236 (E_RNA) where: Base-Base interactions energy: -319.925 where: short stacking energy: -221.637 Base-Backbone interact. energy: -1.978 local terms energy: -355.428069 where: bonds (distance) C4'-P energy: -107.140 bonds (distance) P-C4' energy: -108.379 flat angles C4'-P-C4' energy: -84.610 flat angles P-C4'-P energy: -37.729 tors. eta vs tors. theta energy: -17.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -519.035681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.035681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.035681 (E_RNA) where: Base-Base interactions energy: -211.988 where: short stacking energy: -134.434 Base-Backbone interact. energy: 7.637 local terms energy: -314.684637 where: bonds (distance) C4'-P energy: -111.958 bonds (distance) P-C4' energy: -91.183 flat angles C4'-P-C4' energy: -76.913 flat angles P-C4'-P energy: -57.461 tors. eta vs tors. theta energy: 22.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -476.716523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.716523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.716523 (E_RNA) where: Base-Base interactions energy: -175.340 where: short stacking energy: -129.859 Base-Backbone interact. energy: 9.758 local terms energy: -311.134719 where: bonds (distance) C4'-P energy: -105.853 bonds (distance) P-C4' energy: -98.083 flat angles C4'-P-C4' energy: -80.101 flat angles P-C4'-P energy: -60.215 tors. eta vs tors. theta energy: 33.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1432.103337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.103337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.103337 (E_RNA) where: Base-Base interactions energy: -863.818 where: short stacking energy: -459.149 Base-Backbone interact. energy: 1.900 local terms energy: -570.184949 where: bonds (distance) C4'-P energy: -115.078 bonds (distance) P-C4' energy: -131.748 flat angles C4'-P-C4' energy: -125.391 flat angles P-C4'-P energy: -82.391 tors. eta vs tors. theta energy: -115.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1448.949820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.949820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.949820 (E_RNA) where: Base-Base interactions energy: -897.333 where: short stacking energy: -438.138 Base-Backbone interact. energy: -0.791 local terms energy: -550.825594 where: bonds (distance) C4'-P energy: -119.953 bonds (distance) P-C4' energy: -111.991 flat angles C4'-P-C4' energy: -120.787 flat angles P-C4'-P energy: -84.373 tors. eta vs tors. theta energy: -113.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1412.531714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.531714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.531714 (E_RNA) where: Base-Base interactions energy: -872.571 where: short stacking energy: -422.731 Base-Backbone interact. energy: -0.377 local terms energy: -539.584228 where: bonds (distance) C4'-P energy: -110.724 bonds (distance) P-C4' energy: -130.578 flat angles C4'-P-C4' energy: -121.351 flat angles P-C4'-P energy: -78.373 tors. eta vs tors. theta energy: -98.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1181.078335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.078335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.078335 (E_RNA) where: Base-Base interactions energy: -697.154 where: short stacking energy: -353.653 Base-Backbone interact. energy: 1.384 local terms energy: -485.307833 where: bonds (distance) C4'-P energy: -120.385 bonds (distance) P-C4' energy: -112.457 flat angles C4'-P-C4' energy: -111.691 flat angles P-C4'-P energy: -74.095 tors. eta vs tors. theta energy: -66.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1153.693332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.693332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.693332 (E_RNA) where: Base-Base interactions energy: -671.833 where: short stacking energy: -332.545 Base-Backbone interact. energy: -0.783 local terms energy: -481.077043 where: bonds (distance) C4'-P energy: -125.627 bonds (distance) P-C4' energy: -111.349 flat angles C4'-P-C4' energy: -116.740 flat angles P-C4'-P energy: -68.618 tors. eta vs tors. theta energy: -58.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -899.320106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.320106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.320106 (E_RNA) where: Base-Base interactions energy: -479.063 where: short stacking energy: -254.340 Base-Backbone interact. energy: -0.779 local terms energy: -419.478558 where: bonds (distance) C4'-P energy: -115.994 bonds (distance) P-C4' energy: -109.150 flat angles C4'-P-C4' energy: -108.711 flat angles P-C4'-P energy: -61.148 tors. eta vs tors. theta energy: -24.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -627.824375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.824375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.824375 (E_RNA) where: Base-Base interactions energy: -253.562 where: short stacking energy: -168.306 Base-Backbone interact. energy: -2.424 local terms energy: -371.838239 where: bonds (distance) C4'-P energy: -102.973 bonds (distance) P-C4' energy: -127.506 flat angles C4'-P-C4' energy: -82.190 flat angles P-C4'-P energy: -64.393 tors. eta vs tors. theta energy: 5.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -636.819011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.819011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.819011 (E_RNA) where: Base-Base interactions energy: -284.287 where: short stacking energy: -214.206 Base-Backbone interact. energy: 2.677 local terms energy: -355.209281 where: bonds (distance) C4'-P energy: -103.689 bonds (distance) P-C4' energy: -100.063 flat angles C4'-P-C4' energy: -93.891 flat angles P-C4'-P energy: -40.107 tors. eta vs tors. theta energy: -17.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -529.007119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.007119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.007119 (E_RNA) where: Base-Base interactions energy: -195.025 where: short stacking energy: -152.398 Base-Backbone interact. energy: 0.533 local terms energy: -334.515042 where: bonds (distance) C4'-P energy: -93.686 bonds (distance) P-C4' energy: -109.770 flat angles C4'-P-C4' energy: -83.622 flat angles P-C4'-P energy: -58.538 tors. eta vs tors. theta energy: 11.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -497.256394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.256394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.256394 (E_RNA) where: Base-Base interactions energy: -190.760 where: short stacking energy: -151.789 Base-Backbone interact. energy: 0.183 local terms energy: -306.678755 where: bonds (distance) C4'-P energy: -94.003 bonds (distance) P-C4' energy: -94.347 flat angles C4'-P-C4' energy: -96.667 flat angles P-C4'-P energy: -51.163 tors. eta vs tors. theta energy: 29.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1451.810098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.810098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.810098 (E_RNA) where: Base-Base interactions energy: -863.112 where: short stacking energy: -435.678 Base-Backbone interact. energy: -0.202 local terms energy: -588.496401 where: bonds (distance) C4'-P energy: -133.765 bonds (distance) P-C4' energy: -137.319 flat angles C4'-P-C4' energy: -124.072 flat angles P-C4'-P energy: -75.113 tors. eta vs tors. theta energy: -118.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1545.256916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.256916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1545.256916 (E_RNA) where: Base-Base interactions energy: -977.094 where: short stacking energy: -447.749 Base-Backbone interact. energy: -2.080 local terms energy: -566.083642 where: bonds (distance) C4'-P energy: -115.926 bonds (distance) P-C4' energy: -118.183 flat angles C4'-P-C4' energy: -126.896 flat angles P-C4'-P energy: -95.870 tors. eta vs tors. theta energy: -109.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1351.466028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.466028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.466028 (E_RNA) where: Base-Base interactions energy: -807.159 where: short stacking energy: -396.811 Base-Backbone interact. energy: -2.728 local terms energy: -541.578340 where: bonds (distance) C4'-P energy: -107.516 bonds (distance) P-C4' energy: -124.420 flat angles C4'-P-C4' energy: -129.629 flat angles P-C4'-P energy: -76.112 tors. eta vs tors. theta energy: -103.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1184.795255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.795255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.795255 (E_RNA) where: Base-Base interactions energy: -741.532 where: short stacking energy: -362.888 Base-Backbone interact. energy: -0.918 local terms energy: -442.345087 where: bonds (distance) C4'-P energy: -104.369 bonds (distance) P-C4' energy: -111.335 flat angles C4'-P-C4' energy: -120.329 flat angles P-C4'-P energy: -48.586 tors. eta vs tors. theta energy: -57.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1131.607446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.607446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.607446 (E_RNA) where: Base-Base interactions energy: -664.585 where: short stacking energy: -325.781 Base-Backbone interact. energy: -1.133 local terms energy: -465.890051 where: bonds (distance) C4'-P energy: -107.982 bonds (distance) P-C4' energy: -105.565 flat angles C4'-P-C4' energy: -111.309 flat angles P-C4'-P energy: -68.525 tors. eta vs tors. theta energy: -72.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -949.031861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.031861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.031861 (E_RNA) where: Base-Base interactions energy: -507.749 where: short stacking energy: -262.577 Base-Backbone interact. energy: 0.697 local terms energy: -441.979552 where: bonds (distance) C4'-P energy: -122.439 bonds (distance) P-C4' energy: -120.121 flat angles C4'-P-C4' energy: -100.792 flat angles P-C4'-P energy: -66.893 tors. eta vs tors. theta energy: -31.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -669.905103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.905103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.905103 (E_RNA) where: Base-Base interactions energy: -282.959 where: short stacking energy: -184.136 Base-Backbone interact. energy: -2.181 local terms energy: -384.765287 where: bonds (distance) C4'-P energy: -108.388 bonds (distance) P-C4' energy: -112.410 flat angles C4'-P-C4' energy: -109.456 flat angles P-C4'-P energy: -52.555 tors. eta vs tors. theta energy: -1.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -644.612203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.612203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.612203 (E_RNA) where: Base-Base interactions energy: -296.737 where: short stacking energy: -188.258 Base-Backbone interact. energy: -0.990 local terms energy: -346.884878 where: bonds (distance) C4'-P energy: -109.097 bonds (distance) P-C4' energy: -113.502 flat angles C4'-P-C4' energy: -79.848 flat angles P-C4'-P energy: -54.482 tors. eta vs tors. theta energy: 10.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -507.661114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.661114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.661114 (E_RNA) where: Base-Base interactions energy: -174.754 where: short stacking energy: -144.353 Base-Backbone interact. energy: 0.470 local terms energy: -333.377687 where: bonds (distance) C4'-P energy: -98.777 bonds (distance) P-C4' energy: -112.576 flat angles C4'-P-C4' energy: -83.639 flat angles P-C4'-P energy: -55.588 tors. eta vs tors. theta energy: 17.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -506.567091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.567091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.567091 (E_RNA) where: Base-Base interactions energy: -203.875 where: short stacking energy: -148.742 Base-Backbone interact. energy: -2.304 local terms energy: -300.387707 where: bonds (distance) C4'-P energy: -100.384 bonds (distance) P-C4' energy: -105.432 flat angles C4'-P-C4' energy: -79.422 flat angles P-C4'-P energy: -46.288 tors. eta vs tors. theta energy: 31.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1702.907547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.907547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.907547 (E_RNA) where: Base-Base interactions energy: -1099.707 where: short stacking energy: -513.785 Base-Backbone interact. energy: -2.784 local terms energy: -600.416744 where: bonds (distance) C4'-P energy: -117.434 bonds (distance) P-C4' energy: -128.812 flat angles C4'-P-C4' energy: -137.265 flat angles P-C4'-P energy: -91.761 tors. eta vs tors. theta energy: -125.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1408.443746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.443746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.443746 (E_RNA) where: Base-Base interactions energy: -846.265 where: short stacking energy: -447.697 Base-Backbone interact. energy: -2.100 local terms energy: -560.078778 where: bonds (distance) C4'-P energy: -117.344 bonds (distance) P-C4' energy: -107.160 flat angles C4'-P-C4' energy: -135.669 flat angles P-C4'-P energy: -80.212 tors. eta vs tors. theta energy: -119.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1308.187111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.187111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.187111 (E_RNA) where: Base-Base interactions energy: -777.552 where: short stacking energy: -386.411 Base-Backbone interact. energy: -2.069 local terms energy: -528.565699 where: bonds (distance) C4'-P energy: -115.331 bonds (distance) P-C4' energy: -122.066 flat angles C4'-P-C4' energy: -131.783 flat angles P-C4'-P energy: -80.485 tors. eta vs tors. theta energy: -78.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1169.229007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.229007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.229007 (E_RNA) where: Base-Base interactions energy: -658.681 where: short stacking energy: -348.792 Base-Backbone interact. energy: 7.042 local terms energy: -517.590253 where: bonds (distance) C4'-P energy: -115.180 bonds (distance) P-C4' energy: -118.174 flat angles C4'-P-C4' energy: -130.155 flat angles P-C4'-P energy: -80.542 tors. eta vs tors. theta energy: -73.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1112.729539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.729539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.729539 (E_RNA) where: Base-Base interactions energy: -634.066 where: short stacking energy: -344.847 Base-Backbone interact. energy: 0.016 local terms energy: -478.679478 where: bonds (distance) C4'-P energy: -106.804 bonds (distance) P-C4' energy: -103.029 flat angles C4'-P-C4' energy: -126.917 flat angles P-C4'-P energy: -62.716 tors. eta vs tors. theta energy: -79.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -999.366981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.366981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.366981 (E_RNA) where: Base-Base interactions energy: -605.753 where: short stacking energy: -308.071 Base-Backbone interact. energy: 0.162 local terms energy: -393.776584 where: bonds (distance) C4'-P energy: -94.474 bonds (distance) P-C4' energy: -101.193 flat angles C4'-P-C4' energy: -95.012 flat angles P-C4'-P energy: -74.904 tors. eta vs tors. theta energy: -28.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -701.244927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.244927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.244927 (E_RNA) where: Base-Base interactions energy: -309.562 where: short stacking energy: -209.285 Base-Backbone interact. energy: -3.262 local terms energy: -388.420477 where: bonds (distance) C4'-P energy: -92.042 bonds (distance) P-C4' energy: -114.632 flat angles C4'-P-C4' energy: -104.203 flat angles P-C4'-P energy: -55.282 tors. eta vs tors. theta energy: -22.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -611.118277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.118277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.118277 (E_RNA) where: Base-Base interactions energy: -242.770 where: short stacking energy: -184.369 Base-Backbone interact. energy: 0.244 local terms energy: -368.592483 where: bonds (distance) C4'-P energy: -111.529 bonds (distance) P-C4' energy: -102.372 flat angles C4'-P-C4' energy: -99.882 flat angles P-C4'-P energy: -71.130 tors. eta vs tors. theta energy: 16.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -577.430982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.430982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.430982 (E_RNA) where: Base-Base interactions energy: -242.408 where: short stacking energy: -171.330 Base-Backbone interact. energy: 1.182 local terms energy: -336.205070 where: bonds (distance) C4'-P energy: -100.910 bonds (distance) P-C4' energy: -103.928 flat angles C4'-P-C4' energy: -79.533 flat angles P-C4'-P energy: -53.156 tors. eta vs tors. theta energy: 1.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -477.348154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.348154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.348154 (E_RNA) where: Base-Base interactions energy: -160.472 where: short stacking energy: -138.114 Base-Backbone interact. energy: -0.653 local terms energy: -316.222957 where: bonds (distance) C4'-P energy: -110.665 bonds (distance) P-C4' energy: -91.626 flat angles C4'-P-C4' energy: -72.721 flat angles P-C4'-P energy: -48.553 tors. eta vs tors. theta energy: 7.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1760.868925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1760.868925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1760.868925 (E_RNA) where: Base-Base interactions energy: -1168.791 where: short stacking energy: -531.671 Base-Backbone interact. energy: 0.254 local terms energy: -592.332058 where: bonds (distance) C4'-P energy: -124.721 bonds (distance) P-C4' energy: -124.130 flat angles C4'-P-C4' energy: -124.732 flat angles P-C4'-P energy: -71.570 tors. eta vs tors. theta energy: -147.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1327.237112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.237112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.237112 (E_RNA) where: Base-Base interactions energy: -800.635 where: short stacking energy: -424.452 Base-Backbone interact. energy: -1.228 local terms energy: -525.373591 where: bonds (distance) C4'-P energy: -115.413 bonds (distance) P-C4' energy: -119.966 flat angles C4'-P-C4' energy: -109.247 flat angles P-C4'-P energy: -81.532 tors. eta vs tors. theta energy: -99.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1353.189222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.189222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.189222 (E_RNA) where: Base-Base interactions energy: -813.050 where: short stacking energy: -387.805 Base-Backbone interact. energy: -0.794 local terms energy: -539.345300 where: bonds (distance) C4'-P energy: -121.323 bonds (distance) P-C4' energy: -115.737 flat angles C4'-P-C4' energy: -126.901 flat angles P-C4'-P energy: -95.255 tors. eta vs tors. theta energy: -80.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1280.035998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.035998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.035998 (E_RNA) where: Base-Base interactions energy: -764.783 where: short stacking energy: -396.394 Base-Backbone interact. energy: -1.938 local terms energy: -513.315616 where: bonds (distance) C4'-P energy: -109.695 bonds (distance) P-C4' energy: -118.958 flat angles C4'-P-C4' energy: -94.990 flat angles P-C4'-P energy: -87.323 tors. eta vs tors. theta energy: -102.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1139.616582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.616582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.616582 (E_RNA) where: Base-Base interactions energy: -643.910 where: short stacking energy: -340.032 Base-Backbone interact. energy: 0.313 local terms energy: -496.019641 where: bonds (distance) C4'-P energy: -132.393 bonds (distance) P-C4' energy: -103.336 flat angles C4'-P-C4' energy: -116.381 flat angles P-C4'-P energy: -80.998 tors. eta vs tors. theta energy: -62.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -955.965863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.965863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.965863 (E_RNA) where: Base-Base interactions energy: -519.295 where: short stacking energy: -272.733 Base-Backbone interact. energy: 2.544 local terms energy: -439.214693 where: bonds (distance) C4'-P energy: -124.636 bonds (distance) P-C4' energy: -118.811 flat angles C4'-P-C4' energy: -94.930 flat angles P-C4'-P energy: -64.680 tors. eta vs tors. theta energy: -36.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -685.824718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.824718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.824718 (E_RNA) where: Base-Base interactions energy: -313.617 where: short stacking energy: -201.579 Base-Backbone interact. energy: 1.968 local terms energy: -374.175360 where: bonds (distance) C4'-P energy: -105.836 bonds (distance) P-C4' energy: -99.599 flat angles C4'-P-C4' energy: -90.040 flat angles P-C4'-P energy: -56.841 tors. eta vs tors. theta energy: -21.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -641.164122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.164122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.164122 (E_RNA) where: Base-Base interactions energy: -277.140 where: short stacking energy: -194.895 Base-Backbone interact. energy: -2.129 local terms energy: -361.895083 where: bonds (distance) C4'-P energy: -108.553 bonds (distance) P-C4' energy: -120.233 flat angles C4'-P-C4' energy: -79.948 flat angles P-C4'-P energy: -61.418 tors. eta vs tors. theta energy: 8.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -504.299069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.299069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.299069 (E_RNA) where: Base-Base interactions energy: -193.023 where: short stacking energy: -133.696 Base-Backbone interact. energy: 2.251 local terms energy: -313.527110 where: bonds (distance) C4'-P energy: -101.482 bonds (distance) P-C4' energy: -97.996 flat angles C4'-P-C4' energy: -87.088 flat angles P-C4'-P energy: -50.515 tors. eta vs tors. theta energy: 23.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -454.306711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.306711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.306711 (E_RNA) where: Base-Base interactions energy: -156.056 where: short stacking energy: -141.036 Base-Backbone interact. energy: 0.708 local terms energy: -298.958673 where: bonds (distance) C4'-P energy: -88.506 bonds (distance) P-C4' energy: -108.026 flat angles C4'-P-C4' energy: -80.844 flat angles P-C4'-P energy: -41.850 tors. eta vs tors. theta energy: 20.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1775.132607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1775.132607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1775.132607 (E_RNA) where: Base-Base interactions energy: -1147.365 where: short stacking energy: -507.732 Base-Backbone interact. energy: -0.817 local terms energy: -626.950802 where: bonds (distance) C4'-P energy: -127.032 bonds (distance) P-C4' energy: -123.118 flat angles C4'-P-C4' energy: -143.363 flat angles P-C4'-P energy: -96.142 tors. eta vs tors. theta energy: -137.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1383.567746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.567746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.567746 (E_RNA) where: Base-Base interactions energy: -832.265 where: short stacking energy: -420.358 Base-Backbone interact. energy: -1.603 local terms energy: -549.699264 where: bonds (distance) C4'-P energy: -116.780 bonds (distance) P-C4' energy: -113.601 flat angles C4'-P-C4' energy: -132.285 flat angles P-C4'-P energy: -72.324 tors. eta vs tors. theta energy: -114.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1323.922420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.922420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.922420 (E_RNA) where: Base-Base interactions energy: -786.631 where: short stacking energy: -412.246 Base-Backbone interact. energy: -1.735 local terms energy: -535.557185 where: bonds (distance) C4'-P energy: -133.774 bonds (distance) P-C4' energy: -117.815 flat angles C4'-P-C4' energy: -116.746 flat angles P-C4'-P energy: -74.263 tors. eta vs tors. theta energy: -92.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1279.525880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.525880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.525880 (E_RNA) where: Base-Base interactions energy: -771.324 where: short stacking energy: -403.469 Base-Backbone interact. energy: -1.065 local terms energy: -507.136291 where: bonds (distance) C4'-P energy: -121.990 bonds (distance) P-C4' energy: -103.004 flat angles C4'-P-C4' energy: -125.087 flat angles P-C4'-P energy: -69.737 tors. eta vs tors. theta energy: -87.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1145.898768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.898768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.898768 (E_RNA) where: Base-Base interactions energy: -642.921 where: short stacking energy: -318.632 Base-Backbone interact. energy: 0.857 local terms energy: -503.834819 where: bonds (distance) C4'-P energy: -111.979 bonds (distance) P-C4' energy: -123.534 flat angles C4'-P-C4' energy: -120.382 flat angles P-C4'-P energy: -82.720 tors. eta vs tors. theta energy: -65.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -967.347559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.347559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.347559 (E_RNA) where: Base-Base interactions energy: -539.951 where: short stacking energy: -278.134 Base-Backbone interact. energy: 0.508 local terms energy: -427.905368 where: bonds (distance) C4'-P energy: -110.006 bonds (distance) P-C4' energy: -99.943 flat angles C4'-P-C4' energy: -107.831 flat angles P-C4'-P energy: -64.097 tors. eta vs tors. theta energy: -46.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -693.774410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.774410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.774410 (E_RNA) where: Base-Base interactions energy: -309.263 where: short stacking energy: -192.884 Base-Backbone interact. energy: -3.674 local terms energy: -380.837088 where: bonds (distance) C4'-P energy: -119.882 bonds (distance) P-C4' energy: -98.152 flat angles C4'-P-C4' energy: -99.379 flat angles P-C4'-P energy: -62.908 tors. eta vs tors. theta energy: -0.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -624.209080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.209080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.209080 (E_RNA) where: Base-Base interactions energy: -300.183 where: short stacking energy: -197.569 Base-Backbone interact. energy: 2.504 local terms energy: -326.529577 where: bonds (distance) C4'-P energy: -91.040 bonds (distance) P-C4' energy: -88.137 flat angles C4'-P-C4' energy: -99.089 flat angles P-C4'-P energy: -48.441 tors. eta vs tors. theta energy: 0.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -529.982332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.982332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.982332 (E_RNA) where: Base-Base interactions energy: -193.550 where: short stacking energy: -163.686 Base-Backbone interact. energy: -0.129 local terms energy: -336.303059 where: bonds (distance) C4'-P energy: -89.129 bonds (distance) P-C4' energy: -95.345 flat angles C4'-P-C4' energy: -108.925 flat angles P-C4'-P energy: -37.369 tors. eta vs tors. theta energy: -5.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -490.148547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.148547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.148547 (E_RNA) where: Base-Base interactions energy: -170.583 where: short stacking energy: -123.307 Base-Backbone interact. energy: 5.806 local terms energy: -325.372325 where: bonds (distance) C4'-P energy: -108.302 bonds (distance) P-C4' energy: -113.171 flat angles C4'-P-C4' energy: -74.188 flat angles P-C4'-P energy: -49.858 tors. eta vs tors. theta energy: 20.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1751.964798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.964798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.964798 (E_RNA) where: Base-Base interactions energy: -1150.837 where: short stacking energy: -526.462 Base-Backbone interact. energy: -1.483 local terms energy: -599.644733 where: bonds (distance) C4'-P energy: -114.882 bonds (distance) P-C4' energy: -133.118 flat angles C4'-P-C4' energy: -135.810 flat angles P-C4'-P energy: -76.142 tors. eta vs tors. theta energy: -139.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1394.430000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.430000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.430000 (E_RNA) where: Base-Base interactions energy: -867.732 where: short stacking energy: -447.731 Base-Backbone interact. energy: 0.790 local terms energy: -527.488530 where: bonds (distance) C4'-P energy: -101.722 bonds (distance) P-C4' energy: -110.166 flat angles C4'-P-C4' energy: -125.887 flat angles P-C4'-P energy: -74.727 tors. eta vs tors. theta energy: -114.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1259.811630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.811630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.811630 (E_RNA) where: Base-Base interactions energy: -734.519 where: short stacking energy: -372.749 Base-Backbone interact. energy: -0.416 local terms energy: -524.876515 where: bonds (distance) C4'-P energy: -123.411 bonds (distance) P-C4' energy: -115.431 flat angles C4'-P-C4' energy: -112.564 flat angles P-C4'-P energy: -77.373 tors. eta vs tors. theta energy: -96.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1321.236695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.236695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.236695 (E_RNA) where: Base-Base interactions energy: -814.611 where: short stacking energy: -397.242 Base-Backbone interact. energy: -0.780 local terms energy: -505.845378 where: bonds (distance) C4'-P energy: -113.608 bonds (distance) P-C4' energy: -115.466 flat angles C4'-P-C4' energy: -118.627 flat angles P-C4'-P energy: -66.771 tors. eta vs tors. theta energy: -91.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1075.477003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.477003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1075.477003 (E_RNA) where: Base-Base interactions energy: -632.563 where: short stacking energy: -325.718 Base-Backbone interact. energy: -2.355 local terms energy: -440.559049 where: bonds (distance) C4'-P energy: -100.252 bonds (distance) P-C4' energy: -94.134 flat angles C4'-P-C4' energy: -109.604 flat angles P-C4'-P energy: -81.114 tors. eta vs tors. theta energy: -55.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -984.571865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.571865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.571865 (E_RNA) where: Base-Base interactions energy: -596.532 where: short stacking energy: -328.781 Base-Backbone interact. energy: 6.727 local terms energy: -394.766703 where: bonds (distance) C4'-P energy: -92.395 bonds (distance) P-C4' energy: -105.255 flat angles C4'-P-C4' energy: -100.765 flat angles P-C4'-P energy: -51.515 tors. eta vs tors. theta energy: -44.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -819.630696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.630696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.630696 (E_RNA) where: Base-Base interactions energy: -395.192 where: short stacking energy: -221.499 Base-Backbone interact. energy: -1.564 local terms energy: -422.874514 where: bonds (distance) C4'-P energy: -113.736 bonds (distance) P-C4' energy: -111.698 flat angles C4'-P-C4' energy: -112.099 flat angles P-C4'-P energy: -61.211 tors. eta vs tors. theta energy: -24.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -652.349397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.349397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.349397 (E_RNA) where: Base-Base interactions energy: -327.472 where: short stacking energy: -178.413 Base-Backbone interact. energy: -3.245 local terms energy: -321.631927 where: bonds (distance) C4'-P energy: -89.963 bonds (distance) P-C4' energy: -113.974 flat angles C4'-P-C4' energy: -87.280 flat angles P-C4'-P energy: -45.389 tors. eta vs tors. theta energy: 14.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -537.930914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.930914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.930914 (E_RNA) where: Base-Base interactions energy: -214.435 where: short stacking energy: -171.077 Base-Backbone interact. energy: 2.653 local terms energy: -326.148990 where: bonds (distance) C4'-P energy: -87.482 bonds (distance) P-C4' energy: -102.436 flat angles C4'-P-C4' energy: -87.120 flat angles P-C4'-P energy: -52.873 tors. eta vs tors. theta energy: 3.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -480.644820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.644820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.644820 (E_RNA) where: Base-Base interactions energy: -158.140 where: short stacking energy: -137.897 Base-Backbone interact. energy: 0.925 local terms energy: -323.429788 where: bonds (distance) C4'-P energy: -111.416 bonds (distance) P-C4' energy: -111.980 flat angles C4'-P-C4' energy: -73.349 flat angles P-C4'-P energy: -51.338 tors. eta vs tors. theta energy: 24.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1795.682961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1795.682961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.682961 (E_RNA) where: Base-Base interactions energy: -1159.007 where: short stacking energy: -541.973 Base-Backbone interact. energy: -3.888 local terms energy: -632.787250 where: bonds (distance) C4'-P energy: -140.552 bonds (distance) P-C4' energy: -120.454 flat angles C4'-P-C4' energy: -137.161 flat angles P-C4'-P energy: -90.169 tors. eta vs tors. theta energy: -144.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1379.010142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.010142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.010142 (E_RNA) where: Base-Base interactions energy: -824.624 where: short stacking energy: -406.842 Base-Backbone interact. energy: -2.524 local terms energy: -551.862082 where: bonds (distance) C4'-P energy: -118.008 bonds (distance) P-C4' energy: -133.347 flat angles C4'-P-C4' energy: -111.330 flat angles P-C4'-P energy: -79.227 tors. eta vs tors. theta energy: -109.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1365.518725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.518725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.518725 (E_RNA) where: Base-Base interactions energy: -829.744 where: short stacking energy: -404.362 Base-Backbone interact. energy: -4.494 local terms energy: -531.280409 where: bonds (distance) C4'-P energy: -108.073 bonds (distance) P-C4' energy: -109.911 flat angles C4'-P-C4' energy: -123.338 flat angles P-C4'-P energy: -93.438 tors. eta vs tors. theta energy: -96.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1251.386075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.386075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.386075 (E_RNA) where: Base-Base interactions energy: -764.983 where: short stacking energy: -385.460 Base-Backbone interact. energy: -2.101 local terms energy: -484.301720 where: bonds (distance) C4'-P energy: -115.182 bonds (distance) P-C4' energy: -116.490 flat angles C4'-P-C4' energy: -116.688 flat angles P-C4'-P energy: -65.235 tors. eta vs tors. theta energy: -70.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1061.936168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.936168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.936168 (E_RNA) where: Base-Base interactions energy: -626.120 where: short stacking energy: -333.440 Base-Backbone interact. energy: 5.851 local terms energy: -441.666400 where: bonds (distance) C4'-P energy: -113.690 bonds (distance) P-C4' energy: -108.827 flat angles C4'-P-C4' energy: -105.985 flat angles P-C4'-P energy: -57.524 tors. eta vs tors. theta energy: -55.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1017.996897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.996897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.996897 (E_RNA) where: Base-Base interactions energy: -572.069 where: short stacking energy: -310.760 Base-Backbone interact. energy: 3.220 local terms energy: -449.147613 where: bonds (distance) C4'-P energy: -113.988 bonds (distance) P-C4' energy: -108.748 flat angles C4'-P-C4' energy: -101.032 flat angles P-C4'-P energy: -59.132 tors. eta vs tors. theta energy: -66.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -759.891656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.891656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.891656 (E_RNA) where: Base-Base interactions energy: -368.600 where: short stacking energy: -243.129 Base-Backbone interact. energy: -3.859 local terms energy: -387.432289 where: bonds (distance) C4'-P energy: -97.608 bonds (distance) P-C4' energy: -102.979 flat angles C4'-P-C4' energy: -101.616 flat angles P-C4'-P energy: -67.212 tors. eta vs tors. theta energy: -18.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -590.046190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.046190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.046190 (E_RNA) where: Base-Base interactions energy: -228.692 where: short stacking energy: -155.821 Base-Backbone interact. energy: 2.362 local terms energy: -363.716035 where: bonds (distance) C4'-P energy: -106.300 bonds (distance) P-C4' energy: -111.460 flat angles C4'-P-C4' energy: -81.150 flat angles P-C4'-P energy: -56.493 tors. eta vs tors. theta energy: -8.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -501.164767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.164767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.164767 (E_RNA) where: Base-Base interactions energy: -204.516 where: short stacking energy: -169.541 Base-Backbone interact. energy: 1.566 local terms energy: -298.215185 where: bonds (distance) C4'-P energy: -103.398 bonds (distance) P-C4' energy: -90.860 flat angles C4'-P-C4' energy: -75.901 flat angles P-C4'-P energy: -33.404 tors. eta vs tors. theta energy: 5.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -488.540700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.540700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.540700 (E_RNA) where: Base-Base interactions energy: -161.606 where: short stacking energy: -136.768 Base-Backbone interact. energy: -2.772 local terms energy: -324.162712 where: bonds (distance) C4'-P energy: -94.050 bonds (distance) P-C4' energy: -100.563 flat angles C4'-P-C4' energy: -97.866 flat angles P-C4'-P energy: -46.781 tors. eta vs tors. theta energy: 15.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1806.856270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.856270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.856270 (E_RNA) where: Base-Base interactions energy: -1207.620 where: short stacking energy: -520.377 Base-Backbone interact. energy: -2.623 local terms energy: -596.613190 where: bonds (distance) C4'-P energy: -121.430 bonds (distance) P-C4' energy: -127.052 flat angles C4'-P-C4' energy: -118.761 flat angles P-C4'-P energy: -84.094 tors. eta vs tors. theta energy: -145.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1504.505594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.505594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.505594 (E_RNA) where: Base-Base interactions energy: -933.489 where: short stacking energy: -452.484 Base-Backbone interact. energy: 0.255 local terms energy: -571.271971 where: bonds (distance) C4'-P energy: -121.460 bonds (distance) P-C4' energy: -117.528 flat angles C4'-P-C4' energy: -118.678 flat angles P-C4'-P energy: -97.379 tors. eta vs tors. theta energy: -116.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1321.026401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.026401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.026401 (E_RNA) where: Base-Base interactions energy: -809.082 where: short stacking energy: -393.641 Base-Backbone interact. energy: -0.624 local terms energy: -511.321364 where: bonds (distance) C4'-P energy: -116.568 bonds (distance) P-C4' energy: -105.239 flat angles C4'-P-C4' energy: -102.941 flat angles P-C4'-P energy: -86.547 tors. eta vs tors. theta energy: -100.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1256.026489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.026489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.026489 (E_RNA) where: Base-Base interactions energy: -753.550 where: short stacking energy: -362.275 Base-Backbone interact. energy: -1.042 local terms energy: -501.434019 where: bonds (distance) C4'-P energy: -109.841 bonds (distance) P-C4' energy: -114.081 flat angles C4'-P-C4' energy: -121.018 flat angles P-C4'-P energy: -69.330 tors. eta vs tors. theta energy: -87.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1083.771243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.771243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.771243 (E_RNA) where: Base-Base interactions energy: -636.756 where: short stacking energy: -328.543 Base-Backbone interact. energy: 0.333 local terms energy: -447.348779 where: bonds (distance) C4'-P energy: -109.254 bonds (distance) P-C4' energy: -109.019 flat angles C4'-P-C4' energy: -100.937 flat angles P-C4'-P energy: -72.522 tors. eta vs tors. theta energy: -55.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1008.402983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.402983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.402983 (E_RNA) where: Base-Base interactions energy: -560.308 where: short stacking energy: -317.968 Base-Backbone interact. energy: -1.019 local terms energy: -447.075911 where: bonds (distance) C4'-P energy: -111.296 bonds (distance) P-C4' energy: -119.971 flat angles C4'-P-C4' energy: -109.250 flat angles P-C4'-P energy: -59.067 tors. eta vs tors. theta energy: -47.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -789.747716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.747716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.747716 (E_RNA) where: Base-Base interactions energy: -365.649 where: short stacking energy: -217.970 Base-Backbone interact. energy: -2.576 local terms energy: -421.522351 where: bonds (distance) C4'-P energy: -115.274 bonds (distance) P-C4' energy: -113.381 flat angles C4'-P-C4' energy: -99.107 flat angles P-C4'-P energy: -75.105 tors. eta vs tors. theta energy: -18.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -535.346802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.346802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.346802 (E_RNA) where: Base-Base interactions energy: -200.356 where: short stacking energy: -162.712 Base-Backbone interact. energy: 2.239 local terms energy: -337.229942 where: bonds (distance) C4'-P energy: -95.228 bonds (distance) P-C4' energy: -116.946 flat angles C4'-P-C4' energy: -76.130 flat angles P-C4'-P energy: -47.637 tors. eta vs tors. theta energy: -1.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -502.703368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.703368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.703368 (E_RNA) where: Base-Base interactions energy: -154.079 where: short stacking energy: -121.916 Base-Backbone interact. energy: 0.026 local terms energy: -348.650956 where: bonds (distance) C4'-P energy: -107.086 bonds (distance) P-C4' energy: -112.477 flat angles C4'-P-C4' energy: -87.860 flat angles P-C4'-P energy: -59.939 tors. eta vs tors. theta energy: 18.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -492.984988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.984988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.984988 (E_RNA) where: Base-Base interactions energy: -170.494 where: short stacking energy: -120.835 Base-Backbone interact. energy: 1.277 local terms energy: -323.767924 where: bonds (distance) C4'-P energy: -101.967 bonds (distance) P-C4' energy: -100.076 flat angles C4'-P-C4' energy: -100.872 flat angles P-C4'-P energy: -55.529 tors. eta vs tors. theta energy: 34.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1815.124889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1815.124889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1815.124889 (E_RNA) where: Base-Base interactions energy: -1198.655 where: short stacking energy: -528.274 Base-Backbone interact. energy: -2.792 local terms energy: -613.677903 where: bonds (distance) C4'-P energy: -126.730 bonds (distance) P-C4' energy: -142.040 flat angles C4'-P-C4' energy: -130.648 flat angles P-C4'-P energy: -81.793 tors. eta vs tors. theta energy: -132.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1492.090284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.090284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.090284 (E_RNA) where: Base-Base interactions energy: -927.596 where: short stacking energy: -475.213 Base-Backbone interact. energy: -3.460 local terms energy: -561.034360 where: bonds (distance) C4'-P energy: -111.456 bonds (distance) P-C4' energy: -124.405 flat angles C4'-P-C4' energy: -129.273 flat angles P-C4'-P energy: -84.558 tors. eta vs tors. theta energy: -111.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1342.730028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.730028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.730028 (E_RNA) where: Base-Base interactions energy: -788.274 where: short stacking energy: -411.749 Base-Backbone interact. energy: -3.948 local terms energy: -550.507972 where: bonds (distance) C4'-P energy: -135.889 bonds (distance) P-C4' energy: -115.771 flat angles C4'-P-C4' energy: -116.038 flat angles P-C4'-P energy: -71.952 tors. eta vs tors. theta energy: -110.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1197.460885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.460885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.460885 (E_RNA) where: Base-Base interactions energy: -688.090 where: short stacking energy: -378.053 Base-Backbone interact. energy: 8.036 local terms energy: -517.406914 where: bonds (distance) C4'-P energy: -126.869 bonds (distance) P-C4' energy: -122.578 flat angles C4'-P-C4' energy: -108.715 flat angles P-C4'-P energy: -68.337 tors. eta vs tors. theta energy: -90.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1047.711022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.711022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.711022 (E_RNA) where: Base-Base interactions energy: -579.075 where: short stacking energy: -296.095 Base-Backbone interact. energy: 2.585 local terms energy: -471.220747 where: bonds (distance) C4'-P energy: -108.398 bonds (distance) P-C4' energy: -136.394 flat angles C4'-P-C4' energy: -115.842 flat angles P-C4'-P energy: -59.688 tors. eta vs tors. theta energy: -50.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -904.354519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.354519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.354519 (E_RNA) where: Base-Base interactions energy: -457.919 where: short stacking energy: -226.965 Base-Backbone interact. energy: -3.038 local terms energy: -443.397971 where: bonds (distance) C4'-P energy: -106.442 bonds (distance) P-C4' energy: -125.234 flat angles C4'-P-C4' energy: -109.585 flat angles P-C4'-P energy: -76.284 tors. eta vs tors. theta energy: -25.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -816.115229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.115229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.115229 (E_RNA) where: Base-Base interactions energy: -407.729 where: short stacking energy: -259.432 Base-Backbone interact. energy: 1.665 local terms energy: -410.051331 where: bonds (distance) C4'-P energy: -92.674 bonds (distance) P-C4' energy: -95.633 flat angles C4'-P-C4' energy: -102.577 flat angles P-C4'-P energy: -78.258 tors. eta vs tors. theta energy: -40.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -588.314643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.314643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.314643 (E_RNA) where: Base-Base interactions energy: -199.577 where: short stacking energy: -176.694 Base-Backbone interact. energy: -0.399 local terms energy: -388.338172 where: bonds (distance) C4'-P energy: -105.564 bonds (distance) P-C4' energy: -125.642 flat angles C4'-P-C4' energy: -115.197 flat angles P-C4'-P energy: -49.179 tors. eta vs tors. theta energy: 7.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -539.478197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.478197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.478197 (E_RNA) where: Base-Base interactions energy: -206.345 where: short stacking energy: -160.150 Base-Backbone interact. energy: -2.701 local terms energy: -330.432693 where: bonds (distance) C4'-P energy: -85.346 bonds (distance) P-C4' energy: -113.918 flat angles C4'-P-C4' energy: -73.727 flat angles P-C4'-P energy: -57.682 tors. eta vs tors. theta energy: 0.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -480.646544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.646544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.646544 (E_RNA) where: Base-Base interactions energy: -163.367 where: short stacking energy: -137.757 Base-Backbone interact. energy: -2.625 local terms energy: -314.654124 where: bonds (distance) C4'-P energy: -109.377 bonds (distance) P-C4' energy: -100.422 flat angles C4'-P-C4' energy: -64.933 flat angles P-C4'-P energy: -52.278 tors. eta vs tors. theta energy: 12.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1782.229127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1782.229127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.229127 (E_RNA) where: Base-Base interactions energy: -1170.891 where: short stacking energy: -520.409 Base-Backbone interact. energy: -1.968 local terms energy: -609.370248 where: bonds (distance) C4'-P energy: -123.081 bonds (distance) P-C4' energy: -127.008 flat angles C4'-P-C4' energy: -128.756 flat angles P-C4'-P energy: -82.281 tors. eta vs tors. theta energy: -148.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1481.058914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.058914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.058914 (E_RNA) where: Base-Base interactions energy: -915.617 where: short stacking energy: -448.666 Base-Backbone interact. energy: -3.171 local terms energy: -562.270466 where: bonds (distance) C4'-P energy: -119.566 bonds (distance) P-C4' energy: -118.783 flat angles C4'-P-C4' energy: -119.459 flat angles P-C4'-P energy: -80.573 tors. eta vs tors. theta energy: -123.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1459.866873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.866873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.866873 (E_RNA) where: Base-Base interactions energy: -904.946 where: short stacking energy: -436.611 Base-Backbone interact. energy: 0.121 local terms energy: -555.042178 where: bonds (distance) C4'-P energy: -114.682 bonds (distance) P-C4' energy: -122.767 flat angles C4'-P-C4' energy: -117.528 flat angles P-C4'-P energy: -80.815 tors. eta vs tors. theta energy: -119.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1196.832493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.832493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.832493 (E_RNA) where: Base-Base interactions energy: -695.400 where: short stacking energy: -331.692 Base-Backbone interact. energy: -0.733 local terms energy: -500.700101 where: bonds (distance) C4'-P energy: -113.797 bonds (distance) P-C4' energy: -117.355 flat angles C4'-P-C4' energy: -110.757 flat angles P-C4'-P energy: -76.869 tors. eta vs tors. theta energy: -81.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1051.160372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.160372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.160372 (E_RNA) where: Base-Base interactions energy: -591.266 where: short stacking energy: -324.292 Base-Backbone interact. energy: -1.547 local terms energy: -458.346969 where: bonds (distance) C4'-P energy: -101.636 bonds (distance) P-C4' energy: -121.336 flat angles C4'-P-C4' energy: -105.856 flat angles P-C4'-P energy: -70.184 tors. eta vs tors. theta energy: -59.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1011.159076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.159076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.159076 (E_RNA) where: Base-Base interactions energy: -582.105 where: short stacking energy: -281.020 Base-Backbone interact. energy: 1.381 local terms energy: -430.434995 where: bonds (distance) C4'-P energy: -107.534 bonds (distance) P-C4' energy: -106.649 flat angles C4'-P-C4' energy: -118.443 flat angles P-C4'-P energy: -72.086 tors. eta vs tors. theta energy: -25.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -791.543613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.543613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.543613 (E_RNA) where: Base-Base interactions energy: -378.781 where: short stacking energy: -223.997 Base-Backbone interact. energy: -0.577 local terms energy: -412.185148 where: bonds (distance) C4'-P energy: -113.555 bonds (distance) P-C4' energy: -100.927 flat angles C4'-P-C4' energy: -109.862 flat angles P-C4'-P energy: -62.668 tors. eta vs tors. theta energy: -25.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -527.822930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.822930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.822930 (E_RNA) where: Base-Base interactions energy: -200.067 where: short stacking energy: -171.110 Base-Backbone interact. energy: 6.387 local terms energy: -334.142550 where: bonds (distance) C4'-P energy: -89.572 bonds (distance) P-C4' energy: -116.306 flat angles C4'-P-C4' energy: -79.952 flat angles P-C4'-P energy: -47.465 tors. eta vs tors. theta energy: -0.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -515.556421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.556421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.556421 (E_RNA) where: Base-Base interactions energy: -209.162 where: short stacking energy: -159.201 Base-Backbone interact. energy: -0.924 local terms energy: -305.470589 where: bonds (distance) C4'-P energy: -96.886 bonds (distance) P-C4' energy: -83.821 flat angles C4'-P-C4' energy: -80.488 flat angles P-C4'-P energy: -64.929 tors. eta vs tors. theta energy: 20.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -451.520094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.520094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.520094 (E_RNA) where: Base-Base interactions energy: -171.045 where: short stacking energy: -142.220 Base-Backbone interact. energy: 4.654 local terms energy: -285.128767 where: bonds (distance) C4'-P energy: -96.072 bonds (distance) P-C4' energy: -97.620 flat angles C4'-P-C4' energy: -75.234 flat angles P-C4'-P energy: -48.757 tors. eta vs tors. theta energy: 32.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1824.234656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.234656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.234656 (E_RNA) where: Base-Base interactions energy: -1203.246 where: short stacking energy: -537.483 Base-Backbone interact. energy: -2.561 local terms energy: -618.428169 where: bonds (distance) C4'-P energy: -116.320 bonds (distance) P-C4' energy: -129.165 flat angles C4'-P-C4' energy: -139.165 flat angles P-C4'-P energy: -86.359 tors. eta vs tors. theta energy: -147.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1493.507812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.507812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.507812 (E_RNA) where: Base-Base interactions energy: -936.480 where: short stacking energy: -469.692 Base-Backbone interact. energy: -2.275 local terms energy: -554.753288 where: bonds (distance) C4'-P energy: -126.983 bonds (distance) P-C4' energy: -117.632 flat angles C4'-P-C4' energy: -122.943 flat angles P-C4'-P energy: -74.314 tors. eta vs tors. theta energy: -112.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1522.259268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.259268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.259268 (E_RNA) where: Base-Base interactions energy: -953.347 where: short stacking energy: -455.313 Base-Backbone interact. energy: -2.950 local terms energy: -565.962951 where: bonds (distance) C4'-P energy: -116.191 bonds (distance) P-C4' energy: -115.663 flat angles C4'-P-C4' energy: -123.595 flat angles P-C4'-P energy: -88.065 tors. eta vs tors. theta energy: -122.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1284.429373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.429373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.429373 (E_RNA) where: Base-Base interactions energy: -791.835 where: short stacking energy: -401.061 Base-Backbone interact. energy: 0.231 local terms energy: -492.825529 where: bonds (distance) C4'-P energy: -117.330 bonds (distance) P-C4' energy: -115.960 flat angles C4'-P-C4' energy: -104.849 flat angles P-C4'-P energy: -61.771 tors. eta vs tors. theta energy: -92.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1081.364530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.364530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.364530 (E_RNA) where: Base-Base interactions energy: -605.112 where: short stacking energy: -332.900 Base-Backbone interact. energy: -1.647 local terms energy: -474.605516 where: bonds (distance) C4'-P energy: -103.584 bonds (distance) P-C4' energy: -126.576 flat angles C4'-P-C4' energy: -110.583 flat angles P-C4'-P energy: -69.329 tors. eta vs tors. theta energy: -64.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1105.263821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.263821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.263821 (E_RNA) where: Base-Base interactions energy: -670.942 where: short stacking energy: -310.221 Base-Backbone interact. energy: 1.304 local terms energy: -435.625751 where: bonds (distance) C4'-P energy: -88.447 bonds (distance) P-C4' energy: -112.926 flat angles C4'-P-C4' energy: -109.561 flat angles P-C4'-P energy: -76.231 tors. eta vs tors. theta energy: -48.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -829.406014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.406014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.406014 (E_RNA) where: Base-Base interactions energy: -418.219 where: short stacking energy: -231.166 Base-Backbone interact. energy: 0.867 local terms energy: -412.053475 where: bonds (distance) C4'-P energy: -111.047 bonds (distance) P-C4' energy: -115.686 flat angles C4'-P-C4' energy: -97.846 flat angles P-C4'-P energy: -76.405 tors. eta vs tors. theta energy: -11.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -542.553787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.553787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.553787 (E_RNA) where: Base-Base interactions energy: -203.348 where: short stacking energy: -182.190 Base-Backbone interact. energy: 0.661 local terms energy: -339.866821 where: bonds (distance) C4'-P energy: -98.595 bonds (distance) P-C4' energy: -106.578 flat angles C4'-P-C4' energy: -77.923 flat angles P-C4'-P energy: -57.135 tors. eta vs tors. theta energy: 0.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -538.740790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.740790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.740790 (E_RNA) where: Base-Base interactions energy: -201.114 where: short stacking energy: -140.548 Base-Backbone interact. energy: 0.129 local terms energy: -337.755265 where: bonds (distance) C4'-P energy: -112.660 bonds (distance) P-C4' energy: -104.623 flat angles C4'-P-C4' energy: -90.470 flat angles P-C4'-P energy: -48.273 tors. eta vs tors. theta energy: 18.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -480.266527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.266527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.266527 (E_RNA) where: Base-Base interactions energy: -192.287 where: short stacking energy: -122.129 Base-Backbone interact. energy: 0.260 local terms energy: -288.239416 where: bonds (distance) C4'-P energy: -104.937 bonds (distance) P-C4' energy: -60.460 flat angles C4'-P-C4' energy: -67.288 flat angles P-C4'-P energy: -57.652 tors. eta vs tors. theta energy: 2.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1841.776418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1841.776418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1841.776418 (E_RNA) where: Base-Base interactions energy: -1212.832 where: short stacking energy: -552.192 Base-Backbone interact. energy: 0.653 local terms energy: -629.597141 where: bonds (distance) C4'-P energy: -119.224 bonds (distance) P-C4' energy: -130.388 flat angles C4'-P-C4' energy: -130.912 flat angles P-C4'-P energy: -96.684 tors. eta vs tors. theta energy: -152.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1627.438025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.438025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.438025 (E_RNA) where: Base-Base interactions energy: -1041.050 where: short stacking energy: -502.543 Base-Backbone interact. energy: -0.836 local terms energy: -585.552340 where: bonds (distance) C4'-P energy: -114.836 bonds (distance) P-C4' energy: -105.216 flat angles C4'-P-C4' energy: -130.023 flat angles P-C4'-P energy: -89.908 tors. eta vs tors. theta energy: -145.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1499.610989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.610989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.610989 (E_RNA) where: Base-Base interactions energy: -965.269 where: short stacking energy: -451.734 Base-Backbone interact. energy: -1.000 local terms energy: -533.341848 where: bonds (distance) C4'-P energy: -128.609 bonds (distance) P-C4' energy: -119.278 flat angles C4'-P-C4' energy: -106.720 flat angles P-C4'-P energy: -70.678 tors. eta vs tors. theta energy: -108.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1247.167704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.167704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.167704 (E_RNA) where: Base-Base interactions energy: -761.650 where: short stacking energy: -363.075 Base-Backbone interact. energy: -1.297 local terms energy: -484.220058 where: bonds (distance) C4'-P energy: -102.983 bonds (distance) P-C4' energy: -121.873 flat angles C4'-P-C4' energy: -116.769 flat angles P-C4'-P energy: -66.194 tors. eta vs tors. theta energy: -76.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1081.243305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.243305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.243305 (E_RNA) where: Base-Base interactions energy: -616.131 where: short stacking energy: -309.789 Base-Backbone interact. energy: -1.143 local terms energy: -463.968712 where: bonds (distance) C4'-P energy: -101.176 bonds (distance) P-C4' energy: -115.999 flat angles C4'-P-C4' energy: -98.097 flat angles P-C4'-P energy: -84.245 tors. eta vs tors. theta energy: -64.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1185.406404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.406404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.406404 (E_RNA) where: Base-Base interactions energy: -712.549 where: short stacking energy: -372.415 Base-Backbone interact. energy: 2.239 local terms energy: -475.096123 where: bonds (distance) C4'-P energy: -101.229 bonds (distance) P-C4' energy: -122.517 flat angles C4'-P-C4' energy: -112.410 flat angles P-C4'-P energy: -62.882 tors. eta vs tors. theta energy: -76.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -798.905824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.905824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.905824 (E_RNA) where: Base-Base interactions energy: -394.666 where: short stacking energy: -205.592 Base-Backbone interact. energy: -1.743 local terms energy: -402.496858 where: bonds (distance) C4'-P energy: -103.776 bonds (distance) P-C4' energy: -105.943 flat angles C4'-P-C4' energy: -92.526 flat angles P-C4'-P energy: -83.180 tors. eta vs tors. theta energy: -17.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -606.769883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.769883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.769883 (E_RNA) where: Base-Base interactions energy: -263.308 where: short stacking energy: -191.893 Base-Backbone interact. energy: -2.225 local terms energy: -341.236954 where: bonds (distance) C4'-P energy: -103.952 bonds (distance) P-C4' energy: -91.739 flat angles C4'-P-C4' energy: -100.799 flat angles P-C4'-P energy: -47.283 tors. eta vs tors. theta energy: 2.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -507.706839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.706839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.706839 (E_RNA) where: Base-Base interactions energy: -180.161 where: short stacking energy: -174.565 Base-Backbone interact. energy: -1.399 local terms energy: -326.147711 where: bonds (distance) C4'-P energy: -95.574 bonds (distance) P-C4' energy: -92.171 flat angles C4'-P-C4' energy: -114.499 flat angles P-C4'-P energy: -42.604 tors. eta vs tors. theta energy: 18.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -477.706124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.706124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.706124 (E_RNA) where: Base-Base interactions energy: -176.175 where: short stacking energy: -147.069 Base-Backbone interact. energy: -0.123 local terms energy: -301.407383 where: bonds (distance) C4'-P energy: -90.948 bonds (distance) P-C4' energy: -97.065 flat angles C4'-P-C4' energy: -79.181 flat angles P-C4'-P energy: -45.268 tors. eta vs tors. theta energy: 11.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1832.823792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1832.823792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1832.823792 (E_RNA) where: Base-Base interactions energy: -1165.545 where: short stacking energy: -503.314 Base-Backbone interact. energy: -4.585 local terms energy: -662.693749 where: bonds (distance) C4'-P energy: -136.635 bonds (distance) P-C4' energy: -134.148 flat angles C4'-P-C4' energy: -144.945 flat angles P-C4'-P energy: -101.520 tors. eta vs tors. theta energy: -145.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1609.885189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.885189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.885189 (E_RNA) where: Base-Base interactions energy: -1013.172 where: short stacking energy: -472.494 Base-Backbone interact. energy: -0.988 local terms energy: -595.725216 where: bonds (distance) C4'-P energy: -128.133 bonds (distance) P-C4' energy: -121.208 flat angles C4'-P-C4' energy: -136.028 flat angles P-C4'-P energy: -82.316 tors. eta vs tors. theta energy: -128.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1466.038922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.038922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.038922 (E_RNA) where: Base-Base interactions energy: -922.380 where: short stacking energy: -399.047 Base-Backbone interact. energy: -0.871 local terms energy: -542.787783 where: bonds (distance) C4'-P energy: -106.776 bonds (distance) P-C4' energy: -125.567 flat angles C4'-P-C4' energy: -135.964 flat angles P-C4'-P energy: -65.956 tors. eta vs tors. theta energy: -108.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1278.024919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.024919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.024919 (E_RNA) where: Base-Base interactions energy: -780.881 where: short stacking energy: -403.007 Base-Backbone interact. energy: -2.588 local terms energy: -494.555900 where: bonds (distance) C4'-P energy: -97.808 bonds (distance) P-C4' energy: -114.156 flat angles C4'-P-C4' energy: -126.506 flat angles P-C4'-P energy: -73.221 tors. eta vs tors. theta energy: -82.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1091.131465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.131465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.131465 (E_RNA) where: Base-Base interactions energy: -605.167 where: short stacking energy: -319.311 Base-Backbone interact. energy: 0.839 local terms energy: -486.803462 where: bonds (distance) C4'-P energy: -105.215 bonds (distance) P-C4' energy: -132.185 flat angles C4'-P-C4' energy: -109.688 flat angles P-C4'-P energy: -61.184 tors. eta vs tors. theta energy: -78.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1145.914042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.914042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.914042 (E_RNA) where: Base-Base interactions energy: -718.715 where: short stacking energy: -342.174 Base-Backbone interact. energy: 0.934 local terms energy: -428.132669 where: bonds (distance) C4'-P energy: -110.669 bonds (distance) P-C4' energy: -83.604 flat angles C4'-P-C4' energy: -99.825 flat angles P-C4'-P energy: -65.132 tors. eta vs tors. theta energy: -68.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -761.450665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.450665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.450665 (E_RNA) where: Base-Base interactions energy: -354.500 where: short stacking energy: -225.338 Base-Backbone interact. energy: -0.060 local terms energy: -406.891435 where: bonds (distance) C4'-P energy: -108.828 bonds (distance) P-C4' energy: -112.426 flat angles C4'-P-C4' energy: -103.784 flat angles P-C4'-P energy: -65.168 tors. eta vs tors. theta energy: -16.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -694.585241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.585241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.585241 (E_RNA) where: Base-Base interactions energy: -319.874 where: short stacking energy: -209.456 Base-Backbone interact. energy: 2.385 local terms energy: -377.096743 where: bonds (distance) C4'-P energy: -108.292 bonds (distance) P-C4' energy: -99.290 flat angles C4'-P-C4' energy: -103.122 flat angles P-C4'-P energy: -62.222 tors. eta vs tors. theta energy: -4.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -562.131041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.131041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.131041 (E_RNA) where: Base-Base interactions energy: -200.569 where: short stacking energy: -139.308 Base-Backbone interact. energy: -3.001 local terms energy: -358.560644 where: bonds (distance) C4'-P energy: -108.650 bonds (distance) P-C4' energy: -114.771 flat angles C4'-P-C4' energy: -98.179 flat angles P-C4'-P energy: -49.247 tors. eta vs tors. theta energy: 12.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -459.614009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.614009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.614009 (E_RNA) where: Base-Base interactions energy: -165.341 where: short stacking energy: -123.724 Base-Backbone interact. energy: -1.907 local terms energy: -292.365962 where: bonds (distance) C4'-P energy: -89.926 bonds (distance) P-C4' energy: -108.989 flat angles C4'-P-C4' energy: -78.312 flat angles P-C4'-P energy: -43.323 tors. eta vs tors. theta energy: 28.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1860.746298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.746298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.746298 (E_RNA) where: Base-Base interactions energy: -1231.007 where: short stacking energy: -565.475 Base-Backbone interact. energy: -2.652 local terms energy: -627.086603 where: bonds (distance) C4'-P energy: -126.315 bonds (distance) P-C4' energy: -114.725 flat angles C4'-P-C4' energy: -136.626 flat angles P-C4'-P energy: -92.437 tors. eta vs tors. theta energy: -156.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1714.348230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.348230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.348230 (E_RNA) where: Base-Base interactions energy: -1115.052 where: short stacking energy: -521.109 Base-Backbone interact. energy: -2.641 local terms energy: -596.656209 where: bonds (distance) C4'-P energy: -124.081 bonds (distance) P-C4' energy: -108.591 flat angles C4'-P-C4' energy: -128.837 flat angles P-C4'-P energy: -81.649 tors. eta vs tors. theta energy: -153.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1530.775798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.775798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.775798 (E_RNA) where: Base-Base interactions energy: -969.351 where: short stacking energy: -442.425 Base-Backbone interact. energy: -4.523 local terms energy: -556.901584 where: bonds (distance) C4'-P energy: -119.483 bonds (distance) P-C4' energy: -121.472 flat angles C4'-P-C4' energy: -127.950 flat angles P-C4'-P energy: -71.006 tors. eta vs tors. theta energy: -116.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1305.978341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.978341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.978341 (E_RNA) where: Base-Base interactions energy: -809.241 where: short stacking energy: -391.063 Base-Backbone interact. energy: -3.687 local terms energy: -493.050549 where: bonds (distance) C4'-P energy: -97.421 bonds (distance) P-C4' energy: -122.022 flat angles C4'-P-C4' energy: -112.510 flat angles P-C4'-P energy: -70.187 tors. eta vs tors. theta energy: -90.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1059.816565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.816565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.816565 (E_RNA) where: Base-Base interactions energy: -631.744 where: short stacking energy: -309.448 Base-Backbone interact. energy: 3.089 local terms energy: -431.161509 where: bonds (distance) C4'-P energy: -103.529 bonds (distance) P-C4' energy: -99.322 flat angles C4'-P-C4' energy: -113.329 flat angles P-C4'-P energy: -65.177 tors. eta vs tors. theta energy: -49.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1135.410970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.410970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.410970 (E_RNA) where: Base-Base interactions energy: -688.077 where: short stacking energy: -320.816 Base-Backbone interact. energy: -3.162 local terms energy: -444.171810 where: bonds (distance) C4'-P energy: -120.011 bonds (distance) P-C4' energy: -112.067 flat angles C4'-P-C4' energy: -102.028 flat angles P-C4'-P energy: -63.590 tors. eta vs tors. theta energy: -46.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -838.146978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.146978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.146978 (E_RNA) where: Base-Base interactions energy: -437.562 where: short stacking energy: -233.127 Base-Backbone interact. energy: -0.206 local terms energy: -400.378875 where: bonds (distance) C4'-P energy: -125.894 bonds (distance) P-C4' energy: -96.603 flat angles C4'-P-C4' energy: -97.774 flat angles P-C4'-P energy: -71.131 tors. eta vs tors. theta energy: -8.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -681.641685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.641685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.641685 (E_RNA) where: Base-Base interactions energy: -295.242 where: short stacking energy: -196.953 Base-Backbone interact. energy: 0.079 local terms energy: -386.479333 where: bonds (distance) C4'-P energy: -98.196 bonds (distance) P-C4' energy: -117.111 flat angles C4'-P-C4' energy: -96.099 flat angles P-C4'-P energy: -60.598 tors. eta vs tors. theta energy: -14.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -561.206919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.206919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.206919 (E_RNA) where: Base-Base interactions energy: -173.320 where: short stacking energy: -155.422 Base-Backbone interact. energy: 1.401 local terms energy: -389.288808 where: bonds (distance) C4'-P energy: -110.731 bonds (distance) P-C4' energy: -117.052 flat angles C4'-P-C4' energy: -100.176 flat angles P-C4'-P energy: -69.252 tors. eta vs tors. theta energy: 7.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -469.518325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.518325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.518325 (E_RNA) where: Base-Base interactions energy: -159.420 where: short stacking energy: -134.689 Base-Backbone interact. energy: 2.492 local terms energy: -312.590603 where: bonds (distance) C4'-P energy: -98.780 bonds (distance) P-C4' energy: -117.422 flat angles C4'-P-C4' energy: -84.349 flat angles P-C4'-P energy: -29.719 tors. eta vs tors. theta energy: 17.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1860.324015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.324015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.324015 (E_RNA) where: Base-Base interactions energy: -1250.042 where: short stacking energy: -527.596 Base-Backbone interact. energy: -3.758 local terms energy: -606.523656 where: bonds (distance) C4'-P energy: -108.173 bonds (distance) P-C4' energy: -120.649 flat angles C4'-P-C4' energy: -146.285 flat angles P-C4'-P energy: -88.370 tors. eta vs tors. theta energy: -143.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1685.075803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.075803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.075803 (E_RNA) where: Base-Base interactions energy: -1086.322 where: short stacking energy: -497.330 Base-Backbone interact. energy: -1.697 local terms energy: -597.056305 where: bonds (distance) C4'-P energy: -117.991 bonds (distance) P-C4' energy: -130.362 flat angles C4'-P-C4' energy: -131.915 flat angles P-C4'-P energy: -81.108 tors. eta vs tors. theta energy: -135.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1490.189968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.189968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.189968 (E_RNA) where: Base-Base interactions energy: -974.898 where: short stacking energy: -450.533 Base-Backbone interact. energy: -2.137 local terms energy: -513.155200 where: bonds (distance) C4'-P energy: -117.712 bonds (distance) P-C4' energy: -100.578 flat angles C4'-P-C4' energy: -113.190 flat angles P-C4'-P energy: -77.498 tors. eta vs tors. theta energy: -104.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1354.051229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.051229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.051229 (E_RNA) where: Base-Base interactions energy: -831.036 where: short stacking energy: -393.070 Base-Backbone interact. energy: 0.990 local terms energy: -524.004345 where: bonds (distance) C4'-P energy: -114.980 bonds (distance) P-C4' energy: -115.246 flat angles C4'-P-C4' energy: -121.234 flat angles P-C4'-P energy: -78.067 tors. eta vs tors. theta energy: -94.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1138.489484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.489484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.489484 (E_RNA) where: Base-Base interactions energy: -672.782 where: short stacking energy: -320.572 Base-Backbone interact. energy: -1.730 local terms energy: -463.978093 where: bonds (distance) C4'-P energy: -114.685 bonds (distance) P-C4' energy: -114.043 flat angles C4'-P-C4' energy: -101.588 flat angles P-C4'-P energy: -71.832 tors. eta vs tors. theta energy: -61.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1054.642776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.642776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.642776 (E_RNA) where: Base-Base interactions energy: -616.304 where: short stacking energy: -311.865 Base-Backbone interact. energy: -0.929 local terms energy: -437.409848 where: bonds (distance) C4'-P energy: -100.375 bonds (distance) P-C4' energy: -104.674 flat angles C4'-P-C4' energy: -98.075 flat angles P-C4'-P energy: -67.117 tors. eta vs tors. theta energy: -67.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -777.373751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.373751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.373751 (E_RNA) where: Base-Base interactions energy: -384.249 where: short stacking energy: -222.294 Base-Backbone interact. energy: -2.370 local terms energy: -390.754926 where: bonds (distance) C4'-P energy: -114.958 bonds (distance) P-C4' energy: -105.898 flat angles C4'-P-C4' energy: -89.769 flat angles P-C4'-P energy: -60.375 tors. eta vs tors. theta energy: -19.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -586.994092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.994092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.994092 (E_RNA) where: Base-Base interactions energy: -252.047 where: short stacking energy: -177.512 Base-Backbone interact. energy: -3.025 local terms energy: -331.921607 where: bonds (distance) C4'-P energy: -103.971 bonds (distance) P-C4' energy: -106.759 flat angles C4'-P-C4' energy: -87.401 flat angles P-C4'-P energy: -38.974 tors. eta vs tors. theta energy: 5.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -495.363447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.363447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.363447 (E_RNA) where: Base-Base interactions energy: -177.138 where: short stacking energy: -134.969 Base-Backbone interact. energy: -0.163 local terms energy: -318.062828 where: bonds (distance) C4'-P energy: -87.985 bonds (distance) P-C4' energy: -97.097 flat angles C4'-P-C4' energy: -95.111 flat angles P-C4'-P energy: -52.923 tors. eta vs tors. theta energy: 15.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -472.544386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.544386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.544386 (E_RNA) where: Base-Base interactions energy: -157.226 where: short stacking energy: -137.201 Base-Backbone interact. energy: 2.623 local terms energy: -317.941653 where: bonds (distance) C4'-P energy: -97.262 bonds (distance) P-C4' energy: -100.908 flat angles C4'-P-C4' energy: -74.616 flat angles P-C4'-P energy: -52.978 tors. eta vs tors. theta energy: 7.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1905.108842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1905.108842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1905.108842 (E_RNA) where: Base-Base interactions energy: -1285.590 where: short stacking energy: -597.060 Base-Backbone interact. energy: -0.536 local terms energy: -618.982331 where: bonds (distance) C4'-P energy: -118.258 bonds (distance) P-C4' energy: -119.858 flat angles C4'-P-C4' energy: -142.193 flat angles P-C4'-P energy: -82.456 tors. eta vs tors. theta energy: -156.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1681.150765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.150765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.150765 (E_RNA) where: Base-Base interactions energy: -1099.775 where: short stacking energy: -511.530 Base-Backbone interact. energy: -1.647 local terms energy: -579.728704 where: bonds (distance) C4'-P energy: -111.629 bonds (distance) P-C4' energy: -120.182 flat angles C4'-P-C4' energy: -135.863 flat angles P-C4'-P energy: -78.138 tors. eta vs tors. theta energy: -133.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1511.870079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.870079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.870079 (E_RNA) where: Base-Base interactions energy: -970.367 where: short stacking energy: -441.991 Base-Backbone interact. energy: -3.236 local terms energy: -538.267272 where: bonds (distance) C4'-P energy: -109.328 bonds (distance) P-C4' energy: -120.836 flat angles C4'-P-C4' energy: -134.204 flat angles P-C4'-P energy: -63.541 tors. eta vs tors. theta energy: -110.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1310.013038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.013038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.013038 (E_RNA) where: Base-Base interactions energy: -799.566 where: short stacking energy: -402.672 Base-Backbone interact. energy: -0.111 local terms energy: -510.336240 where: bonds (distance) C4'-P energy: -108.251 bonds (distance) P-C4' energy: -115.760 flat angles C4'-P-C4' energy: -108.046 flat angles P-C4'-P energy: -83.819 tors. eta vs tors. theta energy: -94.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1194.695814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.695814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.695814 (E_RNA) where: Base-Base interactions energy: -736.757 where: short stacking energy: -327.268 Base-Backbone interact. energy: 1.182 local terms energy: -459.120384 where: bonds (distance) C4'-P energy: -118.805 bonds (distance) P-C4' energy: -110.618 flat angles C4'-P-C4' energy: -108.201 flat angles P-C4'-P energy: -62.021 tors. eta vs tors. theta energy: -59.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1047.390145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.390145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.390145 (E_RNA) where: Base-Base interactions energy: -644.887 where: short stacking energy: -318.767 Base-Backbone interact. energy: 0.090 local terms energy: -402.592766 where: bonds (distance) C4'-P energy: -99.969 bonds (distance) P-C4' energy: -101.663 flat angles C4'-P-C4' energy: -83.966 flat angles P-C4'-P energy: -71.954 tors. eta vs tors. theta energy: -45.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -777.757984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.757984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.757984 (E_RNA) where: Base-Base interactions energy: -380.676 where: short stacking energy: -219.234 Base-Backbone interact. energy: 4.587 local terms energy: -401.668568 where: bonds (distance) C4'-P energy: -116.105 bonds (distance) P-C4' energy: -105.983 flat angles C4'-P-C4' energy: -88.807 flat angles P-C4'-P energy: -78.800 tors. eta vs tors. theta energy: -11.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -643.381264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.381264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.381264 (E_RNA) where: Base-Base interactions energy: -310.760 where: short stacking energy: -189.844 Base-Backbone interact. energy: 0.731 local terms energy: -333.352573 where: bonds (distance) C4'-P energy: -76.184 bonds (distance) P-C4' energy: -110.809 flat angles C4'-P-C4' energy: -80.669 flat angles P-C4'-P energy: -58.184 tors. eta vs tors. theta energy: -7.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -505.372022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.372022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.372022 (E_RNA) where: Base-Base interactions energy: -169.325 where: short stacking energy: -132.811 Base-Backbone interact. energy: 1.979 local terms energy: -338.026217 where: bonds (distance) C4'-P energy: -102.824 bonds (distance) P-C4' energy: -105.725 flat angles C4'-P-C4' energy: -92.038 flat angles P-C4'-P energy: -61.780 tors. eta vs tors. theta energy: 24.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -469.039966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.039966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.039966 (E_RNA) where: Base-Base interactions energy: -159.871 where: short stacking energy: -124.561 Base-Backbone interact. energy: 1.230 local terms energy: -310.398758 where: bonds (distance) C4'-P energy: -113.650 bonds (distance) P-C4' energy: -83.141 flat angles C4'-P-C4' energy: -90.039 flat angles P-C4'-P energy: -60.973 tors. eta vs tors. theta energy: 37.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1875.690038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.690038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.690038 (E_RNA) where: Base-Base interactions energy: -1235.122 where: short stacking energy: -570.414 Base-Backbone interact. energy: -0.946 local terms energy: -639.622963 where: bonds (distance) C4'-P energy: -124.326 bonds (distance) P-C4' energy: -118.953 flat angles C4'-P-C4' energy: -137.885 flat angles P-C4'-P energy: -95.063 tors. eta vs tors. theta energy: -163.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1697.100642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.100642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.100642 (E_RNA) where: Base-Base interactions energy: -1115.687 where: short stacking energy: -522.343 Base-Backbone interact. energy: -1.516 local terms energy: -579.897270 where: bonds (distance) C4'-P energy: -111.863 bonds (distance) P-C4' energy: -116.058 flat angles C4'-P-C4' energy: -125.646 flat angles P-C4'-P energy: -81.993 tors. eta vs tors. theta energy: -144.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1529.237855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.237855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.237855 (E_RNA) where: Base-Base interactions energy: -1020.016 where: short stacking energy: -458.665 Base-Backbone interact. energy: -2.990 local terms energy: -506.231873 where: bonds (distance) C4'-P energy: -119.780 bonds (distance) P-C4' energy: -96.911 flat angles C4'-P-C4' energy: -118.456 flat angles P-C4'-P energy: -64.639 tors. eta vs tors. theta energy: -106.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1322.174189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.174189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.174189 (E_RNA) where: Base-Base interactions energy: -811.747 where: short stacking energy: -391.631 Base-Backbone interact. energy: -3.099 local terms energy: -507.327870 where: bonds (distance) C4'-P energy: -110.770 bonds (distance) P-C4' energy: -121.480 flat angles C4'-P-C4' energy: -109.431 flat angles P-C4'-P energy: -71.339 tors. eta vs tors. theta energy: -94.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1158.620466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.620466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.620466 (E_RNA) where: Base-Base interactions energy: -725.219 where: short stacking energy: -326.015 Base-Backbone interact. energy: -1.035 local terms energy: -432.365803 where: bonds (distance) C4'-P energy: -112.695 bonds (distance) P-C4' energy: -108.045 flat angles C4'-P-C4' energy: -104.538 flat angles P-C4'-P energy: -57.073 tors. eta vs tors. theta energy: -50.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1104.935543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.935543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.935543 (E_RNA) where: Base-Base interactions energy: -635.402 where: short stacking energy: -326.957 Base-Backbone interact. energy: -1.282 local terms energy: -468.251450 where: bonds (distance) C4'-P energy: -109.153 bonds (distance) P-C4' energy: -107.589 flat angles C4'-P-C4' energy: -123.918 flat angles P-C4'-P energy: -78.330 tors. eta vs tors. theta energy: -49.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -810.224658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.224658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.224658 (E_RNA) where: Base-Base interactions energy: -413.985 where: short stacking energy: -236.334 Base-Backbone interact. energy: 1.829 local terms energy: -398.068843 where: bonds (distance) C4'-P energy: -110.525 bonds (distance) P-C4' energy: -107.868 flat angles C4'-P-C4' energy: -111.081 flat angles P-C4'-P energy: -46.391 tors. eta vs tors. theta energy: -22.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -713.122553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.122553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.122553 (E_RNA) where: Base-Base interactions energy: -324.442 where: short stacking energy: -201.936 Base-Backbone interact. energy: -2.382 local terms energy: -386.298720 where: bonds (distance) C4'-P energy: -111.288 bonds (distance) P-C4' energy: -100.398 flat angles C4'-P-C4' energy: -103.376 flat angles P-C4'-P energy: -62.947 tors. eta vs tors. theta energy: -8.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -509.264578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.264578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.264578 (E_RNA) where: Base-Base interactions energy: -167.931 where: short stacking energy: -141.339 Base-Backbone interact. energy: 2.957 local terms energy: -344.290130 where: bonds (distance) C4'-P energy: -81.790 bonds (distance) P-C4' energy: -126.421 flat angles C4'-P-C4' energy: -87.928 flat angles P-C4'-P energy: -50.788 tors. eta vs tors. theta energy: 2.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -455.081324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.081324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.081324 (E_RNA) where: Base-Base interactions energy: -176.638 where: short stacking energy: -124.813 Base-Backbone interact. energy: 0.764 local terms energy: -279.207318 where: bonds (distance) C4'-P energy: -82.534 bonds (distance) P-C4' energy: -94.563 flat angles C4'-P-C4' energy: -76.564 flat angles P-C4'-P energy: -37.478 tors. eta vs tors. theta energy: 11.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1929.629054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.629054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.629054 (E_RNA) where: Base-Base interactions energy: -1286.243 where: short stacking energy: -599.357 Base-Backbone interact. energy: 0.903 local terms energy: -644.289337 where: bonds (distance) C4'-P energy: -125.785 bonds (distance) P-C4' energy: -110.976 flat angles C4'-P-C4' energy: -137.585 flat angles P-C4'-P energy: -94.375 tors. eta vs tors. theta energy: -175.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1695.299674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.299674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.299674 (E_RNA) where: Base-Base interactions energy: -1103.058 where: short stacking energy: -510.692 Base-Backbone interact. energy: -0.971 local terms energy: -591.270443 where: bonds (distance) C4'-P energy: -130.517 bonds (distance) P-C4' energy: -121.808 flat angles C4'-P-C4' energy: -131.274 flat angles P-C4'-P energy: -81.520 tors. eta vs tors. theta energy: -126.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1528.785508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.785508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.785508 (E_RNA) where: Base-Base interactions energy: -980.609 where: short stacking energy: -438.602 Base-Backbone interact. energy: -2.473 local terms energy: -545.703452 where: bonds (distance) C4'-P energy: -111.717 bonds (distance) P-C4' energy: -113.166 flat angles C4'-P-C4' energy: -117.649 flat angles P-C4'-P energy: -94.185 tors. eta vs tors. theta energy: -108.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1321.761356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.761356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.761356 (E_RNA) where: Base-Base interactions energy: -803.197 where: short stacking energy: -364.275 Base-Backbone interact. energy: -0.578 local terms energy: -517.986271 where: bonds (distance) C4'-P energy: -123.970 bonds (distance) P-C4' energy: -113.282 flat angles C4'-P-C4' energy: -127.943 flat angles P-C4'-P energy: -76.975 tors. eta vs tors. theta energy: -75.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1209.092643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.092643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.092643 (E_RNA) where: Base-Base interactions energy: -715.797 where: short stacking energy: -364.368 Base-Backbone interact. energy: -0.427 local terms energy: -492.868292 where: bonds (distance) C4'-P energy: -102.175 bonds (distance) P-C4' energy: -118.017 flat angles C4'-P-C4' energy: -107.621 flat angles P-C4'-P energy: -70.937 tors. eta vs tors. theta energy: -94.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1116.825927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1116.825927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.825927 (E_RNA) where: Base-Base interactions energy: -636.456 where: short stacking energy: -315.711 Base-Backbone interact. energy: -1.942 local terms energy: -478.427545 where: bonds (distance) C4'-P energy: -109.734 bonds (distance) P-C4' energy: -118.781 flat angles C4'-P-C4' energy: -119.086 flat angles P-C4'-P energy: -67.652 tors. eta vs tors. theta energy: -63.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -827.201864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.201864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.201864 (E_RNA) where: Base-Base interactions energy: -451.488 where: short stacking energy: -242.718 Base-Backbone interact. energy: 2.106 local terms energy: -377.819711 where: bonds (distance) C4'-P energy: -83.193 bonds (distance) P-C4' energy: -113.623 flat angles C4'-P-C4' energy: -91.423 flat angles P-C4'-P energy: -53.159 tors. eta vs tors. theta energy: -36.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -679.204056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.204056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.204056 (E_RNA) where: Base-Base interactions energy: -343.037 where: short stacking energy: -203.712 Base-Backbone interact. energy: -0.491 local terms energy: -335.676363 where: bonds (distance) C4'-P energy: -85.824 bonds (distance) P-C4' energy: -92.619 flat angles C4'-P-C4' energy: -94.740 flat angles P-C4'-P energy: -60.125 tors. eta vs tors. theta energy: -2.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -499.362916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.362916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.362916 (E_RNA) where: Base-Base interactions energy: -145.207 where: short stacking energy: -130.172 Base-Backbone interact. energy: 6.513 local terms energy: -360.668256 where: bonds (distance) C4'-P energy: -102.967 bonds (distance) P-C4' energy: -121.322 flat angles C4'-P-C4' energy: -91.233 flat angles P-C4'-P energy: -63.734 tors. eta vs tors. theta energy: 18.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -477.143336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.143336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.143336 (E_RNA) where: Base-Base interactions energy: -148.670 where: short stacking energy: -113.012 Base-Backbone interact. energy: 0.294 local terms energy: -328.767393 where: bonds (distance) C4'-P energy: -112.271 bonds (distance) P-C4' energy: -100.802 flat angles C4'-P-C4' energy: -81.795 flat angles P-C4'-P energy: -53.584 tors. eta vs tors. theta energy: 19.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1930.382252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1930.382252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1930.382252 (E_RNA) where: Base-Base interactions energy: -1297.739 where: short stacking energy: -561.406 Base-Backbone interact. energy: -3.303 local terms energy: -629.340270 where: bonds (distance) C4'-P energy: -120.384 bonds (distance) P-C4' energy: -122.439 flat angles C4'-P-C4' energy: -137.054 flat angles P-C4'-P energy: -83.941 tors. eta vs tors. theta energy: -165.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1696.547728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.547728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.547728 (E_RNA) where: Base-Base interactions energy: -1107.812 where: short stacking energy: -519.523 Base-Backbone interact. energy: -4.161 local terms energy: -584.575036 where: bonds (distance) C4'-P energy: -109.542 bonds (distance) P-C4' energy: -121.037 flat angles C4'-P-C4' energy: -131.591 flat angles P-C4'-P energy: -75.157 tors. eta vs tors. theta energy: -147.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1532.081379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.081379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.081379 (E_RNA) where: Base-Base interactions energy: -970.679 where: short stacking energy: -453.158 Base-Backbone interact. energy: -4.175 local terms energy: -557.227988 where: bonds (distance) C4'-P energy: -114.253 bonds (distance) P-C4' energy: -113.595 flat angles C4'-P-C4' energy: -125.447 flat angles P-C4'-P energy: -82.223 tors. eta vs tors. theta energy: -121.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1319.122588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.122588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.122588 (E_RNA) where: Base-Base interactions energy: -819.983 where: short stacking energy: -373.669 Base-Backbone interact. energy: -0.303 local terms energy: -498.836718 where: bonds (distance) C4'-P energy: -105.332 bonds (distance) P-C4' energy: -115.148 flat angles C4'-P-C4' energy: -116.526 flat angles P-C4'-P energy: -73.262 tors. eta vs tors. theta energy: -88.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1223.392140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.392140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.392140 (E_RNA) where: Base-Base interactions energy: -747.655 where: short stacking energy: -354.949 Base-Backbone interact. energy: -0.185 local terms energy: -475.552486 where: bonds (distance) C4'-P energy: -115.791 bonds (distance) P-C4' energy: -100.102 flat angles C4'-P-C4' energy: -120.775 flat angles P-C4'-P energy: -62.851 tors. eta vs tors. theta energy: -76.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1117.201571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.201571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.201571 (E_RNA) where: Base-Base interactions energy: -670.642 where: short stacking energy: -326.993 Base-Backbone interact. energy: -1.174 local terms energy: -445.386059 where: bonds (distance) C4'-P energy: -114.820 bonds (distance) P-C4' energy: -96.878 flat angles C4'-P-C4' energy: -109.947 flat angles P-C4'-P energy: -64.829 tors. eta vs tors. theta energy: -58.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -835.279801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.279801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.279801 (E_RNA) where: Base-Base interactions energy: -445.465 where: short stacking energy: -253.188 Base-Backbone interact. energy: 0.464 local terms energy: -390.278381 where: bonds (distance) C4'-P energy: -93.971 bonds (distance) P-C4' energy: -92.865 flat angles C4'-P-C4' energy: -108.991 flat angles P-C4'-P energy: -60.526 tors. eta vs tors. theta energy: -33.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -772.014007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.014007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.014007 (E_RNA) where: Base-Base interactions energy: -401.056 where: short stacking energy: -220.703 Base-Backbone interact. energy: -1.041 local terms energy: -369.917257 where: bonds (distance) C4'-P energy: -80.087 bonds (distance) P-C4' energy: -115.930 flat angles C4'-P-C4' energy: -101.309 flat angles P-C4'-P energy: -51.009 tors. eta vs tors. theta energy: -21.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -513.248608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.248608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.248608 (E_RNA) where: Base-Base interactions energy: -194.292 where: short stacking energy: -157.010 Base-Backbone interact. energy: -0.039 local terms energy: -318.916844 where: bonds (distance) C4'-P energy: -87.796 bonds (distance) P-C4' energy: -97.857 flat angles C4'-P-C4' energy: -95.285 flat angles P-C4'-P energy: -41.332 tors. eta vs tors. theta energy: 3.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -450.392489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.392489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.392489 (E_RNA) where: Base-Base interactions energy: -175.269 where: short stacking energy: -123.732 Base-Backbone interact. energy: 4.119 local terms energy: -279.241731 where: bonds (distance) C4'-P energy: -98.101 bonds (distance) P-C4' energy: -95.583 flat angles C4'-P-C4' energy: -68.190 flat angles P-C4'-P energy: -51.603 tors. eta vs tors. theta energy: 34.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1921.810936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1921.810936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1921.810936 (E_RNA) where: Base-Base interactions energy: -1307.799 where: short stacking energy: -587.112 Base-Backbone interact. energy: -1.432 local terms energy: -612.580006 where: bonds (distance) C4'-P energy: -110.266 bonds (distance) P-C4' energy: -122.058 flat angles C4'-P-C4' energy: -139.791 flat angles P-C4'-P energy: -87.891 tors. eta vs tors. theta energy: -152.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1655.912894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.912894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.912894 (E_RNA) where: Base-Base interactions energy: -1092.761 where: short stacking energy: -467.695 Base-Backbone interact. energy: -5.690 local terms energy: -557.462077 where: bonds (distance) C4'-P energy: -107.386 bonds (distance) P-C4' energy: -126.460 flat angles C4'-P-C4' energy: -115.675 flat angles P-C4'-P energy: -77.670 tors. eta vs tors. theta energy: -130.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1492.081976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.081976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.081976 (E_RNA) where: Base-Base interactions energy: -949.608 where: short stacking energy: -420.442 Base-Backbone interact. energy: -5.333 local terms energy: -537.141011 where: bonds (distance) C4'-P energy: -125.649 bonds (distance) P-C4' energy: -120.593 flat angles C4'-P-C4' energy: -133.465 flat angles P-C4'-P energy: -69.076 tors. eta vs tors. theta energy: -88.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1390.049820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.049820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.049820 (E_RNA) where: Base-Base interactions energy: -849.903 where: short stacking energy: -404.776 Base-Backbone interact. energy: -0.299 local terms energy: -539.847490 where: bonds (distance) C4'-P energy: -111.331 bonds (distance) P-C4' energy: -123.057 flat angles C4'-P-C4' energy: -125.114 flat angles P-C4'-P energy: -82.337 tors. eta vs tors. theta energy: -98.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1212.654670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.654670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.654670 (E_RNA) where: Base-Base interactions energy: -746.331 where: short stacking energy: -364.479 Base-Backbone interact. energy: 4.870 local terms energy: -471.193798 where: bonds (distance) C4'-P energy: -100.090 bonds (distance) P-C4' energy: -106.855 flat angles C4'-P-C4' energy: -117.764 flat angles P-C4'-P energy: -78.865 tors. eta vs tors. theta energy: -67.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1110.633015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.633015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.633015 (E_RNA) where: Base-Base interactions energy: -641.870 where: short stacking energy: -312.683 Base-Backbone interact. energy: 0.095 local terms energy: -468.857589 where: bonds (distance) C4'-P energy: -99.082 bonds (distance) P-C4' energy: -109.705 flat angles C4'-P-C4' energy: -107.480 flat angles P-C4'-P energy: -70.663 tors. eta vs tors. theta energy: -81.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -827.411799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.411799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.411799 (E_RNA) where: Base-Base interactions energy: -419.671 where: short stacking energy: -251.534 Base-Backbone interact. energy: 1.307 local terms energy: -409.048134 where: bonds (distance) C4'-P energy: -108.841 bonds (distance) P-C4' energy: -110.687 flat angles C4'-P-C4' energy: -95.472 flat angles P-C4'-P energy: -58.853 tors. eta vs tors. theta energy: -35.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -685.908046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.908046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.908046 (E_RNA) where: Base-Base interactions energy: -341.732 where: short stacking energy: -192.785 Base-Backbone interact. energy: -1.688 local terms energy: -342.488232 where: bonds (distance) C4'-P energy: -74.771 bonds (distance) P-C4' energy: -100.775 flat angles C4'-P-C4' energy: -98.970 flat angles P-C4'-P energy: -58.185 tors. eta vs tors. theta energy: -9.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -515.920379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.920379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.920379 (E_RNA) where: Base-Base interactions energy: -181.618 where: short stacking energy: -131.060 Base-Backbone interact. energy: 3.898 local terms energy: -338.199881 where: bonds (distance) C4'-P energy: -106.731 bonds (distance) P-C4' energy: -108.359 flat angles C4'-P-C4' energy: -98.827 flat angles P-C4'-P energy: -37.684 tors. eta vs tors. theta energy: 13.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -485.068479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.068479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.068479 (E_RNA) where: Base-Base interactions energy: -169.409 where: short stacking energy: -131.840 Base-Backbone interact. energy: 5.845 local terms energy: -321.503900 where: bonds (distance) C4'-P energy: -106.039 bonds (distance) P-C4' energy: -119.215 flat angles C4'-P-C4' energy: -73.354 flat angles P-C4'-P energy: -39.122 tors. eta vs tors. theta energy: 16.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1915.793646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.793646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.793646 (E_RNA) where: Base-Base interactions energy: -1275.597 where: short stacking energy: -563.245 Base-Backbone interact. energy: -2.632 local terms energy: -637.564481 where: bonds (distance) C4'-P energy: -117.255 bonds (distance) P-C4' energy: -119.877 flat angles C4'-P-C4' energy: -143.077 flat angles P-C4'-P energy: -96.953 tors. eta vs tors. theta energy: -160.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1709.800765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.800765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.800765 (E_RNA) where: Base-Base interactions energy: -1115.782 where: short stacking energy: -497.713 Base-Backbone interact. energy: -0.099 local terms energy: -593.919282 where: bonds (distance) C4'-P energy: -120.935 bonds (distance) P-C4' energy: -118.282 flat angles C4'-P-C4' energy: -130.179 flat angles P-C4'-P energy: -86.560 tors. eta vs tors. theta energy: -137.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1558.592027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.592027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.592027 (E_RNA) where: Base-Base interactions energy: -1015.315 where: short stacking energy: -463.082 Base-Backbone interact. energy: -1.389 local terms energy: -541.888169 where: bonds (distance) C4'-P energy: -104.211 bonds (distance) P-C4' energy: -129.458 flat angles C4'-P-C4' energy: -120.278 flat angles P-C4'-P energy: -77.796 tors. eta vs tors. theta energy: -110.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1367.795938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.795938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.795938 (E_RNA) where: Base-Base interactions energy: -842.802 where: short stacking energy: -430.999 Base-Backbone interact. energy: -0.918 local terms energy: -524.075267 where: bonds (distance) C4'-P energy: -106.474 bonds (distance) P-C4' energy: -114.714 flat angles C4'-P-C4' energy: -122.045 flat angles P-C4'-P energy: -76.278 tors. eta vs tors. theta energy: -104.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1219.464497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.464497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.464497 (E_RNA) where: Base-Base interactions energy: -722.757 where: short stacking energy: -356.475 Base-Backbone interact. energy: 1.440 local terms energy: -498.148294 where: bonds (distance) C4'-P energy: -119.848 bonds (distance) P-C4' energy: -110.255 flat angles C4'-P-C4' energy: -111.063 flat angles P-C4'-P energy: -74.133 tors. eta vs tors. theta energy: -82.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1124.742800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.742800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.742800 (E_RNA) where: Base-Base interactions energy: -680.142 where: short stacking energy: -325.346 Base-Backbone interact. energy: -0.384 local terms energy: -444.217157 where: bonds (distance) C4'-P energy: -93.248 bonds (distance) P-C4' energy: -128.217 flat angles C4'-P-C4' energy: -110.136 flat angles P-C4'-P energy: -59.036 tors. eta vs tors. theta energy: -53.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -836.874601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.874601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.874601 (E_RNA) where: Base-Base interactions energy: -417.622 where: short stacking energy: -218.879 Base-Backbone interact. energy: 0.990 local terms energy: -420.242575 where: bonds (distance) C4'-P energy: -103.330 bonds (distance) P-C4' energy: -123.923 flat angles C4'-P-C4' energy: -92.264 flat angles P-C4'-P energy: -74.786 tors. eta vs tors. theta energy: -25.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -709.743225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.743225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.743225 (E_RNA) where: Base-Base interactions energy: -343.082 where: short stacking energy: -189.827 Base-Backbone interact. energy: 1.665 local terms energy: -368.325953 where: bonds (distance) C4'-P energy: -91.442 bonds (distance) P-C4' energy: -107.558 flat angles C4'-P-C4' energy: -84.027 flat angles P-C4'-P energy: -66.527 tors. eta vs tors. theta energy: -18.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -516.915256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.915256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.915256 (E_RNA) where: Base-Base interactions energy: -217.281 where: short stacking energy: -160.196 Base-Backbone interact. energy: 2.501 local terms energy: -302.135007 where: bonds (distance) C4'-P energy: -109.595 bonds (distance) P-C4' energy: -94.920 flat angles C4'-P-C4' energy: -77.222 flat angles P-C4'-P energy: -38.965 tors. eta vs tors. theta energy: 18.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -478.627008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.627008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.627008 (E_RNA) where: Base-Base interactions energy: -157.265 where: short stacking energy: -141.452 Base-Backbone interact. energy: 1.561 local terms energy: -322.922905 where: bonds (distance) C4'-P energy: -110.813 bonds (distance) P-C4' energy: -119.872 flat angles C4'-P-C4' energy: -81.297 flat angles P-C4'-P energy: -28.512 tors. eta vs tors. theta energy: 17.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1925.318148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1925.318148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1925.318148 (E_RNA) where: Base-Base interactions energy: -1275.955 where: short stacking energy: -558.126 Base-Backbone interact. energy: -1.348 local terms energy: -648.015231 where: bonds (distance) C4'-P energy: -116.502 bonds (distance) P-C4' energy: -131.406 flat angles C4'-P-C4' energy: -150.498 flat angles P-C4'-P energy: -95.771 tors. eta vs tors. theta energy: -153.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1745.200880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.200880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1745.200880 (E_RNA) where: Base-Base interactions energy: -1132.003 where: short stacking energy: -500.564 Base-Backbone interact. energy: -3.606 local terms energy: -609.592156 where: bonds (distance) C4'-P energy: -113.016 bonds (distance) P-C4' energy: -118.815 flat angles C4'-P-C4' energy: -138.773 flat angles P-C4'-P energy: -84.545 tors. eta vs tors. theta energy: -154.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1463.127766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.127766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.127766 (E_RNA) where: Base-Base interactions energy: -939.600 where: short stacking energy: -425.214 Base-Backbone interact. energy: -2.369 local terms energy: -521.159350 where: bonds (distance) C4'-P energy: -117.703 bonds (distance) P-C4' energy: -109.286 flat angles C4'-P-C4' energy: -116.139 flat angles P-C4'-P energy: -76.397 tors. eta vs tors. theta energy: -101.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1378.181745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.181745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.181745 (E_RNA) where: Base-Base interactions energy: -864.434 where: short stacking energy: -405.656 Base-Backbone interact. energy: -3.697 local terms energy: -510.051172 where: bonds (distance) C4'-P energy: -109.197 bonds (distance) P-C4' energy: -112.048 flat angles C4'-P-C4' energy: -112.747 flat angles P-C4'-P energy: -76.909 tors. eta vs tors. theta energy: -99.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1140.763499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.763499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.763499 (E_RNA) where: Base-Base interactions energy: -687.538 where: short stacking energy: -320.217 Base-Backbone interact. energy: 1.808 local terms energy: -455.033726 where: bonds (distance) C4'-P energy: -105.503 bonds (distance) P-C4' energy: -120.661 flat angles C4'-P-C4' energy: -117.322 flat angles P-C4'-P energy: -63.956 tors. eta vs tors. theta energy: -47.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1061.765853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.765853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.765853 (E_RNA) where: Base-Base interactions energy: -658.131 where: short stacking energy: -320.201 Base-Backbone interact. energy: 0.654 local terms energy: -404.288491 where: bonds (distance) C4'-P energy: -90.009 bonds (distance) P-C4' energy: -109.215 flat angles C4'-P-C4' energy: -102.660 flat angles P-C4'-P energy: -49.649 tors. eta vs tors. theta energy: -52.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -886.290577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.290577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.290577 (E_RNA) where: Base-Base interactions energy: -447.439 where: short stacking energy: -263.838 Base-Backbone interact. energy: -1.954 local terms energy: -436.897182 where: bonds (distance) C4'-P energy: -106.221 bonds (distance) P-C4' energy: -112.638 flat angles C4'-P-C4' energy: -103.869 flat angles P-C4'-P energy: -65.489 tors. eta vs tors. theta energy: -48.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -696.655184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.655184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.655184 (E_RNA) where: Base-Base interactions energy: -323.846 where: short stacking energy: -192.369 Base-Backbone interact. energy: -2.083 local terms energy: -370.726628 where: bonds (distance) C4'-P energy: -98.241 bonds (distance) P-C4' energy: -113.016 flat angles C4'-P-C4' energy: -104.909 flat angles P-C4'-P energy: -50.666 tors. eta vs tors. theta energy: -3.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -553.908405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.908405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.908405 (E_RNA) where: Base-Base interactions energy: -236.984 where: short stacking energy: -156.734 Base-Backbone interact. energy: -3.428 local terms energy: -313.496187 where: bonds (distance) C4'-P energy: -102.726 bonds (distance) P-C4' energy: -80.921 flat angles C4'-P-C4' energy: -95.294 flat angles P-C4'-P energy: -37.514 tors. eta vs tors. theta energy: 2.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -469.748513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.748513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.748513 (E_RNA) where: Base-Base interactions energy: -169.820 where: short stacking energy: -136.416 Base-Backbone interact. energy: -3.975 local terms energy: -295.953233 where: bonds (distance) C4'-P energy: -97.243 bonds (distance) P-C4' energy: -77.902 flat angles C4'-P-C4' energy: -90.548 flat angles P-C4'-P energy: -53.419 tors. eta vs tors. theta energy: 23.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1937.071497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1937.071497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1937.071497 (E_RNA) where: Base-Base interactions energy: -1310.276 where: short stacking energy: -580.165 Base-Backbone interact. energy: -2.088 local terms energy: -624.708147 where: bonds (distance) C4'-P energy: -128.026 bonds (distance) P-C4' energy: -122.224 flat angles C4'-P-C4' energy: -125.018 flat angles P-C4'-P energy: -94.797 tors. eta vs tors. theta energy: -154.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1783.798183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1783.798183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.798183 (E_RNA) where: Base-Base interactions energy: -1176.926 where: short stacking energy: -510.690 Base-Backbone interact. energy: -5.380 local terms energy: -601.492207 where: bonds (distance) C4'-P energy: -135.766 bonds (distance) P-C4' energy: -122.885 flat angles C4'-P-C4' energy: -120.064 flat angles P-C4'-P energy: -77.451 tors. eta vs tors. theta energy: -145.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1487.887318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1487.887318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.887318 (E_RNA) where: Base-Base interactions energy: -955.693 where: short stacking energy: -454.090 Base-Backbone interact. energy: -1.726 local terms energy: -530.467767 where: bonds (distance) C4'-P energy: -111.743 bonds (distance) P-C4' energy: -108.349 flat angles C4'-P-C4' energy: -130.252 flat angles P-C4'-P energy: -77.704 tors. eta vs tors. theta energy: -102.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1419.305633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.305633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.305633 (E_RNA) where: Base-Base interactions energy: -876.686 where: short stacking energy: -411.111 Base-Backbone interact. energy: -2.012 local terms energy: -540.607454 where: bonds (distance) C4'-P energy: -101.369 bonds (distance) P-C4' energy: -120.693 flat angles C4'-P-C4' energy: -122.303 flat angles P-C4'-P energy: -82.833 tors. eta vs tors. theta energy: -113.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1080.232598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.232598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.232598 (E_RNA) where: Base-Base interactions energy: -628.426 where: short stacking energy: -329.688 Base-Backbone interact. energy: 0.474 local terms energy: -452.280492 where: bonds (distance) C4'-P energy: -89.260 bonds (distance) P-C4' energy: -117.682 flat angles C4'-P-C4' energy: -119.521 flat angles P-C4'-P energy: -69.114 tors. eta vs tors. theta energy: -56.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1039.360941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.360941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.360941 (E_RNA) where: Base-Base interactions energy: -599.188 where: short stacking energy: -258.500 Base-Backbone interact. energy: 1.848 local terms energy: -442.020323 where: bonds (distance) C4'-P energy: -109.410 bonds (distance) P-C4' energy: -124.953 flat angles C4'-P-C4' energy: -117.572 flat angles P-C4'-P energy: -58.981 tors. eta vs tors. theta energy: -31.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -881.776852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.776852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.776852 (E_RNA) where: Base-Base interactions energy: -471.655 where: short stacking energy: -266.656 Base-Backbone interact. energy: -4.415 local terms energy: -405.707146 where: bonds (distance) C4'-P energy: -100.049 bonds (distance) P-C4' energy: -120.588 flat angles C4'-P-C4' energy: -92.919 flat angles P-C4'-P energy: -61.789 tors. eta vs tors. theta energy: -30.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -746.370233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.370233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.370233 (E_RNA) where: Base-Base interactions energy: -390.709 where: short stacking energy: -218.240 Base-Backbone interact. energy: -2.950 local terms energy: -352.711429 where: bonds (distance) C4'-P energy: -99.107 bonds (distance) P-C4' energy: -102.833 flat angles C4'-P-C4' energy: -96.588 flat angles P-C4'-P energy: -48.049 tors. eta vs tors. theta energy: -6.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -536.345286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.345286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.345286 (E_RNA) where: Base-Base interactions energy: -196.366 where: short stacking energy: -135.876 Base-Backbone interact. energy: -1.485 local terms energy: -338.494175 where: bonds (distance) C4'-P energy: -109.227 bonds (distance) P-C4' energy: -101.823 flat angles C4'-P-C4' energy: -82.452 flat angles P-C4'-P energy: -62.426 tors. eta vs tors. theta energy: 17.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -483.777176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.777176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.777176 (E_RNA) where: Base-Base interactions energy: -175.715 where: short stacking energy: -145.601 Base-Backbone interact. energy: -2.042 local terms energy: -306.019487 where: bonds (distance) C4'-P energy: -95.815 bonds (distance) P-C4' energy: -97.592 flat angles C4'-P-C4' energy: -69.402 flat angles P-C4'-P energy: -60.457 tors. eta vs tors. theta energy: 17.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1976.826298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1976.826298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1976.826298 (E_RNA) where: Base-Base interactions energy: -1333.574 where: short stacking energy: -579.608 Base-Backbone interact. energy: -1.683 local terms energy: -641.569694 where: bonds (distance) C4'-P energy: -106.652 bonds (distance) P-C4' energy: -132.840 flat angles C4'-P-C4' energy: -137.260 flat angles P-C4'-P energy: -95.510 tors. eta vs tors. theta energy: -169.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1776.206830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.206830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.206830 (E_RNA) where: Base-Base interactions energy: -1169.835 where: short stacking energy: -472.694 Base-Backbone interact. energy: -0.903 local terms energy: -605.468978 where: bonds (distance) C4'-P energy: -123.777 bonds (distance) P-C4' energy: -122.799 flat angles C4'-P-C4' energy: -133.840 flat angles P-C4'-P energy: -92.262 tors. eta vs tors. theta energy: -132.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1567.201093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.201093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.201093 (E_RNA) where: Base-Base interactions energy: -1017.017 where: short stacking energy: -464.135 Base-Backbone interact. energy: -4.858 local terms energy: -545.325272 where: bonds (distance) C4'-P energy: -115.940 bonds (distance) P-C4' energy: -121.876 flat angles C4'-P-C4' energy: -116.845 flat angles P-C4'-P energy: -74.050 tors. eta vs tors. theta energy: -116.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1412.888090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.888090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.888090 (E_RNA) where: Base-Base interactions energy: -901.959 where: short stacking energy: -410.754 Base-Backbone interact. energy: 4.135 local terms energy: -515.063785 where: bonds (distance) C4'-P energy: -106.750 bonds (distance) P-C4' energy: -117.771 flat angles C4'-P-C4' energy: -109.718 flat angles P-C4'-P energy: -88.755 tors. eta vs tors. theta energy: -92.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1165.582699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.582699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.582699 (E_RNA) where: Base-Base interactions energy: -681.240 where: short stacking energy: -330.073 Base-Backbone interact. energy: -0.647 local terms energy: -483.696504 where: bonds (distance) C4'-P energy: -98.338 bonds (distance) P-C4' energy: -125.065 flat angles C4'-P-C4' energy: -101.709 flat angles P-C4'-P energy: -84.742 tors. eta vs tors. theta energy: -73.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1106.284446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.284446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.284446 (E_RNA) where: Base-Base interactions energy: -652.715 where: short stacking energy: -328.041 Base-Backbone interact. energy: -0.300 local terms energy: -453.269228 where: bonds (distance) C4'-P energy: -107.628 bonds (distance) P-C4' energy: -97.180 flat angles C4'-P-C4' energy: -116.733 flat angles P-C4'-P energy: -68.889 tors. eta vs tors. theta energy: -62.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -841.127158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.127158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.127158 (E_RNA) where: Base-Base interactions energy: -441.659 where: short stacking energy: -244.643 Base-Backbone interact. energy: 2.413 local terms energy: -401.881102 where: bonds (distance) C4'-P energy: -121.389 bonds (distance) P-C4' energy: -105.021 flat angles C4'-P-C4' energy: -105.292 flat angles P-C4'-P energy: -64.882 tors. eta vs tors. theta energy: -5.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -732.841394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.841394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.841394 (E_RNA) where: Base-Base interactions energy: -350.681 where: short stacking energy: -187.969 Base-Backbone interact. energy: 0.612 local terms energy: -382.771909 where: bonds (distance) C4'-P energy: -107.533 bonds (distance) P-C4' energy: -124.876 flat angles C4'-P-C4' energy: -99.814 flat angles P-C4'-P energy: -53.583 tors. eta vs tors. theta energy: 3.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -585.983269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.983269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.983269 (E_RNA) where: Base-Base interactions energy: -255.376 where: short stacking energy: -173.811 Base-Backbone interact. energy: 5.447 local terms energy: -336.053872 where: bonds (distance) C4'-P energy: -99.297 bonds (distance) P-C4' energy: -110.792 flat angles C4'-P-C4' energy: -80.084 flat angles P-C4'-P energy: -44.875 tors. eta vs tors. theta energy: -1.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -476.963835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.963835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.963835 (E_RNA) where: Base-Base interactions energy: -164.658 where: short stacking energy: -131.738 Base-Backbone interact. energy: -0.006 local terms energy: -312.299631 where: bonds (distance) C4'-P energy: -81.387 bonds (distance) P-C4' energy: -110.302 flat angles C4'-P-C4' energy: -84.009 flat angles P-C4'-P energy: -56.263 tors. eta vs tors. theta energy: 19.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1988.616942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1988.616942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1988.616942 (E_RNA) where: Base-Base interactions energy: -1349.891 where: short stacking energy: -568.179 Base-Backbone interact. energy: -1.157 local terms energy: -637.569494 where: bonds (distance) C4'-P energy: -124.995 bonds (distance) P-C4' energy: -126.571 flat angles C4'-P-C4' energy: -133.183 flat angles P-C4'-P energy: -93.829 tors. eta vs tors. theta energy: -158.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1814.364306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1814.364306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1814.364306 (E_RNA) where: Base-Base interactions energy: -1211.103 where: short stacking energy: -518.847 Base-Backbone interact. energy: 2.624 local terms energy: -605.885282 where: bonds (distance) C4'-P energy: -114.861 bonds (distance) P-C4' energy: -132.330 flat angles C4'-P-C4' energy: -122.940 flat angles P-C4'-P energy: -85.836 tors. eta vs tors. theta energy: -149.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1548.080657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.080657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.080657 (E_RNA) where: Base-Base interactions energy: -1026.069 where: short stacking energy: -428.938 Base-Backbone interact. energy: -0.249 local terms energy: -521.762539 where: bonds (distance) C4'-P energy: -109.006 bonds (distance) P-C4' energy: -111.144 flat angles C4'-P-C4' energy: -120.448 flat angles P-C4'-P energy: -86.204 tors. eta vs tors. theta energy: -94.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1405.453245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.453245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.453245 (E_RNA) where: Base-Base interactions energy: -901.351 where: short stacking energy: -410.657 Base-Backbone interact. energy: 0.060 local terms energy: -504.161857 where: bonds (distance) C4'-P energy: -100.352 bonds (distance) P-C4' energy: -121.456 flat angles C4'-P-C4' energy: -122.380 flat angles P-C4'-P energy: -71.701 tors. eta vs tors. theta energy: -88.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1175.670541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.670541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.670541 (E_RNA) where: Base-Base interactions energy: -699.973 where: short stacking energy: -353.496 Base-Backbone interact. energy: 3.978 local terms energy: -479.675598 where: bonds (distance) C4'-P energy: -116.264 bonds (distance) P-C4' energy: -113.229 flat angles C4'-P-C4' energy: -115.336 flat angles P-C4'-P energy: -62.424 tors. eta vs tors. theta energy: -72.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1050.751212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.751212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.751212 (E_RNA) where: Base-Base interactions energy: -582.572 where: short stacking energy: -297.536 Base-Backbone interact. energy: -1.435 local terms energy: -466.744382 where: bonds (distance) C4'-P energy: -107.891 bonds (distance) P-C4' energy: -122.420 flat angles C4'-P-C4' energy: -113.539 flat angles P-C4'-P energy: -54.870 tors. eta vs tors. theta energy: -68.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -880.023572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.023572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.023572 (E_RNA) where: Base-Base interactions energy: -493.476 where: short stacking energy: -253.506 Base-Backbone interact. energy: 0.455 local terms energy: -387.002439 where: bonds (distance) C4'-P energy: -106.078 bonds (distance) P-C4' energy: -96.736 flat angles C4'-P-C4' energy: -112.741 flat angles P-C4'-P energy: -55.484 tors. eta vs tors. theta energy: -15.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -775.833861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.833861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.833861 (E_RNA) where: Base-Base interactions energy: -397.049 where: short stacking energy: -233.974 Base-Backbone interact. energy: 1.683 local terms energy: -380.467722 where: bonds (distance) C4'-P energy: -95.773 bonds (distance) P-C4' energy: -105.834 flat angles C4'-P-C4' energy: -102.031 flat angles P-C4'-P energy: -57.011 tors. eta vs tors. theta energy: -19.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -558.745110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.745110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.745110 (E_RNA) where: Base-Base interactions energy: -221.676 where: short stacking energy: -159.787 Base-Backbone interact. energy: 1.416 local terms energy: -338.485760 where: bonds (distance) C4'-P energy: -102.809 bonds (distance) P-C4' energy: -117.308 flat angles C4'-P-C4' energy: -86.980 flat angles P-C4'-P energy: -48.359 tors. eta vs tors. theta energy: 16.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -465.794883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.794883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.794883 (E_RNA) where: Base-Base interactions energy: -160.275 where: short stacking energy: -133.568 Base-Backbone interact. energy: -0.994 local terms energy: -304.526047 where: bonds (distance) C4'-P energy: -94.773 bonds (distance) P-C4' energy: -102.993 flat angles C4'-P-C4' energy: -84.720 flat angles P-C4'-P energy: -54.110 tors. eta vs tors. theta energy: 32.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1978.217915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1978.217915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1978.217915 (E_RNA) where: Base-Base interactions energy: -1360.345 where: short stacking energy: -585.566 Base-Backbone interact. energy: -2.627 local terms energy: -615.246362 where: bonds (distance) C4'-P energy: -107.104 bonds (distance) P-C4' energy: -122.644 flat angles C4'-P-C4' energy: -123.731 flat angles P-C4'-P energy: -89.497 tors. eta vs tors. theta energy: -172.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1810.980106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1810.980106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1810.980106 (E_RNA) where: Base-Base interactions energy: -1216.872 where: short stacking energy: -522.037 Base-Backbone interact. energy: -5.545 local terms energy: -588.563144 where: bonds (distance) C4'-P energy: -114.615 bonds (distance) P-C4' energy: -111.393 flat angles C4'-P-C4' energy: -125.192 flat angles P-C4'-P energy: -80.723 tors. eta vs tors. theta energy: -156.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1565.161487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.161487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.161487 (E_RNA) where: Base-Base interactions energy: -1037.636 where: short stacking energy: -452.534 Base-Backbone interact. energy: -3.241 local terms energy: -524.284613 where: bonds (distance) C4'-P energy: -94.244 bonds (distance) P-C4' energy: -118.669 flat angles C4'-P-C4' energy: -127.572 flat angles P-C4'-P energy: -77.490 tors. eta vs tors. theta energy: -106.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1329.871946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.871946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.871946 (E_RNA) where: Base-Base interactions energy: -841.425 where: short stacking energy: -374.181 Base-Backbone interact. energy: 0.073 local terms energy: -488.519771 where: bonds (distance) C4'-P energy: -104.092 bonds (distance) P-C4' energy: -118.006 flat angles C4'-P-C4' energy: -111.064 flat angles P-C4'-P energy: -78.063 tors. eta vs tors. theta energy: -77.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1198.877580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.877580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.877580 (E_RNA) where: Base-Base interactions energy: -708.285 where: short stacking energy: -357.966 Base-Backbone interact. energy: 2.015 local terms energy: -492.607956 where: bonds (distance) C4'-P energy: -117.974 bonds (distance) P-C4' energy: -107.623 flat angles C4'-P-C4' energy: -113.941 flat angles P-C4'-P energy: -82.862 tors. eta vs tors. theta energy: -70.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1073.725868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.725868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.725868 (E_RNA) where: Base-Base interactions energy: -622.854 where: short stacking energy: -280.694 Base-Backbone interact. energy: -3.910 local terms energy: -446.961816 where: bonds (distance) C4'-P energy: -118.530 bonds (distance) P-C4' energy: -102.140 flat angles C4'-P-C4' energy: -102.774 flat angles P-C4'-P energy: -68.631 tors. eta vs tors. theta energy: -54.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1021.442746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.442746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.442746 (E_RNA) where: Base-Base interactions energy: -598.460 where: short stacking energy: -315.164 Base-Backbone interact. energy: -0.849 local terms energy: -422.133687 where: bonds (distance) C4'-P energy: -108.466 bonds (distance) P-C4' energy: -100.979 flat angles C4'-P-C4' energy: -92.045 flat angles P-C4'-P energy: -63.172 tors. eta vs tors. theta energy: -57.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -806.358332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.358332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.358332 (E_RNA) where: Base-Base interactions energy: -452.549 where: short stacking energy: -240.696 Base-Backbone interact. energy: 2.675 local terms energy: -356.484503 where: bonds (distance) C4'-P energy: -106.310 bonds (distance) P-C4' energy: -107.287 flat angles C4'-P-C4' energy: -73.932 flat angles P-C4'-P energy: -61.220 tors. eta vs tors. theta energy: -7.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -560.095251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.095251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.095251 (E_RNA) where: Base-Base interactions energy: -232.863 where: short stacking energy: -153.342 Base-Backbone interact. energy: 4.958 local terms energy: -332.190235 where: bonds (distance) C4'-P energy: -96.193 bonds (distance) P-C4' energy: -99.575 flat angles C4'-P-C4' energy: -85.472 flat angles P-C4'-P energy: -49.761 tors. eta vs tors. theta energy: -1.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -481.849433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.849433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.849433 (E_RNA) where: Base-Base interactions energy: -191.284 where: short stacking energy: -125.032 Base-Backbone interact. energy: 4.211 local terms energy: -294.776354 where: bonds (distance) C4'-P energy: -89.349 bonds (distance) P-C4' energy: -92.960 flat angles C4'-P-C4' energy: -99.189 flat angles P-C4'-P energy: -46.642 tors. eta vs tors. theta energy: 33.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1979.894054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.894054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.894054 (E_RNA) where: Base-Base interactions energy: -1339.700 where: short stacking energy: -573.903 Base-Backbone interact. energy: -0.668 local terms energy: -639.526600 where: bonds (distance) C4'-P energy: -120.631 bonds (distance) P-C4' energy: -125.804 flat angles C4'-P-C4' energy: -135.702 flat angles P-C4'-P energy: -93.192 tors. eta vs tors. theta energy: -164.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1755.333120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1755.333120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.333120 (E_RNA) where: Base-Base interactions energy: -1162.777 where: short stacking energy: -519.768 Base-Backbone interact. energy: -1.329 local terms energy: -591.227733 where: bonds (distance) C4'-P energy: -121.440 bonds (distance) P-C4' energy: -118.545 flat angles C4'-P-C4' energy: -128.610 flat angles P-C4'-P energy: -88.811 tors. eta vs tors. theta energy: -133.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1609.102527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.102527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.102527 (E_RNA) where: Base-Base interactions energy: -1054.084 where: short stacking energy: -447.789 Base-Backbone interact. energy: -0.798 local terms energy: -554.221075 where: bonds (distance) C4'-P energy: -122.326 bonds (distance) P-C4' energy: -120.923 flat angles C4'-P-C4' energy: -120.205 flat angles P-C4'-P energy: -90.370 tors. eta vs tors. theta energy: -100.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1401.422132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.422132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.422132 (E_RNA) where: Base-Base interactions energy: -869.760 where: short stacking energy: -400.726 Base-Backbone interact. energy: 0.305 local terms energy: -531.966877 where: bonds (distance) C4'-P energy: -121.889 bonds (distance) P-C4' energy: -116.011 flat angles C4'-P-C4' energy: -118.690 flat angles P-C4'-P energy: -80.981 tors. eta vs tors. theta energy: -94.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1224.744634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.744634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.744634 (E_RNA) where: Base-Base interactions energy: -749.544 where: short stacking energy: -385.248 Base-Backbone interact. energy: 1.484 local terms energy: -476.683963 where: bonds (distance) C4'-P energy: -105.204 bonds (distance) P-C4' energy: -114.699 flat angles C4'-P-C4' energy: -114.463 flat angles P-C4'-P energy: -65.904 tors. eta vs tors. theta energy: -76.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1109.115426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.115426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.115426 (E_RNA) where: Base-Base interactions energy: -698.062 where: short stacking energy: -317.072 Base-Backbone interact. energy: 0.955 local terms energy: -412.008555 where: bonds (distance) C4'-P energy: -102.989 bonds (distance) P-C4' energy: -95.400 flat angles C4'-P-C4' energy: -90.944 flat angles P-C4'-P energy: -72.555 tors. eta vs tors. theta energy: -50.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1010.185313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.185313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.185313 (E_RNA) where: Base-Base interactions energy: -574.383 where: short stacking energy: -298.589 Base-Backbone interact. energy: -1.605 local terms energy: -434.197492 where: bonds (distance) C4'-P energy: -104.800 bonds (distance) P-C4' energy: -100.575 flat angles C4'-P-C4' energy: -93.129 flat angles P-C4'-P energy: -77.626 tors. eta vs tors. theta energy: -58.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -760.481777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.481777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.481777 (E_RNA) where: Base-Base interactions energy: -384.419 where: short stacking energy: -206.136 Base-Backbone interact. energy: -2.380 local terms energy: -373.682666 where: bonds (distance) C4'-P energy: -104.785 bonds (distance) P-C4' energy: -98.431 flat angles C4'-P-C4' energy: -91.003 flat angles P-C4'-P energy: -67.604 tors. eta vs tors. theta energy: -11.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -515.041626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.041626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.041626 (E_RNA) where: Base-Base interactions energy: -177.465 where: short stacking energy: -132.700 Base-Backbone interact. energy: -0.237 local terms energy: -337.339382 where: bonds (distance) C4'-P energy: -100.401 bonds (distance) P-C4' energy: -110.562 flat angles C4'-P-C4' energy: -68.902 flat angles P-C4'-P energy: -76.074 tors. eta vs tors. theta energy: 18.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -484.932988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.932988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.932988 (E_RNA) where: Base-Base interactions energy: -179.511 where: short stacking energy: -123.049 Base-Backbone interact. energy: 5.539 local terms energy: -310.961271 where: bonds (distance) C4'-P energy: -102.488 bonds (distance) P-C4' energy: -109.497 flat angles C4'-P-C4' energy: -77.609 flat angles P-C4'-P energy: -38.301 tors. eta vs tors. theta energy: 16.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2004.033923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2004.033923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2004.033923 (E_RNA) where: Base-Base interactions energy: -1378.934 where: short stacking energy: -578.367 Base-Backbone interact. energy: -1.451 local terms energy: -623.648911 where: bonds (distance) C4'-P energy: -126.253 bonds (distance) P-C4' energy: -118.717 flat angles C4'-P-C4' energy: -134.056 flat angles P-C4'-P energy: -85.681 tors. eta vs tors. theta energy: -158.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1802.614864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1802.614864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1802.614864 (E_RNA) where: Base-Base interactions energy: -1211.872 where: short stacking energy: -529.062 Base-Backbone interact. energy: -1.353 local terms energy: -589.389756 where: bonds (distance) C4'-P energy: -125.140 bonds (distance) P-C4' energy: -111.918 flat angles C4'-P-C4' energy: -131.235 flat angles P-C4'-P energy: -70.948 tors. eta vs tors. theta energy: -150.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1682.251975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.251975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.251975 (E_RNA) where: Base-Base interactions energy: -1108.699 where: short stacking energy: -469.771 Base-Backbone interact. energy: -4.182 local terms energy: -569.371677 where: bonds (distance) C4'-P energy: -125.969 bonds (distance) P-C4' energy: -109.955 flat angles C4'-P-C4' energy: -127.023 flat angles P-C4'-P energy: -79.966 tors. eta vs tors. theta energy: -126.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1417.181652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.181652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.181652 (E_RNA) where: Base-Base interactions energy: -902.693 where: short stacking energy: -394.816 Base-Backbone interact. energy: -2.316 local terms energy: -512.172370 where: bonds (distance) C4'-P energy: -108.663 bonds (distance) P-C4' energy: -108.565 flat angles C4'-P-C4' energy: -109.700 flat angles P-C4'-P energy: -92.247 tors. eta vs tors. theta energy: -92.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1168.514100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.514100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.514100 (E_RNA) where: Base-Base interactions energy: -704.404 where: short stacking energy: -364.963 Base-Backbone interact. energy: 1.707 local terms energy: -465.817324 where: bonds (distance) C4'-P energy: -96.027 bonds (distance) P-C4' energy: -120.950 flat angles C4'-P-C4' energy: -114.414 flat angles P-C4'-P energy: -72.969 tors. eta vs tors. theta energy: -61.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1137.872427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.872427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.872427 (E_RNA) where: Base-Base interactions energy: -684.947 where: short stacking energy: -326.875 Base-Backbone interact. energy: 0.723 local terms energy: -453.648380 where: bonds (distance) C4'-P energy: -105.003 bonds (distance) P-C4' energy: -111.835 flat angles C4'-P-C4' energy: -109.461 flat angles P-C4'-P energy: -62.935 tors. eta vs tors. theta energy: -64.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -930.818323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.818323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.818323 (E_RNA) where: Base-Base interactions energy: -500.032 where: short stacking energy: -245.840 Base-Backbone interact. energy: 0.583 local terms energy: -431.369291 where: bonds (distance) C4'-P energy: -120.005 bonds (distance) P-C4' energy: -90.009 flat angles C4'-P-C4' energy: -100.165 flat angles P-C4'-P energy: -85.291 tors. eta vs tors. theta energy: -35.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -705.267440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.267440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.267440 (E_RNA) where: Base-Base interactions energy: -334.484 where: short stacking energy: -194.623 Base-Backbone interact. energy: -1.200 local terms energy: -369.583451 where: bonds (distance) C4'-P energy: -104.663 bonds (distance) P-C4' energy: -100.025 flat angles C4'-P-C4' energy: -90.526 flat angles P-C4'-P energy: -62.098 tors. eta vs tors. theta energy: -12.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -536.002725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.002725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.002725 (E_RNA) where: Base-Base interactions energy: -216.779 where: short stacking energy: -159.476 Base-Backbone interact. energy: -1.357 local terms energy: -317.866765 where: bonds (distance) C4'-P energy: -93.699 bonds (distance) P-C4' energy: -101.287 flat angles C4'-P-C4' energy: -80.726 flat angles P-C4'-P energy: -50.287 tors. eta vs tors. theta energy: 8.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -568.111590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.111590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.111590 (E_RNA) where: Base-Base interactions energy: -228.600 where: short stacking energy: -149.533 Base-Backbone interact. energy: 0.818 local terms energy: -340.329350 where: bonds (distance) C4'-P energy: -101.530 bonds (distance) P-C4' energy: -100.022 flat angles C4'-P-C4' energy: -92.387 flat angles P-C4'-P energy: -53.003 tors. eta vs tors. theta energy: 6.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2006.545467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2006.545467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2006.545467 (E_RNA) where: Base-Base interactions energy: -1379.863 where: short stacking energy: -596.176 Base-Backbone interact. energy: -2.744 local terms energy: -623.938488 where: bonds (distance) C4'-P energy: -111.533 bonds (distance) P-C4' energy: -113.444 flat angles C4'-P-C4' energy: -142.678 flat angles P-C4'-P energy: -83.234 tors. eta vs tors. theta energy: -173.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1799.139730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.139730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.139730 (E_RNA) where: Base-Base interactions energy: -1191.813 where: short stacking energy: -534.826 Base-Backbone interact. energy: -0.393 local terms energy: -606.933522 where: bonds (distance) C4'-P energy: -124.165 bonds (distance) P-C4' energy: -110.085 flat angles C4'-P-C4' energy: -131.181 flat angles P-C4'-P energy: -89.525 tors. eta vs tors. theta energy: -151.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1708.375355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.375355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.375355 (E_RNA) where: Base-Base interactions energy: -1137.991 where: short stacking energy: -497.648 Base-Backbone interact. energy: -0.490 local terms energy: -569.894025 where: bonds (distance) C4'-P energy: -114.278 bonds (distance) P-C4' energy: -136.157 flat angles C4'-P-C4' energy: -117.997 flat angles P-C4'-P energy: -81.384 tors. eta vs tors. theta energy: -120.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1451.658892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.658892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.658892 (E_RNA) where: Base-Base interactions energy: -916.573 where: short stacking energy: -428.469 Base-Backbone interact. energy: -2.155 local terms energy: -532.931818 where: bonds (distance) C4'-P energy: -117.573 bonds (distance) P-C4' energy: -109.721 flat angles C4'-P-C4' energy: -118.368 flat angles P-C4'-P energy: -65.996 tors. eta vs tors. theta energy: -121.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1265.436736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.436736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.436736 (E_RNA) where: Base-Base interactions energy: -784.041 where: short stacking energy: -373.426 Base-Backbone interact. energy: -1.719 local terms energy: -479.677412 where: bonds (distance) C4'-P energy: -105.885 bonds (distance) P-C4' energy: -101.864 flat angles C4'-P-C4' energy: -123.105 flat angles P-C4'-P energy: -65.990 tors. eta vs tors. theta energy: -82.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1070.392915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.392915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.392915 (E_RNA) where: Base-Base interactions energy: -608.820 where: short stacking energy: -292.114 Base-Backbone interact. energy: -0.789 local terms energy: -460.784517 where: bonds (distance) C4'-P energy: -114.410 bonds (distance) P-C4' energy: -122.467 flat angles C4'-P-C4' energy: -113.374 flat angles P-C4'-P energy: -60.454 tors. eta vs tors. theta energy: -50.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -853.007275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.007275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.007275 (E_RNA) where: Base-Base interactions energy: -488.945 where: short stacking energy: -271.114 Base-Backbone interact. energy: -0.960 local terms energy: -363.102444 where: bonds (distance) C4'-P energy: -82.194 bonds (distance) P-C4' energy: -85.239 flat angles C4'-P-C4' energy: -97.408 flat angles P-C4'-P energy: -55.818 tors. eta vs tors. theta energy: -42.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -758.012200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.012200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.012200 (E_RNA) where: Base-Base interactions energy: -374.927 where: short stacking energy: -210.008 Base-Backbone interact. energy: -2.320 local terms energy: -380.765517 where: bonds (distance) C4'-P energy: -98.428 bonds (distance) P-C4' energy: -98.603 flat angles C4'-P-C4' energy: -123.186 flat angles P-C4'-P energy: -50.905 tors. eta vs tors. theta energy: -9.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -678.420632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.420632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.420632 (E_RNA) where: Base-Base interactions energy: -329.531 where: short stacking energy: -193.223 Base-Backbone interact. energy: -0.856 local terms energy: -348.034380 where: bonds (distance) C4'-P energy: -96.770 bonds (distance) P-C4' energy: -101.766 flat angles C4'-P-C4' energy: -95.406 flat angles P-C4'-P energy: -57.325 tors. eta vs tors. theta energy: 3.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -529.225177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.225177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.225177 (E_RNA) where: Base-Base interactions energy: -215.875 where: short stacking energy: -171.493 Base-Backbone interact. energy: 6.075 local terms energy: -319.426069 where: bonds (distance) C4'-P energy: -92.209 bonds (distance) P-C4' energy: -95.054 flat angles C4'-P-C4' energy: -83.503 flat angles P-C4'-P energy: -59.607 tors. eta vs tors. theta energy: 10.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1989.494750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1989.494750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1989.494750 (E_RNA) where: Base-Base interactions energy: -1343.217 where: short stacking energy: -573.996 Base-Backbone interact. energy: -3.143 local terms energy: -643.134504 where: bonds (distance) C4'-P energy: -121.765 bonds (distance) P-C4' energy: -118.104 flat angles C4'-P-C4' energy: -139.331 flat angles P-C4'-P energy: -100.998 tors. eta vs tors. theta energy: -162.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1813.073084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1813.073084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.073084 (E_RNA) where: Base-Base interactions energy: -1227.066 where: short stacking energy: -509.241 Base-Backbone interact. energy: 1.910 local terms energy: -587.917179 where: bonds (distance) C4'-P energy: -109.139 bonds (distance) P-C4' energy: -111.432 flat angles C4'-P-C4' energy: -135.697 flat angles P-C4'-P energy: -84.337 tors. eta vs tors. theta energy: -147.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1677.580063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.580063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.580063 (E_RNA) where: Base-Base interactions energy: -1122.682 where: short stacking energy: -480.941 Base-Backbone interact. energy: -3.205 local terms energy: -551.693256 where: bonds (distance) C4'-P energy: -130.938 bonds (distance) P-C4' energy: -109.539 flat angles C4'-P-C4' energy: -131.754 flat angles P-C4'-P energy: -75.437 tors. eta vs tors. theta energy: -104.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1434.736427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.736427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.736427 (E_RNA) where: Base-Base interactions energy: -928.459 where: short stacking energy: -420.282 Base-Backbone interact. energy: -0.465 local terms energy: -505.812184 where: bonds (distance) C4'-P energy: -90.541 bonds (distance) P-C4' energy: -115.599 flat angles C4'-P-C4' energy: -102.759 flat angles P-C4'-P energy: -87.369 tors. eta vs tors. theta energy: -109.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1240.552477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.552477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.552477 (E_RNA) where: Base-Base interactions energy: -766.965 where: short stacking energy: -359.893 Base-Backbone interact. energy: -3.354 local terms energy: -470.233816 where: bonds (distance) C4'-P energy: -103.419 bonds (distance) P-C4' energy: -100.209 flat angles C4'-P-C4' energy: -117.584 flat angles P-C4'-P energy: -72.211 tors. eta vs tors. theta energy: -76.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1048.997587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.997587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.997587 (E_RNA) where: Base-Base interactions energy: -591.975 where: short stacking energy: -333.210 Base-Backbone interact. energy: 2.558 local terms energy: -459.581069 where: bonds (distance) C4'-P energy: -98.756 bonds (distance) P-C4' energy: -112.192 flat angles C4'-P-C4' energy: -114.281 flat angles P-C4'-P energy: -79.700 tors. eta vs tors. theta energy: -54.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -917.313760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.313760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.313760 (E_RNA) where: Base-Base interactions energy: -508.719 where: short stacking energy: -260.149 Base-Backbone interact. energy: -2.219 local terms energy: -406.375993 where: bonds (distance) C4'-P energy: -106.778 bonds (distance) P-C4' energy: -102.549 flat angles C4'-P-C4' energy: -100.095 flat angles P-C4'-P energy: -68.920 tors. eta vs tors. theta energy: -28.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -744.346405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.346405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.346405 (E_RNA) where: Base-Base interactions energy: -387.231 where: short stacking energy: -240.364 Base-Backbone interact. energy: 1.503 local terms energy: -358.618750 where: bonds (distance) C4'-P energy: -101.725 bonds (distance) P-C4' energy: -99.693 flat angles C4'-P-C4' energy: -84.319 flat angles P-C4'-P energy: -40.982 tors. eta vs tors. theta energy: -31.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -637.156560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.156560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.156560 (E_RNA) where: Base-Base interactions energy: -293.244 where: short stacking energy: -183.960 Base-Backbone interact. energy: 0.550 local terms energy: -344.463014 where: bonds (distance) C4'-P energy: -97.652 bonds (distance) P-C4' energy: -114.193 flat angles C4'-P-C4' energy: -74.830 flat angles P-C4'-P energy: -56.790 tors. eta vs tors. theta energy: -0.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -580.072071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.072071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.072071 (E_RNA) where: Base-Base interactions energy: -288.832 where: short stacking energy: -157.948 Base-Backbone interact. energy: 1.097 local terms energy: -292.337601 where: bonds (distance) C4'-P energy: -63.573 bonds (distance) P-C4' energy: -101.378 flat angles C4'-P-C4' energy: -97.800 flat angles P-C4'-P energy: -45.750 tors. eta vs tors. theta energy: 16.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1955.703968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1955.703968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1955.703968 (E_RNA) where: Base-Base interactions energy: -1326.233 where: short stacking energy: -562.778 Base-Backbone interact. energy: -0.155 local terms energy: -629.315740 where: bonds (distance) C4'-P energy: -119.041 bonds (distance) P-C4' energy: -126.101 flat angles C4'-P-C4' energy: -131.183 flat angles P-C4'-P energy: -92.510 tors. eta vs tors. theta energy: -160.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1824.898301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.898301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.898301 (E_RNA) where: Base-Base interactions energy: -1195.729 where: short stacking energy: -506.333 Base-Backbone interact. energy: 0.146 local terms energy: -629.315785 where: bonds (distance) C4'-P energy: -127.067 bonds (distance) P-C4' energy: -132.164 flat angles C4'-P-C4' energy: -131.619 flat angles P-C4'-P energy: -95.126 tors. eta vs tors. theta energy: -143.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1705.560813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.560813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1705.560813 (E_RNA) where: Base-Base interactions energy: -1163.282 where: short stacking energy: -452.911 Base-Backbone interact. energy: -1.761 local terms energy: -540.517709 where: bonds (distance) C4'-P energy: -105.137 bonds (distance) P-C4' energy: -116.285 flat angles C4'-P-C4' energy: -125.942 flat angles P-C4'-P energy: -75.043 tors. eta vs tors. theta energy: -118.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1469.750239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.750239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.750239 (E_RNA) where: Base-Base interactions energy: -925.415 where: short stacking energy: -409.707 Base-Backbone interact. energy: 2.740 local terms energy: -547.075251 where: bonds (distance) C4'-P energy: -113.935 bonds (distance) P-C4' energy: -119.041 flat angles C4'-P-C4' energy: -118.774 flat angles P-C4'-P energy: -78.072 tors. eta vs tors. theta energy: -117.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1240.462535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.462535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.462535 (E_RNA) where: Base-Base interactions energy: -764.023 where: short stacking energy: -365.673 Base-Backbone interact. energy: 3.137 local terms energy: -479.576264 where: bonds (distance) C4'-P energy: -103.254 bonds (distance) P-C4' energy: -107.155 flat angles C4'-P-C4' energy: -124.660 flat angles P-C4'-P energy: -76.599 tors. eta vs tors. theta energy: -67.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1080.006393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.006393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.006393 (E_RNA) where: Base-Base interactions energy: -652.845 where: short stacking energy: -314.475 Base-Backbone interact. energy: 2.461 local terms energy: -429.622482 where: bonds (distance) C4'-P energy: -109.226 bonds (distance) P-C4' energy: -105.144 flat angles C4'-P-C4' energy: -99.165 flat angles P-C4'-P energy: -66.722 tors. eta vs tors. theta energy: -49.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1029.248147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.248147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.248147 (E_RNA) where: Base-Base interactions energy: -606.796 where: short stacking energy: -293.898 Base-Backbone interact. energy: 3.017 local terms energy: -425.469478 where: bonds (distance) C4'-P energy: -96.175 bonds (distance) P-C4' energy: -113.778 flat angles C4'-P-C4' energy: -96.778 flat angles P-C4'-P energy: -67.906 tors. eta vs tors. theta energy: -50.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -699.994632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.994632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.994632 (E_RNA) where: Base-Base interactions energy: -361.785 where: short stacking energy: -180.143 Base-Backbone interact. energy: 5.585 local terms energy: -343.794778 where: bonds (distance) C4'-P energy: -102.081 bonds (distance) P-C4' energy: -93.467 flat angles C4'-P-C4' energy: -76.571 flat angles P-C4'-P energy: -62.255 tors. eta vs tors. theta energy: -9.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -620.724974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.724974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.724974 (E_RNA) where: Base-Base interactions energy: -285.945 where: short stacking energy: -186.824 Base-Backbone interact. energy: -0.404 local terms energy: -334.376099 where: bonds (distance) C4'-P energy: -93.883 bonds (distance) P-C4' energy: -88.308 flat angles C4'-P-C4' energy: -92.548 flat angles P-C4'-P energy: -50.748 tors. eta vs tors. theta energy: -8.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -589.101962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.101962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.101962 (E_RNA) where: Base-Base interactions energy: -256.051 where: short stacking energy: -148.991 Base-Backbone interact. energy: -2.531 local terms energy: -330.519322 where: bonds (distance) C4'-P energy: -103.397 bonds (distance) P-C4' energy: -96.663 flat angles C4'-P-C4' energy: -78.059 flat angles P-C4'-P energy: -55.312 tors. eta vs tors. theta energy: 2.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1999.230744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1999.230744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1999.230744 (E_RNA) where: Base-Base interactions energy: -1351.294 where: short stacking energy: -595.283 Base-Backbone interact. energy: -2.838 local terms energy: -645.098735 where: bonds (distance) C4'-P energy: -126.401 bonds (distance) P-C4' energy: -121.432 flat angles C4'-P-C4' energy: -138.608 flat angles P-C4'-P energy: -102.323 tors. eta vs tors. theta energy: -156.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1768.661262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1768.661262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.661262 (E_RNA) where: Base-Base interactions energy: -1164.439 where: short stacking energy: -534.129 Base-Backbone interact. energy: -2.888 local terms energy: -601.334908 where: bonds (distance) C4'-P energy: -113.531 bonds (distance) P-C4' energy: -128.237 flat angles C4'-P-C4' energy: -131.914 flat angles P-C4'-P energy: -88.787 tors. eta vs tors. theta energy: -138.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1697.993066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.993066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.993066 (E_RNA) where: Base-Base interactions energy: -1153.579 where: short stacking energy: -462.896 Base-Backbone interact. energy: -2.075 local terms energy: -542.338689 where: bonds (distance) C4'-P energy: -114.015 bonds (distance) P-C4' energy: -102.008 flat angles C4'-P-C4' energy: -137.738 flat angles P-C4'-P energy: -75.629 tors. eta vs tors. theta energy: -112.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1470.890035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.890035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.890035 (E_RNA) where: Base-Base interactions energy: -954.385 where: short stacking energy: -430.664 Base-Backbone interact. energy: 1.524 local terms energy: -518.029079 where: bonds (distance) C4'-P energy: -94.752 bonds (distance) P-C4' energy: -124.840 flat angles C4'-P-C4' energy: -109.328 flat angles P-C4'-P energy: -80.763 tors. eta vs tors. theta energy: -108.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1238.338486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.338486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.338486 (E_RNA) where: Base-Base interactions energy: -752.234 where: short stacking energy: -355.909 Base-Backbone interact. energy: 0.032 local terms energy: -486.135643 where: bonds (distance) C4'-P energy: -109.283 bonds (distance) P-C4' energy: -123.043 flat angles C4'-P-C4' energy: -105.365 flat angles P-C4'-P energy: -74.357 tors. eta vs tors. theta energy: -74.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1145.098245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.098245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.098245 (E_RNA) where: Base-Base interactions energy: -668.872 where: short stacking energy: -306.621 Base-Backbone interact. energy: -0.356 local terms energy: -475.870245 where: bonds (distance) C4'-P energy: -115.652 bonds (distance) P-C4' energy: -129.912 flat angles C4'-P-C4' energy: -102.507 flat angles P-C4'-P energy: -66.093 tors. eta vs tors. theta energy: -61.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1045.009532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.009532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.009532 (E_RNA) where: Base-Base interactions energy: -594.197 where: short stacking energy: -303.344 Base-Backbone interact. energy: 0.328 local terms energy: -451.140345 where: bonds (distance) C4'-P energy: -107.446 bonds (distance) P-C4' energy: -118.040 flat angles C4'-P-C4' energy: -111.136 flat angles P-C4'-P energy: -44.470 tors. eta vs tors. theta energy: -70.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -672.715038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.715038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.715038 (E_RNA) where: Base-Base interactions energy: -293.892 where: short stacking energy: -201.616 Base-Backbone interact. energy: -0.095 local terms energy: -378.728654 where: bonds (distance) C4'-P energy: -113.812 bonds (distance) P-C4' energy: -100.009 flat angles C4'-P-C4' energy: -88.695 flat angles P-C4'-P energy: -63.070 tors. eta vs tors. theta energy: -13.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -626.278638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.278638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.278638 (E_RNA) where: Base-Base interactions energy: -284.564 where: short stacking energy: -203.564 Base-Backbone interact. energy: 1.930 local terms energy: -343.645126 where: bonds (distance) C4'-P energy: -103.955 bonds (distance) P-C4' energy: -101.547 flat angles C4'-P-C4' energy: -76.460 flat angles P-C4'-P energy: -56.637 tors. eta vs tors. theta energy: -5.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -510.982395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.982395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.982395 (E_RNA) where: Base-Base interactions energy: -212.128 where: short stacking energy: -164.548 Base-Backbone interact. energy: 7.191 local terms energy: -306.045427 where: bonds (distance) C4'-P energy: -107.171 bonds (distance) P-C4' energy: -90.282 flat angles C4'-P-C4' energy: -80.747 flat angles P-C4'-P energy: -37.120 tors. eta vs tors. theta energy: 9.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1992.170877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1992.170877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1992.170877 (E_RNA) where: Base-Base interactions energy: -1330.405 where: short stacking energy: -586.257 Base-Backbone interact. energy: 2.536 local terms energy: -664.301543 where: bonds (distance) C4'-P energy: -128.874 bonds (distance) P-C4' energy: -132.355 flat angles C4'-P-C4' energy: -136.591 flat angles P-C4'-P energy: -97.101 tors. eta vs tors. theta energy: -169.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1792.193960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1792.193960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.193960 (E_RNA) where: Base-Base interactions energy: -1192.763 where: short stacking energy: -514.910 Base-Backbone interact. energy: 1.306 local terms energy: -600.737012 where: bonds (distance) C4'-P energy: -125.119 bonds (distance) P-C4' energy: -117.911 flat angles C4'-P-C4' energy: -121.921 flat angles P-C4'-P energy: -93.881 tors. eta vs tors. theta energy: -141.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1668.721262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.721262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.721262 (E_RNA) where: Base-Base interactions energy: -1126.358 where: short stacking energy: -455.421 Base-Backbone interact. energy: 4.041 local terms energy: -546.403932 where: bonds (distance) C4'-P energy: -129.172 bonds (distance) P-C4' energy: -110.551 flat angles C4'-P-C4' energy: -124.352 flat angles P-C4'-P energy: -68.003 tors. eta vs tors. theta energy: -114.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1562.808027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.808027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.808027 (E_RNA) where: Base-Base interactions energy: -991.156 where: short stacking energy: -443.343 Base-Backbone interact. energy: 6.153 local terms energy: -577.805208 where: bonds (distance) C4'-P energy: -107.709 bonds (distance) P-C4' energy: -125.766 flat angles C4'-P-C4' energy: -123.604 flat angles P-C4'-P energy: -87.215 tors. eta vs tors. theta energy: -133.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1256.840647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.840647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.840647 (E_RNA) where: Base-Base interactions energy: -784.807 where: short stacking energy: -363.643 Base-Backbone interact. energy: -0.931 local terms energy: -471.102402 where: bonds (distance) C4'-P energy: -103.567 bonds (distance) P-C4' energy: -119.655 flat angles C4'-P-C4' energy: -106.401 flat angles P-C4'-P energy: -77.861 tors. eta vs tors. theta energy: -63.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1142.924400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.924400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1142.924400 (E_RNA) where: Base-Base interactions energy: -652.930 where: short stacking energy: -325.368 Base-Backbone interact. energy: 0.658 local terms energy: -490.652269 where: bonds (distance) C4'-P energy: -114.208 bonds (distance) P-C4' energy: -119.797 flat angles C4'-P-C4' energy: -111.182 flat angles P-C4'-P energy: -68.634 tors. eta vs tors. theta energy: -76.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1031.793988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.793988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.793988 (E_RNA) where: Base-Base interactions energy: -608.365 where: short stacking energy: -285.910 Base-Backbone interact. energy: 4.453 local terms energy: -427.881884 where: bonds (distance) C4'-P energy: -118.103 bonds (distance) P-C4' energy: -113.976 flat angles C4'-P-C4' energy: -95.170 flat angles P-C4'-P energy: -50.519 tors. eta vs tors. theta energy: -50.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -703.575501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.575501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.575501 (E_RNA) where: Base-Base interactions energy: -348.020 where: short stacking energy: -224.203 Base-Backbone interact. energy: -1.700 local terms energy: -353.855536 where: bonds (distance) C4'-P energy: -90.641 bonds (distance) P-C4' energy: -113.876 flat angles C4'-P-C4' energy: -79.447 flat angles P-C4'-P energy: -60.204 tors. eta vs tors. theta energy: -9.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -583.907251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.907251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.907251 (E_RNA) where: Base-Base interactions energy: -261.919 where: short stacking energy: -180.399 Base-Backbone interact. energy: 3.604 local terms energy: -325.592125 where: bonds (distance) C4'-P energy: -76.480 bonds (distance) P-C4' energy: -110.811 flat angles C4'-P-C4' energy: -97.875 flat angles P-C4'-P energy: -52.775 tors. eta vs tors. theta energy: 12.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -602.538214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.538214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.538214 (E_RNA) where: Base-Base interactions energy: -265.101 where: short stacking energy: -150.008 Base-Backbone interact. energy: -2.676 local terms energy: -334.761787 where: bonds (distance) C4'-P energy: -104.036 bonds (distance) P-C4' energy: -110.855 flat angles C4'-P-C4' energy: -84.386 flat angles P-C4'-P energy: -38.130 tors. eta vs tors. theta energy: 2.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1985.268861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1985.268861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1985.268861 (E_RNA) where: Base-Base interactions energy: -1352.450 where: short stacking energy: -580.260 Base-Backbone interact. energy: 0.051 local terms energy: -632.869912 where: bonds (distance) C4'-P energy: -112.205 bonds (distance) P-C4' energy: -123.044 flat angles C4'-P-C4' energy: -135.989 flat angles P-C4'-P energy: -99.167 tors. eta vs tors. theta energy: -162.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1833.024428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1833.024428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1833.024428 (E_RNA) where: Base-Base interactions energy: -1211.071 where: short stacking energy: -513.552 Base-Backbone interact. energy: -2.535 local terms energy: -619.418784 where: bonds (distance) C4'-P energy: -119.151 bonds (distance) P-C4' energy: -115.020 flat angles C4'-P-C4' energy: -142.490 flat angles P-C4'-P energy: -91.005 tors. eta vs tors. theta energy: -151.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1668.192893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.192893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.192893 (E_RNA) where: Base-Base interactions energy: -1140.146 where: short stacking energy: -494.475 Base-Backbone interact. energy: -1.476 local terms energy: -526.571084 where: bonds (distance) C4'-P energy: -109.757 bonds (distance) P-C4' energy: -101.656 flat angles C4'-P-C4' energy: -120.919 flat angles P-C4'-P energy: -70.590 tors. eta vs tors. theta energy: -123.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1580.048391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.048391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.048391 (E_RNA) where: Base-Base interactions energy: -1027.566 where: short stacking energy: -464.143 Base-Backbone interact. energy: -2.211 local terms energy: -550.271960 where: bonds (distance) C4'-P energy: -104.608 bonds (distance) P-C4' energy: -122.211 flat angles C4'-P-C4' energy: -122.496 flat angles P-C4'-P energy: -76.532 tors. eta vs tors. theta energy: -124.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1334.857185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.857185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.857185 (E_RNA) where: Base-Base interactions energy: -827.114 where: short stacking energy: -393.324 Base-Backbone interact. energy: -3.966 local terms energy: -503.777445 where: bonds (distance) C4'-P energy: -113.754 bonds (distance) P-C4' energy: -113.209 flat angles C4'-P-C4' energy: -112.154 flat angles P-C4'-P energy: -77.246 tors. eta vs tors. theta energy: -87.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1124.934160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.934160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.934160 (E_RNA) where: Base-Base interactions energy: -644.429 where: short stacking energy: -312.767 Base-Backbone interact. energy: 0.579 local terms energy: -481.083790 where: bonds (distance) C4'-P energy: -121.347 bonds (distance) P-C4' energy: -102.278 flat angles C4'-P-C4' energy: -113.812 flat angles P-C4'-P energy: -74.622 tors. eta vs tors. theta energy: -69.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1045.942020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.942020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.942020 (E_RNA) where: Base-Base interactions energy: -591.072 where: short stacking energy: -301.319 Base-Backbone interact. energy: 0.379 local terms energy: -455.249953 where: bonds (distance) C4'-P energy: -105.434 bonds (distance) P-C4' energy: -108.468 flat angles C4'-P-C4' energy: -116.740 flat angles P-C4'-P energy: -77.541 tors. eta vs tors. theta energy: -47.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -696.835927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.835927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.835927 (E_RNA) where: Base-Base interactions energy: -326.759 where: short stacking energy: -203.808 Base-Backbone interact. energy: 3.795 local terms energy: -373.872026 where: bonds (distance) C4'-P energy: -98.297 bonds (distance) P-C4' energy: -103.426 flat angles C4'-P-C4' energy: -117.031 flat angles P-C4'-P energy: -51.706 tors. eta vs tors. theta energy: -3.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -560.528174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.528174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.528174 (E_RNA) where: Base-Base interactions energy: -228.680 where: short stacking energy: -159.313 Base-Backbone interact. energy: 1.883 local terms energy: -333.731248 where: bonds (distance) C4'-P energy: -107.020 bonds (distance) P-C4' energy: -111.676 flat angles C4'-P-C4' energy: -88.240 flat angles P-C4'-P energy: -49.327 tors. eta vs tors. theta energy: 22.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -648.454143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.454143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.454143 (E_RNA) where: Base-Base interactions energy: -319.120 where: short stacking energy: -184.359 Base-Backbone interact. energy: -1.917 local terms energy: -327.417100 where: bonds (distance) C4'-P energy: -86.668 bonds (distance) P-C4' energy: -81.945 flat angles C4'-P-C4' energy: -89.842 flat angles P-C4'-P energy: -57.043 tors. eta vs tors. theta energy: -11.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1961.127955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1961.127955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.127955 (E_RNA) where: Base-Base interactions energy: -1310.139 where: short stacking energy: -582.467 Base-Backbone interact. energy: -1.968 local terms energy: -649.021208 where: bonds (distance) C4'-P energy: -122.691 bonds (distance) P-C4' energy: -117.819 flat angles C4'-P-C4' energy: -154.210 flat angles P-C4'-P energy: -92.464 tors. eta vs tors. theta energy: -161.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1827.643468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.643468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.643468 (E_RNA) where: Base-Base interactions energy: -1212.783 where: short stacking energy: -547.458 Base-Backbone interact. energy: -2.749 local terms energy: -612.110605 where: bonds (distance) C4'-P energy: -117.262 bonds (distance) P-C4' energy: -134.091 flat angles C4'-P-C4' energy: -129.942 flat angles P-C4'-P energy: -71.568 tors. eta vs tors. theta energy: -159.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1683.731782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.731782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.731782 (E_RNA) where: Base-Base interactions energy: -1119.719 where: short stacking energy: -485.107 Base-Backbone interact. energy: 1.729 local terms energy: -565.742113 where: bonds (distance) C4'-P energy: -112.216 bonds (distance) P-C4' energy: -119.843 flat angles C4'-P-C4' energy: -141.963 flat angles P-C4'-P energy: -75.146 tors. eta vs tors. theta energy: -116.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1588.105789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.105789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.105789 (E_RNA) where: Base-Base interactions energy: -1034.291 where: short stacking energy: -466.925 Base-Backbone interact. energy: -3.416 local terms energy: -550.398820 where: bonds (distance) C4'-P energy: -107.814 bonds (distance) P-C4' energy: -107.651 flat angles C4'-P-C4' energy: -129.773 flat angles P-C4'-P energy: -73.033 tors. eta vs tors. theta energy: -132.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1369.455949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.455949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.455949 (E_RNA) where: Base-Base interactions energy: -868.890 where: short stacking energy: -378.628 Base-Backbone interact. energy: -1.630 local terms energy: -498.935420 where: bonds (distance) C4'-P energy: -99.622 bonds (distance) P-C4' energy: -111.017 flat angles C4'-P-C4' energy: -113.324 flat angles P-C4'-P energy: -83.064 tors. eta vs tors. theta energy: -91.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1119.462169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.462169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1119.462169 (E_RNA) where: Base-Base interactions energy: -687.881 where: short stacking energy: -329.831 Base-Backbone interact. energy: -1.684 local terms energy: -429.897293 where: bonds (distance) C4'-P energy: -112.623 bonds (distance) P-C4' energy: -101.364 flat angles C4'-P-C4' energy: -116.222 flat angles P-C4'-P energy: -54.434 tors. eta vs tors. theta energy: -45.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -993.168203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.168203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.168203 (E_RNA) where: Base-Base interactions energy: -578.076 where: short stacking energy: -288.426 Base-Backbone interact. energy: -2.859 local terms energy: -412.233920 where: bonds (distance) C4'-P energy: -99.083 bonds (distance) P-C4' energy: -116.068 flat angles C4'-P-C4' energy: -92.710 flat angles P-C4'-P energy: -57.715 tors. eta vs tors. theta energy: -46.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -733.794886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.794886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.794886 (E_RNA) where: Base-Base interactions energy: -358.719 where: short stacking energy: -216.561 Base-Backbone interact. energy: -2.388 local terms energy: -372.688485 where: bonds (distance) C4'-P energy: -104.369 bonds (distance) P-C4' energy: -105.358 flat angles C4'-P-C4' energy: -90.705 flat angles P-C4'-P energy: -50.803 tors. eta vs tors. theta energy: -21.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -700.398815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.398815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.398815 (E_RNA) where: Base-Base interactions energy: -363.832 where: short stacking energy: -209.464 Base-Backbone interact. energy: -3.464 local terms energy: -333.102670 where: bonds (distance) C4'-P energy: -94.266 bonds (distance) P-C4' energy: -110.185 flat angles C4'-P-C4' energy: -84.056 flat angles P-C4'-P energy: -43.151 tors. eta vs tors. theta energy: -1.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -538.740187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.740187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.740187 (E_RNA) where: Base-Base interactions energy: -215.819 where: short stacking energy: -147.305 Base-Backbone interact. energy: -1.301 local terms energy: -321.620547 where: bonds (distance) C4'-P energy: -108.759 bonds (distance) P-C4' energy: -118.303 flat angles C4'-P-C4' energy: -86.454 flat angles P-C4'-P energy: -38.759 tors. eta vs tors. theta energy: 30.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1991.831904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1991.831904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1991.831904 (E_RNA) where: Base-Base interactions energy: -1351.339 where: short stacking energy: -589.819 Base-Backbone interact. energy: 0.709 local terms energy: -641.202217 where: bonds (distance) C4'-P energy: -118.826 bonds (distance) P-C4' energy: -134.177 flat angles C4'-P-C4' energy: -132.478 flat angles P-C4'-P energy: -84.405 tors. eta vs tors. theta energy: -171.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1797.671187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.671187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.671187 (E_RNA) where: Base-Base interactions energy: -1171.307 where: short stacking energy: -540.776 Base-Backbone interact. energy: -2.524 local terms energy: -623.840232 where: bonds (distance) C4'-P energy: -119.262 bonds (distance) P-C4' energy: -135.386 flat angles C4'-P-C4' energy: -134.869 flat angles P-C4'-P energy: -88.258 tors. eta vs tors. theta energy: -146.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1658.010565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.010565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.010565 (E_RNA) where: Base-Base interactions energy: -1130.633 where: short stacking energy: -473.818 Base-Backbone interact. energy: -1.618 local terms energy: -525.759247 where: bonds (distance) C4'-P energy: -110.789 bonds (distance) P-C4' energy: -107.616 flat angles C4'-P-C4' energy: -118.126 flat angles P-C4'-P energy: -70.366 tors. eta vs tors. theta energy: -118.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1541.501837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.501837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.501837 (E_RNA) where: Base-Base interactions energy: -969.831 where: short stacking energy: -457.937 Base-Backbone interact. energy: 1.541 local terms energy: -573.212354 where: bonds (distance) C4'-P energy: -128.405 bonds (distance) P-C4' energy: -110.816 flat angles C4'-P-C4' energy: -139.436 flat angles P-C4'-P energy: -82.200 tors. eta vs tors. theta energy: -112.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1423.978818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.978818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.978818 (E_RNA) where: Base-Base interactions energy: -922.060 where: short stacking energy: -425.998 Base-Backbone interact. energy: -0.741 local terms energy: -501.177920 where: bonds (distance) C4'-P energy: -94.720 bonds (distance) P-C4' energy: -111.319 flat angles C4'-P-C4' energy: -107.918 flat angles P-C4'-P energy: -84.977 tors. eta vs tors. theta energy: -102.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -999.136337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.136337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.136337 (E_RNA) where: Base-Base interactions energy: -554.672 where: short stacking energy: -290.165 Base-Backbone interact. energy: -0.415 local terms energy: -444.049199 where: bonds (distance) C4'-P energy: -91.286 bonds (distance) P-C4' energy: -121.554 flat angles C4'-P-C4' energy: -113.563 flat angles P-C4'-P energy: -69.960 tors. eta vs tors. theta energy: -47.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1063.064487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.064487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.064487 (E_RNA) where: Base-Base interactions energy: -650.454 where: short stacking energy: -332.513 Base-Backbone interact. energy: -4.156 local terms energy: -408.454699 where: bonds (distance) C4'-P energy: -86.134 bonds (distance) P-C4' energy: -100.427 flat angles C4'-P-C4' energy: -103.069 flat angles P-C4'-P energy: -62.135 tors. eta vs tors. theta energy: -56.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -722.065553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.065553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.065553 (E_RNA) where: Base-Base interactions energy: -365.488 where: short stacking energy: -220.286 Base-Backbone interact. energy: 3.485 local terms energy: -360.062661 where: bonds (distance) C4'-P energy: -91.786 bonds (distance) P-C4' energy: -114.028 flat angles C4'-P-C4' energy: -109.340 flat angles P-C4'-P energy: -24.733 tors. eta vs tors. theta energy: -20.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -684.635249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.635249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.635249 (E_RNA) where: Base-Base interactions energy: -350.105 where: short stacking energy: -220.536 Base-Backbone interact. energy: 0.921 local terms energy: -335.451515 where: bonds (distance) C4'-P energy: -95.208 bonds (distance) P-C4' energy: -93.140 flat angles C4'-P-C4' energy: -73.497 flat angles P-C4'-P energy: -57.710 tors. eta vs tors. theta energy: -15.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -508.630892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.630892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.630892 (E_RNA) where: Base-Base interactions energy: -191.836 where: short stacking energy: -131.737 Base-Backbone interact. energy: 0.725 local terms energy: -317.520323 where: bonds (distance) C4'-P energy: -86.526 bonds (distance) P-C4' energy: -113.361 flat angles C4'-P-C4' energy: -99.378 flat angles P-C4'-P energy: -44.864 tors. eta vs tors. theta energy: 26.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1976.109833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1976.109833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1976.109833 (E_RNA) where: Base-Base interactions energy: -1334.977 where: short stacking energy: -588.539 Base-Backbone interact. energy: -0.940 local terms energy: -640.192667 where: bonds (distance) C4'-P energy: -130.801 bonds (distance) P-C4' energy: -118.296 flat angles C4'-P-C4' energy: -136.842 flat angles P-C4'-P energy: -88.660 tors. eta vs tors. theta energy: -165.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1799.752626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.752626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.752626 (E_RNA) where: Base-Base interactions energy: -1196.613 where: short stacking energy: -522.242 Base-Backbone interact. energy: -0.567 local terms energy: -602.572221 where: bonds (distance) C4'-P energy: -129.600 bonds (distance) P-C4' energy: -124.889 flat angles C4'-P-C4' energy: -121.575 flat angles P-C4'-P energy: -84.901 tors. eta vs tors. theta energy: -141.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1644.949597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.949597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.949597 (E_RNA) where: Base-Base interactions energy: -1088.098 where: short stacking energy: -469.396 Base-Backbone interact. energy: -3.256 local terms energy: -553.595803 where: bonds (distance) C4'-P energy: -126.743 bonds (distance) P-C4' energy: -113.266 flat angles C4'-P-C4' energy: -121.286 flat angles P-C4'-P energy: -76.406 tors. eta vs tors. theta energy: -115.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1571.627908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.627908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.627908 (E_RNA) where: Base-Base interactions energy: -1018.446 where: short stacking energy: -465.066 Base-Backbone interact. energy: -2.755 local terms energy: -550.426106 where: bonds (distance) C4'-P energy: -105.349 bonds (distance) P-C4' energy: -115.505 flat angles C4'-P-C4' energy: -119.195 flat angles P-C4'-P energy: -79.823 tors. eta vs tors. theta energy: -130.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1432.268984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.268984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.268984 (E_RNA) where: Base-Base interactions energy: -925.649 where: short stacking energy: -402.880 Base-Backbone interact. energy: -0.508 local terms energy: -506.111862 where: bonds (distance) C4'-P energy: -112.559 bonds (distance) P-C4' energy: -114.765 flat angles C4'-P-C4' energy: -114.041 flat angles P-C4'-P energy: -78.693 tors. eta vs tors. theta energy: -86.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1016.268220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.268220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.268220 (E_RNA) where: Base-Base interactions energy: -568.633 where: short stacking energy: -299.890 Base-Backbone interact. energy: -0.079 local terms energy: -447.556112 where: bonds (distance) C4'-P energy: -106.460 bonds (distance) P-C4' energy: -111.986 flat angles C4'-P-C4' energy: -106.018 flat angles P-C4'-P energy: -75.787 tors. eta vs tors. theta energy: -47.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1068.359542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.359542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.359542 (E_RNA) where: Base-Base interactions energy: -628.398 where: short stacking energy: -296.501 Base-Backbone interact. energy: -4.312 local terms energy: -435.649399 where: bonds (distance) C4'-P energy: -97.801 bonds (distance) P-C4' energy: -116.368 flat angles C4'-P-C4' energy: -103.818 flat angles P-C4'-P energy: -64.440 tors. eta vs tors. theta energy: -53.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -769.070801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.070801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.070801 (E_RNA) where: Base-Base interactions energy: -375.481 where: short stacking energy: -247.628 Base-Backbone interact. energy: 5.312 local terms energy: -398.901817 where: bonds (distance) C4'-P energy: -101.670 bonds (distance) P-C4' energy: -109.923 flat angles C4'-P-C4' energy: -94.837 flat angles P-C4'-P energy: -48.545 tors. eta vs tors. theta energy: -43.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -689.788082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.788082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.788082 (E_RNA) where: Base-Base interactions energy: -321.537 where: short stacking energy: -196.203 Base-Backbone interact. energy: -0.285 local terms energy: -367.965647 where: bonds (distance) C4'-P energy: -105.711 bonds (distance) P-C4' energy: -94.534 flat angles C4'-P-C4' energy: -90.023 flat angles P-C4'-P energy: -58.625 tors. eta vs tors. theta energy: -19.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -488.186198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.186198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.186198 (E_RNA) where: Base-Base interactions energy: -191.545 where: short stacking energy: -128.002 Base-Backbone interact. energy: -2.171 local terms energy: -294.470449 where: bonds (distance) C4'-P energy: -99.318 bonds (distance) P-C4' energy: -92.487 flat angles C4'-P-C4' energy: -92.990 flat angles P-C4'-P energy: -56.494 tors. eta vs tors. theta energy: 46.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1967.957005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1967.957005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1967.957005 (E_RNA) where: Base-Base interactions energy: -1334.383 where: short stacking energy: -575.378 Base-Backbone interact. energy: -3.225 local terms energy: -630.348938 where: bonds (distance) C4'-P energy: -111.429 bonds (distance) P-C4' energy: -116.801 flat angles C4'-P-C4' energy: -139.178 flat angles P-C4'-P energy: -100.173 tors. eta vs tors. theta energy: -162.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1858.259737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1858.259737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1858.259737 (E_RNA) where: Base-Base interactions energy: -1241.509 where: short stacking energy: -535.892 Base-Backbone interact. energy: -5.261 local terms energy: -611.489814 where: bonds (distance) C4'-P energy: -118.014 bonds (distance) P-C4' energy: -116.744 flat angles C4'-P-C4' energy: -128.620 flat angles P-C4'-P energy: -90.746 tors. eta vs tors. theta energy: -157.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1686.110713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.110713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.110713 (E_RNA) where: Base-Base interactions energy: -1105.470 where: short stacking energy: -469.228 Base-Backbone interact. energy: -3.836 local terms energy: -576.804409 where: bonds (distance) C4'-P energy: -116.512 bonds (distance) P-C4' energy: -117.902 flat angles C4'-P-C4' energy: -128.602 flat angles P-C4'-P energy: -89.832 tors. eta vs tors. theta energy: -123.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1554.612157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.612157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.612157 (E_RNA) where: Base-Base interactions energy: -987.957 where: short stacking energy: -454.157 Base-Backbone interact. energy: -2.264 local terms energy: -564.392054 where: bonds (distance) C4'-P energy: -129.033 bonds (distance) P-C4' energy: -117.045 flat angles C4'-P-C4' energy: -138.022 flat angles P-C4'-P energy: -60.187 tors. eta vs tors. theta energy: -120.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1411.839949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.839949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.839949 (E_RNA) where: Base-Base interactions energy: -911.886 where: short stacking energy: -425.180 Base-Backbone interact. energy: -0.721 local terms energy: -499.233461 where: bonds (distance) C4'-P energy: -105.079 bonds (distance) P-C4' energy: -97.965 flat angles C4'-P-C4' energy: -115.094 flat angles P-C4'-P energy: -74.708 tors. eta vs tors. theta energy: -106.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1129.340792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.340792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.340792 (E_RNA) where: Base-Base interactions energy: -658.501 where: short stacking energy: -323.712 Base-Backbone interact. energy: -0.517 local terms energy: -470.322268 where: bonds (distance) C4'-P energy: -115.801 bonds (distance) P-C4' energy: -101.896 flat angles C4'-P-C4' energy: -125.481 flat angles P-C4'-P energy: -77.790 tors. eta vs tors. theta energy: -49.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -961.328196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.328196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.328196 (E_RNA) where: Base-Base interactions energy: -527.476 where: short stacking energy: -266.861 Base-Backbone interact. energy: -0.137 local terms energy: -433.714840 where: bonds (distance) C4'-P energy: -109.076 bonds (distance) P-C4' energy: -101.089 flat angles C4'-P-C4' energy: -112.196 flat angles P-C4'-P energy: -62.096 tors. eta vs tors. theta energy: -49.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -737.787892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.787892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.787892 (E_RNA) where: Base-Base interactions energy: -367.090 where: short stacking energy: -213.411 Base-Backbone interact. energy: 2.362 local terms energy: -373.059300 where: bonds (distance) C4'-P energy: -97.358 bonds (distance) P-C4' energy: -105.077 flat angles C4'-P-C4' energy: -98.644 flat angles P-C4'-P energy: -50.680 tors. eta vs tors. theta energy: -21.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -671.919392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.919392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.919392 (E_RNA) where: Base-Base interactions energy: -345.647 where: short stacking energy: -196.425 Base-Backbone interact. energy: -3.725 local terms energy: -322.547052 where: bonds (distance) C4'-P energy: -72.944 bonds (distance) P-C4' energy: -98.995 flat angles C4'-P-C4' energy: -85.614 flat angles P-C4'-P energy: -64.059 tors. eta vs tors. theta energy: -0.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -537.105142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.105142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.105142 (E_RNA) where: Base-Base interactions energy: -238.290 where: short stacking energy: -135.580 Base-Backbone interact. energy: 1.964 local terms energy: -300.779614 where: bonds (distance) C4'-P energy: -71.601 bonds (distance) P-C4' energy: -91.252 flat angles C4'-P-C4' energy: -95.177 flat angles P-C4'-P energy: -60.589 tors. eta vs tors. theta energy: 17.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1993.016429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.016429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.016429 (E_RNA) where: Base-Base interactions energy: -1341.183 where: short stacking energy: -598.652 Base-Backbone interact. energy: 0.598 local terms energy: -652.431058 where: bonds (distance) C4'-P energy: -124.474 bonds (distance) P-C4' energy: -122.499 flat angles C4'-P-C4' energy: -147.745 flat angles P-C4'-P energy: -97.739 tors. eta vs tors. theta energy: -159.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1813.518605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1813.518605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.518605 (E_RNA) where: Base-Base interactions energy: -1201.246 where: short stacking energy: -538.919 Base-Backbone interact. energy: -1.789 local terms energy: -610.483772 where: bonds (distance) C4'-P energy: -109.540 bonds (distance) P-C4' energy: -126.883 flat angles C4'-P-C4' energy: -141.500 flat angles P-C4'-P energy: -76.574 tors. eta vs tors. theta energy: -155.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1740.166181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.166181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.166181 (E_RNA) where: Base-Base interactions energy: -1177.970 where: short stacking energy: -491.678 Base-Backbone interact. energy: 0.267 local terms energy: -562.463019 where: bonds (distance) C4'-P energy: -120.870 bonds (distance) P-C4' energy: -129.695 flat angles C4'-P-C4' energy: -116.982 flat angles P-C4'-P energy: -70.992 tors. eta vs tors. theta energy: -123.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1622.284141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1622.284141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.284141 (E_RNA) where: Base-Base interactions energy: -1065.967 where: short stacking energy: -476.922 Base-Backbone interact. energy: 2.490 local terms energy: -558.806314 where: bonds (distance) C4'-P energy: -109.670 bonds (distance) P-C4' energy: -103.133 flat angles C4'-P-C4' energy: -127.015 flat angles P-C4'-P energy: -86.721 tors. eta vs tors. theta energy: -132.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1371.768824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.768824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.768824 (E_RNA) where: Base-Base interactions energy: -896.297 where: short stacking energy: -414.908 Base-Backbone interact. energy: 6.924 local terms energy: -482.395487 where: bonds (distance) C4'-P energy: -103.316 bonds (distance) P-C4' energy: -107.231 flat angles C4'-P-C4' energy: -110.569 flat angles P-C4'-P energy: -72.315 tors. eta vs tors. theta energy: -88.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1061.163613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.163613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.163613 (E_RNA) where: Base-Base interactions energy: -593.165 where: short stacking energy: -325.607 Base-Backbone interact. energy: -1.569 local terms energy: -466.430022 where: bonds (distance) C4'-P energy: -108.325 bonds (distance) P-C4' energy: -124.215 flat angles C4'-P-C4' energy: -114.164 flat angles P-C4'-P energy: -66.678 tors. eta vs tors. theta energy: -53.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -947.291381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.291381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.291381 (E_RNA) where: Base-Base interactions energy: -527.118 where: short stacking energy: -281.783 Base-Backbone interact. energy: 0.992 local terms energy: -421.165768 where: bonds (distance) C4'-P energy: -121.326 bonds (distance) P-C4' energy: -102.094 flat angles C4'-P-C4' energy: -110.224 flat angles P-C4'-P energy: -48.386 tors. eta vs tors. theta energy: -39.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -758.391804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.391804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.391804 (E_RNA) where: Base-Base interactions energy: -417.471 where: short stacking energy: -211.837 Base-Backbone interact. energy: 0.351 local terms energy: -341.272577 where: bonds (distance) C4'-P energy: -101.706 bonds (distance) P-C4' energy: -98.515 flat angles C4'-P-C4' energy: -96.137 flat angles P-C4'-P energy: -48.305 tors. eta vs tors. theta energy: 3.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -647.761781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.761781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.761781 (E_RNA) where: Base-Base interactions energy: -311.236 where: short stacking energy: -209.865 Base-Backbone interact. energy: 2.899 local terms energy: -339.424435 where: bonds (distance) C4'-P energy: -111.976 bonds (distance) P-C4' energy: -102.632 flat angles C4'-P-C4' energy: -69.836 flat angles P-C4'-P energy: -61.867 tors. eta vs tors. theta energy: 6.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -580.258003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.258003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.258003 (E_RNA) where: Base-Base interactions energy: -246.117 where: short stacking energy: -152.058 Base-Backbone interact. energy: 6.120 local terms energy: -340.260283 where: bonds (distance) C4'-P energy: -106.800 bonds (distance) P-C4' energy: -105.872 flat angles C4'-P-C4' energy: -88.461 flat angles P-C4'-P energy: -52.766 tors. eta vs tors. theta energy: 13.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2000.415637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2000.415637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2000.415637 (E_RNA) where: Base-Base interactions energy: -1379.040 where: short stacking energy: -577.955 Base-Backbone interact. energy: -0.821 local terms energy: -620.554875 where: bonds (distance) C4'-P energy: -113.147 bonds (distance) P-C4' energy: -123.991 flat angles C4'-P-C4' energy: -136.571 flat angles P-C4'-P energy: -85.093 tors. eta vs tors. theta energy: -161.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1873.016181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1873.016181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.016181 (E_RNA) where: Base-Base interactions energy: -1269.583 where: short stacking energy: -555.711 Base-Backbone interact. energy: -0.803 local terms energy: -602.629691 where: bonds (distance) C4'-P energy: -103.635 bonds (distance) P-C4' energy: -118.921 flat angles C4'-P-C4' energy: -117.592 flat angles P-C4'-P energy: -99.702 tors. eta vs tors. theta energy: -162.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1696.378476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.378476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.378476 (E_RNA) where: Base-Base interactions energy: -1125.077 where: short stacking energy: -505.031 Base-Backbone interact. energy: -4.066 local terms energy: -567.235469 where: bonds (distance) C4'-P energy: -117.253 bonds (distance) P-C4' energy: -111.696 flat angles C4'-P-C4' energy: -123.534 flat angles P-C4'-P energy: -81.759 tors. eta vs tors. theta energy: -132.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1625.861052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.861052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.861052 (E_RNA) where: Base-Base interactions energy: -1062.022 where: short stacking energy: -464.278 Base-Backbone interact. energy: -1.451 local terms energy: -562.388662 where: bonds (distance) C4'-P energy: -123.941 bonds (distance) P-C4' energy: -103.792 flat angles C4'-P-C4' energy: -123.144 flat angles P-C4'-P energy: -80.720 tors. eta vs tors. theta energy: -130.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1389.219323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.219323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.219323 (E_RNA) where: Base-Base interactions energy: -874.978 where: short stacking energy: -398.484 Base-Backbone interact. energy: -1.725 local terms energy: -512.517042 where: bonds (distance) C4'-P energy: -104.946 bonds (distance) P-C4' energy: -118.520 flat angles C4'-P-C4' energy: -123.467 flat angles P-C4'-P energy: -68.494 tors. eta vs tors. theta energy: -97.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1061.604414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.604414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.604414 (E_RNA) where: Base-Base interactions energy: -604.870 where: short stacking energy: -295.899 Base-Backbone interact. energy: -1.170 local terms energy: -455.564420 where: bonds (distance) C4'-P energy: -113.591 bonds (distance) P-C4' energy: -112.916 flat angles C4'-P-C4' energy: -117.056 flat angles P-C4'-P energy: -60.526 tors. eta vs tors. theta energy: -51.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -940.929539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.929539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.929539 (E_RNA) where: Base-Base interactions energy: -533.236 where: short stacking energy: -271.507 Base-Backbone interact. energy: 1.394 local terms energy: -409.087830 where: bonds (distance) C4'-P energy: -111.582 bonds (distance) P-C4' energy: -116.349 flat angles C4'-P-C4' energy: -91.099 flat angles P-C4'-P energy: -50.454 tors. eta vs tors. theta energy: -39.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -767.077310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.077310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.077310 (E_RNA) where: Base-Base interactions energy: -388.116 where: short stacking energy: -220.227 Base-Backbone interact. energy: 4.407 local terms energy: -383.368261 where: bonds (distance) C4'-P energy: -92.465 bonds (distance) P-C4' energy: -119.436 flat angles C4'-P-C4' energy: -106.579 flat angles P-C4'-P energy: -54.445 tors. eta vs tors. theta energy: -10.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -568.587576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.587576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.587576 (E_RNA) where: Base-Base interactions energy: -204.989 where: short stacking energy: -149.285 Base-Backbone interact. energy: -1.094 local terms energy: -362.504331 where: bonds (distance) C4'-P energy: -101.319 bonds (distance) P-C4' energy: -113.793 flat angles C4'-P-C4' energy: -82.393 flat angles P-C4'-P energy: -52.002 tors. eta vs tors. theta energy: -12.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -541.036559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.036559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.036559 (E_RNA) where: Base-Base interactions energy: -242.286 where: short stacking energy: -139.590 Base-Backbone interact. energy: 1.480 local terms energy: -300.230825 where: bonds (distance) C4'-P energy: -85.493 bonds (distance) P-C4' energy: -116.907 flat angles C4'-P-C4' energy: -85.454 flat angles P-C4'-P energy: -40.004 tors. eta vs tors. theta energy: 27.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1941.004866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1941.004866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1941.004866 (E_RNA) where: Base-Base interactions energy: -1286.795 where: short stacking energy: -558.536 Base-Backbone interact. energy: -2.148 local terms energy: -652.061605 where: bonds (distance) C4'-P energy: -137.092 bonds (distance) P-C4' energy: -134.370 flat angles C4'-P-C4' energy: -138.594 flat angles P-C4'-P energy: -81.462 tors. eta vs tors. theta energy: -160.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1866.006869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1866.006869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1866.006869 (E_RNA) where: Base-Base interactions energy: -1234.239 where: short stacking energy: -547.449 Base-Backbone interact. energy: 2.076 local terms energy: -633.844144 where: bonds (distance) C4'-P energy: -115.937 bonds (distance) P-C4' energy: -129.206 flat angles C4'-P-C4' energy: -131.697 flat angles P-C4'-P energy: -91.539 tors. eta vs tors. theta energy: -165.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1703.247980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.247980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.247980 (E_RNA) where: Base-Base interactions energy: -1092.760 where: short stacking energy: -492.883 Base-Backbone interact. energy: -4.396 local terms energy: -606.091762 where: bonds (distance) C4'-P energy: -120.436 bonds (distance) P-C4' energy: -130.897 flat angles C4'-P-C4' energy: -125.496 flat angles P-C4'-P energy: -92.433 tors. eta vs tors. theta energy: -136.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1597.500008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.500008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.500008 (E_RNA) where: Base-Base interactions energy: -1057.621 where: short stacking energy: -457.402 Base-Backbone interact. energy: 1.526 local terms energy: -541.404441 where: bonds (distance) C4'-P energy: -93.593 bonds (distance) P-C4' energy: -128.622 flat angles C4'-P-C4' energy: -104.907 flat angles P-C4'-P energy: -88.451 tors. eta vs tors. theta energy: -125.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1376.647963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.647963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.647963 (E_RNA) where: Base-Base interactions energy: -861.723 where: short stacking energy: -391.595 Base-Backbone interact. energy: 0.204 local terms energy: -515.128743 where: bonds (distance) C4'-P energy: -111.608 bonds (distance) P-C4' energy: -124.105 flat angles C4'-P-C4' energy: -109.702 flat angles P-C4'-P energy: -76.552 tors. eta vs tors. theta energy: -93.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1070.513933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.513933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.513933 (E_RNA) where: Base-Base interactions energy: -605.545 where: short stacking energy: -301.049 Base-Backbone interact. energy: -1.932 local terms energy: -463.036972 where: bonds (distance) C4'-P energy: -114.221 bonds (distance) P-C4' energy: -117.242 flat angles C4'-P-C4' energy: -102.455 flat angles P-C4'-P energy: -69.624 tors. eta vs tors. theta energy: -59.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -937.523661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.523661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.523661 (E_RNA) where: Base-Base interactions energy: -491.764 where: short stacking energy: -245.089 Base-Backbone interact. energy: -1.612 local terms energy: -444.147252 where: bonds (distance) C4'-P energy: -112.992 bonds (distance) P-C4' energy: -118.621 flat angles C4'-P-C4' energy: -97.986 flat angles P-C4'-P energy: -78.135 tors. eta vs tors. theta energy: -36.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -796.407245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.407245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.407245 (E_RNA) where: Base-Base interactions energy: -430.730 where: short stacking energy: -210.819 Base-Backbone interact. energy: -0.419 local terms energy: -365.258640 where: bonds (distance) C4'-P energy: -96.540 bonds (distance) P-C4' energy: -91.064 flat angles C4'-P-C4' energy: -102.723 flat angles P-C4'-P energy: -54.861 tors. eta vs tors. theta energy: -20.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -531.965605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.965605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.965605 (E_RNA) where: Base-Base interactions energy: -190.199 where: short stacking energy: -139.636 Base-Backbone interact. energy: -1.338 local terms energy: -340.428059 where: bonds (distance) C4'-P energy: -100.084 bonds (distance) P-C4' energy: -107.792 flat angles C4'-P-C4' energy: -85.772 flat angles P-C4'-P energy: -57.579 tors. eta vs tors. theta energy: 10.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -521.641135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.641135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.641135 (E_RNA) where: Base-Base interactions energy: -231.756 where: short stacking energy: -158.069 Base-Backbone interact. energy: -1.116 local terms energy: -288.768881 where: bonds (distance) C4'-P energy: -82.233 bonds (distance) P-C4' energy: -94.878 flat angles C4'-P-C4' energy: -86.790 flat angles P-C4'-P energy: -51.703 tors. eta vs tors. theta energy: 26.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1938.217346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1938.217346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1938.217346 (E_RNA) where: Base-Base interactions energy: -1302.614 where: short stacking energy: -550.341 Base-Backbone interact. energy: -2.722 local terms energy: -632.881399 where: bonds (distance) C4'-P energy: -128.924 bonds (distance) P-C4' energy: -119.821 flat angles C4'-P-C4' energy: -139.973 flat angles P-C4'-P energy: -84.972 tors. eta vs tors. theta energy: -159.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1852.211148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1852.211148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1852.211148 (E_RNA) where: Base-Base interactions energy: -1245.081 where: short stacking energy: -527.478 Base-Backbone interact. energy: 4.207 local terms energy: -611.336354 where: bonds (distance) C4'-P energy: -124.340 bonds (distance) P-C4' energy: -121.000 flat angles C4'-P-C4' energy: -127.856 flat angles P-C4'-P energy: -77.946 tors. eta vs tors. theta energy: -160.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1711.150441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1711.150441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.150441 (E_RNA) where: Base-Base interactions energy: -1114.067 where: short stacking energy: -481.061 Base-Backbone interact. energy: 0.713 local terms energy: -597.796675 where: bonds (distance) C4'-P energy: -120.121 bonds (distance) P-C4' energy: -125.222 flat angles C4'-P-C4' energy: -132.576 flat angles P-C4'-P energy: -81.901 tors. eta vs tors. theta energy: -137.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1639.248243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.248243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.248243 (E_RNA) where: Base-Base interactions energy: -1063.707 where: short stacking energy: -473.057 Base-Backbone interact. energy: 1.637 local terms energy: -577.178987 where: bonds (distance) C4'-P energy: -104.495 bonds (distance) P-C4' energy: -120.465 flat angles C4'-P-C4' energy: -126.330 flat angles P-C4'-P energy: -85.220 tors. eta vs tors. theta energy: -140.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1397.533063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.533063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.533063 (E_RNA) where: Base-Base interactions energy: -878.015 where: short stacking energy: -394.077 Base-Backbone interact. energy: 0.891 local terms energy: -520.408846 where: bonds (distance) C4'-P energy: -110.770 bonds (distance) P-C4' energy: -118.588 flat angles C4'-P-C4' energy: -128.107 flat angles P-C4'-P energy: -86.398 tors. eta vs tors. theta energy: -76.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1146.337894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.337894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1146.337894 (E_RNA) where: Base-Base interactions energy: -685.868 where: short stacking energy: -312.612 Base-Backbone interact. energy: 1.657 local terms energy: -462.126333 where: bonds (distance) C4'-P energy: -96.640 bonds (distance) P-C4' energy: -104.895 flat angles C4'-P-C4' energy: -114.088 flat angles P-C4'-P energy: -80.917 tors. eta vs tors. theta energy: -65.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -995.862599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.862599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.862599 (E_RNA) where: Base-Base interactions energy: -594.833 where: short stacking energy: -270.739 Base-Backbone interact. energy: 5.229 local terms energy: -406.258710 where: bonds (distance) C4'-P energy: -108.394 bonds (distance) P-C4' energy: -107.872 flat angles C4'-P-C4' energy: -108.329 flat angles P-C4'-P energy: -45.850 tors. eta vs tors. theta energy: -35.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -767.108163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.108163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.108163 (E_RNA) where: Base-Base interactions energy: -367.235 where: short stacking energy: -219.581 Base-Backbone interact. energy: 1.144 local terms energy: -401.017701 where: bonds (distance) C4'-P energy: -100.208 bonds (distance) P-C4' energy: -107.526 flat angles C4'-P-C4' energy: -99.673 flat angles P-C4'-P energy: -72.996 tors. eta vs tors. theta energy: -20.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -575.618222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.618222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.618222 (E_RNA) where: Base-Base interactions energy: -242.647 where: short stacking energy: -148.600 Base-Backbone interact. energy: 0.005 local terms energy: -332.976463 where: bonds (distance) C4'-P energy: -93.894 bonds (distance) P-C4' energy: -105.090 flat angles C4'-P-C4' energy: -88.954 flat angles P-C4'-P energy: -48.653 tors. eta vs tors. theta energy: 3.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -553.288838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.288838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.288838 (E_RNA) where: Base-Base interactions energy: -224.958 where: short stacking energy: -151.304 Base-Backbone interact. energy: 7.321 local terms energy: -335.652759 where: bonds (distance) C4'-P energy: -105.836 bonds (distance) P-C4' energy: -106.834 flat angles C4'-P-C4' energy: -76.501 flat angles P-C4'-P energy: -48.004 tors. eta vs tors. theta energy: 1.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1962.638427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.638427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.638427 (E_RNA) where: Base-Base interactions energy: -1338.616 where: short stacking energy: -567.759 Base-Backbone interact. energy: 1.215 local terms energy: -625.237292 where: bonds (distance) C4'-P energy: -117.876 bonds (distance) P-C4' energy: -124.724 flat angles C4'-P-C4' energy: -136.916 flat angles P-C4'-P energy: -90.211 tors. eta vs tors. theta energy: -155.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1866.752348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1866.752348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1866.752348 (E_RNA) where: Base-Base interactions energy: -1262.495 where: short stacking energy: -554.213 Base-Backbone interact. energy: -0.830 local terms energy: -603.427433 where: bonds (distance) C4'-P energy: -109.824 bonds (distance) P-C4' energy: -122.506 flat angles C4'-P-C4' energy: -126.034 flat angles P-C4'-P energy: -91.339 tors. eta vs tors. theta energy: -153.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1734.164927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.164927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.164927 (E_RNA) where: Base-Base interactions energy: -1149.402 where: short stacking energy: -500.238 Base-Backbone interact. energy: -1.343 local terms energy: -583.420080 where: bonds (distance) C4'-P energy: -100.705 bonds (distance) P-C4' energy: -130.694 flat angles C4'-P-C4' energy: -125.023 flat angles P-C4'-P energy: -86.642 tors. eta vs tors. theta energy: -140.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1654.960355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.960355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.960355 (E_RNA) where: Base-Base interactions energy: -1076.365 where: short stacking energy: -491.894 Base-Backbone interact. energy: -2.524 local terms energy: -576.071551 where: bonds (distance) C4'-P energy: -114.515 bonds (distance) P-C4' energy: -111.859 flat angles C4'-P-C4' energy: -127.110 flat angles P-C4'-P energy: -73.970 tors. eta vs tors. theta energy: -148.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1403.087569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.087569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.087569 (E_RNA) where: Base-Base interactions energy: -926.810 where: short stacking energy: -423.023 Base-Backbone interact. energy: -3.290 local terms energy: -472.987947 where: bonds (distance) C4'-P energy: -97.007 bonds (distance) P-C4' energy: -90.386 flat angles C4'-P-C4' energy: -118.197 flat angles P-C4'-P energy: -74.517 tors. eta vs tors. theta energy: -92.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1097.001323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.001323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.001323 (E_RNA) where: Base-Base interactions energy: -657.551 where: short stacking energy: -313.255 Base-Backbone interact. energy: -4.427 local terms energy: -435.022988 where: bonds (distance) C4'-P energy: -103.599 bonds (distance) P-C4' energy: -104.570 flat angles C4'-P-C4' energy: -109.101 flat angles P-C4'-P energy: -63.486 tors. eta vs tors. theta energy: -54.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1032.933796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.933796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.933796 (E_RNA) where: Base-Base interactions energy: -574.862 where: short stacking energy: -286.183 Base-Backbone interact. energy: -1.885 local terms energy: -456.186967 where: bonds (distance) C4'-P energy: -104.979 bonds (distance) P-C4' energy: -122.396 flat angles C4'-P-C4' energy: -101.158 flat angles P-C4'-P energy: -64.516 tors. eta vs tors. theta energy: -63.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -763.378536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.378536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.378536 (E_RNA) where: Base-Base interactions energy: -387.459 where: short stacking energy: -215.606 Base-Backbone interact. energy: -4.158 local terms energy: -371.761290 where: bonds (distance) C4'-P energy: -93.021 bonds (distance) P-C4' energy: -93.761 flat angles C4'-P-C4' energy: -86.141 flat angles P-C4'-P energy: -62.619 tors. eta vs tors. theta energy: -36.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -578.329500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.329500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.329500 (E_RNA) where: Base-Base interactions energy: -241.026 where: short stacking energy: -173.519 Base-Backbone interact. energy: 8.352 local terms energy: -345.655000 where: bonds (distance) C4'-P energy: -92.689 bonds (distance) P-C4' energy: -104.473 flat angles C4'-P-C4' energy: -83.964 flat angles P-C4'-P energy: -56.663 tors. eta vs tors. theta energy: -7.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -540.998197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.998197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.998197 (E_RNA) where: Base-Base interactions energy: -252.284 where: short stacking energy: -167.683 Base-Backbone interact. energy: 0.732 local terms energy: -289.445859 where: bonds (distance) C4'-P energy: -100.412 bonds (distance) P-C4' energy: -94.166 flat angles C4'-P-C4' energy: -79.480 flat angles P-C4'-P energy: -31.130 tors. eta vs tors. theta energy: 15.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1987.879598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1987.879598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1987.879598 (E_RNA) where: Base-Base interactions energy: -1347.133 where: short stacking energy: -569.791 Base-Backbone interact. energy: -0.259 local terms energy: -640.487145 where: bonds (distance) C4'-P energy: -127.532 bonds (distance) P-C4' energy: -129.749 flat angles C4'-P-C4' energy: -121.512 flat angles P-C4'-P energy: -90.114 tors. eta vs tors. theta energy: -171.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1881.828056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1881.828056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1881.828056 (E_RNA) where: Base-Base interactions energy: -1252.658 where: short stacking energy: -536.855 Base-Backbone interact. energy: -2.807 local terms energy: -626.363638 where: bonds (distance) C4'-P energy: -127.270 bonds (distance) P-C4' energy: -118.175 flat angles C4'-P-C4' energy: -131.573 flat angles P-C4'-P energy: -83.355 tors. eta vs tors. theta energy: -165.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1758.428559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1758.428559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.428559 (E_RNA) where: Base-Base interactions energy: -1167.246 where: short stacking energy: -507.942 Base-Backbone interact. energy: -3.709 local terms energy: -587.474375 where: bonds (distance) C4'-P energy: -116.654 bonds (distance) P-C4' energy: -128.561 flat angles C4'-P-C4' energy: -132.366 flat angles P-C4'-P energy: -81.525 tors. eta vs tors. theta energy: -128.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1671.882700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1671.882700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.882700 (E_RNA) where: Base-Base interactions energy: -1122.904 where: short stacking energy: -501.712 Base-Backbone interact. energy: -4.306 local terms energy: -544.672844 where: bonds (distance) C4'-P energy: -100.405 bonds (distance) P-C4' energy: -118.158 flat angles C4'-P-C4' energy: -104.890 flat angles P-C4'-P energy: -84.446 tors. eta vs tors. theta energy: -136.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1400.209751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.209751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.209751 (E_RNA) where: Base-Base interactions energy: -880.915 where: short stacking energy: -388.176 Base-Backbone interact. energy: 0.576 local terms energy: -519.870265 where: bonds (distance) C4'-P energy: -97.656 bonds (distance) P-C4' energy: -125.880 flat angles C4'-P-C4' energy: -107.231 flat angles P-C4'-P energy: -76.858 tors. eta vs tors. theta energy: -112.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1097.047965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.047965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.047965 (E_RNA) where: Base-Base interactions energy: -646.724 where: short stacking energy: -331.572 Base-Backbone interact. energy: 0.868 local terms energy: -451.191978 where: bonds (distance) C4'-P energy: -99.450 bonds (distance) P-C4' energy: -121.778 flat angles C4'-P-C4' energy: -104.167 flat angles P-C4'-P energy: -71.206 tors. eta vs tors. theta energy: -54.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -901.189376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.189376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.189376 (E_RNA) where: Base-Base interactions energy: -503.429 where: short stacking energy: -251.031 Base-Backbone interact. energy: 0.871 local terms energy: -398.631611 where: bonds (distance) C4'-P energy: -96.132 bonds (distance) P-C4' energy: -111.752 flat angles C4'-P-C4' energy: -96.866 flat angles P-C4'-P energy: -57.039 tors. eta vs tors. theta energy: -36.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -741.686937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.686937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.686937 (E_RNA) where: Base-Base interactions energy: -332.471 where: short stacking energy: -204.816 Base-Backbone interact. energy: 0.291 local terms energy: -409.506997 where: bonds (distance) C4'-P energy: -113.090 bonds (distance) P-C4' energy: -108.704 flat angles C4'-P-C4' energy: -102.729 flat angles P-C4'-P energy: -73.015 tors. eta vs tors. theta energy: -11.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -596.528948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.528948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.528948 (E_RNA) where: Base-Base interactions energy: -295.151 where: short stacking energy: -168.099 Base-Backbone interact. energy: -0.060 local terms energy: -301.317684 where: bonds (distance) C4'-P energy: -87.765 bonds (distance) P-C4' energy: -105.988 flat angles C4'-P-C4' energy: -69.187 flat angles P-C4'-P energy: -41.355 tors. eta vs tors. theta energy: 2.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -558.861615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.861615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.861615 (E_RNA) where: Base-Base interactions energy: -227.478 where: short stacking energy: -163.663 Base-Backbone interact. energy: -0.406 local terms energy: -330.978124 where: bonds (distance) C4'-P energy: -93.250 bonds (distance) P-C4' energy: -103.970 flat angles C4'-P-C4' energy: -85.565 flat angles P-C4'-P energy: -32.028 tors. eta vs tors. theta energy: -16.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1983.699304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.699304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1983.699304 (E_RNA) where: Base-Base interactions energy: -1349.034 where: short stacking energy: -574.289 Base-Backbone interact. energy: -4.528 local terms energy: -630.137317 where: bonds (distance) C4'-P energy: -126.441 bonds (distance) P-C4' energy: -110.189 flat angles C4'-P-C4' energy: -143.362 flat angles P-C4'-P energy: -86.107 tors. eta vs tors. theta energy: -164.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1868.249492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.249492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1868.249492 (E_RNA) where: Base-Base interactions energy: -1247.197 where: short stacking energy: -549.166 Base-Backbone interact. energy: -2.692 local terms energy: -618.361067 where: bonds (distance) C4'-P energy: -113.831 bonds (distance) P-C4' energy: -112.839 flat angles C4'-P-C4' energy: -139.774 flat angles P-C4'-P energy: -94.066 tors. eta vs tors. theta energy: -157.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1710.529589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.529589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.529589 (E_RNA) where: Base-Base interactions energy: -1124.851 where: short stacking energy: -498.512 Base-Backbone interact. energy: -0.106 local terms energy: -585.572226 where: bonds (distance) C4'-P energy: -127.978 bonds (distance) P-C4' energy: -118.475 flat angles C4'-P-C4' energy: -132.798 flat angles P-C4'-P energy: -82.309 tors. eta vs tors. theta energy: -124.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1710.426807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.426807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.426807 (E_RNA) where: Base-Base interactions energy: -1157.031 where: short stacking energy: -501.779 Base-Backbone interact. energy: -2.679 local terms energy: -550.717282 where: bonds (distance) C4'-P energy: -122.605 bonds (distance) P-C4' energy: -90.189 flat angles C4'-P-C4' energy: -139.758 flat angles P-C4'-P energy: -64.280 tors. eta vs tors. theta energy: -133.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1477.728406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.728406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.728406 (E_RNA) where: Base-Base interactions energy: -953.932 where: short stacking energy: -441.900 Base-Backbone interact. energy: -0.179 local terms energy: -523.617753 where: bonds (distance) C4'-P energy: -108.222 bonds (distance) P-C4' energy: -119.513 flat angles C4'-P-C4' energy: -118.974 flat angles P-C4'-P energy: -72.784 tors. eta vs tors. theta energy: -104.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1073.145183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.145183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.145183 (E_RNA) where: Base-Base interactions energy: -626.072 where: short stacking energy: -315.240 Base-Backbone interact. energy: -0.574 local terms energy: -446.499086 where: bonds (distance) C4'-P energy: -99.136 bonds (distance) P-C4' energy: -116.634 flat angles C4'-P-C4' energy: -90.257 flat angles P-C4'-P energy: -68.196 tors. eta vs tors. theta energy: -72.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -917.634753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.634753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.634753 (E_RNA) where: Base-Base interactions energy: -486.809 where: short stacking energy: -256.912 Base-Backbone interact. energy: -1.513 local terms energy: -429.312731 where: bonds (distance) C4'-P energy: -108.697 bonds (distance) P-C4' energy: -97.543 flat angles C4'-P-C4' energy: -124.793 flat angles P-C4'-P energy: -54.567 tors. eta vs tors. theta energy: -43.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -741.001861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.001861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.001861 (E_RNA) where: Base-Base interactions energy: -364.397 where: short stacking energy: -230.197 Base-Backbone interact. energy: -0.542 local terms energy: -376.062898 where: bonds (distance) C4'-P energy: -93.076 bonds (distance) P-C4' energy: -89.943 flat angles C4'-P-C4' energy: -99.829 flat angles P-C4'-P energy: -63.309 tors. eta vs tors. theta energy: -29.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -664.939513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.939513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.939513 (E_RNA) where: Base-Base interactions energy: -324.179 where: short stacking energy: -188.166 Base-Backbone interact. energy: 2.207 local terms energy: -342.967381 where: bonds (distance) C4'-P energy: -103.596 bonds (distance) P-C4' energy: -102.763 flat angles C4'-P-C4' energy: -89.681 flat angles P-C4'-P energy: -43.100 tors. eta vs tors. theta energy: -3.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -564.937019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.937019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.937019 (E_RNA) where: Base-Base interactions energy: -241.218 where: short stacking energy: -148.057 Base-Backbone interact. energy: 4.126 local terms energy: -327.845030 where: bonds (distance) C4'-P energy: -108.360 bonds (distance) P-C4' energy: -114.269 flat angles C4'-P-C4' energy: -81.531 flat angles P-C4'-P energy: -34.850 tors. eta vs tors. theta energy: 11.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1978.466423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1978.466423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1978.466423 (E_RNA) where: Base-Base interactions energy: -1320.077 where: short stacking energy: -565.130 Base-Backbone interact. energy: -2.611 local terms energy: -655.778645 where: bonds (distance) C4'-P energy: -121.721 bonds (distance) P-C4' energy: -134.363 flat angles C4'-P-C4' energy: -127.886 flat angles P-C4'-P energy: -100.708 tors. eta vs tors. theta energy: -171.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1862.027283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1862.027283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1862.027283 (E_RNA) where: Base-Base interactions energy: -1252.854 where: short stacking energy: -551.008 Base-Backbone interact. energy: -5.640 local terms energy: -603.533001 where: bonds (distance) C4'-P energy: -122.310 bonds (distance) P-C4' energy: -109.964 flat angles C4'-P-C4' energy: -124.854 flat angles P-C4'-P energy: -87.998 tors. eta vs tors. theta energy: -158.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1704.598392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.598392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.598392 (E_RNA) where: Base-Base interactions energy: -1137.114 where: short stacking energy: -492.080 Base-Backbone interact. energy: -0.967 local terms energy: -566.516799 where: bonds (distance) C4'-P energy: -105.270 bonds (distance) P-C4' energy: -117.587 flat angles C4'-P-C4' energy: -131.708 flat angles P-C4'-P energy: -79.686 tors. eta vs tors. theta energy: -132.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1629.943006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.943006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.943006 (E_RNA) where: Base-Base interactions energy: -1086.223 where: short stacking energy: -461.385 Base-Backbone interact. energy: 0.688 local terms energy: -544.407772 where: bonds (distance) C4'-P energy: -111.709 bonds (distance) P-C4' energy: -112.521 flat angles C4'-P-C4' energy: -120.654 flat angles P-C4'-P energy: -77.185 tors. eta vs tors. theta energy: -122.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1377.393353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.393353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.393353 (E_RNA) where: Base-Base interactions energy: -867.191 where: short stacking energy: -396.707 Base-Backbone interact. energy: -2.200 local terms energy: -508.003035 where: bonds (distance) C4'-P energy: -100.805 bonds (distance) P-C4' energy: -99.461 flat angles C4'-P-C4' energy: -130.571 flat angles P-C4'-P energy: -71.033 tors. eta vs tors. theta energy: -106.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1168.623988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.623988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.623988 (E_RNA) where: Base-Base interactions energy: -699.357 where: short stacking energy: -341.743 Base-Backbone interact. energy: -1.943 local terms energy: -467.323873 where: bonds (distance) C4'-P energy: -112.450 bonds (distance) P-C4' energy: -114.735 flat angles C4'-P-C4' energy: -103.520 flat angles P-C4'-P energy: -69.548 tors. eta vs tors. theta energy: -67.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -911.033644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.033644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.033644 (E_RNA) where: Base-Base interactions energy: -482.636 where: short stacking energy: -252.205 Base-Backbone interact. energy: 4.602 local terms energy: -432.999050 where: bonds (distance) C4'-P energy: -105.480 bonds (distance) P-C4' energy: -120.167 flat angles C4'-P-C4' energy: -117.700 flat angles P-C4'-P energy: -59.277 tors. eta vs tors. theta energy: -30.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -766.885131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.885131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.885131 (E_RNA) where: Base-Base interactions energy: -366.932 where: short stacking energy: -202.688 Base-Backbone interact. energy: -0.985 local terms energy: -398.968019 where: bonds (distance) C4'-P energy: -94.225 bonds (distance) P-C4' energy: -105.957 flat angles C4'-P-C4' energy: -113.135 flat angles P-C4'-P energy: -74.369 tors. eta vs tors. theta energy: -11.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -625.670105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.670105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.670105 (E_RNA) where: Base-Base interactions energy: -264.107 where: short stacking energy: -156.630 Base-Backbone interact. energy: -1.598 local terms energy: -359.965276 where: bonds (distance) C4'-P energy: -97.186 bonds (distance) P-C4' energy: -107.886 flat angles C4'-P-C4' energy: -94.519 flat angles P-C4'-P energy: -62.630 tors. eta vs tors. theta energy: 2.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -567.419036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.419036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.419036 (E_RNA) where: Base-Base interactions energy: -221.929 where: short stacking energy: -110.570 Base-Backbone interact. energy: -0.994 local terms energy: -344.496384 where: bonds (distance) C4'-P energy: -91.761 bonds (distance) P-C4' energy: -131.613 flat angles C4'-P-C4' energy: -76.398 flat angles P-C4'-P energy: -59.194 tors. eta vs tors. theta energy: 14.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1997.892379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1997.892379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1997.892379 (E_RNA) where: Base-Base interactions energy: -1356.199 where: short stacking energy: -604.224 Base-Backbone interact. energy: -2.583 local terms energy: -639.109938 where: bonds (distance) C4'-P energy: -121.696 bonds (distance) P-C4' energy: -117.255 flat angles C4'-P-C4' energy: -130.840 flat angles P-C4'-P energy: -90.174 tors. eta vs tors. theta energy: -179.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1850.420229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1850.420229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1850.420229 (E_RNA) where: Base-Base interactions energy: -1229.909 where: short stacking energy: -520.264 Base-Backbone interact. energy: -1.858 local terms energy: -618.653421 where: bonds (distance) C4'-P energy: -123.738 bonds (distance) P-C4' energy: -132.211 flat angles C4'-P-C4' energy: -127.788 flat angles P-C4'-P energy: -77.434 tors. eta vs tors. theta energy: -157.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1685.939164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.939164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.939164 (E_RNA) where: Base-Base interactions energy: -1112.369 where: short stacking energy: -480.965 Base-Backbone interact. energy: -3.909 local terms energy: -569.660689 where: bonds (distance) C4'-P energy: -127.342 bonds (distance) P-C4' energy: -114.522 flat angles C4'-P-C4' energy: -133.102 flat angles P-C4'-P energy: -69.616 tors. eta vs tors. theta energy: -125.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1705.323135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.323135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1705.323135 (E_RNA) where: Base-Base interactions energy: -1130.043 where: short stacking energy: -514.792 Base-Backbone interact. energy: -2.775 local terms energy: -572.504661 where: bonds (distance) C4'-P energy: -119.211 bonds (distance) P-C4' energy: -97.886 flat angles C4'-P-C4' energy: -121.938 flat angles P-C4'-P energy: -81.871 tors. eta vs tors. theta energy: -151.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1410.455839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.455839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.455839 (E_RNA) where: Base-Base interactions energy: -898.035 where: short stacking energy: -399.973 Base-Backbone interact. energy: -0.468 local terms energy: -511.953003 where: bonds (distance) C4'-P energy: -121.291 bonds (distance) P-C4' energy: -107.440 flat angles C4'-P-C4' energy: -113.754 flat angles P-C4'-P energy: -74.724 tors. eta vs tors. theta energy: -94.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1173.767044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.767044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.767044 (E_RNA) where: Base-Base interactions energy: -693.635 where: short stacking energy: -299.330 Base-Backbone interact. energy: -2.478 local terms energy: -477.654318 where: bonds (distance) C4'-P energy: -113.818 bonds (distance) P-C4' energy: -126.186 flat angles C4'-P-C4' energy: -100.285 flat angles P-C4'-P energy: -80.567 tors. eta vs tors. theta energy: -56.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -913.725212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.725212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.725212 (E_RNA) where: Base-Base interactions energy: -492.347 where: short stacking energy: -239.433 Base-Backbone interact. energy: 2.481 local terms energy: -423.859907 where: bonds (distance) C4'-P energy: -118.364 bonds (distance) P-C4' energy: -114.729 flat angles C4'-P-C4' energy: -112.450 flat angles P-C4'-P energy: -55.634 tors. eta vs tors. theta energy: -22.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -775.970992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.970992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.970992 (E_RNA) where: Base-Base interactions energy: -389.957 where: short stacking energy: -210.181 Base-Backbone interact. energy: -0.093 local terms energy: -385.921478 where: bonds (distance) C4'-P energy: -109.448 bonds (distance) P-C4' energy: -113.434 flat angles C4'-P-C4' energy: -91.398 flat angles P-C4'-P energy: -55.364 tors. eta vs tors. theta energy: -16.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -577.557012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.557012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.557012 (E_RNA) where: Base-Base interactions energy: -265.360 where: short stacking energy: -149.522 Base-Backbone interact. energy: -0.640 local terms energy: -311.556563 where: bonds (distance) C4'-P energy: -103.708 bonds (distance) P-C4' energy: -94.735 flat angles C4'-P-C4' energy: -96.130 flat angles P-C4'-P energy: -53.457 tors. eta vs tors. theta energy: 36.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -595.783081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.783081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.783081 (E_RNA) where: Base-Base interactions energy: -265.735 where: short stacking energy: -168.683 Base-Backbone interact. energy: 5.241 local terms energy: -335.289898 where: bonds (distance) C4'-P energy: -96.897 bonds (distance) P-C4' energy: -98.145 flat angles C4'-P-C4' energy: -91.768 flat angles P-C4'-P energy: -45.462 tors. eta vs tors. theta energy: -3.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2012.331235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.331235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.331235 (E_RNA) where: Base-Base interactions energy: -1352.335 where: short stacking energy: -592.657 Base-Backbone interact. energy: -2.999 local terms energy: -656.997357 where: bonds (distance) C4'-P energy: -120.462 bonds (distance) P-C4' energy: -134.444 flat angles C4'-P-C4' energy: -143.411 flat angles P-C4'-P energy: -83.197 tors. eta vs tors. theta energy: -175.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1836.427216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1836.427216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1836.427216 (E_RNA) where: Base-Base interactions energy: -1236.842 where: short stacking energy: -513.470 Base-Backbone interact. energy: -1.812 local terms energy: -597.772515 where: bonds (distance) C4'-P energy: -104.872 bonds (distance) P-C4' energy: -126.427 flat angles C4'-P-C4' energy: -129.554 flat angles P-C4'-P energy: -87.633 tors. eta vs tors. theta energy: -149.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1715.888956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.888956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1715.888956 (E_RNA) where: Base-Base interactions energy: -1121.964 where: short stacking energy: -503.101 Base-Backbone interact. energy: -0.724 local terms energy: -593.201003 where: bonds (distance) C4'-P energy: -119.410 bonds (distance) P-C4' energy: -128.348 flat angles C4'-P-C4' energy: -128.931 flat angles P-C4'-P energy: -80.370 tors. eta vs tors. theta energy: -136.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1703.557081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.557081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.557081 (E_RNA) where: Base-Base interactions energy: -1131.824 where: short stacking energy: -509.532 Base-Backbone interact. energy: -0.587 local terms energy: -571.145859 where: bonds (distance) C4'-P energy: -121.691 bonds (distance) P-C4' energy: -112.600 flat angles C4'-P-C4' energy: -123.870 flat angles P-C4'-P energy: -69.472 tors. eta vs tors. theta energy: -143.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1452.123637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.123637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.123637 (E_RNA) where: Base-Base interactions energy: -921.749 where: short stacking energy: -437.690 Base-Backbone interact. energy: -1.530 local terms energy: -528.844614 where: bonds (distance) C4'-P energy: -119.879 bonds (distance) P-C4' energy: -102.494 flat angles C4'-P-C4' energy: -127.560 flat angles P-C4'-P energy: -81.929 tors. eta vs tors. theta energy: -96.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1210.540524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.540524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.540524 (E_RNA) where: Base-Base interactions energy: -742.310 where: short stacking energy: -333.136 Base-Backbone interact. energy: -0.047 local terms energy: -468.183668 where: bonds (distance) C4'-P energy: -100.779 bonds (distance) P-C4' energy: -115.450 flat angles C4'-P-C4' energy: -100.498 flat angles P-C4'-P energy: -85.076 tors. eta vs tors. theta energy: -66.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -915.769315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.769315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.769315 (E_RNA) where: Base-Base interactions energy: -522.029 where: short stacking energy: -269.750 Base-Backbone interact. energy: 3.048 local terms energy: -396.788085 where: bonds (distance) C4'-P energy: -99.228 bonds (distance) P-C4' energy: -101.960 flat angles C4'-P-C4' energy: -100.322 flat angles P-C4'-P energy: -56.217 tors. eta vs tors. theta energy: -39.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -779.502753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.502753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.502753 (E_RNA) where: Base-Base interactions energy: -357.724 where: short stacking energy: -215.138 Base-Backbone interact. energy: 0.195 local terms energy: -421.973921 where: bonds (distance) C4'-P energy: -103.768 bonds (distance) P-C4' energy: -121.929 flat angles C4'-P-C4' energy: -109.234 flat angles P-C4'-P energy: -68.897 tors. eta vs tors. theta energy: -18.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -598.799444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.799444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.799444 (E_RNA) where: Base-Base interactions energy: -261.042 where: short stacking energy: -191.556 Base-Backbone interact. energy: -2.017 local terms energy: -335.740493 where: bonds (distance) C4'-P energy: -101.786 bonds (distance) P-C4' energy: -93.262 flat angles C4'-P-C4' energy: -97.393 flat angles P-C4'-P energy: -43.919 tors. eta vs tors. theta energy: 0.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -508.072350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.072350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.072350 (E_RNA) where: Base-Base interactions energy: -201.119 where: short stacking energy: -150.493 Base-Backbone interact. energy: -2.700 local terms energy: -304.253937 where: bonds (distance) C4'-P energy: -85.406 bonds (distance) P-C4' energy: -105.670 flat angles C4'-P-C4' energy: -75.138 flat angles P-C4'-P energy: -51.547 tors. eta vs tors. theta energy: 13.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2012.851632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.851632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.851632 (E_RNA) where: Base-Base interactions energy: -1361.362 where: short stacking energy: -604.798 Base-Backbone interact. energy: -2.081 local terms energy: -649.408614 where: bonds (distance) C4'-P energy: -117.163 bonds (distance) P-C4' energy: -125.448 flat angles C4'-P-C4' energy: -140.362 flat angles P-C4'-P energy: -94.484 tors. eta vs tors. theta energy: -171.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1833.522217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1833.522217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1833.522217 (E_RNA) where: Base-Base interactions energy: -1219.867 where: short stacking energy: -549.563 Base-Backbone interact. energy: 0.854 local terms energy: -614.509370 where: bonds (distance) C4'-P energy: -118.847 bonds (distance) P-C4' energy: -112.728 flat angles C4'-P-C4' energy: -135.989 flat angles P-C4'-P energy: -89.544 tors. eta vs tors. theta energy: -157.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1683.556300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.556300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.556300 (E_RNA) where: Base-Base interactions energy: -1106.526 where: short stacking energy: -497.525 Base-Backbone interact. energy: -2.942 local terms energy: -574.088568 where: bonds (distance) C4'-P energy: -118.504 bonds (distance) P-C4' energy: -118.856 flat angles C4'-P-C4' energy: -118.577 flat angles P-C4'-P energy: -96.878 tors. eta vs tors. theta energy: -121.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1652.326207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.326207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.326207 (E_RNA) where: Base-Base interactions energy: -1111.626 where: short stacking energy: -500.325 Base-Backbone interact. energy: -2.193 local terms energy: -538.507253 where: bonds (distance) C4'-P energy: -103.764 bonds (distance) P-C4' energy: -102.415 flat angles C4'-P-C4' energy: -123.095 flat angles P-C4'-P energy: -74.270 tors. eta vs tors. theta energy: -134.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1411.470347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.470347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.470347 (E_RNA) where: Base-Base interactions energy: -900.166 where: short stacking energy: -433.206 Base-Backbone interact. energy: -0.083 local terms energy: -511.221422 where: bonds (distance) C4'-P energy: -121.795 bonds (distance) P-C4' energy: -106.574 flat angles C4'-P-C4' energy: -112.000 flat angles P-C4'-P energy: -66.360 tors. eta vs tors. theta energy: -104.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1162.315806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.315806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.315806 (E_RNA) where: Base-Base interactions energy: -716.166 where: short stacking energy: -338.117 Base-Backbone interact. energy: 0.664 local terms energy: -446.813825 where: bonds (distance) C4'-P energy: -95.177 bonds (distance) P-C4' energy: -101.195 flat angles C4'-P-C4' energy: -117.365 flat angles P-C4'-P energy: -70.397 tors. eta vs tors. theta energy: -62.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -958.659996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.659996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.659996 (E_RNA) where: Base-Base interactions energy: -531.093 where: short stacking energy: -283.682 Base-Backbone interact. energy: -2.691 local terms energy: -424.875978 where: bonds (distance) C4'-P energy: -102.342 bonds (distance) P-C4' energy: -111.199 flat angles C4'-P-C4' energy: -99.176 flat angles P-C4'-P energy: -51.895 tors. eta vs tors. theta energy: -60.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -729.292179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.292179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.292179 (E_RNA) where: Base-Base interactions energy: -391.548 where: short stacking energy: -220.434 Base-Backbone interact. energy: -2.301 local terms energy: -335.443701 where: bonds (distance) C4'-P energy: -87.498 bonds (distance) P-C4' energy: -116.008 flat angles C4'-P-C4' energy: -76.253 flat angles P-C4'-P energy: -44.933 tors. eta vs tors. theta energy: -10.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -544.357788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.357788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.357788 (E_RNA) where: Base-Base interactions energy: -207.698 where: short stacking energy: -168.941 Base-Backbone interact. energy: -0.970 local terms energy: -335.689226 where: bonds (distance) C4'-P energy: -96.409 bonds (distance) P-C4' energy: -96.539 flat angles C4'-P-C4' energy: -92.151 flat angles P-C4'-P energy: -37.571 tors. eta vs tors. theta energy: -13.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -515.030342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.030342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.030342 (E_RNA) where: Base-Base interactions energy: -211.418 where: short stacking energy: -136.229 Base-Backbone interact. energy: -0.217 local terms energy: -303.395958 where: bonds (distance) C4'-P energy: -100.753 bonds (distance) P-C4' energy: -109.010 flat angles C4'-P-C4' energy: -73.198 flat angles P-C4'-P energy: -63.681 tors. eta vs tors. theta energy: 43.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -2009.468325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2009.468325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2009.468325 (E_RNA) where: Base-Base interactions energy: -1335.694 where: short stacking energy: -581.911 Base-Backbone interact. energy: -2.417 local terms energy: -671.357719 where: bonds (distance) C4'-P energy: -129.673 bonds (distance) P-C4' energy: -128.606 flat angles C4'-P-C4' energy: -144.928 flat angles P-C4'-P energy: -95.973 tors. eta vs tors. theta energy: -172.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1914.880995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.880995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.880995 (E_RNA) where: Base-Base interactions energy: -1304.756 where: short stacking energy: -536.195 Base-Backbone interact. energy: 1.606 local terms energy: -611.731135 where: bonds (distance) C4'-P energy: -112.505 bonds (distance) P-C4' energy: -123.669 flat angles C4'-P-C4' energy: -136.899 flat angles P-C4'-P energy: -73.402 tors. eta vs tors. theta energy: -165.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1683.498954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.498954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.498954 (E_RNA) where: Base-Base interactions energy: -1101.381 where: short stacking energy: -483.260 Base-Backbone interact. energy: -4.459 local terms energy: -577.659404 where: bonds (distance) C4'-P energy: -107.293 bonds (distance) P-C4' energy: -131.349 flat angles C4'-P-C4' energy: -122.565 flat angles P-C4'-P energy: -95.894 tors. eta vs tors. theta energy: -120.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1658.999989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.999989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.999989 (E_RNA) where: Base-Base interactions energy: -1093.857 where: short stacking energy: -494.705 Base-Backbone interact. energy: -1.960 local terms energy: -563.182871 where: bonds (distance) C4'-P energy: -115.018 bonds (distance) P-C4' energy: -116.128 flat angles C4'-P-C4' energy: -129.829 flat angles P-C4'-P energy: -71.044 tors. eta vs tors. theta energy: -131.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1497.095137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.095137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.095137 (E_RNA) where: Base-Base interactions energy: -934.899 where: short stacking energy: -446.601 Base-Backbone interact. energy: -4.449 local terms energy: -557.747446 where: bonds (distance) C4'-P energy: -108.262 bonds (distance) P-C4' energy: -117.435 flat angles C4'-P-C4' energy: -127.675 flat angles P-C4'-P energy: -91.865 tors. eta vs tors. theta energy: -112.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1237.880083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.880083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.880083 (E_RNA) where: Base-Base interactions energy: -753.151 where: short stacking energy: -335.949 Base-Backbone interact. energy: -1.447 local terms energy: -483.282800 where: bonds (distance) C4'-P energy: -108.886 bonds (distance) P-C4' energy: -109.535 flat angles C4'-P-C4' energy: -107.028 flat angles P-C4'-P energy: -81.840 tors. eta vs tors. theta energy: -75.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1000.183660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.183660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.183660 (E_RNA) where: Base-Base interactions energy: -568.442 where: short stacking energy: -292.498 Base-Backbone interact. energy: -3.174 local terms energy: -428.567433 where: bonds (distance) C4'-P energy: -94.715 bonds (distance) P-C4' energy: -128.506 flat angles C4'-P-C4' energy: -93.201 flat angles P-C4'-P energy: -60.939 tors. eta vs tors. theta energy: -51.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -769.494547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.494547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.494547 (E_RNA) where: Base-Base interactions energy: -400.209 where: short stacking energy: -212.104 Base-Backbone interact. energy: -1.743 local terms energy: -367.541788 where: bonds (distance) C4'-P energy: -104.125 bonds (distance) P-C4' energy: -100.080 flat angles C4'-P-C4' energy: -98.420 flat angles P-C4'-P energy: -54.736 tors. eta vs tors. theta energy: -10.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -554.469146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -554.469146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.469146 (E_RNA) where: Base-Base interactions energy: -216.536 where: short stacking energy: -151.320 Base-Backbone interact. energy: 0.599 local terms energy: -338.532083 where: bonds (distance) C4'-P energy: -108.313 bonds (distance) P-C4' energy: -105.188 flat angles C4'-P-C4' energy: -89.578 flat angles P-C4'-P energy: -43.983 tors. eta vs tors. theta energy: 8.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -568.420746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.420746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.420746 (E_RNA) where: Base-Base interactions energy: -234.072 where: short stacking energy: -159.865 Base-Backbone interact. energy: -3.596 local terms energy: -330.753103 where: bonds (distance) C4'-P energy: -85.702 bonds (distance) P-C4' energy: -98.867 flat angles C4'-P-C4' energy: -98.980 flat angles P-C4'-P energy: -46.894 tors. eta vs tors. theta energy: -0.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -2019.277802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2019.277802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2019.277802 (E_RNA) where: Base-Base interactions energy: -1352.437 where: short stacking energy: -601.445 Base-Backbone interact. energy: -2.222 local terms energy: -664.619393 where: bonds (distance) C4'-P energy: -120.790 bonds (distance) P-C4' energy: -131.730 flat angles C4'-P-C4' energy: -139.326 flat angles P-C4'-P energy: -95.086 tors. eta vs tors. theta energy: -177.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1895.311854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.311854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.311854 (E_RNA) where: Base-Base interactions energy: -1270.950 where: short stacking energy: -533.453 Base-Backbone interact. energy: -2.401 local terms energy: -621.960149 where: bonds (distance) C4'-P energy: -111.956 bonds (distance) P-C4' energy: -125.491 flat angles C4'-P-C4' energy: -128.763 flat angles P-C4'-P energy: -89.943 tors. eta vs tors. theta energy: -165.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1691.039162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.039162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.039162 (E_RNA) where: Base-Base interactions energy: -1113.318 where: short stacking energy: -495.704 Base-Backbone interact. energy: -1.939 local terms energy: -575.782375 where: bonds (distance) C4'-P energy: -129.268 bonds (distance) P-C4' energy: -111.070 flat angles C4'-P-C4' energy: -117.307 flat angles P-C4'-P energy: -76.043 tors. eta vs tors. theta energy: -142.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1608.433313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.433313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.433313 (E_RNA) where: Base-Base interactions energy: -1083.439 where: short stacking energy: -460.214 Base-Backbone interact. energy: -4.146 local terms energy: -520.848525 where: bonds (distance) C4'-P energy: -114.738 bonds (distance) P-C4' energy: -93.730 flat angles C4'-P-C4' energy: -124.945 flat angles P-C4'-P energy: -75.013 tors. eta vs tors. theta energy: -112.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1461.561269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.561269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.561269 (E_RNA) where: Base-Base interactions energy: -911.845 where: short stacking energy: -422.749 Base-Backbone interact. energy: -3.180 local terms energy: -546.536268 where: bonds (distance) C4'-P energy: -103.029 bonds (distance) P-C4' energy: -109.114 flat angles C4'-P-C4' energy: -125.843 flat angles P-C4'-P energy: -86.440 tors. eta vs tors. theta energy: -122.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1233.305242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.305242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.305242 (E_RNA) where: Base-Base interactions energy: -761.237 where: short stacking energy: -329.591 Base-Backbone interact. energy: 0.723 local terms energy: -472.791084 where: bonds (distance) C4'-P energy: -100.492 bonds (distance) P-C4' energy: -99.727 flat angles C4'-P-C4' energy: -116.782 flat angles P-C4'-P energy: -68.174 tors. eta vs tors. theta energy: -87.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1065.554919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.554919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.554919 (E_RNA) where: Base-Base interactions energy: -657.910 where: short stacking energy: -301.438 Base-Backbone interact. energy: 0.528 local terms energy: -408.173110 where: bonds (distance) C4'-P energy: -107.120 bonds (distance) P-C4' energy: -119.966 flat angles C4'-P-C4' energy: -86.624 flat angles P-C4'-P energy: -53.316 tors. eta vs tors. theta energy: -41.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -733.341012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.341012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.341012 (E_RNA) where: Base-Base interactions energy: -355.088 where: short stacking energy: -231.151 Base-Backbone interact. energy: 1.536 local terms energy: -379.789538 where: bonds (distance) C4'-P energy: -92.077 bonds (distance) P-C4' energy: -115.487 flat angles C4'-P-C4' energy: -87.199 flat angles P-C4'-P energy: -63.116 tors. eta vs tors. theta energy: -21.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -588.233757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.233757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.233757 (E_RNA) where: Base-Base interactions energy: -265.101 where: short stacking energy: -174.080 Base-Backbone interact. energy: 5.775 local terms energy: -328.907235 where: bonds (distance) C4'-P energy: -97.147 bonds (distance) P-C4' energy: -97.950 flat angles C4'-P-C4' energy: -92.556 flat angles P-C4'-P energy: -47.827 tors. eta vs tors. theta energy: 6.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -542.884066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.884066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.884066 (E_RNA) where: Base-Base interactions energy: -234.841 where: short stacking energy: -146.597 Base-Backbone interact. energy: 1.280 local terms energy: -309.322595 where: bonds (distance) C4'-P energy: -90.506 bonds (distance) P-C4' energy: -108.936 flat angles C4'-P-C4' energy: -80.706 flat angles P-C4'-P energy: -46.672 tors. eta vs tors. theta energy: 17.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -2061.386967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2061.386967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2061.386967 (E_RNA) where: Base-Base interactions energy: -1384.058 where: short stacking energy: -593.216 Base-Backbone interact. energy: -2.390 local terms energy: -674.939177 where: bonds (distance) C4'-P energy: -120.555 bonds (distance) P-C4' energy: -125.678 flat angles C4'-P-C4' energy: -142.874 flat angles P-C4'-P energy: -97.148 tors. eta vs tors. theta energy: -188.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1883.951356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.951356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.951356 (E_RNA) where: Base-Base interactions energy: -1265.913 where: short stacking energy: -538.149 Base-Backbone interact. energy: 0.938 local terms energy: -618.976230 where: bonds (distance) C4'-P energy: -124.445 bonds (distance) P-C4' energy: -119.446 flat angles C4'-P-C4' energy: -119.615 flat angles P-C4'-P energy: -93.662 tors. eta vs tors. theta energy: -161.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1752.076248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1752.076248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1752.076248 (E_RNA) where: Base-Base interactions energy: -1157.477 where: short stacking energy: -517.453 Base-Backbone interact. energy: 0.898 local terms energy: -595.496532 where: bonds (distance) C4'-P energy: -118.621 bonds (distance) P-C4' energy: -119.849 flat angles C4'-P-C4' energy: -125.228 flat angles P-C4'-P energy: -75.611 tors. eta vs tors. theta energy: -156.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1622.252544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1622.252544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.252544 (E_RNA) where: Base-Base interactions energy: -1075.240 where: short stacking energy: -469.351 Base-Backbone interact. energy: -3.851 local terms energy: -543.161739 where: bonds (distance) C4'-P energy: -89.708 bonds (distance) P-C4' energy: -125.941 flat angles C4'-P-C4' energy: -124.445 flat angles P-C4'-P energy: -82.417 tors. eta vs tors. theta energy: -120.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1489.355088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.355088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.355088 (E_RNA) where: Base-Base interactions energy: -972.726 where: short stacking energy: -473.325 Base-Backbone interact. energy: 0.011 local terms energy: -516.639779 where: bonds (distance) C4'-P energy: -74.660 bonds (distance) P-C4' energy: -111.481 flat angles C4'-P-C4' energy: -117.728 flat angles P-C4'-P energy: -83.999 tors. eta vs tors. theta energy: -128.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1111.824856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.824856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.824856 (E_RNA) where: Base-Base interactions energy: -662.223 where: short stacking energy: -306.583 Base-Backbone interact. energy: -3.319 local terms energy: -446.282666 where: bonds (distance) C4'-P energy: -101.667 bonds (distance) P-C4' energy: -105.967 flat angles C4'-P-C4' energy: -101.848 flat angles P-C4'-P energy: -70.233 tors. eta vs tors. theta energy: -66.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1140.588980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.588980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.588980 (E_RNA) where: Base-Base interactions energy: -689.857 where: short stacking energy: -304.404 Base-Backbone interact. energy: 0.304 local terms energy: -451.036095 where: bonds (distance) C4'-P energy: -100.283 bonds (distance) P-C4' energy: -118.608 flat angles C4'-P-C4' energy: -97.039 flat angles P-C4'-P energy: -81.248 tors. eta vs tors. theta energy: -53.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -747.138773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.138773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.138773 (E_RNA) where: Base-Base interactions energy: -363.294 where: short stacking energy: -230.098 Base-Backbone interact. energy: -1.717 local terms energy: -382.127883 where: bonds (distance) C4'-P energy: -95.528 bonds (distance) P-C4' energy: -115.894 flat angles C4'-P-C4' energy: -90.820 flat angles P-C4'-P energy: -55.203 tors. eta vs tors. theta energy: -24.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -723.556266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.556266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.556266 (E_RNA) where: Base-Base interactions energy: -354.704 where: short stacking energy: -195.119 Base-Backbone interact. energy: 4.144 local terms energy: -372.995990 where: bonds (distance) C4'-P energy: -96.109 bonds (distance) P-C4' energy: -111.971 flat angles C4'-P-C4' energy: -96.018 flat angles P-C4'-P energy: -50.609 tors. eta vs tors. theta energy: -18.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -494.879724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.879724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.879724 (E_RNA) where: Base-Base interactions energy: -218.425 where: short stacking energy: -147.241 Base-Backbone interact. energy: 2.017 local terms energy: -278.471179 where: bonds (distance) C4'-P energy: -118.263 bonds (distance) P-C4' energy: -75.840 flat angles C4'-P-C4' energy: -69.989 flat angles P-C4'-P energy: -44.343 tors. eta vs tors. theta energy: 29.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -2029.662871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.662871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.662871 (E_RNA) where: Base-Base interactions energy: -1357.406 where: short stacking energy: -609.525 Base-Backbone interact. energy: -2.648 local terms energy: -669.608206 where: bonds (distance) C4'-P energy: -120.625 bonds (distance) P-C4' energy: -115.222 flat angles C4'-P-C4' energy: -144.909 flat angles P-C4'-P energy: -103.397 tors. eta vs tors. theta energy: -185.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1891.856278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.856278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.856278 (E_RNA) where: Base-Base interactions energy: -1258.198 where: short stacking energy: -548.302 Base-Backbone interact. energy: -2.994 local terms energy: -630.664065 where: bonds (distance) C4'-P energy: -121.230 bonds (distance) P-C4' energy: -118.044 flat angles C4'-P-C4' energy: -133.302 flat angles P-C4'-P energy: -93.779 tors. eta vs tors. theta energy: -164.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1732.138427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.138427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.138427 (E_RNA) where: Base-Base interactions energy: -1126.282 where: short stacking energy: -482.207 Base-Backbone interact. energy: -1.300 local terms energy: -604.555981 where: bonds (distance) C4'-P energy: -121.433 bonds (distance) P-C4' energy: -125.144 flat angles C4'-P-C4' energy: -138.067 flat angles P-C4'-P energy: -89.198 tors. eta vs tors. theta energy: -130.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1652.821504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.821504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.821504 (E_RNA) where: Base-Base interactions energy: -1118.352 where: short stacking energy: -490.583 Base-Backbone interact. energy: -1.979 local terms energy: -532.490066 where: bonds (distance) C4'-P energy: -100.526 bonds (distance) P-C4' energy: -111.899 flat angles C4'-P-C4' energy: -122.864 flat angles P-C4'-P energy: -71.358 tors. eta vs tors. theta energy: -125.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1478.709648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.709648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.709648 (E_RNA) where: Base-Base interactions energy: -942.924 where: short stacking energy: -419.951 Base-Backbone interact. energy: -1.831 local terms energy: -533.954968 where: bonds (distance) C4'-P energy: -111.086 bonds (distance) P-C4' energy: -109.517 flat angles C4'-P-C4' energy: -117.304 flat angles P-C4'-P energy: -79.289 tors. eta vs tors. theta energy: -116.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1096.210277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1096.210277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.210277 (E_RNA) where: Base-Base interactions energy: -624.131 where: short stacking energy: -292.170 Base-Backbone interact. energy: -1.441 local terms energy: -470.638068 where: bonds (distance) C4'-P energy: -99.254 bonds (distance) P-C4' energy: -121.373 flat angles C4'-P-C4' energy: -121.279 flat angles P-C4'-P energy: -74.337 tors. eta vs tors. theta energy: -54.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1073.689979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.689979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.689979 (E_RNA) where: Base-Base interactions energy: -629.418 where: short stacking energy: -299.968 Base-Backbone interact. energy: 0.940 local terms energy: -445.211646 where: bonds (distance) C4'-P energy: -103.827 bonds (distance) P-C4' energy: -121.256 flat angles C4'-P-C4' energy: -102.437 flat angles P-C4'-P energy: -67.593 tors. eta vs tors. theta energy: -50.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -700.228268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.228268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.228268 (E_RNA) where: Base-Base interactions energy: -344.592 where: short stacking energy: -201.048 Base-Backbone interact. energy: 2.276 local terms energy: -357.911869 where: bonds (distance) C4'-P energy: -107.062 bonds (distance) P-C4' energy: -97.695 flat angles C4'-P-C4' energy: -95.662 flat angles P-C4'-P energy: -56.911 tors. eta vs tors. theta energy: -0.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -680.337496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.337496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.337496 (E_RNA) where: Base-Base interactions energy: -330.398 where: short stacking energy: -176.219 Base-Backbone interact. energy: 0.046 local terms energy: -349.985263 where: bonds (distance) C4'-P energy: -105.403 bonds (distance) P-C4' energy: -96.725 flat angles C4'-P-C4' energy: -92.384 flat angles P-C4'-P energy: -61.583 tors. eta vs tors. theta energy: 6.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -516.498440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.498440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.498440 (E_RNA) where: Base-Base interactions energy: -186.568 where: short stacking energy: -161.181 Base-Backbone interact. energy: -2.645 local terms energy: -327.284953 where: bonds (distance) C4'-P energy: -93.059 bonds (distance) P-C4' energy: -95.200 flat angles C4'-P-C4' energy: -96.464 flat angles P-C4'-P energy: -44.280 tors. eta vs tors. theta energy: 1.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -2058.849468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2058.849468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.849468 (E_RNA) where: Base-Base interactions energy: -1391.106 where: short stacking energy: -645.740 Base-Backbone interact. energy: -2.617 local terms energy: -665.126412 where: bonds (distance) C4'-P energy: -117.649 bonds (distance) P-C4' energy: -114.948 flat angles C4'-P-C4' energy: -151.623 flat angles P-C4'-P energy: -94.299 tors. eta vs tors. theta energy: -186.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1904.102468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1904.102468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1904.102468 (E_RNA) where: Base-Base interactions energy: -1275.914 where: short stacking energy: -543.152 Base-Backbone interact. energy: -0.213 local terms energy: -627.975429 where: bonds (distance) C4'-P energy: -120.507 bonds (distance) P-C4' energy: -119.237 flat angles C4'-P-C4' energy: -130.952 flat angles P-C4'-P energy: -95.382 tors. eta vs tors. theta energy: -161.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1754.671139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1754.671139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.671139 (E_RNA) where: Base-Base interactions energy: -1161.376 where: short stacking energy: -497.581 Base-Backbone interact. energy: -2.818 local terms energy: -590.477364 where: bonds (distance) C4'-P energy: -128.504 bonds (distance) P-C4' energy: -113.701 flat angles C4'-P-C4' energy: -120.853 flat angles P-C4'-P energy: -73.580 tors. eta vs tors. theta energy: -153.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1648.081812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.081812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.081812 (E_RNA) where: Base-Base interactions energy: -1076.203 where: short stacking energy: -478.181 Base-Backbone interact. energy: -2.905 local terms energy: -568.973675 where: bonds (distance) C4'-P energy: -106.212 bonds (distance) P-C4' energy: -123.268 flat angles C4'-P-C4' energy: -137.550 flat angles P-C4'-P energy: -71.763 tors. eta vs tors. theta energy: -130.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1573.945183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.945183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.945183 (E_RNA) where: Base-Base interactions energy: -1030.619 where: short stacking energy: -444.157 Base-Backbone interact. energy: -0.775 local terms energy: -542.550337 where: bonds (distance) C4'-P energy: -111.328 bonds (distance) P-C4' energy: -116.653 flat angles C4'-P-C4' energy: -121.337 flat angles P-C4'-P energy: -72.760 tors. eta vs tors. theta energy: -120.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1111.963466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1111.963466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.963466 (E_RNA) where: Base-Base interactions energy: -646.928 where: short stacking energy: -305.107 Base-Backbone interact. energy: -4.140 local terms energy: -460.895072 where: bonds (distance) C4'-P energy: -104.463 bonds (distance) P-C4' energy: -119.923 flat angles C4'-P-C4' energy: -110.353 flat angles P-C4'-P energy: -81.364 tors. eta vs tors. theta energy: -44.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1049.739724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.739724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1049.739724 (E_RNA) where: Base-Base interactions energy: -617.189 where: short stacking energy: -278.925 Base-Backbone interact. energy: -2.495 local terms energy: -430.055946 where: bonds (distance) C4'-P energy: -97.250 bonds (distance) P-C4' energy: -97.966 flat angles C4'-P-C4' energy: -108.814 flat angles P-C4'-P energy: -63.414 tors. eta vs tors. theta energy: -62.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -723.291212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.291212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.291212 (E_RNA) where: Base-Base interactions energy: -323.482 where: short stacking energy: -174.836 Base-Backbone interact. energy: -1.647 local terms energy: -398.162571 where: bonds (distance) C4'-P energy: -101.872 bonds (distance) P-C4' energy: -97.068 flat angles C4'-P-C4' energy: -109.606 flat angles P-C4'-P energy: -74.233 tors. eta vs tors. theta energy: -15.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -715.871621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.871621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.871621 (E_RNA) where: Base-Base interactions energy: -369.387 where: short stacking energy: -177.285 Base-Backbone interact. energy: -1.310 local terms energy: -345.174703 where: bonds (distance) C4'-P energy: -104.073 bonds (distance) P-C4' energy: -104.042 flat angles C4'-P-C4' energy: -96.104 flat angles P-C4'-P energy: -32.959 tors. eta vs tors. theta energy: -7.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -464.502470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.502470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.502470 (E_RNA) where: Base-Base interactions energy: -152.325 where: short stacking energy: -118.008 Base-Backbone interact. energy: 3.604 local terms energy: -315.781657 where: bonds (distance) C4'-P energy: -101.963 bonds (distance) P-C4' energy: -108.366 flat angles C4'-P-C4' energy: -72.349 flat angles P-C4'-P energy: -52.997 tors. eta vs tors. theta energy: 19.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -2046.235306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.235306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2046.235306 (E_RNA) where: Base-Base interactions energy: -1365.688 where: short stacking energy: -595.932 Base-Backbone interact. energy: 2.674 local terms energy: -683.221393 where: bonds (distance) C4'-P energy: -122.062 bonds (distance) P-C4' energy: -133.133 flat angles C4'-P-C4' energy: -139.372 flat angles P-C4'-P energy: -102.448 tors. eta vs tors. theta energy: -186.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1869.998619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1869.998619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1869.998619 (E_RNA) where: Base-Base interactions energy: -1247.188 where: short stacking energy: -520.008 Base-Backbone interact. energy: -0.631 local terms energy: -622.179898 where: bonds (distance) C4'-P energy: -111.604 bonds (distance) P-C4' energy: -129.367 flat angles C4'-P-C4' energy: -147.365 flat angles P-C4'-P energy: -87.314 tors. eta vs tors. theta energy: -146.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1763.289805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1763.289805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.289805 (E_RNA) where: Base-Base interactions energy: -1177.971 where: short stacking energy: -494.840 Base-Backbone interact. energy: -1.051 local terms energy: -584.268127 where: bonds (distance) C4'-P energy: -107.850 bonds (distance) P-C4' energy: -121.288 flat angles C4'-P-C4' energy: -125.073 flat angles P-C4'-P energy: -82.122 tors. eta vs tors. theta energy: -147.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1605.171239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.171239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.171239 (E_RNA) where: Base-Base interactions energy: -1050.485 where: short stacking energy: -468.663 Base-Backbone interact. energy: -1.723 local terms energy: -552.963752 where: bonds (distance) C4'-P energy: -120.289 bonds (distance) P-C4' energy: -113.213 flat angles C4'-P-C4' energy: -132.869 flat angles P-C4'-P energy: -74.441 tors. eta vs tors. theta energy: -112.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1585.471661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.471661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.471661 (E_RNA) where: Base-Base interactions energy: -1039.924 where: short stacking energy: -439.601 Base-Backbone interact. energy: -3.325 local terms energy: -542.222963 where: bonds (distance) C4'-P energy: -116.367 bonds (distance) P-C4' energy: -112.065 flat angles C4'-P-C4' energy: -126.778 flat angles P-C4'-P energy: -73.383 tors. eta vs tors. theta energy: -113.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1190.366189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.366189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.366189 (E_RNA) where: Base-Base interactions energy: -665.091 where: short stacking energy: -336.476 Base-Backbone interact. energy: -2.301 local terms energy: -522.973957 where: bonds (distance) C4'-P energy: -119.428 bonds (distance) P-C4' energy: -125.529 flat angles C4'-P-C4' energy: -126.945 flat angles P-C4'-P energy: -76.830 tors. eta vs tors. theta energy: -74.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -976.708153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.708153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.708153 (E_RNA) where: Base-Base interactions energy: -554.317 where: short stacking energy: -287.376 Base-Backbone interact. energy: 3.754 local terms energy: -426.144636 where: bonds (distance) C4'-P energy: -111.261 bonds (distance) P-C4' energy: -111.195 flat angles C4'-P-C4' energy: -91.921 flat angles P-C4'-P energy: -75.171 tors. eta vs tors. theta energy: -36.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -747.854659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.854659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.854659 (E_RNA) where: Base-Base interactions energy: -352.918 where: short stacking energy: -194.682 Base-Backbone interact. energy: -2.486 local terms energy: -392.450652 where: bonds (distance) C4'-P energy: -115.076 bonds (distance) P-C4' energy: -91.055 flat angles C4'-P-C4' energy: -104.802 flat angles P-C4'-P energy: -67.180 tors. eta vs tors. theta energy: -14.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -686.704753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.704753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.704753 (E_RNA) where: Base-Base interactions energy: -320.360 where: short stacking energy: -185.131 Base-Backbone interact. energy: 4.127 local terms energy: -370.471540 where: bonds (distance) C4'-P energy: -88.726 bonds (distance) P-C4' energy: -126.702 flat angles C4'-P-C4' energy: -105.698 flat angles P-C4'-P energy: -51.542 tors. eta vs tors. theta energy: 2.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -491.156151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.156151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.156151 (E_RNA) where: Base-Base interactions energy: -161.549 where: short stacking energy: -132.055 Base-Backbone interact. energy: -1.632 local terms energy: -327.975011 where: bonds (distance) C4'-P energy: -105.357 bonds (distance) P-C4' energy: -116.712 flat angles C4'-P-C4' energy: -83.713 flat angles P-C4'-P energy: -59.852 tors. eta vs tors. theta energy: 37.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -2038.805503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2038.805503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2038.805503 (E_RNA) where: Base-Base interactions energy: -1380.162 where: short stacking energy: -614.052 Base-Backbone interact. energy: -3.808 local terms energy: -654.835066 where: bonds (distance) C4'-P energy: -118.917 bonds (distance) P-C4' energy: -124.544 flat angles C4'-P-C4' energy: -141.776 flat angles P-C4'-P energy: -96.007 tors. eta vs tors. theta energy: -173.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1899.501447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.501447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.501447 (E_RNA) where: Base-Base interactions energy: -1277.595 where: short stacking energy: -521.813 Base-Backbone interact. energy: 0.221 local terms energy: -622.127694 where: bonds (distance) C4'-P energy: -132.257 bonds (distance) P-C4' energy: -116.041 flat angles C4'-P-C4' energy: -138.278 flat angles P-C4'-P energy: -91.162 tors. eta vs tors. theta energy: -144.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1799.787759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1799.787759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.787759 (E_RNA) where: Base-Base interactions energy: -1184.925 where: short stacking energy: -504.098 Base-Backbone interact. energy: -3.178 local terms energy: -611.684532 where: bonds (distance) C4'-P energy: -119.065 bonds (distance) P-C4' energy: -119.844 flat angles C4'-P-C4' energy: -139.061 flat angles P-C4'-P energy: -79.068 tors. eta vs tors. theta energy: -154.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1625.063002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.063002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.063002 (E_RNA) where: Base-Base interactions energy: -1083.771 where: short stacking energy: -445.968 Base-Backbone interact. energy: 1.162 local terms energy: -542.454244 where: bonds (distance) C4'-P energy: -106.492 bonds (distance) P-C4' energy: -108.018 flat angles C4'-P-C4' energy: -119.038 flat angles P-C4'-P energy: -93.609 tors. eta vs tors. theta energy: -115.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1572.884791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.884791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.884791 (E_RNA) where: Base-Base interactions energy: -1080.842 where: short stacking energy: -476.420 Base-Backbone interact. energy: -0.529 local terms energy: -491.513846 where: bonds (distance) C4'-P energy: -101.687 bonds (distance) P-C4' energy: -104.788 flat angles C4'-P-C4' energy: -111.668 flat angles P-C4'-P energy: -64.120 tors. eta vs tors. theta energy: -109.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1233.684078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.684078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.684078 (E_RNA) where: Base-Base interactions energy: -757.012 where: short stacking energy: -357.386 Base-Backbone interact. energy: -2.074 local terms energy: -474.597647 where: bonds (distance) C4'-P energy: -102.554 bonds (distance) P-C4' energy: -120.552 flat angles C4'-P-C4' energy: -111.632 flat angles P-C4'-P energy: -67.791 tors. eta vs tors. theta energy: -72.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -963.852675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.852675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.852675 (E_RNA) where: Base-Base interactions energy: -573.358 where: short stacking energy: -286.492 Base-Backbone interact. energy: -1.994 local terms energy: -388.500504 where: bonds (distance) C4'-P energy: -117.109 bonds (distance) P-C4' energy: -102.861 flat angles C4'-P-C4' energy: -84.408 flat angles P-C4'-P energy: -57.682 tors. eta vs tors. theta energy: -26.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -782.563844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.563844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.563844 (E_RNA) where: Base-Base interactions energy: -407.519 where: short stacking energy: -230.703 Base-Backbone interact. energy: 0.803 local terms energy: -375.847733 where: bonds (distance) C4'-P energy: -98.569 bonds (distance) P-C4' energy: -110.218 flat angles C4'-P-C4' energy: -96.278 flat angles P-C4'-P energy: -42.157 tors. eta vs tors. theta energy: -28.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -669.839991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.839991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.839991 (E_RNA) where: Base-Base interactions energy: -325.890 where: short stacking energy: -181.891 Base-Backbone interact. energy: -0.128 local terms energy: -343.821984 where: bonds (distance) C4'-P energy: -86.962 bonds (distance) P-C4' energy: -87.713 flat angles C4'-P-C4' energy: -106.295 flat angles P-C4'-P energy: -63.479 tors. eta vs tors. theta energy: 0.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -536.649062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.649062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.649062 (E_RNA) where: Base-Base interactions energy: -209.224 where: short stacking energy: -138.420 Base-Backbone interact. energy: -0.744 local terms energy: -326.681042 where: bonds (distance) C4'-P energy: -85.882 bonds (distance) P-C4' energy: -102.130 flat angles C4'-P-C4' energy: -79.522 flat angles P-C4'-P energy: -58.493 tors. eta vs tors. theta energy: -0.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -2017.360561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2017.360561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2017.360561 (E_RNA) where: Base-Base interactions energy: -1349.620 where: short stacking energy: -584.518 Base-Backbone interact. energy: 3.141 local terms energy: -670.882038 where: bonds (distance) C4'-P energy: -125.299 bonds (distance) P-C4' energy: -126.952 flat angles C4'-P-C4' energy: -149.799 flat angles P-C4'-P energy: -85.874 tors. eta vs tors. theta energy: -182.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1887.245207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1887.245207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1887.245207 (E_RNA) where: Base-Base interactions energy: -1262.122 where: short stacking energy: -538.977 Base-Backbone interact. energy: 3.417 local terms energy: -628.540485 where: bonds (distance) C4'-P energy: -122.362 bonds (distance) P-C4' energy: -122.529 flat angles C4'-P-C4' energy: -136.452 flat angles P-C4'-P energy: -91.551 tors. eta vs tors. theta energy: -155.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1800.514581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.514581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.514581 (E_RNA) where: Base-Base interactions energy: -1203.380 where: short stacking energy: -529.808 Base-Backbone interact. energy: 0.625 local terms energy: -597.759786 where: bonds (distance) C4'-P energy: -111.655 bonds (distance) P-C4' energy: -121.883 flat angles C4'-P-C4' energy: -121.747 flat angles P-C4'-P energy: -99.508 tors. eta vs tors. theta energy: -142.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1605.435582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.435582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.435582 (E_RNA) where: Base-Base interactions energy: -1067.827 where: short stacking energy: -451.904 Base-Backbone interact. energy: -1.118 local terms energy: -536.491067 where: bonds (distance) C4'-P energy: -114.455 bonds (distance) P-C4' energy: -109.326 flat angles C4'-P-C4' energy: -119.062 flat angles P-C4'-P energy: -80.400 tors. eta vs tors. theta energy: -113.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1558.229071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.229071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.229071 (E_RNA) where: Base-Base interactions energy: -993.658 where: short stacking energy: -439.608 Base-Backbone interact. energy: -1.812 local terms energy: -562.759688 where: bonds (distance) C4'-P energy: -115.765 bonds (distance) P-C4' energy: -131.981 flat angles C4'-P-C4' energy: -109.471 flat angles P-C4'-P energy: -80.816 tors. eta vs tors. theta energy: -124.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1314.669194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.669194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.669194 (E_RNA) where: Base-Base interactions energy: -844.953 where: short stacking energy: -395.554 Base-Backbone interact. energy: -2.022 local terms energy: -467.693655 where: bonds (distance) C4'-P energy: -108.436 bonds (distance) P-C4' energy: -94.408 flat angles C4'-P-C4' energy: -108.536 flat angles P-C4'-P energy: -60.792 tors. eta vs tors. theta energy: -95.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -886.843011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -886.843011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.843011 (E_RNA) where: Base-Base interactions energy: -487.341 where: short stacking energy: -250.783 Base-Backbone interact. energy: -1.355 local terms energy: -398.147047 where: bonds (distance) C4'-P energy: -101.138 bonds (distance) P-C4' energy: -104.387 flat angles C4'-P-C4' energy: -114.562 flat angles P-C4'-P energy: -54.387 tors. eta vs tors. theta energy: -23.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -730.047988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.047988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.047988 (E_RNA) where: Base-Base interactions energy: -361.217 where: short stacking energy: -211.474 Base-Backbone interact. energy: -1.660 local terms energy: -367.171056 where: bonds (distance) C4'-P energy: -108.611 bonds (distance) P-C4' energy: -117.428 flat angles C4'-P-C4' energy: -73.478 flat angles P-C4'-P energy: -52.989 tors. eta vs tors. theta energy: -14.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -649.147223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.147223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.147223 (E_RNA) where: Base-Base interactions energy: -298.478 where: short stacking energy: -169.998 Base-Backbone interact. energy: 4.291 local terms energy: -354.960596 where: bonds (distance) C4'-P energy: -114.594 bonds (distance) P-C4' energy: -109.446 flat angles C4'-P-C4' energy: -84.338 flat angles P-C4'-P energy: -43.024 tors. eta vs tors. theta energy: -3.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -510.463546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.463546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.463546 (E_RNA) where: Base-Base interactions energy: -208.905 where: short stacking energy: -151.446 Base-Backbone interact. energy: -0.579 local terms energy: -300.979594 where: bonds (distance) C4'-P energy: -107.233 bonds (distance) P-C4' energy: -92.966 flat angles C4'-P-C4' energy: -68.117 flat angles P-C4'-P energy: -52.856 tors. eta vs tors. theta energy: 20.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -2010.517964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2010.517964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2010.517964 (E_RNA) where: Base-Base interactions energy: -1380.005 where: short stacking energy: -595.105 Base-Backbone interact. energy: -1.320 local terms energy: -629.192914 where: bonds (distance) C4'-P energy: -111.683 bonds (distance) P-C4' energy: -124.726 flat angles C4'-P-C4' energy: -137.886 flat angles P-C4'-P energy: -84.300 tors. eta vs tors. theta energy: -170.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1908.726802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1908.726802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1908.726802 (E_RNA) where: Base-Base interactions energy: -1289.583 where: short stacking energy: -513.286 Base-Backbone interact. energy: -6.736 local terms energy: -612.407755 where: bonds (distance) C4'-P energy: -129.995 bonds (distance) P-C4' energy: -120.332 flat angles C4'-P-C4' energy: -129.484 flat angles P-C4'-P energy: -89.160 tors. eta vs tors. theta energy: -143.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1802.351938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1802.351938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1802.351938 (E_RNA) where: Base-Base interactions energy: -1224.389 where: short stacking energy: -550.649 Base-Backbone interact. energy: -0.504 local terms energy: -577.458969 where: bonds (distance) C4'-P energy: -102.538 bonds (distance) P-C4' energy: -125.735 flat angles C4'-P-C4' energy: -121.297 flat angles P-C4'-P energy: -71.790 tors. eta vs tors. theta energy: -156.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1636.746447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.746447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.746447 (E_RNA) where: Base-Base interactions energy: -1110.209 where: short stacking energy: -476.278 Base-Backbone interact. energy: -1.439 local terms energy: -525.098855 where: bonds (distance) C4'-P energy: -114.501 bonds (distance) P-C4' energy: -108.657 flat angles C4'-P-C4' energy: -117.772 flat angles P-C4'-P energy: -71.097 tors. eta vs tors. theta energy: -113.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1525.339408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.339408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.339408 (E_RNA) where: Base-Base interactions energy: -1010.355 where: short stacking energy: -446.867 Base-Backbone interact. energy: -0.436 local terms energy: -514.547861 where: bonds (distance) C4'-P energy: -99.086 bonds (distance) P-C4' energy: -112.172 flat angles C4'-P-C4' energy: -108.665 flat angles P-C4'-P energy: -76.802 tors. eta vs tors. theta energy: -117.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1330.237262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.237262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.237262 (E_RNA) where: Base-Base interactions energy: -848.719 where: short stacking energy: -382.141 Base-Backbone interact. energy: 2.041 local terms energy: -483.559587 where: bonds (distance) C4'-P energy: -107.185 bonds (distance) P-C4' energy: -101.088 flat angles C4'-P-C4' energy: -119.598 flat angles P-C4'-P energy: -70.110 tors. eta vs tors. theta energy: -85.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -793.875778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.875778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.875778 (E_RNA) where: Base-Base interactions energy: -390.540 where: short stacking energy: -222.610 Base-Backbone interact. energy: -0.817 local terms energy: -402.518970 where: bonds (distance) C4'-P energy: -104.249 bonds (distance) P-C4' energy: -113.331 flat angles C4'-P-C4' energy: -106.474 flat angles P-C4'-P energy: -72.074 tors. eta vs tors. theta energy: -6.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -766.966182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.966182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.966182 (E_RNA) where: Base-Base interactions energy: -379.304 where: short stacking energy: -211.581 Base-Backbone interact. energy: 2.703 local terms energy: -390.365920 where: bonds (distance) C4'-P energy: -106.592 bonds (distance) P-C4' energy: -111.254 flat angles C4'-P-C4' energy: -88.815 flat angles P-C4'-P energy: -58.129 tors. eta vs tors. theta energy: -25.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -650.325526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.325526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.325526 (E_RNA) where: Base-Base interactions energy: -305.147 where: short stacking energy: -203.703 Base-Backbone interact. energy: 0.930 local terms energy: -346.108492 where: bonds (distance) C4'-P energy: -95.428 bonds (distance) P-C4' energy: -95.924 flat angles C4'-P-C4' energy: -94.237 flat angles P-C4'-P energy: -59.970 tors. eta vs tors. theta energy: -0.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -550.683004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.683004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.683004 (E_RNA) where: Base-Base interactions energy: -235.522 where: short stacking energy: -150.161 Base-Backbone interact. energy: 3.129 local terms energy: -318.289459 where: bonds (distance) C4'-P energy: -93.827 bonds (distance) P-C4' energy: -91.741 flat angles C4'-P-C4' energy: -87.708 flat angles P-C4'-P energy: -57.925 tors. eta vs tors. theta energy: 12.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -2009.965732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2009.965732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2009.965732 (E_RNA) where: Base-Base interactions energy: -1372.269 where: short stacking energy: -599.390 Base-Backbone interact. energy: -0.719 local terms energy: -636.977229 where: bonds (distance) C4'-P energy: -112.292 bonds (distance) P-C4' energy: -117.679 flat angles C4'-P-C4' energy: -138.047 flat angles P-C4'-P energy: -90.294 tors. eta vs tors. theta energy: -178.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1861.133077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1861.133077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1861.133077 (E_RNA) where: Base-Base interactions energy: -1260.074 where: short stacking energy: -521.802 Base-Backbone interact. energy: -1.831 local terms energy: -599.228121 where: bonds (distance) C4'-P energy: -134.820 bonds (distance) P-C4' energy: -106.871 flat angles C4'-P-C4' energy: -127.937 flat angles P-C4'-P energy: -87.200 tors. eta vs tors. theta energy: -142.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1812.884253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.884253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.884253 (E_RNA) where: Base-Base interactions energy: -1218.496 where: short stacking energy: -527.337 Base-Backbone interact. energy: -0.903 local terms energy: -593.485808 where: bonds (distance) C4'-P energy: -109.585 bonds (distance) P-C4' energy: -117.856 flat angles C4'-P-C4' energy: -131.122 flat angles P-C4'-P energy: -79.861 tors. eta vs tors. theta energy: -155.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1613.026132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.026132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.026132 (E_RNA) where: Base-Base interactions energy: -1063.227 where: short stacking energy: -455.591 Base-Backbone interact. energy: -2.407 local terms energy: -547.392347 where: bonds (distance) C4'-P energy: -113.249 bonds (distance) P-C4' energy: -124.980 flat angles C4'-P-C4' energy: -122.003 flat angles P-C4'-P energy: -85.481 tors. eta vs tors. theta energy: -101.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1378.737266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.737266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.737266 (E_RNA) where: Base-Base interactions energy: -876.831 where: short stacking energy: -413.436 Base-Backbone interact. energy: -3.699 local terms energy: -498.206897 where: bonds (distance) C4'-P energy: -108.661 bonds (distance) P-C4' energy: -99.952 flat angles C4'-P-C4' energy: -121.990 flat angles P-C4'-P energy: -68.417 tors. eta vs tors. theta energy: -99.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1491.547635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.547635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.547635 (E_RNA) where: Base-Base interactions energy: -947.473 where: short stacking energy: -410.293 Base-Backbone interact. energy: -0.847 local terms energy: -543.227176 where: bonds (distance) C4'-P energy: -113.376 bonds (distance) P-C4' energy: -114.888 flat angles C4'-P-C4' energy: -119.632 flat angles P-C4'-P energy: -86.543 tors. eta vs tors. theta energy: -108.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -806.590838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.590838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.590838 (E_RNA) where: Base-Base interactions energy: -403.063 where: short stacking energy: -219.709 Base-Backbone interact. energy: 7.530 local terms energy: -411.057901 where: bonds (distance) C4'-P energy: -114.054 bonds (distance) P-C4' energy: -103.687 flat angles C4'-P-C4' energy: -112.610 flat angles P-C4'-P energy: -69.205 tors. eta vs tors. theta energy: -11.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -776.911104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.911104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.911104 (E_RNA) where: Base-Base interactions energy: -384.312 where: short stacking energy: -202.793 Base-Backbone interact. energy: -1.015 local terms energy: -391.584037 where: bonds (distance) C4'-P energy: -93.481 bonds (distance) P-C4' energy: -106.773 flat angles C4'-P-C4' energy: -103.674 flat angles P-C4'-P energy: -65.585 tors. eta vs tors. theta energy: -22.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -590.900611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.900611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.900611 (E_RNA) where: Base-Base interactions energy: -237.293 where: short stacking energy: -153.031 Base-Backbone interact. energy: 1.835 local terms energy: -355.442931 where: bonds (distance) C4'-P energy: -98.566 bonds (distance) P-C4' energy: -110.089 flat angles C4'-P-C4' energy: -96.283 flat angles P-C4'-P energy: -43.553 tors. eta vs tors. theta energy: -6.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -543.089172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.089172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.089172 (E_RNA) where: Base-Base interactions energy: -249.219 where: short stacking energy: -158.423 Base-Backbone interact. energy: 7.428 local terms energy: -301.298069 where: bonds (distance) C4'-P energy: -98.794 bonds (distance) P-C4' energy: -101.011 flat angles C4'-P-C4' energy: -75.228 flat angles P-C4'-P energy: -44.310 tors. eta vs tors. theta energy: 18.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -2021.625741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2021.625741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2021.625741 (E_RNA) where: Base-Base interactions energy: -1351.559 where: short stacking energy: -569.337 Base-Backbone interact. energy: -1.482 local terms energy: -668.584626 where: bonds (distance) C4'-P energy: -119.409 bonds (distance) P-C4' energy: -141.783 flat angles C4'-P-C4' energy: -139.788 flat angles P-C4'-P energy: -92.954 tors. eta vs tors. theta energy: -174.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1891.068665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.068665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.068665 (E_RNA) where: Base-Base interactions energy: -1273.112 where: short stacking energy: -536.820 Base-Backbone interact. energy: 0.453 local terms energy: -618.409218 where: bonds (distance) C4'-P energy: -123.786 bonds (distance) P-C4' energy: -132.100 flat angles C4'-P-C4' energy: -122.652 flat angles P-C4'-P energy: -78.081 tors. eta vs tors. theta energy: -161.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1844.255541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1844.255541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1844.255541 (E_RNA) where: Base-Base interactions energy: -1231.961 where: short stacking energy: -515.297 Base-Backbone interact. energy: -2.882 local terms energy: -609.412594 where: bonds (distance) C4'-P energy: -120.820 bonds (distance) P-C4' energy: -123.882 flat angles C4'-P-C4' energy: -136.065 flat angles P-C4'-P energy: -84.547 tors. eta vs tors. theta energy: -144.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1604.015975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.015975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.015975 (E_RNA) where: Base-Base interactions energy: -1074.761 where: short stacking energy: -452.999 Base-Backbone interact. energy: -3.869 local terms energy: -525.385290 where: bonds (distance) C4'-P energy: -111.520 bonds (distance) P-C4' energy: -106.949 flat angles C4'-P-C4' energy: -130.550 flat angles P-C4'-P energy: -64.452 tors. eta vs tors. theta energy: -111.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1448.642311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.642311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.642311 (E_RNA) where: Base-Base interactions energy: -958.616 where: short stacking energy: -435.998 Base-Backbone interact. energy: -2.163 local terms energy: -487.863289 where: bonds (distance) C4'-P energy: -96.158 bonds (distance) P-C4' energy: -107.398 flat angles C4'-P-C4' energy: -101.607 flat angles P-C4'-P energy: -71.601 tors. eta vs tors. theta energy: -111.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1412.410366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.410366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.410366 (E_RNA) where: Base-Base interactions energy: -930.631 where: short stacking energy: -398.722 Base-Backbone interact. energy: -4.207 local terms energy: -477.571717 where: bonds (distance) C4'-P energy: -109.308 bonds (distance) P-C4' energy: -105.913 flat angles C4'-P-C4' energy: -93.921 flat angles P-C4'-P energy: -72.152 tors. eta vs tors. theta energy: -96.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -805.636387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.636387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.636387 (E_RNA) where: Base-Base interactions energy: -424.841 where: short stacking energy: -261.376 Base-Backbone interact. energy: -2.655 local terms energy: -378.140279 where: bonds (distance) C4'-P energy: -101.417 bonds (distance) P-C4' energy: -100.550 flat angles C4'-P-C4' energy: -96.464 flat angles P-C4'-P energy: -53.977 tors. eta vs tors. theta energy: -25.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -732.716216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.716216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.716216 (E_RNA) where: Base-Base interactions energy: -361.649 where: short stacking energy: -192.101 Base-Backbone interact. energy: -1.551 local terms energy: -369.516008 where: bonds (distance) C4'-P energy: -86.752 bonds (distance) P-C4' energy: -114.654 flat angles C4'-P-C4' energy: -92.770 flat angles P-C4'-P energy: -54.800 tors. eta vs tors. theta energy: -20.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -574.420930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.420930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.420930 (E_RNA) where: Base-Base interactions energy: -241.347 where: short stacking energy: -173.489 Base-Backbone interact. energy: 2.529 local terms energy: -335.603656 where: bonds (distance) C4'-P energy: -92.401 bonds (distance) P-C4' energy: -81.311 flat angles C4'-P-C4' energy: -103.438 flat angles P-C4'-P energy: -64.854 tors. eta vs tors. theta energy: 6.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -523.787042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.787042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.787042 (E_RNA) where: Base-Base interactions energy: -226.112 where: short stacking energy: -141.030 Base-Backbone interact. energy: 4.616 local terms energy: -302.291636 where: bonds (distance) C4'-P energy: -85.644 bonds (distance) P-C4' energy: -107.944 flat angles C4'-P-C4' energy: -78.965 flat angles P-C4'-P energy: -55.281 tors. eta vs tors. theta energy: 25.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -2036.687749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2036.687749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2036.687749 (E_RNA) where: Base-Base interactions energy: -1372.209 where: short stacking energy: -591.509 Base-Backbone interact. energy: -0.504 local terms energy: -663.974498 where: bonds (distance) C4'-P energy: -129.864 bonds (distance) P-C4' energy: -128.255 flat angles C4'-P-C4' energy: -142.523 flat angles P-C4'-P energy: -86.290 tors. eta vs tors. theta energy: -177.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1915.061255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.061255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.061255 (E_RNA) where: Base-Base interactions energy: -1301.515 where: short stacking energy: -541.565 Base-Backbone interact. energy: -2.508 local terms energy: -611.038475 where: bonds (distance) C4'-P energy: -120.238 bonds (distance) P-C4' energy: -118.036 flat angles C4'-P-C4' energy: -137.772 flat angles P-C4'-P energy: -83.478 tors. eta vs tors. theta energy: -151.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1847.425842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1847.425842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1847.425842 (E_RNA) where: Base-Base interactions energy: -1258.993 where: short stacking energy: -558.783 Base-Backbone interact. energy: -0.447 local terms energy: -587.986126 where: bonds (distance) C4'-P energy: -108.167 bonds (distance) P-C4' energy: -106.383 flat angles C4'-P-C4' energy: -127.766 flat angles P-C4'-P energy: -88.286 tors. eta vs tors. theta energy: -157.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1587.314263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.314263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.314263 (E_RNA) where: Base-Base interactions energy: -1038.209 where: short stacking energy: -465.404 Base-Backbone interact. energy: 2.419 local terms energy: -551.523825 where: bonds (distance) C4'-P energy: -124.918 bonds (distance) P-C4' energy: -111.954 flat angles C4'-P-C4' energy: -126.323 flat angles P-C4'-P energy: -72.358 tors. eta vs tors. theta energy: -115.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1466.679408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.679408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.679408 (E_RNA) where: Base-Base interactions energy: -932.023 where: short stacking energy: -387.954 Base-Backbone interact. energy: -3.195 local terms energy: -531.462183 where: bonds (distance) C4'-P energy: -121.237 bonds (distance) P-C4' energy: -112.951 flat angles C4'-P-C4' energy: -125.369 flat angles P-C4'-P energy: -85.387 tors. eta vs tors. theta energy: -86.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1456.478881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.478881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.478881 (E_RNA) where: Base-Base interactions energy: -955.497 where: short stacking energy: -422.331 Base-Backbone interact. energy: 1.748 local terms energy: -502.729916 where: bonds (distance) C4'-P energy: -100.484 bonds (distance) P-C4' energy: -116.267 flat angles C4'-P-C4' energy: -114.439 flat angles P-C4'-P energy: -70.554 tors. eta vs tors. theta energy: -100.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -768.633450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.633450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.633450 (E_RNA) where: Base-Base interactions energy: -406.845 where: short stacking energy: -233.724 Base-Backbone interact. energy: -2.223 local terms energy: -359.566154 where: bonds (distance) C4'-P energy: -87.052 bonds (distance) P-C4' energy: -118.025 flat angles C4'-P-C4' energy: -86.287 flat angles P-C4'-P energy: -53.577 tors. eta vs tors. theta energy: -14.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -748.006672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.006672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.006672 (E_RNA) where: Base-Base interactions energy: -358.831 where: short stacking energy: -207.297 Base-Backbone interact. energy: -4.708 local terms energy: -384.466891 where: bonds (distance) C4'-P energy: -86.186 bonds (distance) P-C4' energy: -105.812 flat angles C4'-P-C4' energy: -94.217 flat angles P-C4'-P energy: -67.325 tors. eta vs tors. theta energy: -30.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -541.116852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.116852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.116852 (E_RNA) where: Base-Base interactions energy: -185.137 where: short stacking energy: -128.647 Base-Backbone interact. energy: 0.521 local terms energy: -356.500385 where: bonds (distance) C4'-P energy: -108.806 bonds (distance) P-C4' energy: -113.600 flat angles C4'-P-C4' energy: -79.945 flat angles P-C4'-P energy: -58.441 tors. eta vs tors. theta energy: 4.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -483.231060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.231060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.231060 (E_RNA) where: Base-Base interactions energy: -176.759 where: short stacking energy: -138.968 Base-Backbone interact. energy: -0.711 local terms energy: -305.761226 where: bonds (distance) C4'-P energy: -107.419 bonds (distance) P-C4' energy: -92.143 flat angles C4'-P-C4' energy: -80.779 flat angles P-C4'-P energy: -40.900 tors. eta vs tors. theta energy: 15.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -2037.550774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.550774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.550774 (E_RNA) where: Base-Base interactions energy: -1349.797 where: short stacking energy: -593.579 Base-Backbone interact. energy: -2.205 local terms energy: -685.549253 where: bonds (distance) C4'-P energy: -138.605 bonds (distance) P-C4' energy: -130.597 flat angles C4'-P-C4' energy: -133.862 flat angles P-C4'-P energy: -98.349 tors. eta vs tors. theta energy: -184.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1878.302420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1878.302420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1878.302420 (E_RNA) where: Base-Base interactions energy: -1251.793 where: short stacking energy: -511.530 Base-Backbone interact. energy: -6.294 local terms energy: -620.215340 where: bonds (distance) C4'-P energy: -122.468 bonds (distance) P-C4' energy: -133.579 flat angles C4'-P-C4' energy: -130.616 flat angles P-C4'-P energy: -85.195 tors. eta vs tors. theta energy: -148.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1839.071166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1839.071166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1839.071166 (E_RNA) where: Base-Base interactions energy: -1236.171 where: short stacking energy: -527.212 Base-Backbone interact. energy: -1.511 local terms energy: -601.389404 where: bonds (distance) C4'-P energy: -124.170 bonds (distance) P-C4' energy: -110.629 flat angles C4'-P-C4' energy: -124.594 flat angles P-C4'-P energy: -88.536 tors. eta vs tors. theta energy: -153.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1622.265542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1622.265542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.265542 (E_RNA) where: Base-Base interactions energy: -1073.067 where: short stacking energy: -481.212 Base-Backbone interact. energy: -3.233 local terms energy: -545.965263 where: bonds (distance) C4'-P energy: -118.576 bonds (distance) P-C4' energy: -111.256 flat angles C4'-P-C4' energy: -135.620 flat angles P-C4'-P energy: -71.818 tors. eta vs tors. theta energy: -108.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1459.267521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.267521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.267521 (E_RNA) where: Base-Base interactions energy: -941.851 where: short stacking energy: -410.101 Base-Backbone interact. energy: 0.974 local terms energy: -518.390521 where: bonds (distance) C4'-P energy: -107.160 bonds (distance) P-C4' energy: -99.293 flat angles C4'-P-C4' energy: -120.497 flat angles P-C4'-P energy: -80.039 tors. eta vs tors. theta energy: -111.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1483.400607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.400607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.400607 (E_RNA) where: Base-Base interactions energy: -995.067 where: short stacking energy: -449.550 Base-Backbone interact. energy: 0.931 local terms energy: -489.264454 where: bonds (distance) C4'-P energy: -105.657 bonds (distance) P-C4' energy: -103.387 flat angles C4'-P-C4' energy: -102.145 flat angles P-C4'-P energy: -66.929 tors. eta vs tors. theta energy: -111.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -938.779283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.779283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.779283 (E_RNA) where: Base-Base interactions energy: -536.149 where: short stacking energy: -272.622 Base-Backbone interact. energy: 7.779 local terms energy: -410.410046 where: bonds (distance) C4'-P energy: -95.764 bonds (distance) P-C4' energy: -108.799 flat angles C4'-P-C4' energy: -93.794 flat angles P-C4'-P energy: -64.485 tors. eta vs tors. theta energy: -47.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -731.103603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.103603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.103603 (E_RNA) where: Base-Base interactions energy: -376.429 where: short stacking energy: -213.697 Base-Backbone interact. energy: 3.407 local terms energy: -358.081773 where: bonds (distance) C4'-P energy: -83.798 bonds (distance) P-C4' energy: -101.053 flat angles C4'-P-C4' energy: -89.824 flat angles P-C4'-P energy: -61.844 tors. eta vs tors. theta energy: -21.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -557.443581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.443581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.443581 (E_RNA) where: Base-Base interactions energy: -234.773 where: short stacking energy: -162.244 Base-Backbone interact. energy: 0.329 local terms energy: -322.999763 where: bonds (distance) C4'-P energy: -106.710 bonds (distance) P-C4' energy: -110.000 flat angles C4'-P-C4' energy: -72.285 flat angles P-C4'-P energy: -49.802 tors. eta vs tors. theta energy: 15.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -509.004966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.004966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.004966 (E_RNA) where: Base-Base interactions energy: -219.217 where: short stacking energy: -144.320 Base-Backbone interact. energy: 4.804 local terms energy: -294.591573 where: bonds (distance) C4'-P energy: -96.257 bonds (distance) P-C4' energy: -104.367 flat angles C4'-P-C4' energy: -70.341 flat angles P-C4'-P energy: -49.678 tors. eta vs tors. theta energy: 26.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -2022.962568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2022.962568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2022.962568 (E_RNA) where: Base-Base interactions energy: -1385.179 where: short stacking energy: -588.723 Base-Backbone interact. energy: 0.629 local terms energy: -638.413291 where: bonds (distance) C4'-P energy: -110.821 bonds (distance) P-C4' energy: -124.087 flat angles C4'-P-C4' energy: -138.639 flat angles P-C4'-P energy: -85.465 tors. eta vs tors. theta energy: -179.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1892.660867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1892.660867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1892.660867 (E_RNA) where: Base-Base interactions energy: -1289.316 where: short stacking energy: -549.744 Base-Backbone interact. energy: -3.921 local terms energy: -599.423789 where: bonds (distance) C4'-P energy: -98.106 bonds (distance) P-C4' energy: -113.088 flat angles C4'-P-C4' energy: -126.080 flat angles P-C4'-P energy: -103.726 tors. eta vs tors. theta energy: -158.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1868.970954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.970954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1868.970954 (E_RNA) where: Base-Base interactions energy: -1232.220 where: short stacking energy: -530.001 Base-Backbone interact. energy: 0.285 local terms energy: -637.035445 where: bonds (distance) C4'-P energy: -118.784 bonds (distance) P-C4' energy: -126.080 flat angles C4'-P-C4' energy: -136.297 flat angles P-C4'-P energy: -93.423 tors. eta vs tors. theta energy: -162.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1567.719009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.719009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.719009 (E_RNA) where: Base-Base interactions energy: -1026.281 where: short stacking energy: -443.624 Base-Backbone interact. energy: -1.340 local terms energy: -540.097751 where: bonds (distance) C4'-P energy: -95.808 bonds (distance) P-C4' energy: -125.562 flat angles C4'-P-C4' energy: -118.550 flat angles P-C4'-P energy: -78.646 tors. eta vs tors. theta energy: -121.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1441.914616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.914616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.914616 (E_RNA) where: Base-Base interactions energy: -943.999 where: short stacking energy: -399.210 Base-Backbone interact. energy: -3.047 local terms energy: -494.868708 where: bonds (distance) C4'-P energy: -99.224 bonds (distance) P-C4' energy: -109.393 flat angles C4'-P-C4' energy: -116.911 flat angles P-C4'-P energy: -66.803 tors. eta vs tors. theta energy: -102.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1441.557268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.557268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.557268 (E_RNA) where: Base-Base interactions energy: -942.981 where: short stacking energy: -417.081 Base-Backbone interact. energy: -0.545 local terms energy: -498.030366 where: bonds (distance) C4'-P energy: -109.280 bonds (distance) P-C4' energy: -92.001 flat angles C4'-P-C4' energy: -121.658 flat angles P-C4'-P energy: -78.244 tors. eta vs tors. theta energy: -96.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -917.780668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.780668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.780668 (E_RNA) where: Base-Base interactions energy: -510.791 where: short stacking energy: -276.900 Base-Backbone interact. energy: 5.672 local terms energy: -412.662306 where: bonds (distance) C4'-P energy: -91.557 bonds (distance) P-C4' energy: -106.265 flat angles C4'-P-C4' energy: -102.417 flat angles P-C4'-P energy: -64.707 tors. eta vs tors. theta energy: -47.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -749.698806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.698806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.698806 (E_RNA) where: Base-Base interactions energy: -381.589 where: short stacking energy: -229.418 Base-Backbone interact. energy: -1.320 local terms energy: -366.789436 where: bonds (distance) C4'-P energy: -89.593 bonds (distance) P-C4' energy: -101.470 flat angles C4'-P-C4' energy: -106.925 flat angles P-C4'-P energy: -56.384 tors. eta vs tors. theta energy: -12.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -580.104057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.104057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.104057 (E_RNA) where: Base-Base interactions energy: -263.642 where: short stacking energy: -154.559 Base-Backbone interact. energy: 2.106 local terms energy: -318.567629 where: bonds (distance) C4'-P energy: -82.200 bonds (distance) P-C4' energy: -86.817 flat angles C4'-P-C4' energy: -89.221 flat angles P-C4'-P energy: -59.936 tors. eta vs tors. theta energy: -0.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -499.702845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.702845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.702845 (E_RNA) where: Base-Base interactions energy: -209.991 where: short stacking energy: -155.307 Base-Backbone interact. energy: 5.130 local terms energy: -294.841325 where: bonds (distance) C4'-P energy: -85.616 bonds (distance) P-C4' energy: -107.830 flat angles C4'-P-C4' energy: -76.805 flat angles P-C4'-P energy: -37.923 tors. eta vs tors. theta energy: 13.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -2015.354921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.354921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.354921 (E_RNA) where: Base-Base interactions energy: -1372.823 where: short stacking energy: -592.729 Base-Backbone interact. energy: -2.323 local terms energy: -640.209381 where: bonds (distance) C4'-P energy: -109.991 bonds (distance) P-C4' energy: -121.050 flat angles C4'-P-C4' energy: -139.365 flat angles P-C4'-P energy: -96.876 tors. eta vs tors. theta energy: -172.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1883.616260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.616260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.616260 (E_RNA) where: Base-Base interactions energy: -1267.337 where: short stacking energy: -510.614 Base-Backbone interact. energy: -0.304 local terms energy: -615.974756 where: bonds (distance) C4'-P energy: -94.587 bonds (distance) P-C4' energy: -127.240 flat angles C4'-P-C4' energy: -131.067 flat angles P-C4'-P energy: -102.874 tors. eta vs tors. theta energy: -160.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1873.963449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1873.963449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.963449 (E_RNA) where: Base-Base interactions energy: -1227.939 where: short stacking energy: -543.577 Base-Backbone interact. energy: -0.632 local terms energy: -645.392021 where: bonds (distance) C4'-P energy: -127.092 bonds (distance) P-C4' energy: -127.524 flat angles C4'-P-C4' energy: -122.033 flat angles P-C4'-P energy: -101.526 tors. eta vs tors. theta energy: -167.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1568.930606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.930606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.930606 (E_RNA) where: Base-Base interactions energy: -1074.653 where: short stacking energy: -455.150 Base-Backbone interact. energy: -0.430 local terms energy: -493.847549 where: bonds (distance) C4'-P energy: -100.629 bonds (distance) P-C4' energy: -108.440 flat angles C4'-P-C4' energy: -120.906 flat angles P-C4'-P energy: -60.305 tors. eta vs tors. theta energy: -103.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1480.553662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.553662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.553662 (E_RNA) where: Base-Base interactions energy: -980.534 where: short stacking energy: -407.786 Base-Backbone interact. energy: -2.501 local terms energy: -497.518032 where: bonds (distance) C4'-P energy: -111.062 bonds (distance) P-C4' energy: -104.362 flat angles C4'-P-C4' energy: -113.112 flat angles P-C4'-P energy: -76.876 tors. eta vs tors. theta energy: -92.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1418.128633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.128633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.128633 (E_RNA) where: Base-Base interactions energy: -913.834 where: short stacking energy: -410.350 Base-Backbone interact. energy: -3.211 local terms energy: -501.083867 where: bonds (distance) C4'-P energy: -112.768 bonds (distance) P-C4' energy: -106.193 flat angles C4'-P-C4' energy: -115.925 flat angles P-C4'-P energy: -65.927 tors. eta vs tors. theta energy: -100.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -967.472667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.472667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.472667 (E_RNA) where: Base-Base interactions energy: -521.134 where: short stacking energy: -272.214 Base-Backbone interact. energy: 2.701 local terms energy: -449.039321 where: bonds (distance) C4'-P energy: -106.002 bonds (distance) P-C4' energy: -114.043 flat angles C4'-P-C4' energy: -103.178 flat angles P-C4'-P energy: -86.343 tors. eta vs tors. theta energy: -39.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -796.091617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.091617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.091617 (E_RNA) where: Base-Base interactions energy: -408.312 where: short stacking energy: -220.310 Base-Backbone interact. energy: -1.131 local terms energy: -386.649520 where: bonds (distance) C4'-P energy: -117.735 bonds (distance) P-C4' energy: -104.061 flat angles C4'-P-C4' energy: -96.089 flat angles P-C4'-P energy: -55.987 tors. eta vs tors. theta energy: -12.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -583.719522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.719522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.719522 (E_RNA) where: Base-Base interactions energy: -242.725 where: short stacking energy: -135.862 Base-Backbone interact. energy: -1.339 local terms energy: -339.654854 where: bonds (distance) C4'-P energy: -112.277 bonds (distance) P-C4' energy: -112.821 flat angles C4'-P-C4' energy: -81.496 flat angles P-C4'-P energy: -55.377 tors. eta vs tors. theta energy: 22.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -476.531549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.531549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.531549 (E_RNA) where: Base-Base interactions energy: -144.878 where: short stacking energy: -116.239 Base-Backbone interact. energy: -2.281 local terms energy: -329.371688 where: bonds (distance) C4'-P energy: -93.915 bonds (distance) P-C4' energy: -123.665 flat angles C4'-P-C4' energy: -86.745 flat angles P-C4'-P energy: -54.361 tors. eta vs tors. theta energy: 29.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -2037.877908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.877908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.877908 (E_RNA) where: Base-Base interactions energy: -1405.033 where: short stacking energy: -582.808 Base-Backbone interact. energy: 4.250 local terms energy: -637.094786 where: bonds (distance) C4'-P energy: -106.730 bonds (distance) P-C4' energy: -116.519 flat angles C4'-P-C4' energy: -141.820 flat angles P-C4'-P energy: -101.598 tors. eta vs tors. theta energy: -170.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1885.131157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.131157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.131157 (E_RNA) where: Base-Base interactions energy: -1250.117 where: short stacking energy: -568.393 Base-Backbone interact. energy: -3.592 local terms energy: -631.422091 where: bonds (distance) C4'-P energy: -100.081 bonds (distance) P-C4' energy: -135.538 flat angles C4'-P-C4' energy: -129.689 flat angles P-C4'-P energy: -97.431 tors. eta vs tors. theta energy: -168.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1863.920883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1863.920883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1863.920883 (E_RNA) where: Base-Base interactions energy: -1243.592 where: short stacking energy: -539.636 Base-Backbone interact. energy: -0.315 local terms energy: -620.014433 where: bonds (distance) C4'-P energy: -121.786 bonds (distance) P-C4' energy: -113.854 flat angles C4'-P-C4' energy: -135.476 flat angles P-C4'-P energy: -79.808 tors. eta vs tors. theta energy: -169.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1537.936930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.936930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.936930 (E_RNA) where: Base-Base interactions energy: -1014.436 where: short stacking energy: -431.208 Base-Backbone interact. energy: 1.013 local terms energy: -524.514015 where: bonds (distance) C4'-P energy: -117.004 bonds (distance) P-C4' energy: -111.542 flat angles C4'-P-C4' energy: -128.243 flat angles P-C4'-P energy: -65.718 tors. eta vs tors. theta energy: -102.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1477.461359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.461359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.461359 (E_RNA) where: Base-Base interactions energy: -986.212 where: short stacking energy: -414.275 Base-Backbone interact. energy: 9.148 local terms energy: -500.397912 where: bonds (distance) C4'-P energy: -108.876 bonds (distance) P-C4' energy: -102.736 flat angles C4'-P-C4' energy: -119.165 flat angles P-C4'-P energy: -71.607 tors. eta vs tors. theta energy: -98.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1370.619986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.619986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.619986 (E_RNA) where: Base-Base interactions energy: -849.096 where: short stacking energy: -365.752 Base-Backbone interact. energy: -2.522 local terms energy: -519.001885 where: bonds (distance) C4'-P energy: -115.490 bonds (distance) P-C4' energy: -122.132 flat angles C4'-P-C4' energy: -113.644 flat angles P-C4'-P energy: -74.864 tors. eta vs tors. theta energy: -92.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -993.902246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.902246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.902246 (E_RNA) where: Base-Base interactions energy: -573.332 where: short stacking energy: -278.022 Base-Backbone interact. energy: -1.194 local terms energy: -419.376238 where: bonds (distance) C4'-P energy: -99.226 bonds (distance) P-C4' energy: -110.158 flat angles C4'-P-C4' energy: -95.066 flat angles P-C4'-P energy: -68.165 tors. eta vs tors. theta energy: -46.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -763.243499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.243499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.243499 (E_RNA) where: Base-Base interactions energy: -409.069 where: short stacking energy: -202.172 Base-Backbone interact. energy: 0.815 local terms energy: -354.989598 where: bonds (distance) C4'-P energy: -106.627 bonds (distance) P-C4' energy: -101.173 flat angles C4'-P-C4' energy: -79.879 flat angles P-C4'-P energy: -56.605 tors. eta vs tors. theta energy: -10.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -562.670739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.670739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.670739 (E_RNA) where: Base-Base interactions energy: -246.331 where: short stacking energy: -180.498 Base-Backbone interact. energy: -0.283 local terms energy: -316.056746 where: bonds (distance) C4'-P energy: -105.557 bonds (distance) P-C4' energy: -85.793 flat angles C4'-P-C4' energy: -97.803 flat angles P-C4'-P energy: -45.383 tors. eta vs tors. theta energy: 18.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -546.477593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.477593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.477593 (E_RNA) where: Base-Base interactions energy: -224.195 where: short stacking energy: -148.712 Base-Backbone interact. energy: -4.068 local terms energy: -318.213815 where: bonds (distance) C4'-P energy: -93.436 bonds (distance) P-C4' energy: -118.566 flat angles C4'-P-C4' energy: -67.684 flat angles P-C4'-P energy: -41.019 tors. eta vs tors. theta energy: 2.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -2036.315458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2036.315458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2036.315458 (E_RNA) where: Base-Base interactions energy: -1365.169 where: short stacking energy: -551.675 Base-Backbone interact. energy: -1.964 local terms energy: -669.182631 where: bonds (distance) C4'-P energy: -115.719 bonds (distance) P-C4' energy: -125.806 flat angles C4'-P-C4' energy: -143.443 flat angles P-C4'-P energy: -106.355 tors. eta vs tors. theta energy: -177.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1887.382485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1887.382485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1887.382485 (E_RNA) where: Base-Base interactions energy: -1278.148 where: short stacking energy: -550.491 Base-Backbone interact. energy: -4.149 local terms energy: -605.085423 where: bonds (distance) C4'-P energy: -117.997 bonds (distance) P-C4' energy: -115.656 flat angles C4'-P-C4' energy: -126.043 flat angles P-C4'-P energy: -82.755 tors. eta vs tors. theta energy: -162.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1837.347608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1837.347608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1837.347608 (E_RNA) where: Base-Base interactions energy: -1244.940 where: short stacking energy: -516.279 Base-Backbone interact. energy: -1.074 local terms energy: -591.333259 where: bonds (distance) C4'-P energy: -99.119 bonds (distance) P-C4' energy: -118.257 flat angles C4'-P-C4' energy: -127.267 flat angles P-C4'-P energy: -91.098 tors. eta vs tors. theta energy: -155.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1593.316952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.316952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.316952 (E_RNA) where: Base-Base interactions energy: -1062.558 where: short stacking energy: -443.347 Base-Backbone interact. energy: 3.682 local terms energy: -534.440432 where: bonds (distance) C4'-P energy: -121.110 bonds (distance) P-C4' energy: -97.022 flat angles C4'-P-C4' energy: -123.679 flat angles P-C4'-P energy: -90.410 tors. eta vs tors. theta energy: -102.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1476.451498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.451498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.451498 (E_RNA) where: Base-Base interactions energy: -979.237 where: short stacking energy: -433.085 Base-Backbone interact. energy: 0.183 local terms energy: -497.397572 where: bonds (distance) C4'-P energy: -99.980 bonds (distance) P-C4' energy: -112.748 flat angles C4'-P-C4' energy: -120.875 flat angles P-C4'-P energy: -73.264 tors. eta vs tors. theta energy: -90.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1281.132548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.132548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.132548 (E_RNA) where: Base-Base interactions energy: -799.435 where: short stacking energy: -349.302 Base-Backbone interact. energy: 2.438 local terms energy: -484.135131 where: bonds (distance) C4'-P energy: -121.147 bonds (distance) P-C4' energy: -100.843 flat angles C4'-P-C4' energy: -113.312 flat angles P-C4'-P energy: -75.661 tors. eta vs tors. theta energy: -73.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -983.275594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.275594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.275594 (E_RNA) where: Base-Base interactions energy: -563.156 where: short stacking energy: -279.055 Base-Backbone interact. energy: -2.238 local terms energy: -417.881239 where: bonds (distance) C4'-P energy: -112.835 bonds (distance) P-C4' energy: -106.270 flat angles C4'-P-C4' energy: -85.354 flat angles P-C4'-P energy: -60.301 tors. eta vs tors. theta energy: -53.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -717.702261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.702261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.702261 (E_RNA) where: Base-Base interactions energy: -330.139 where: short stacking energy: -210.236 Base-Backbone interact. energy: 0.404 local terms energy: -387.966660 where: bonds (distance) C4'-P energy: -107.897 bonds (distance) P-C4' energy: -113.216 flat angles C4'-P-C4' energy: -103.960 flat angles P-C4'-P energy: -60.562 tors. eta vs tors. theta energy: -2.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -592.604498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.604498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.604498 (E_RNA) where: Base-Base interactions energy: -243.149 where: short stacking energy: -150.988 Base-Backbone interact. energy: 1.541 local terms energy: -350.996463 where: bonds (distance) C4'-P energy: -104.180 bonds (distance) P-C4' energy: -109.858 flat angles C4'-P-C4' energy: -73.943 flat angles P-C4'-P energy: -78.738 tors. eta vs tors. theta energy: 15.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -493.123925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.123925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.123925 (E_RNA) where: Base-Base interactions energy: -152.243 where: short stacking energy: -120.764 Base-Backbone interact. energy: 1.255 local terms energy: -342.135655 where: bonds (distance) C4'-P energy: -100.141 bonds (distance) P-C4' energy: -110.344 flat angles C4'-P-C4' energy: -82.576 flat angles P-C4'-P energy: -53.492 tors. eta vs tors. theta energy: 4.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -2042.549263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2042.549263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2042.549263 (E_RNA) where: Base-Base interactions energy: -1381.872 where: short stacking energy: -604.966 Base-Backbone interact. energy: -1.676 local terms energy: -659.001354 where: bonds (distance) C4'-P energy: -126.646 bonds (distance) P-C4' energy: -119.635 flat angles C4'-P-C4' energy: -143.422 flat angles P-C4'-P energy: -99.310 tors. eta vs tors. theta energy: -169.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1921.255745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1921.255745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1921.255745 (E_RNA) where: Base-Base interactions energy: -1275.965 where: short stacking energy: -541.732 Base-Backbone interact. energy: -3.783 local terms energy: -641.507470 where: bonds (distance) C4'-P energy: -123.464 bonds (distance) P-C4' energy: -127.801 flat angles C4'-P-C4' energy: -126.733 flat angles P-C4'-P energy: -104.606 tors. eta vs tors. theta energy: -158.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1811.141254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1811.141254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1811.141254 (E_RNA) where: Base-Base interactions energy: -1217.417 where: short stacking energy: -526.242 Base-Backbone interact. energy: -2.162 local terms energy: -591.562702 where: bonds (distance) C4'-P energy: -112.222 bonds (distance) P-C4' energy: -106.143 flat angles C4'-P-C4' energy: -128.683 flat angles P-C4'-P energy: -86.641 tors. eta vs tors. theta energy: -157.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1587.527785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.527785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.527785 (E_RNA) where: Base-Base interactions energy: -1029.871 where: short stacking energy: -453.514 Base-Backbone interact. energy: -3.762 local terms energy: -553.894620 where: bonds (distance) C4'-P energy: -120.119 bonds (distance) P-C4' energy: -109.998 flat angles C4'-P-C4' energy: -125.065 flat angles P-C4'-P energy: -92.356 tors. eta vs tors. theta energy: -106.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1500.356785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.356785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.356785 (E_RNA) where: Base-Base interactions energy: -982.469 where: short stacking energy: -433.756 Base-Backbone interact. energy: -1.475 local terms energy: -516.412413 where: bonds (distance) C4'-P energy: -106.862 bonds (distance) P-C4' energy: -118.252 flat angles C4'-P-C4' energy: -109.984 flat angles P-C4'-P energy: -63.841 tors. eta vs tors. theta energy: -117.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1274.469115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.469115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.469115 (E_RNA) where: Base-Base interactions energy: -800.039 where: short stacking energy: -352.756 Base-Backbone interact. energy: -3.739 local terms energy: -470.691573 where: bonds (distance) C4'-P energy: -115.466 bonds (distance) P-C4' energy: -104.725 flat angles C4'-P-C4' energy: -99.573 flat angles P-C4'-P energy: -74.513 tors. eta vs tors. theta energy: -76.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1006.577513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.577513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.577513 (E_RNA) where: Base-Base interactions energy: -579.547 where: short stacking energy: -267.614 Base-Backbone interact. energy: -1.881 local terms energy: -425.149567 where: bonds (distance) C4'-P energy: -88.515 bonds (distance) P-C4' energy: -108.462 flat angles C4'-P-C4' energy: -116.834 flat angles P-C4'-P energy: -61.962 tors. eta vs tors. theta energy: -49.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -795.825034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.825034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.825034 (E_RNA) where: Base-Base interactions energy: -411.492 where: short stacking energy: -227.880 Base-Backbone interact. energy: 0.950 local terms energy: -385.283564 where: bonds (distance) C4'-P energy: -91.769 bonds (distance) P-C4' energy: -115.512 flat angles C4'-P-C4' energy: -88.839 flat angles P-C4'-P energy: -58.827 tors. eta vs tors. theta energy: -30.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -516.381878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.381878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.381878 (E_RNA) where: Base-Base interactions energy: -195.612 where: short stacking energy: -140.240 Base-Backbone interact. energy: -1.364 local terms energy: -319.405830 where: bonds (distance) C4'-P energy: -99.925 bonds (distance) P-C4' energy: -89.283 flat angles C4'-P-C4' energy: -89.598 flat angles P-C4'-P energy: -60.190 tors. eta vs tors. theta energy: 19.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -566.990744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.990744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.990744 (E_RNA) where: Base-Base interactions energy: -233.462 where: short stacking energy: -151.831 Base-Backbone interact. energy: 1.937 local terms energy: -335.466234 where: bonds (distance) C4'-P energy: -87.014 bonds (distance) P-C4' energy: -104.739 flat angles C4'-P-C4' energy: -80.198 flat angles P-C4'-P energy: -64.530 tors. eta vs tors. theta energy: 1.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -2027.369417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2027.369417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2027.369417 (E_RNA) where: Base-Base interactions energy: -1366.023 where: short stacking energy: -587.274 Base-Backbone interact. energy: -1.525 local terms energy: -659.820714 where: bonds (distance) C4'-P energy: -124.158 bonds (distance) P-C4' energy: -128.540 flat angles C4'-P-C4' energy: -129.561 flat angles P-C4'-P energy: -105.686 tors. eta vs tors. theta energy: -171.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1916.098225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1916.098225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1916.098225 (E_RNA) where: Base-Base interactions energy: -1320.979 where: short stacking energy: -552.631 Base-Backbone interact. energy: -2.018 local terms energy: -593.100882 where: bonds (distance) C4'-P energy: -106.533 bonds (distance) P-C4' energy: -112.158 flat angles C4'-P-C4' energy: -131.005 flat angles P-C4'-P energy: -84.899 tors. eta vs tors. theta energy: -158.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1835.537576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1835.537576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1835.537576 (E_RNA) where: Base-Base interactions energy: -1199.004 where: short stacking energy: -520.984 Base-Backbone interact. energy: -0.874 local terms energy: -635.659715 where: bonds (distance) C4'-P energy: -119.487 bonds (distance) P-C4' energy: -114.989 flat angles C4'-P-C4' energy: -133.819 flat angles P-C4'-P energy: -104.305 tors. eta vs tors. theta energy: -163.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1600.510427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.510427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.510427 (E_RNA) where: Base-Base interactions energy: -1050.663 where: short stacking energy: -485.882 Base-Backbone interact. energy: -5.420 local terms energy: -544.427309 where: bonds (distance) C4'-P energy: -106.568 bonds (distance) P-C4' energy: -124.373 flat angles C4'-P-C4' energy: -132.887 flat angles P-C4'-P energy: -60.104 tors. eta vs tors. theta energy: -120.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1492.060345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.060345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.060345 (E_RNA) where: Base-Base interactions energy: -959.176 where: short stacking energy: -433.886 Base-Backbone interact. energy: -2.364 local terms energy: -530.520721 where: bonds (distance) C4'-P energy: -114.739 bonds (distance) P-C4' energy: -114.223 flat angles C4'-P-C4' energy: -121.712 flat angles P-C4'-P energy: -74.222 tors. eta vs tors. theta energy: -105.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1274.647420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.647420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.647420 (E_RNA) where: Base-Base interactions energy: -822.476 where: short stacking energy: -390.643 Base-Backbone interact. energy: 1.547 local terms energy: -453.718275 where: bonds (distance) C4'-P energy: -106.821 bonds (distance) P-C4' energy: -101.252 flat angles C4'-P-C4' energy: -105.105 flat angles P-C4'-P energy: -56.858 tors. eta vs tors. theta energy: -83.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -972.074440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.074440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.074440 (E_RNA) where: Base-Base interactions energy: -544.988 where: short stacking energy: -285.743 Base-Backbone interact. energy: -1.450 local terms energy: -425.636745 where: bonds (distance) C4'-P energy: -113.157 bonds (distance) P-C4' energy: -115.764 flat angles C4'-P-C4' energy: -102.446 flat angles P-C4'-P energy: -49.585 tors. eta vs tors. theta energy: -44.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -785.894696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.894696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.894696 (E_RNA) where: Base-Base interactions energy: -398.127 where: short stacking energy: -211.048 Base-Backbone interact. energy: 1.262 local terms energy: -389.030381 where: bonds (distance) C4'-P energy: -101.351 bonds (distance) P-C4' energy: -108.632 flat angles C4'-P-C4' energy: -104.023 flat angles P-C4'-P energy: -45.537 tors. eta vs tors. theta energy: -29.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -585.471049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.471049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.471049 (E_RNA) where: Base-Base interactions energy: -212.764 where: short stacking energy: -161.624 Base-Backbone interact. energy: 3.470 local terms energy: -376.176647 where: bonds (distance) C4'-P energy: -102.981 bonds (distance) P-C4' energy: -111.806 flat angles C4'-P-C4' energy: -96.432 flat angles P-C4'-P energy: -58.257 tors. eta vs tors. theta energy: -6.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -518.213222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.213222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.213222 (E_RNA) where: Base-Base interactions energy: -242.184 where: short stacking energy: -144.248 Base-Backbone interact. energy: 0.078 local terms energy: -276.106905 where: bonds (distance) C4'-P energy: -83.353 bonds (distance) P-C4' energy: -99.587 flat angles C4'-P-C4' energy: -52.315 flat angles P-C4'-P energy: -59.460 tors. eta vs tors. theta energy: 18.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -2037.833863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.833863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.833863 (E_RNA) where: Base-Base interactions energy: -1370.973 where: short stacking energy: -575.676 Base-Backbone interact. energy: -1.042 local terms energy: -665.818592 where: bonds (distance) C4'-P energy: -121.920 bonds (distance) P-C4' energy: -133.997 flat angles C4'-P-C4' energy: -145.675 flat angles P-C4'-P energy: -80.822 tors. eta vs tors. theta energy: -183.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1913.155159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1913.155159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1913.155159 (E_RNA) where: Base-Base interactions energy: -1299.306 where: short stacking energy: -557.440 Base-Backbone interact. energy: -1.345 local terms energy: -612.504057 where: bonds (distance) C4'-P energy: -114.399 bonds (distance) P-C4' energy: -112.475 flat angles C4'-P-C4' energy: -139.448 flat angles P-C4'-P energy: -89.229 tors. eta vs tors. theta energy: -156.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1827.281624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.281624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.281624 (E_RNA) where: Base-Base interactions energy: -1225.439 where: short stacking energy: -523.713 Base-Backbone interact. energy: -2.361 local terms energy: -599.481209 where: bonds (distance) C4'-P energy: -100.259 bonds (distance) P-C4' energy: -129.037 flat angles C4'-P-C4' energy: -128.023 flat angles P-C4'-P energy: -82.750 tors. eta vs tors. theta energy: -159.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1591.996555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.996555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.996555 (E_RNA) where: Base-Base interactions energy: -1037.672 where: short stacking energy: -456.017 Base-Backbone interact. energy: -3.889 local terms energy: -550.434871 where: bonds (distance) C4'-P energy: -100.584 bonds (distance) P-C4' energy: -130.317 flat angles C4'-P-C4' energy: -120.421 flat angles P-C4'-P energy: -77.701 tors. eta vs tors. theta energy: -121.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1461.466308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.466308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.466308 (E_RNA) where: Base-Base interactions energy: -956.054 where: short stacking energy: -443.070 Base-Backbone interact. energy: 0.985 local terms energy: -506.396664 where: bonds (distance) C4'-P energy: -102.097 bonds (distance) P-C4' energy: -105.355 flat angles C4'-P-C4' energy: -110.486 flat angles P-C4'-P energy: -81.036 tors. eta vs tors. theta energy: -107.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1344.474770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.474770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.474770 (E_RNA) where: Base-Base interactions energy: -828.453 where: short stacking energy: -382.764 Base-Backbone interact. energy: -0.177 local terms energy: -515.844445 where: bonds (distance) C4'-P energy: -108.737 bonds (distance) P-C4' energy: -110.385 flat angles C4'-P-C4' energy: -117.948 flat angles P-C4'-P energy: -73.572 tors. eta vs tors. theta energy: -105.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1008.464275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.464275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.464275 (E_RNA) where: Base-Base interactions energy: -551.192 where: short stacking energy: -298.597 Base-Backbone interact. energy: -0.121 local terms energy: -457.151306 where: bonds (distance) C4'-P energy: -112.653 bonds (distance) P-C4' energy: -115.796 flat angles C4'-P-C4' energy: -111.462 flat angles P-C4'-P energy: -66.594 tors. eta vs tors. theta energy: -50.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -795.354090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.354090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.354090 (E_RNA) where: Base-Base interactions energy: -416.499 where: short stacking energy: -228.146 Base-Backbone interact. energy: -0.328 local terms energy: -378.527586 where: bonds (distance) C4'-P energy: -76.807 bonds (distance) P-C4' energy: -104.119 flat angles C4'-P-C4' energy: -112.869 flat angles P-C4'-P energy: -65.435 tors. eta vs tors. theta energy: -19.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -523.497598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.497598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.497598 (E_RNA) where: Base-Base interactions energy: -170.350 where: short stacking energy: -151.946 Base-Backbone interact. energy: 8.638 local terms energy: -361.786282 where: bonds (distance) C4'-P energy: -100.844 bonds (distance) P-C4' energy: -113.820 flat angles C4'-P-C4' energy: -102.016 flat angles P-C4'-P energy: -54.847 tors. eta vs tors. theta energy: 9.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -473.598601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.598601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.598601 (E_RNA) where: Base-Base interactions energy: -164.264 where: short stacking energy: -155.657 Base-Backbone interact. energy: 1.558 local terms energy: -310.891942 where: bonds (distance) C4'-P energy: -105.005 bonds (distance) P-C4' energy: -98.138 flat angles C4'-P-C4' energy: -88.738 flat angles P-C4'-P energy: -42.256 tors. eta vs tors. theta energy: 23.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -2028.509650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2028.509650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2028.509650 (E_RNA) where: Base-Base interactions energy: -1365.578 where: short stacking energy: -595.472 Base-Backbone interact. energy: -0.374 local terms energy: -662.557829 where: bonds (distance) C4'-P energy: -128.563 bonds (distance) P-C4' energy: -124.796 flat angles C4'-P-C4' energy: -130.333 flat angles P-C4'-P energy: -96.423 tors. eta vs tors. theta energy: -182.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1875.018800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.018800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.018800 (E_RNA) where: Base-Base interactions energy: -1274.521 where: short stacking energy: -525.743 Base-Backbone interact. energy: -4.236 local terms energy: -596.261768 where: bonds (distance) C4'-P energy: -123.125 bonds (distance) P-C4' energy: -118.349 flat angles C4'-P-C4' energy: -130.890 flat angles P-C4'-P energy: -80.479 tors. eta vs tors. theta energy: -143.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1797.247154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.247154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.247154 (E_RNA) where: Base-Base interactions energy: -1187.133 where: short stacking energy: -502.964 Base-Backbone interact. energy: -3.229 local terms energy: -606.885531 where: bonds (distance) C4'-P energy: -128.809 bonds (distance) P-C4' energy: -117.750 flat angles C4'-P-C4' energy: -117.989 flat angles P-C4'-P energy: -86.602 tors. eta vs tors. theta energy: -155.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1570.161775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.161775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.161775 (E_RNA) where: Base-Base interactions energy: -1045.928 where: short stacking energy: -443.370 Base-Backbone interact. energy: -4.622 local terms energy: -519.610885 where: bonds (distance) C4'-P energy: -104.495 bonds (distance) P-C4' energy: -125.680 flat angles C4'-P-C4' energy: -110.501 flat angles P-C4'-P energy: -69.908 tors. eta vs tors. theta energy: -109.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1477.780505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.780505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.780505 (E_RNA) where: Base-Base interactions energy: -945.932 where: short stacking energy: -454.771 Base-Backbone interact. energy: -1.514 local terms energy: -530.334150 where: bonds (distance) C4'-P energy: -115.859 bonds (distance) P-C4' energy: -111.590 flat angles C4'-P-C4' energy: -124.100 flat angles P-C4'-P energy: -65.645 tors. eta vs tors. theta energy: -113.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1352.028193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.028193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.028193 (E_RNA) where: Base-Base interactions energy: -845.028 where: short stacking energy: -390.703 Base-Backbone interact. energy: 1.336 local terms energy: -508.336689 where: bonds (distance) C4'-P energy: -105.887 bonds (distance) P-C4' energy: -110.234 flat angles C4'-P-C4' energy: -120.886 flat angles P-C4'-P energy: -79.243 tors. eta vs tors. theta energy: -92.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1010.793244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.793244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.793244 (E_RNA) where: Base-Base interactions energy: -567.869 where: short stacking energy: -264.221 Base-Backbone interact. energy: -0.665 local terms energy: -442.259248 where: bonds (distance) C4'-P energy: -111.131 bonds (distance) P-C4' energy: -126.265 flat angles C4'-P-C4' energy: -92.958 flat angles P-C4'-P energy: -56.093 tors. eta vs tors. theta energy: -55.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -763.009355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.009355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.009355 (E_RNA) where: Base-Base interactions energy: -371.255 where: short stacking energy: -225.128 Base-Backbone interact. energy: -1.299 local terms energy: -390.454865 where: bonds (distance) C4'-P energy: -93.197 bonds (distance) P-C4' energy: -119.170 flat angles C4'-P-C4' energy: -99.049 flat angles P-C4'-P energy: -49.305 tors. eta vs tors. theta energy: -29.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -511.318833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.318833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.318833 (E_RNA) where: Base-Base interactions energy: -174.374 where: short stacking energy: -150.649 Base-Backbone interact. energy: 3.037 local terms energy: -339.981698 where: bonds (distance) C4'-P energy: -97.713 bonds (distance) P-C4' energy: -108.652 flat angles C4'-P-C4' energy: -79.738 flat angles P-C4'-P energy: -55.315 tors. eta vs tors. theta energy: 1.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -475.986666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.986666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.986666 (E_RNA) where: Base-Base interactions energy: -152.219 where: short stacking energy: -143.150 Base-Backbone interact. energy: 3.366 local terms energy: -327.133371 where: bonds (distance) C4'-P energy: -87.115 bonds (distance) P-C4' energy: -104.099 flat angles C4'-P-C4' energy: -93.483 flat angles P-C4'-P energy: -50.778 tors. eta vs tors. theta energy: 8.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -2051.879785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2051.879785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2051.879785 (E_RNA) where: Base-Base interactions energy: -1382.156 where: short stacking energy: -573.199 Base-Backbone interact. energy: -0.005 local terms energy: -669.718736 where: bonds (distance) C4'-P energy: -125.387 bonds (distance) P-C4' energy: -134.646 flat angles C4'-P-C4' energy: -131.573 flat angles P-C4'-P energy: -101.913 tors. eta vs tors. theta energy: -176.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1893.737515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1893.737515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1893.737515 (E_RNA) where: Base-Base interactions energy: -1296.096 where: short stacking energy: -519.602 Base-Backbone interact. energy: -4.941 local terms energy: -592.700471 where: bonds (distance) C4'-P energy: -113.678 bonds (distance) P-C4' energy: -112.044 flat angles C4'-P-C4' energy: -132.668 flat angles P-C4'-P energy: -102.950 tors. eta vs tors. theta energy: -131.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1783.644281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1783.644281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.644281 (E_RNA) where: Base-Base interactions energy: -1190.291 where: short stacking energy: -517.207 Base-Backbone interact. energy: -0.295 local terms energy: -593.057788 where: bonds (distance) C4'-P energy: -101.597 bonds (distance) P-C4' energy: -129.319 flat angles C4'-P-C4' energy: -133.306 flat angles P-C4'-P energy: -71.143 tors. eta vs tors. theta energy: -157.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1558.838905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.838905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.838905 (E_RNA) where: Base-Base interactions energy: -1041.454 where: short stacking energy: -461.430 Base-Backbone interact. energy: -1.949 local terms energy: -515.435482 where: bonds (distance) C4'-P energy: -101.559 bonds (distance) P-C4' energy: -116.747 flat angles C4'-P-C4' energy: -116.312 flat angles P-C4'-P energy: -68.411 tors. eta vs tors. theta energy: -112.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1484.018389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.018389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.018389 (E_RNA) where: Base-Base interactions energy: -953.349 where: short stacking energy: -410.709 Base-Backbone interact. energy: -2.155 local terms energy: -528.513834 where: bonds (distance) C4'-P energy: -99.987 bonds (distance) P-C4' energy: -116.284 flat angles C4'-P-C4' energy: -133.963 flat angles P-C4'-P energy: -73.302 tors. eta vs tors. theta energy: -104.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1351.149008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.149008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.149008 (E_RNA) where: Base-Base interactions energy: -858.260 where: short stacking energy: -373.257 Base-Backbone interact. energy: -2.451 local terms energy: -490.438135 where: bonds (distance) C4'-P energy: -95.227 bonds (distance) P-C4' energy: -119.137 flat angles C4'-P-C4' energy: -118.506 flat angles P-C4'-P energy: -67.032 tors. eta vs tors. theta energy: -90.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1031.934248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.934248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.934248 (E_RNA) where: Base-Base interactions energy: -604.956 where: short stacking energy: -266.462 Base-Backbone interact. energy: -0.375 local terms energy: -426.603477 where: bonds (distance) C4'-P energy: -101.567 bonds (distance) P-C4' energy: -100.780 flat angles C4'-P-C4' energy: -112.400 flat angles P-C4'-P energy: -64.235 tors. eta vs tors. theta energy: -47.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -771.582045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.582045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.582045 (E_RNA) where: Base-Base interactions energy: -374.003 where: short stacking energy: -226.186 Base-Backbone interact. energy: -1.982 local terms energy: -395.597790 where: bonds (distance) C4'-P energy: -100.848 bonds (distance) P-C4' energy: -103.119 flat angles C4'-P-C4' energy: -102.481 flat angles P-C4'-P energy: -54.350 tors. eta vs tors. theta energy: -34.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -563.225740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.225740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.225740 (E_RNA) where: Base-Base interactions energy: -241.776 where: short stacking energy: -160.304 Base-Backbone interact. energy: -2.338 local terms energy: -319.111756 where: bonds (distance) C4'-P energy: -95.935 bonds (distance) P-C4' energy: -113.960 flat angles C4'-P-C4' energy: -94.716 flat angles P-C4'-P energy: -27.132 tors. eta vs tors. theta energy: 12.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -486.111927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.111927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.111927 (E_RNA) where: Base-Base interactions energy: -168.309 where: short stacking energy: -118.006 Base-Backbone interact. energy: 4.265 local terms energy: -322.067480 where: bonds (distance) C4'-P energy: -97.065 bonds (distance) P-C4' energy: -120.411 flat angles C4'-P-C4' energy: -88.100 flat angles P-C4'-P energy: -52.431 tors. eta vs tors. theta energy: 35.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -2017.046405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2017.046405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2017.046405 (E_RNA) where: Base-Base interactions energy: -1354.661 where: short stacking energy: -585.435 Base-Backbone interact. energy: -2.689 local terms energy: -659.695913 where: bonds (distance) C4'-P energy: -124.406 bonds (distance) P-C4' energy: -132.783 flat angles C4'-P-C4' energy: -138.929 flat angles P-C4'-P energy: -99.913 tors. eta vs tors. theta energy: -163.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1895.302032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.302032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.302032 (E_RNA) where: Base-Base interactions energy: -1291.908 where: short stacking energy: -528.355 Base-Backbone interact. energy: -7.246 local terms energy: -596.147316 where: bonds (distance) C4'-P energy: -124.333 bonds (distance) P-C4' energy: -112.009 flat angles C4'-P-C4' energy: -129.474 flat angles P-C4'-P energy: -86.135 tors. eta vs tors. theta energy: -144.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1824.181522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.181522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.181522 (E_RNA) where: Base-Base interactions energy: -1244.002 where: short stacking energy: -540.666 Base-Backbone interact. energy: -2.525 local terms energy: -577.654220 where: bonds (distance) C4'-P energy: -121.674 bonds (distance) P-C4' energy: -107.506 flat angles C4'-P-C4' energy: -133.815 flat angles P-C4'-P energy: -72.312 tors. eta vs tors. theta energy: -142.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1577.878807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.878807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.878807 (E_RNA) where: Base-Base interactions energy: -1053.509 where: short stacking energy: -454.237 Base-Backbone interact. energy: -1.622 local terms energy: -522.747849 where: bonds (distance) C4'-P energy: -110.028 bonds (distance) P-C4' energy: -105.926 flat angles C4'-P-C4' energy: -121.994 flat angles P-C4'-P energy: -71.607 tors. eta vs tors. theta energy: -113.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1438.857340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.857340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.857340 (E_RNA) where: Base-Base interactions energy: -912.951 where: short stacking energy: -395.484 Base-Backbone interact. energy: -2.120 local terms energy: -523.786180 where: bonds (distance) C4'-P energy: -112.743 bonds (distance) P-C4' energy: -114.584 flat angles C4'-P-C4' energy: -129.118 flat angles P-C4'-P energy: -81.489 tors. eta vs tors. theta energy: -85.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1375.536477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.536477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.536477 (E_RNA) where: Base-Base interactions energy: -885.037 where: short stacking energy: -402.884 Base-Backbone interact. energy: -1.634 local terms energy: -488.866308 where: bonds (distance) C4'-P energy: -98.841 bonds (distance) P-C4' energy: -114.767 flat angles C4'-P-C4' energy: -112.586 flat angles P-C4'-P energy: -64.263 tors. eta vs tors. theta energy: -98.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1059.236904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.236904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.236904 (E_RNA) where: Base-Base interactions energy: -606.700 where: short stacking energy: -300.639 Base-Backbone interact. energy: 1.554 local terms energy: -454.090442 where: bonds (distance) C4'-P energy: -100.023 bonds (distance) P-C4' energy: -116.702 flat angles C4'-P-C4' energy: -101.725 flat angles P-C4'-P energy: -72.025 tors. eta vs tors. theta energy: -63.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -753.528851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.528851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.528851 (E_RNA) where: Base-Base interactions energy: -358.656 where: short stacking energy: -192.157 Base-Backbone interact. energy: -6.516 local terms energy: -388.356252 where: bonds (distance) C4'-P energy: -98.560 bonds (distance) P-C4' energy: -124.757 flat angles C4'-P-C4' energy: -99.825 flat angles P-C4'-P energy: -65.587 tors. eta vs tors. theta energy: 0.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -574.361706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.361706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.361706 (E_RNA) where: Base-Base interactions energy: -234.986 where: short stacking energy: -175.507 Base-Backbone interact. energy: 4.286 local terms energy: -343.661348 where: bonds (distance) C4'-P energy: -110.757 bonds (distance) P-C4' energy: -111.239 flat angles C4'-P-C4' energy: -83.320 flat angles P-C4'-P energy: -52.800 tors. eta vs tors. theta energy: 14.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -467.714418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.714418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.714418 (E_RNA) where: Base-Base interactions energy: -159.522 where: short stacking energy: -114.816 Base-Backbone interact. energy: -2.648 local terms energy: -305.544748 where: bonds (distance) C4'-P energy: -87.205 bonds (distance) P-C4' energy: -116.354 flat angles C4'-P-C4' energy: -88.118 flat angles P-C4'-P energy: -49.632 tors. eta vs tors. theta energy: 35.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -2028.887800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2028.887800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2028.887800 (E_RNA) where: Base-Base interactions energy: -1372.967 where: short stacking energy: -596.757 Base-Backbone interact. energy: -0.855 local terms energy: -655.065987 where: bonds (distance) C4'-P energy: -122.290 bonds (distance) P-C4' energy: -119.714 flat angles C4'-P-C4' energy: -138.590 flat angles P-C4'-P energy: -97.064 tors. eta vs tors. theta energy: -177.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1873.479129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1873.479129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1873.479129 (E_RNA) where: Base-Base interactions energy: -1292.437 where: short stacking energy: -507.704 Base-Backbone interact. energy: -3.330 local terms energy: -577.711901 where: bonds (distance) C4'-P energy: -116.062 bonds (distance) P-C4' energy: -116.936 flat angles C4'-P-C4' energy: -136.225 flat angles P-C4'-P energy: -79.401 tors. eta vs tors. theta energy: -129.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1845.581468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.581468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.581468 (E_RNA) where: Base-Base interactions energy: -1227.741 where: short stacking energy: -517.278 Base-Backbone interact. energy: -0.796 local terms energy: -617.044847 where: bonds (distance) C4'-P energy: -122.073 bonds (distance) P-C4' energy: -122.074 flat angles C4'-P-C4' energy: -136.076 flat angles P-C4'-P energy: -84.611 tors. eta vs tors. theta energy: -152.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1547.450719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.450719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.450719 (E_RNA) where: Base-Base interactions energy: -1009.842 where: short stacking energy: -449.326 Base-Backbone interact. energy: -0.648 local terms energy: -536.960166 where: bonds (distance) C4'-P energy: -114.610 bonds (distance) P-C4' energy: -117.293 flat angles C4'-P-C4' energy: -127.689 flat angles P-C4'-P energy: -69.832 tors. eta vs tors. theta energy: -107.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1484.612163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.612163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.612163 (E_RNA) where: Base-Base interactions energy: -972.785 where: short stacking energy: -437.079 Base-Backbone interact. energy: -3.822 local terms energy: -508.005450 where: bonds (distance) C4'-P energy: -113.953 bonds (distance) P-C4' energy: -114.265 flat angles C4'-P-C4' energy: -104.426 flat angles P-C4'-P energy: -73.134 tors. eta vs tors. theta energy: -102.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1307.062581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.062581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.062581 (E_RNA) where: Base-Base interactions energy: -838.605 where: short stacking energy: -376.542 Base-Backbone interact. energy: 0.666 local terms energy: -469.123497 where: bonds (distance) C4'-P energy: -109.714 bonds (distance) P-C4' energy: -117.998 flat angles C4'-P-C4' energy: -83.633 flat angles P-C4'-P energy: -67.066 tors. eta vs tors. theta energy: -90.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1037.701204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.701204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.701204 (E_RNA) where: Base-Base interactions energy: -615.803 where: short stacking energy: -294.156 Base-Backbone interact. energy: -3.507 local terms energy: -418.390996 where: bonds (distance) C4'-P energy: -94.315 bonds (distance) P-C4' energy: -114.617 flat angles C4'-P-C4' energy: -100.313 flat angles P-C4'-P energy: -67.075 tors. eta vs tors. theta energy: -42.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -726.141589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.141589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.141589 (E_RNA) where: Base-Base interactions energy: -348.961 where: short stacking energy: -208.120 Base-Backbone interact. energy: -1.448 local terms energy: -375.732337 where: bonds (distance) C4'-P energy: -108.329 bonds (distance) P-C4' energy: -106.364 flat angles C4'-P-C4' energy: -83.289 flat angles P-C4'-P energy: -52.011 tors. eta vs tors. theta energy: -25.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -556.912996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.912996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.912996 (E_RNA) where: Base-Base interactions energy: -238.306 where: short stacking energy: -156.169 Base-Backbone interact. energy: 1.196 local terms energy: -319.802359 where: bonds (distance) C4'-P energy: -88.843 bonds (distance) P-C4' energy: -94.024 flat angles C4'-P-C4' energy: -90.690 flat angles P-C4'-P energy: -49.763 tors. eta vs tors. theta energy: 3.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -468.315477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.315477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.315477 (E_RNA) where: Base-Base interactions energy: -204.493 where: short stacking energy: -132.020 Base-Backbone interact. energy: 1.151 local terms energy: -264.973318 where: bonds (distance) C4'-P energy: -76.436 bonds (distance) P-C4' energy: -114.362 flat angles C4'-P-C4' energy: -75.140 flat angles P-C4'-P energy: -34.995 tors. eta vs tors. theta energy: 35.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -2036.990234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2036.990234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2036.990234 (E_RNA) where: Base-Base interactions energy: -1373.088 where: short stacking energy: -591.285 Base-Backbone interact. energy: 1.157 local terms energy: -665.058825 where: bonds (distance) C4'-P energy: -122.788 bonds (distance) P-C4' energy: -132.495 flat angles C4'-P-C4' energy: -143.163 flat angles P-C4'-P energy: -91.762 tors. eta vs tors. theta energy: -174.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1874.793591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1874.793591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1874.793591 (E_RNA) where: Base-Base interactions energy: -1289.749 where: short stacking energy: -516.982 Base-Backbone interact. energy: -5.535 local terms energy: -579.510047 where: bonds (distance) C4'-P energy: -114.056 bonds (distance) P-C4' energy: -129.666 flat angles C4'-P-C4' energy: -119.053 flat angles P-C4'-P energy: -85.948 tors. eta vs tors. theta energy: -130.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1824.762785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.762785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.762785 (E_RNA) where: Base-Base interactions energy: -1216.078 where: short stacking energy: -533.427 Base-Backbone interact. energy: -4.741 local terms energy: -603.944088 where: bonds (distance) C4'-P energy: -120.873 bonds (distance) P-C4' energy: -111.731 flat angles C4'-P-C4' energy: -134.978 flat angles P-C4'-P energy: -76.540 tors. eta vs tors. theta energy: -159.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1578.233307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.233307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.233307 (E_RNA) where: Base-Base interactions energy: -1038.992 where: short stacking energy: -474.092 Base-Backbone interact. energy: -2.751 local terms energy: -536.490038 where: bonds (distance) C4'-P energy: -105.550 bonds (distance) P-C4' energy: -112.809 flat angles C4'-P-C4' energy: -118.158 flat angles P-C4'-P energy: -84.124 tors. eta vs tors. theta energy: -115.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1411.561695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.561695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.561695 (E_RNA) where: Base-Base interactions energy: -885.551 where: short stacking energy: -392.449 Base-Backbone interact. energy: -2.756 local terms energy: -523.253874 where: bonds (distance) C4'-P energy: -117.895 bonds (distance) P-C4' energy: -110.998 flat angles C4'-P-C4' energy: -120.077 flat angles P-C4'-P energy: -79.919 tors. eta vs tors. theta energy: -94.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1393.458357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.458357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.458357 (E_RNA) where: Base-Base interactions energy: -875.813 where: short stacking energy: -420.043 Base-Backbone interact. energy: -0.759 local terms energy: -516.886521 where: bonds (distance) C4'-P energy: -87.405 bonds (distance) P-C4' energy: -113.050 flat angles C4'-P-C4' energy: -133.520 flat angles P-C4'-P energy: -71.916 tors. eta vs tors. theta energy: -110.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1060.820387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.820387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.820387 (E_RNA) where: Base-Base interactions energy: -602.518 where: short stacking energy: -307.202 Base-Backbone interact. energy: 0.265 local terms energy: -458.567248 where: bonds (distance) C4'-P energy: -101.156 bonds (distance) P-C4' energy: -109.742 flat angles C4'-P-C4' energy: -115.686 flat angles P-C4'-P energy: -73.020 tors. eta vs tors. theta energy: -58.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -758.405548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.405548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.405548 (E_RNA) where: Base-Base interactions energy: -383.775 where: short stacking energy: -215.932 Base-Backbone interact. energy: 4.220 local terms energy: -378.850168 where: bonds (distance) C4'-P energy: -109.339 bonds (distance) P-C4' energy: -102.957 flat angles C4'-P-C4' energy: -106.084 flat angles P-C4'-P energy: -51.136 tors. eta vs tors. theta energy: -9.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -553.678543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.678543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.678543 (E_RNA) where: Base-Base interactions energy: -221.065 where: short stacking energy: -151.021 Base-Backbone interact. energy: -1.446 local terms energy: -331.167777 where: bonds (distance) C4'-P energy: -108.174 bonds (distance) P-C4' energy: -77.858 flat angles C4'-P-C4' energy: -89.348 flat angles P-C4'-P energy: -58.924 tors. eta vs tors. theta energy: 3.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -493.215214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.215214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.215214 (E_RNA) where: Base-Base interactions energy: -167.790 where: short stacking energy: -134.883 Base-Backbone interact. energy: 1.480 local terms energy: -326.904627 where: bonds (distance) C4'-P energy: -99.014 bonds (distance) P-C4' energy: -110.506 flat angles C4'-P-C4' energy: -103.190 flat angles P-C4'-P energy: -41.963 tors. eta vs tors. theta energy: 27.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -2022.026772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2022.026772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2022.026772 (E_RNA) where: Base-Base interactions energy: -1361.585 where: short stacking energy: -585.182 Base-Backbone interact. energy: -0.955 local terms energy: -659.487151 where: bonds (distance) C4'-P energy: -126.073 bonds (distance) P-C4' energy: -119.898 flat angles C4'-P-C4' energy: -136.436 flat angles P-C4'-P energy: -102.225 tors. eta vs tors. theta energy: -174.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1875.707806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.707806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.707806 (E_RNA) where: Base-Base interactions energy: -1280.783 where: short stacking energy: -529.027 Base-Backbone interact. energy: -0.577 local terms energy: -594.348227 where: bonds (distance) C4'-P energy: -120.873 bonds (distance) P-C4' energy: -124.382 flat angles C4'-P-C4' energy: -140.831 flat angles P-C4'-P energy: -74.902 tors. eta vs tors. theta energy: -133.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1863.458693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1863.458693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1863.458693 (E_RNA) where: Base-Base interactions energy: -1244.853 where: short stacking energy: -536.607 Base-Backbone interact. energy: -1.269 local terms energy: -617.336767 where: bonds (distance) C4'-P energy: -111.866 bonds (distance) P-C4' energy: -122.032 flat angles C4'-P-C4' energy: -128.399 flat angles P-C4'-P energy: -88.032 tors. eta vs tors. theta energy: -167.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1619.866050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.866050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.866050 (E_RNA) where: Base-Base interactions energy: -1064.825 where: short stacking energy: -455.542 Base-Backbone interact. energy: 5.217 local terms energy: -560.257670 where: bonds (distance) C4'-P energy: -108.169 bonds (distance) P-C4' energy: -117.694 flat angles C4'-P-C4' energy: -124.043 flat angles P-C4'-P energy: -92.694 tors. eta vs tors. theta energy: -117.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1469.867663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.867663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.867663 (E_RNA) where: Base-Base interactions energy: -952.803 where: short stacking energy: -423.743 Base-Backbone interact. energy: -1.403 local terms energy: -515.661816 where: bonds (distance) C4'-P energy: -102.506 bonds (distance) P-C4' energy: -119.627 flat angles C4'-P-C4' energy: -120.445 flat angles P-C4'-P energy: -69.495 tors. eta vs tors. theta energy: -103.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1300.504281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.504281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.504281 (E_RNA) where: Base-Base interactions energy: -818.034 where: short stacking energy: -364.471 Base-Backbone interact. energy: 1.270 local terms energy: -483.739787 where: bonds (distance) C4'-P energy: -103.417 bonds (distance) P-C4' energy: -123.529 flat angles C4'-P-C4' energy: -118.616 flat angles P-C4'-P energy: -58.908 tors. eta vs tors. theta energy: -79.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1040.395897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.395897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.395897 (E_RNA) where: Base-Base interactions energy: -619.823 where: short stacking energy: -299.245 Base-Backbone interact. energy: -0.988 local terms energy: -419.584907 where: bonds (distance) C4'-P energy: -94.320 bonds (distance) P-C4' energy: -98.760 flat angles C4'-P-C4' energy: -98.731 flat angles P-C4'-P energy: -59.650 tors. eta vs tors. theta energy: -68.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -767.877941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.877941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.877941 (E_RNA) where: Base-Base interactions energy: -362.978 where: short stacking energy: -225.163 Base-Backbone interact. energy: -1.964 local terms energy: -402.935791 where: bonds (distance) C4'-P energy: -103.579 bonds (distance) P-C4' energy: -115.161 flat angles C4'-P-C4' energy: -102.121 flat angles P-C4'-P energy: -53.198 tors. eta vs tors. theta energy: -28.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -536.766600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.766600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.766600 (E_RNA) where: Base-Base interactions energy: -213.668 where: short stacking energy: -181.192 Base-Backbone interact. energy: -2.717 local terms energy: -320.382207 where: bonds (distance) C4'-P energy: -93.151 bonds (distance) P-C4' energy: -101.670 flat angles C4'-P-C4' energy: -82.680 flat angles P-C4'-P energy: -53.804 tors. eta vs tors. theta energy: 10.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -488.440567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.440567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.440567 (E_RNA) where: Base-Base interactions energy: -163.385 where: short stacking energy: -126.552 Base-Backbone interact. energy: 0.470 local terms energy: -325.525033 where: bonds (distance) C4'-P energy: -92.888 bonds (distance) P-C4' energy: -112.959 flat angles C4'-P-C4' energy: -82.924 flat angles P-C4'-P energy: -54.612 tors. eta vs tors. theta energy: 17.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1998.046175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1998.046175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1998.046175 (E_RNA) where: Base-Base interactions energy: -1348.395 where: short stacking energy: -573.601 Base-Backbone interact. energy: 2.477 local terms energy: -652.128451 where: bonds (distance) C4'-P energy: -122.596 bonds (distance) P-C4' energy: -123.894 flat angles C4'-P-C4' energy: -138.410 flat angles P-C4'-P energy: -101.844 tors. eta vs tors. theta energy: -165.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1877.167043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1877.167043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1877.167043 (E_RNA) where: Base-Base interactions energy: -1266.617 where: short stacking energy: -547.459 Base-Backbone interact. energy: -1.759 local terms energy: -608.790398 where: bonds (distance) C4'-P energy: -109.272 bonds (distance) P-C4' energy: -122.376 flat angles C4'-P-C4' energy: -133.240 flat angles P-C4'-P energy: -80.534 tors. eta vs tors. theta energy: -163.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1825.815070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1825.815070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1825.815070 (E_RNA) where: Base-Base interactions energy: -1242.113 where: short stacking energy: -516.712 Base-Backbone interact. energy: -1.796 local terms energy: -581.905837 where: bonds (distance) C4'-P energy: -109.655 bonds (distance) P-C4' energy: -117.211 flat angles C4'-P-C4' energy: -123.377 flat angles P-C4'-P energy: -87.839 tors. eta vs tors. theta energy: -143.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1624.665508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.665508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.665508 (E_RNA) where: Base-Base interactions energy: -1073.177 where: short stacking energy: -441.514 Base-Backbone interact. energy: -3.107 local terms energy: -548.381928 where: bonds (distance) C4'-P energy: -115.637 bonds (distance) P-C4' energy: -124.451 flat angles C4'-P-C4' energy: -127.705 flat angles P-C4'-P energy: -65.026 tors. eta vs tors. theta energy: -115.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1568.770613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.770613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.770613 (E_RNA) where: Base-Base interactions energy: -1013.760 where: short stacking energy: -469.558 Base-Backbone interact. energy: 1.695 local terms energy: -556.705572 where: bonds (distance) C4'-P energy: -112.591 bonds (distance) P-C4' energy: -105.337 flat angles C4'-P-C4' energy: -126.907 flat angles P-C4'-P energy: -83.110 tors. eta vs tors. theta energy: -128.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1252.571678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.571678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.571678 (E_RNA) where: Base-Base interactions energy: -773.295 where: short stacking energy: -346.800 Base-Backbone interact. energy: 1.828 local terms energy: -481.104290 where: bonds (distance) C4'-P energy: -103.899 bonds (distance) P-C4' energy: -109.124 flat angles C4'-P-C4' energy: -126.751 flat angles P-C4'-P energy: -65.667 tors. eta vs tors. theta energy: -75.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1010.136766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.136766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.136766 (E_RNA) where: Base-Base interactions energy: -582.630 where: short stacking energy: -286.165 Base-Backbone interact. energy: 5.683 local terms energy: -433.190063 where: bonds (distance) C4'-P energy: -108.901 bonds (distance) P-C4' energy: -106.518 flat angles C4'-P-C4' energy: -102.092 flat angles P-C4'-P energy: -74.618 tors. eta vs tors. theta energy: -41.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -778.148198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.148198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.148198 (E_RNA) where: Base-Base interactions energy: -402.200 where: short stacking energy: -204.452 Base-Backbone interact. energy: 1.021 local terms energy: -376.968465 where: bonds (distance) C4'-P energy: -114.308 bonds (distance) P-C4' energy: -98.355 flat angles C4'-P-C4' energy: -96.999 flat angles P-C4'-P energy: -63.390 tors. eta vs tors. theta energy: -3.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -520.435635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.435635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.435635 (E_RNA) where: Base-Base interactions energy: -171.670 where: short stacking energy: -145.188 Base-Backbone interact. energy: 0.645 local terms energy: -349.410965 where: bonds (distance) C4'-P energy: -98.379 bonds (distance) P-C4' energy: -114.157 flat angles C4'-P-C4' energy: -91.743 flat angles P-C4'-P energy: -54.175 tors. eta vs tors. theta energy: 9.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -451.233154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.233154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.233154 (E_RNA) where: Base-Base interactions energy: -178.148 where: short stacking energy: -133.843 Base-Backbone interact. energy: 6.570 local terms energy: -279.655286 where: bonds (distance) C4'-P energy: -93.393 bonds (distance) P-C4' energy: -105.888 flat angles C4'-P-C4' energy: -61.426 flat angles P-C4'-P energy: -47.067 tors. eta vs tors. theta energy: 28.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -2024.405307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.405307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.405307 (E_RNA) where: Base-Base interactions energy: -1371.418 where: short stacking energy: -559.864 Base-Backbone interact. energy: -1.122 local terms energy: -651.864968 where: bonds (distance) C4'-P energy: -129.298 bonds (distance) P-C4' energy: -119.043 flat angles C4'-P-C4' energy: -142.540 flat angles P-C4'-P energy: -95.275 tors. eta vs tors. theta energy: -165.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1885.813607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.813607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.813607 (E_RNA) where: Base-Base interactions energy: -1258.040 where: short stacking energy: -537.162 Base-Backbone interact. energy: 0.361 local terms energy: -628.134625 where: bonds (distance) C4'-P energy: -130.380 bonds (distance) P-C4' energy: -116.905 flat angles C4'-P-C4' energy: -125.394 flat angles P-C4'-P energy: -92.027 tors. eta vs tors. theta energy: -163.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1871.858038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.858038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.858038 (E_RNA) where: Base-Base interactions energy: -1245.859 where: short stacking energy: -524.334 Base-Backbone interact. energy: -1.729 local terms energy: -624.269913 where: bonds (distance) C4'-P energy: -105.554 bonds (distance) P-C4' energy: -124.168 flat angles C4'-P-C4' energy: -139.714 flat angles P-C4'-P energy: -100.363 tors. eta vs tors. theta energy: -154.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1572.079272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.079272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.079272 (E_RNA) where: Base-Base interactions energy: -1039.053 where: short stacking energy: -469.649 Base-Backbone interact. energy: 2.832 local terms energy: -535.858345 where: bonds (distance) C4'-P energy: -108.086 bonds (distance) P-C4' energy: -113.745 flat angles C4'-P-C4' energy: -116.444 flat angles P-C4'-P energy: -80.175 tors. eta vs tors. theta energy: -117.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1512.653121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.653121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.653121 (E_RNA) where: Base-Base interactions energy: -995.842 where: short stacking energy: -414.403 Base-Backbone interact. energy: 0.067 local terms energy: -516.877472 where: bonds (distance) C4'-P energy: -117.246 bonds (distance) P-C4' energy: -101.443 flat angles C4'-P-C4' energy: -124.389 flat angles P-C4'-P energy: -75.835 tors. eta vs tors. theta energy: -97.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1231.740807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.740807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.740807 (E_RNA) where: Base-Base interactions energy: -756.983 where: short stacking energy: -340.782 Base-Backbone interact. energy: -1.793 local terms energy: -472.964842 where: bonds (distance) C4'-P energy: -96.853 bonds (distance) P-C4' energy: -100.114 flat angles C4'-P-C4' energy: -121.082 flat angles P-C4'-P energy: -77.334 tors. eta vs tors. theta energy: -77.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -978.604811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.604811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.604811 (E_RNA) where: Base-Base interactions energy: -575.974 where: short stacking energy: -291.288 Base-Backbone interact. energy: -0.591 local terms energy: -402.039277 where: bonds (distance) C4'-P energy: -105.910 bonds (distance) P-C4' energy: -109.117 flat angles C4'-P-C4' energy: -89.115 flat angles P-C4'-P energy: -52.323 tors. eta vs tors. theta energy: -45.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -813.517965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.517965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.517965 (E_RNA) where: Base-Base interactions energy: -418.254 where: short stacking energy: -220.180 Base-Backbone interact. energy: -4.463 local terms energy: -390.800432 where: bonds (distance) C4'-P energy: -98.372 bonds (distance) P-C4' energy: -112.089 flat angles C4'-P-C4' energy: -108.630 flat angles P-C4'-P energy: -58.478 tors. eta vs tors. theta energy: -13.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -548.054179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.054179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.054179 (E_RNA) where: Base-Base interactions energy: -211.748 where: short stacking energy: -169.796 Base-Backbone interact. energy: -1.083 local terms energy: -335.222472 where: bonds (distance) C4'-P energy: -102.598 bonds (distance) P-C4' energy: -100.378 flat angles C4'-P-C4' energy: -90.440 flat angles P-C4'-P energy: -45.375 tors. eta vs tors. theta energy: 3.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -481.866499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.866499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.866499 (E_RNA) where: Base-Base interactions energy: -180.751 where: short stacking energy: -139.461 Base-Backbone interact. energy: -1.254 local terms energy: -299.861404 where: bonds (distance) C4'-P energy: -106.753 bonds (distance) P-C4' energy: -106.119 flat angles C4'-P-C4' energy: -60.363 flat angles P-C4'-P energy: -56.713 tors. eta vs tors. theta energy: 30.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -2015.626739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.626739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.626739 (E_RNA) where: Base-Base interactions energy: -1371.328 where: short stacking energy: -581.842 Base-Backbone interact. energy: -2.284 local terms energy: -642.015317 where: bonds (distance) C4'-P energy: -123.823 bonds (distance) P-C4' energy: -126.520 flat angles C4'-P-C4' energy: -132.636 flat angles P-C4'-P energy: -88.351 tors. eta vs tors. theta energy: -170.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1917.757644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1917.757644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.757644 (E_RNA) where: Base-Base interactions energy: -1298.557 where: short stacking energy: -553.774 Base-Backbone interact. energy: 1.885 local terms energy: -621.085216 where: bonds (distance) C4'-P energy: -101.776 bonds (distance) P-C4' energy: -124.238 flat angles C4'-P-C4' energy: -133.117 flat angles P-C4'-P energy: -94.581 tors. eta vs tors. theta energy: -167.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1822.428168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1822.428168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1822.428168 (E_RNA) where: Base-Base interactions energy: -1260.997 where: short stacking energy: -531.511 Base-Backbone interact. energy: 0.757 local terms energy: -562.187606 where: bonds (distance) C4'-P energy: -110.765 bonds (distance) P-C4' energy: -114.898 flat angles C4'-P-C4' energy: -117.031 flat angles P-C4'-P energy: -78.334 tors. eta vs tors. theta energy: -141.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1594.853807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.853807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.853807 (E_RNA) where: Base-Base interactions energy: -1046.673 where: short stacking energy: -450.131 Base-Backbone interact. energy: 1.058 local terms energy: -549.238183 where: bonds (distance) C4'-P energy: -117.921 bonds (distance) P-C4' energy: -110.825 flat angles C4'-P-C4' energy: -124.017 flat angles P-C4'-P energy: -87.038 tors. eta vs tors. theta energy: -109.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1549.583575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.583575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.583575 (E_RNA) where: Base-Base interactions energy: -1014.795 where: short stacking energy: -464.037 Base-Backbone interact. energy: 3.951 local terms energy: -538.739351 where: bonds (distance) C4'-P energy: -106.269 bonds (distance) P-C4' energy: -116.863 flat angles C4'-P-C4' energy: -124.200 flat angles P-C4'-P energy: -72.928 tors. eta vs tors. theta energy: -118.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1291.856009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.856009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.856009 (E_RNA) where: Base-Base interactions energy: -791.502 where: short stacking energy: -349.803 Base-Backbone interact. energy: -0.500 local terms energy: -499.853542 where: bonds (distance) C4'-P energy: -103.192 bonds (distance) P-C4' energy: -112.431 flat angles C4'-P-C4' energy: -119.637 flat angles P-C4'-P energy: -79.332 tors. eta vs tors. theta energy: -85.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1063.254339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.254339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.254339 (E_RNA) where: Base-Base interactions energy: -637.004 where: short stacking energy: -311.123 Base-Backbone interact. energy: -0.374 local terms energy: -425.876418 where: bonds (distance) C4'-P energy: -98.836 bonds (distance) P-C4' energy: -114.564 flat angles C4'-P-C4' energy: -94.866 flat angles P-C4'-P energy: -64.630 tors. eta vs tors. theta energy: -52.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -804.426404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.426404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.426404 (E_RNA) where: Base-Base interactions energy: -440.533 where: short stacking energy: -233.551 Base-Backbone interact. energy: -1.804 local terms energy: -362.089251 where: bonds (distance) C4'-P energy: -103.080 bonds (distance) P-C4' energy: -92.275 flat angles C4'-P-C4' energy: -94.298 flat angles P-C4'-P energy: -49.582 tors. eta vs tors. theta energy: -22.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -527.380516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.380516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.380516 (E_RNA) where: Base-Base interactions energy: -178.134 where: short stacking energy: -122.676 Base-Backbone interact. energy: 0.970 local terms energy: -350.216472 where: bonds (distance) C4'-P energy: -122.719 bonds (distance) P-C4' energy: -112.968 flat angles C4'-P-C4' energy: -101.346 flat angles P-C4'-P energy: -45.063 tors. eta vs tors. theta energy: 31.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -477.527381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.527381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.527381 (E_RNA) where: Base-Base interactions energy: -173.182 where: short stacking energy: -118.122 Base-Backbone interact. energy: 3.138 local terms energy: -307.483869 where: bonds (distance) C4'-P energy: -106.982 bonds (distance) P-C4' energy: -113.486 flat angles C4'-P-C4' energy: -74.759 flat angles P-C4'-P energy: -45.363 tors. eta vs tors. theta energy: 33.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -2037.342945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2037.342945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2037.342945 (E_RNA) where: Base-Base interactions energy: -1384.062 where: short stacking energy: -584.488 Base-Backbone interact. energy: 2.888 local terms energy: -656.168940 where: bonds (distance) C4'-P energy: -133.469 bonds (distance) P-C4' energy: -107.576 flat angles C4'-P-C4' energy: -136.530 flat angles P-C4'-P energy: -101.105 tors. eta vs tors. theta energy: -177.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1959.505433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.505433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.505433 (E_RNA) where: Base-Base interactions energy: -1313.122 where: short stacking energy: -600.804 Base-Backbone interact. energy: 1.662 local terms energy: -648.045397 where: bonds (distance) C4'-P energy: -124.306 bonds (distance) P-C4' energy: -119.394 flat angles C4'-P-C4' energy: -132.268 flat angles P-C4'-P energy: -83.706 tors. eta vs tors. theta energy: -188.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1824.931910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.931910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.931910 (E_RNA) where: Base-Base interactions energy: -1235.252 where: short stacking energy: -537.114 Base-Backbone interact. energy: 1.197 local terms energy: -590.876279 where: bonds (distance) C4'-P energy: -104.864 bonds (distance) P-C4' energy: -120.016 flat angles C4'-P-C4' energy: -135.161 flat angles P-C4'-P energy: -87.001 tors. eta vs tors. theta energy: -143.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1601.445568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.445568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.445568 (E_RNA) where: Base-Base interactions energy: -1036.884 where: short stacking energy: -467.653 Base-Backbone interact. energy: 0.995 local terms energy: -565.556039 where: bonds (distance) C4'-P energy: -100.342 bonds (distance) P-C4' energy: -120.779 flat angles C4'-P-C4' energy: -129.805 flat angles P-C4'-P energy: -91.677 tors. eta vs tors. theta energy: -122.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1540.390861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.390861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.390861 (E_RNA) where: Base-Base interactions energy: -1015.593 where: short stacking energy: -442.759 Base-Backbone interact. energy: -1.549 local terms energy: -523.248851 where: bonds (distance) C4'-P energy: -105.454 bonds (distance) P-C4' energy: -118.470 flat angles C4'-P-C4' energy: -110.441 flat angles P-C4'-P energy: -83.659 tors. eta vs tors. theta energy: -105.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1219.546729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.546729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.546729 (E_RNA) where: Base-Base interactions energy: -780.061 where: short stacking energy: -370.984 Base-Backbone interact. energy: 0.839 local terms energy: -440.324618 where: bonds (distance) C4'-P energy: -96.038 bonds (distance) P-C4' energy: -109.040 flat angles C4'-P-C4' energy: -105.559 flat angles P-C4'-P energy: -43.727 tors. eta vs tors. theta energy: -85.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1089.447832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.447832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.447832 (E_RNA) where: Base-Base interactions energy: -640.008 where: short stacking energy: -317.047 Base-Backbone interact. energy: -0.510 local terms energy: -448.929596 where: bonds (distance) C4'-P energy: -111.141 bonds (distance) P-C4' energy: -105.025 flat angles C4'-P-C4' energy: -100.070 flat angles P-C4'-P energy: -64.821 tors. eta vs tors. theta energy: -67.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -825.263769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.263769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.263769 (E_RNA) where: Base-Base interactions energy: -439.550 where: short stacking energy: -231.346 Base-Backbone interact. energy: -0.356 local terms energy: -385.357688 where: bonds (distance) C4'-P energy: -100.729 bonds (distance) P-C4' energy: -99.708 flat angles C4'-P-C4' energy: -102.245 flat angles P-C4'-P energy: -63.438 tors. eta vs tors. theta energy: -19.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -508.291218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.291218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.291218 (E_RNA) where: Base-Base interactions energy: -151.572 where: short stacking energy: -137.116 Base-Backbone interact. energy: -0.850 local terms energy: -355.870109 where: bonds (distance) C4'-P energy: -106.665 bonds (distance) P-C4' energy: -119.550 flat angles C4'-P-C4' energy: -99.195 flat angles P-C4'-P energy: -44.439 tors. eta vs tors. theta energy: 13.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -532.656147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.656147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.656147 (E_RNA) where: Base-Base interactions energy: -215.503 where: short stacking energy: -147.507 Base-Backbone interact. energy: -1.493 local terms energy: -315.660821 where: bonds (distance) C4'-P energy: -91.285 bonds (distance) P-C4' energy: -96.286 flat angles C4'-P-C4' energy: -85.793 flat angles P-C4'-P energy: -47.071 tors. eta vs tors. theta energy: 4.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -2040.227771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2040.227771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2040.227771 (E_RNA) where: Base-Base interactions energy: -1365.358 where: short stacking energy: -589.588 Base-Backbone interact. energy: -0.769 local terms energy: -674.100570 where: bonds (distance) C4'-P energy: -123.382 bonds (distance) P-C4' energy: -126.991 flat angles C4'-P-C4' energy: -148.592 flat angles P-C4'-P energy: -94.116 tors. eta vs tors. theta energy: -181.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1936.595684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.595684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.595684 (E_RNA) where: Base-Base interactions energy: -1315.610 where: short stacking energy: -564.660 Base-Backbone interact. energy: -3.934 local terms energy: -617.051753 where: bonds (distance) C4'-P energy: -121.058 bonds (distance) P-C4' energy: -123.998 flat angles C4'-P-C4' energy: -134.542 flat angles P-C4'-P energy: -80.968 tors. eta vs tors. theta energy: -156.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1794.932320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1794.932320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1794.932320 (E_RNA) where: Base-Base interactions energy: -1197.098 where: short stacking energy: -495.850 Base-Backbone interact. energy: -4.350 local terms energy: -593.484869 where: bonds (distance) C4'-P energy: -124.351 bonds (distance) P-C4' energy: -117.738 flat angles C4'-P-C4' energy: -126.710 flat angles P-C4'-P energy: -76.114 tors. eta vs tors. theta energy: -148.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1614.259130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.259130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.259130 (E_RNA) where: Base-Base interactions energy: -1028.860 where: short stacking energy: -441.232 Base-Backbone interact. energy: -3.634 local terms energy: -581.764825 where: bonds (distance) C4'-P energy: -122.300 bonds (distance) P-C4' energy: -131.393 flat angles C4'-P-C4' energy: -122.396 flat angles P-C4'-P energy: -75.336 tors. eta vs tors. theta energy: -130.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1533.809792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.809792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.809792 (E_RNA) where: Base-Base interactions energy: -1011.522 where: short stacking energy: -430.723 Base-Backbone interact. energy: 7.446 local terms energy: -529.734545 where: bonds (distance) C4'-P energy: -110.518 bonds (distance) P-C4' energy: -106.133 flat angles C4'-P-C4' energy: -122.385 flat angles P-C4'-P energy: -80.608 tors. eta vs tors. theta energy: -110.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1152.456497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.456497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.456497 (E_RNA) where: Base-Base interactions energy: -704.158 where: short stacking energy: -339.909 Base-Backbone interact. energy: 3.309 local terms energy: -451.607411 where: bonds (distance) C4'-P energy: -102.345 bonds (distance) P-C4' energy: -109.657 flat angles C4'-P-C4' energy: -108.980 flat angles P-C4'-P energy: -74.197 tors. eta vs tors. theta energy: -56.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1053.861674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.861674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.861674 (E_RNA) where: Base-Base interactions energy: -621.429 where: short stacking energy: -297.433 Base-Backbone interact. energy: -2.303 local terms energy: -430.129334 where: bonds (distance) C4'-P energy: -114.635 bonds (distance) P-C4' energy: -110.653 flat angles C4'-P-C4' energy: -101.874 flat angles P-C4'-P energy: -56.368 tors. eta vs tors. theta energy: -46.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -802.212717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.212717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.212717 (E_RNA) where: Base-Base interactions energy: -428.179 where: short stacking energy: -249.412 Base-Backbone interact. energy: 0.264 local terms energy: -374.297954 where: bonds (distance) C4'-P energy: -80.272 bonds (distance) P-C4' energy: -104.610 flat angles C4'-P-C4' energy: -109.795 flat angles P-C4'-P energy: -45.980 tors. eta vs tors. theta energy: -33.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -551.936665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.936665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.936665 (E_RNA) where: Base-Base interactions energy: -231.833 where: short stacking energy: -164.651 Base-Backbone interact. energy: -1.072 local terms energy: -319.031869 where: bonds (distance) C4'-P energy: -109.755 bonds (distance) P-C4' energy: -99.111 flat angles C4'-P-C4' energy: -86.899 flat angles P-C4'-P energy: -44.377 tors. eta vs tors. theta energy: 21.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -507.109099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.109099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.109099 (E_RNA) where: Base-Base interactions energy: -175.379 where: short stacking energy: -129.479 Base-Backbone interact. energy: 0.248 local terms energy: -331.978544 where: bonds (distance) C4'-P energy: -81.175 bonds (distance) P-C4' energy: -122.976 flat angles C4'-P-C4' energy: -92.146 flat angles P-C4'-P energy: -57.423 tors. eta vs tors. theta energy: 21.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -2056.078431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2056.078431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2056.078431 (E_RNA) where: Base-Base interactions energy: -1396.873 where: short stacking energy: -603.195 Base-Backbone interact. energy: -0.305 local terms energy: -658.900550 where: bonds (distance) C4'-P energy: -129.321 bonds (distance) P-C4' energy: -125.342 flat angles C4'-P-C4' energy: -133.555 flat angles P-C4'-P energy: -90.763 tors. eta vs tors. theta energy: -179.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1951.607023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1951.607023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1951.607023 (E_RNA) where: Base-Base interactions energy: -1287.572 where: short stacking energy: -566.259 Base-Backbone interact. energy: -4.822 local terms energy: -659.212460 where: bonds (distance) C4'-P energy: -121.827 bonds (distance) P-C4' energy: -122.181 flat angles C4'-P-C4' energy: -139.281 flat angles P-C4'-P energy: -96.313 tors. eta vs tors. theta energy: -179.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1827.683581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.683581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.683581 (E_RNA) where: Base-Base interactions energy: -1239.893 where: short stacking energy: -537.130 Base-Backbone interact. energy: -0.462 local terms energy: -587.328544 where: bonds (distance) C4'-P energy: -113.088 bonds (distance) P-C4' energy: -106.940 flat angles C4'-P-C4' energy: -120.481 flat angles P-C4'-P energy: -95.995 tors. eta vs tors. theta energy: -150.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1631.264514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.264514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.264514 (E_RNA) where: Base-Base interactions energy: -1084.231 where: short stacking energy: -499.176 Base-Backbone interact. energy: 1.016 local terms energy: -548.049590 where: bonds (distance) C4'-P energy: -110.186 bonds (distance) P-C4' energy: -102.816 flat angles C4'-P-C4' energy: -134.328 flat angles P-C4'-P energy: -66.948 tors. eta vs tors. theta energy: -133.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1453.632840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.632840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.632840 (E_RNA) where: Base-Base interactions energy: -913.377 where: short stacking energy: -388.010 Base-Backbone interact. energy: -2.525 local terms energy: -537.731096 where: bonds (distance) C4'-P energy: -117.593 bonds (distance) P-C4' energy: -116.502 flat angles C4'-P-C4' energy: -127.397 flat angles P-C4'-P energy: -72.838 tors. eta vs tors. theta energy: -103.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1169.197459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.197459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.197459 (E_RNA) where: Base-Base interactions energy: -724.831 where: short stacking energy: -368.569 Base-Backbone interact. energy: 0.215 local terms energy: -444.581744 where: bonds (distance) C4'-P energy: -93.096 bonds (distance) P-C4' energy: -103.383 flat angles C4'-P-C4' energy: -104.288 flat angles P-C4'-P energy: -73.903 tors. eta vs tors. theta energy: -69.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1103.179789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.179789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.179789 (E_RNA) where: Base-Base interactions energy: -663.802 where: short stacking energy: -307.021 Base-Backbone interact. energy: 2.645 local terms energy: -442.022603 where: bonds (distance) C4'-P energy: -106.093 bonds (distance) P-C4' energy: -109.183 flat angles C4'-P-C4' energy: -98.650 flat angles P-C4'-P energy: -67.778 tors. eta vs tors. theta energy: -60.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -838.670705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.670705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.670705 (E_RNA) where: Base-Base interactions energy: -432.816 where: short stacking energy: -227.469 Base-Backbone interact. energy: 0.235 local terms energy: -406.089802 where: bonds (distance) C4'-P energy: -86.135 bonds (distance) P-C4' energy: -107.146 flat angles C4'-P-C4' energy: -101.678 flat angles P-C4'-P energy: -72.883 tors. eta vs tors. theta energy: -38.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -600.390666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.390666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.390666 (E_RNA) where: Base-Base interactions energy: -256.538 where: short stacking energy: -194.791 Base-Backbone interact. energy: -1.297 local terms energy: -342.555769 where: bonds (distance) C4'-P energy: -102.134 bonds (distance) P-C4' energy: -95.104 flat angles C4'-P-C4' energy: -94.743 flat angles P-C4'-P energy: -51.449 tors. eta vs tors. theta energy: 0.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -519.653165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.653165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.653165 (E_RNA) where: Base-Base interactions energy: -196.534 where: short stacking energy: -134.757 Base-Backbone interact. energy: 1.786 local terms energy: -324.905554 where: bonds (distance) C4'-P energy: -97.609 bonds (distance) P-C4' energy: -90.628 flat angles C4'-P-C4' energy: -98.053 flat angles P-C4'-P energy: -57.836 tors. eta vs tors. theta energy: 19.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -2045.047341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2045.047341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2045.047341 (E_RNA) where: Base-Base interactions energy: -1401.184 where: short stacking energy: -583.367 Base-Backbone interact. energy: 3.508 local terms energy: -647.371426 where: bonds (distance) C4'-P energy: -108.001 bonds (distance) P-C4' energy: -127.719 flat angles C4'-P-C4' energy: -148.160 flat angles P-C4'-P energy: -94.663 tors. eta vs tors. theta energy: -168.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1920.832043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1920.832043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1920.832043 (E_RNA) where: Base-Base interactions energy: -1290.260 where: short stacking energy: -579.375 Base-Backbone interact. energy: 4.210 local terms energy: -634.782187 where: bonds (distance) C4'-P energy: -122.386 bonds (distance) P-C4' energy: -120.966 flat angles C4'-P-C4' energy: -135.252 flat angles P-C4'-P energy: -86.961 tors. eta vs tors. theta energy: -169.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1807.359463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1807.359463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.359463 (E_RNA) where: Base-Base interactions energy: -1204.310 where: short stacking energy: -513.928 Base-Backbone interact. energy: -2.982 local terms energy: -600.067757 where: bonds (distance) C4'-P energy: -122.812 bonds (distance) P-C4' energy: -109.323 flat angles C4'-P-C4' energy: -123.396 flat angles P-C4'-P energy: -92.466 tors. eta vs tors. theta energy: -152.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1580.410852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.410852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.410852 (E_RNA) where: Base-Base interactions energy: -999.797 where: short stacking energy: -432.574 Base-Backbone interact. energy: -3.077 local terms energy: -577.536869 where: bonds (distance) C4'-P energy: -111.653 bonds (distance) P-C4' energy: -129.217 flat angles C4'-P-C4' energy: -129.081 flat angles P-C4'-P energy: -88.404 tors. eta vs tors. theta energy: -119.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1488.244979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.244979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.244979 (E_RNA) where: Base-Base interactions energy: -957.639 where: short stacking energy: -401.239 Base-Backbone interact. energy: -3.979 local terms energy: -526.627093 where: bonds (distance) C4'-P energy: -109.273 bonds (distance) P-C4' energy: -118.017 flat angles C4'-P-C4' energy: -119.060 flat angles P-C4'-P energy: -79.017 tors. eta vs tors. theta energy: -101.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1179.435708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.435708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.435708 (E_RNA) where: Base-Base interactions energy: -679.674 where: short stacking energy: -325.272 Base-Backbone interact. energy: -0.193 local terms energy: -499.568774 where: bonds (distance) C4'-P energy: -113.147 bonds (distance) P-C4' energy: -120.408 flat angles C4'-P-C4' energy: -115.749 flat angles P-C4'-P energy: -75.621 tors. eta vs tors. theta energy: -74.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -983.246168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.246168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.246168 (E_RNA) where: Base-Base interactions energy: -546.887 where: short stacking energy: -279.332 Base-Backbone interact. energy: 3.794 local terms energy: -440.152400 where: bonds (distance) C4'-P energy: -92.477 bonds (distance) P-C4' energy: -111.843 flat angles C4'-P-C4' energy: -112.027 flat angles P-C4'-P energy: -64.456 tors. eta vs tors. theta energy: -59.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -811.155726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.155726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.155726 (E_RNA) where: Base-Base interactions energy: -449.017 where: short stacking energy: -254.332 Base-Backbone interact. energy: -2.438 local terms energy: -359.700835 where: bonds (distance) C4'-P energy: -94.711 bonds (distance) P-C4' energy: -99.492 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -42.984 tors. eta vs tors. theta energy: -14.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -586.136905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.136905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.136905 (E_RNA) where: Base-Base interactions energy: -268.638 where: short stacking energy: -197.854 Base-Backbone interact. energy: 5.398 local terms energy: -322.896871 where: bonds (distance) C4'-P energy: -95.712 bonds (distance) P-C4' energy: -82.047 flat angles C4'-P-C4' energy: -86.003 flat angles P-C4'-P energy: -55.194 tors. eta vs tors. theta energy: -3.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -563.244754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.244754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.244754 (E_RNA) where: Base-Base interactions energy: -219.986 where: short stacking energy: -150.128 Base-Backbone interact. energy: 0.073 local terms energy: -343.331898 where: bonds (distance) C4'-P energy: -106.744 bonds (distance) P-C4' energy: -99.813 flat angles C4'-P-C4' energy: -78.454 flat angles P-C4'-P energy: -71.569 tors. eta vs tors. theta energy: 13.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -2015.671471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.671471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.671471 (E_RNA) where: Base-Base interactions energy: -1362.200 where: short stacking energy: -577.326 Base-Backbone interact. energy: -2.165 local terms energy: -651.306519 where: bonds (distance) C4'-P energy: -124.314 bonds (distance) P-C4' energy: -119.149 flat angles C4'-P-C4' energy: -137.759 flat angles P-C4'-P energy: -92.597 tors. eta vs tors. theta energy: -177.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1914.992505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.992505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.992505 (E_RNA) where: Base-Base interactions energy: -1270.843 where: short stacking energy: -566.556 Base-Backbone interact. energy: -0.677 local terms energy: -643.472225 where: bonds (distance) C4'-P energy: -119.477 bonds (distance) P-C4' energy: -119.685 flat angles C4'-P-C4' energy: -143.492 flat angles P-C4'-P energy: -90.060 tors. eta vs tors. theta energy: -170.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1807.006468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1807.006468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.006468 (E_RNA) where: Base-Base interactions energy: -1193.113 where: short stacking energy: -510.024 Base-Backbone interact. energy: -2.114 local terms energy: -611.779442 where: bonds (distance) C4'-P energy: -100.677 bonds (distance) P-C4' energy: -142.649 flat angles C4'-P-C4' energy: -131.922 flat angles P-C4'-P energy: -89.381 tors. eta vs tors. theta energy: -147.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1593.960013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.960013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.960013 (E_RNA) where: Base-Base interactions energy: -1020.486 where: short stacking energy: -460.812 Base-Backbone interact. energy: 0.306 local terms energy: -573.780150 where: bonds (distance) C4'-P energy: -110.274 bonds (distance) P-C4' energy: -122.068 flat angles C4'-P-C4' energy: -130.160 flat angles P-C4'-P energy: -83.582 tors. eta vs tors. theta energy: -127.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -1523.786119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.786119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.786119 (E_RNA) where: Base-Base interactions energy: -964.745 where: short stacking energy: -427.437 Base-Backbone interact. energy: -2.219 local terms energy: -556.822282 where: bonds (distance) C4'-P energy: -112.818 bonds (distance) P-C4' energy: -116.729 flat angles C4'-P-C4' energy: -137.775 flat angles P-C4'-P energy: -64.965 tors. eta vs tors. theta energy: -124.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1102.267252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.267252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.267252 (E_RNA) where: Base-Base interactions energy: -673.764 where: short stacking energy: -316.563 Base-Backbone interact. energy: -2.044 local terms energy: -426.459730 where: bonds (distance) C4'-P energy: -91.644 bonds (distance) P-C4' energy: -117.449 flat angles C4'-P-C4' energy: -99.365 flat angles P-C4'-P energy: -62.853 tors. eta vs tors. theta energy: -55.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1024.880446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.880446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.880446 (E_RNA) where: Base-Base interactions energy: -587.699 where: short stacking energy: -296.096 Base-Backbone interact. energy: -3.695 local terms energy: -433.487209 where: bonds (distance) C4'-P energy: -125.666 bonds (distance) P-C4' energy: -107.353 flat angles C4'-P-C4' energy: -85.998 flat angles P-C4'-P energy: -55.039 tors. eta vs tors. theta energy: -59.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -797.828221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.828221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.828221 (E_RNA) where: Base-Base interactions energy: -421.261 where: short stacking energy: -220.872 Base-Backbone interact. energy: -2.169 local terms energy: -374.398356 where: bonds (distance) C4'-P energy: -87.879 bonds (distance) P-C4' energy: -107.525 flat angles C4'-P-C4' energy: -94.411 flat angles P-C4'-P energy: -63.960 tors. eta vs tors. theta energy: -20.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -578.552774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.552774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.552774 (E_RNA) where: Base-Base interactions energy: -255.217 where: short stacking energy: -144.327 Base-Backbone interact. energy: 0.355 local terms energy: -323.689992 where: bonds (distance) C4'-P energy: -92.889 bonds (distance) P-C4' energy: -108.463 flat angles C4'-P-C4' energy: -104.495 flat angles P-C4'-P energy: -49.943 tors. eta vs tors. theta energy: 32.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -535.447143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.447143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.447143 (E_RNA) where: Base-Base interactions energy: -205.176 where: short stacking energy: -131.659 Base-Backbone interact. energy: -1.669 local terms energy: -328.602448 where: bonds (distance) C4'-P energy: -93.383 bonds (distance) P-C4' energy: -124.085 flat angles C4'-P-C4' energy: -77.379 flat angles P-C4'-P energy: -49.297 tors. eta vs tors. theta energy: 15.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -2042.048112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2042.048112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2042.048112 (E_RNA) where: Base-Base interactions energy: -1382.897 where: short stacking energy: -598.602 Base-Backbone interact. energy: 1.638 local terms energy: -660.788923 where: bonds (distance) C4'-P energy: -127.937 bonds (distance) P-C4' energy: -119.162 flat angles C4'-P-C4' energy: -134.615 flat angles P-C4'-P energy: -95.161 tors. eta vs tors. theta energy: -183.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1964.041749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.041749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.041749 (E_RNA) where: Base-Base interactions energy: -1327.036 where: short stacking energy: -589.701 Base-Backbone interact. energy: -1.220 local terms energy: -635.785972 where: bonds (distance) C4'-P energy: -106.403 bonds (distance) P-C4' energy: -131.168 flat angles C4'-P-C4' energy: -144.711 flat angles P-C4'-P energy: -77.176 tors. eta vs tors. theta energy: -176.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1854.457481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1854.457481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1854.457481 (E_RNA) where: Base-Base interactions energy: -1260.908 where: short stacking energy: -522.216 Base-Backbone interact. energy: -3.561 local terms energy: -589.988787 where: bonds (distance) C4'-P energy: -112.197 bonds (distance) P-C4' energy: -116.462 flat angles C4'-P-C4' energy: -119.867 flat angles P-C4'-P energy: -88.922 tors. eta vs tors. theta energy: -152.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1637.741112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.741112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.741112 (E_RNA) where: Base-Base interactions energy: -1061.442 where: short stacking energy: -477.347 Base-Backbone interact. energy: -3.997 local terms energy: -572.302551 where: bonds (distance) C4'-P energy: -105.590 bonds (distance) P-C4' energy: -106.525 flat angles C4'-P-C4' energy: -125.400 flat angles P-C4'-P energy: -88.384 tors. eta vs tors. theta energy: -146.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -1559.420249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.420249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.420249 (E_RNA) where: Base-Base interactions energy: -1045.987 where: short stacking energy: -456.734 Base-Backbone interact. energy: -2.789 local terms energy: -510.644723 where: bonds (distance) C4'-P energy: -108.905 bonds (distance) P-C4' energy: -98.855 flat angles C4'-P-C4' energy: -109.732 flat angles P-C4'-P energy: -64.421 tors. eta vs tors. theta energy: -128.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -1087.915590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.915590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.915590 (E_RNA) where: Base-Base interactions energy: -637.872 where: short stacking energy: -333.653 Base-Backbone interact. energy: -0.105 local terms energy: -449.938937 where: bonds (distance) C4'-P energy: -105.426 bonds (distance) P-C4' energy: -102.374 flat angles C4'-P-C4' energy: -104.706 flat angles P-C4'-P energy: -72.075 tors. eta vs tors. theta energy: -65.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -990.635162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.635162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.635162 (E_RNA) where: Base-Base interactions energy: -590.233 where: short stacking energy: -283.984 Base-Backbone interact. energy: 2.299 local terms energy: -402.700398 where: bonds (distance) C4'-P energy: -108.043 bonds (distance) P-C4' energy: -104.883 flat angles C4'-P-C4' energy: -105.389 flat angles P-C4'-P energy: -48.557 tors. eta vs tors. theta energy: -35.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -827.765249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.765249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.765249 (E_RNA) where: Base-Base interactions energy: -427.123 where: short stacking energy: -249.622 Base-Backbone interact. energy: 0.316 local terms energy: -400.958091 where: bonds (distance) C4'-P energy: -96.738 bonds (distance) P-C4' energy: -105.377 flat angles C4'-P-C4' energy: -97.161 flat angles P-C4'-P energy: -59.066 tors. eta vs tors. theta energy: -42.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -562.394166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.394166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.394166 (E_RNA) where: Base-Base interactions energy: -223.732 where: short stacking energy: -157.524 Base-Backbone interact. energy: -1.982 local terms energy: -336.679925 where: bonds (distance) C4'-P energy: -101.906 bonds (distance) P-C4' energy: -105.183 flat angles C4'-P-C4' energy: -78.610 flat angles P-C4'-P energy: -50.211 tors. eta vs tors. theta energy: -0.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -564.096679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.096679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.096679 (E_RNA) where: Base-Base interactions energy: -251.609 where: short stacking energy: -181.641 Base-Backbone interact. energy: 0.316 local terms energy: -312.803134 where: bonds (distance) C4'-P energy: -75.362 bonds (distance) P-C4' energy: -106.538 flat angles C4'-P-C4' energy: -71.991 flat angles P-C4'-P energy: -62.191 tors. eta vs tors. theta energy: 3.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -2053.044441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2053.044441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2053.044441 (E_RNA) where: Base-Base interactions energy: -1389.511 where: short stacking energy: -602.326 Base-Backbone interact. energy: 0.168 local terms energy: -663.701668 where: bonds (distance) C4'-P energy: -129.325 bonds (distance) P-C4' energy: -130.574 flat angles C4'-P-C4' energy: -140.110 flat angles P-C4'-P energy: -86.717 tors. eta vs tors. theta energy: -176.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1949.708871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1949.708871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1949.708871 (E_RNA) where: Base-Base interactions energy: -1311.589 where: short stacking energy: -576.195 Base-Backbone interact. energy: -2.368 local terms energy: -635.752192 where: bonds (distance) C4'-P energy: -117.199 bonds (distance) P-C4' energy: -114.116 flat angles C4'-P-C4' energy: -126.379 flat angles P-C4'-P energy: -101.147 tors. eta vs tors. theta energy: -176.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1830.950882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1830.950882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1830.950882 (E_RNA) where: Base-Base interactions energy: -1236.440 where: short stacking energy: -556.034 Base-Backbone interact. energy: 1.234 local terms energy: -595.744254 where: bonds (distance) C4'-P energy: -108.611 bonds (distance) P-C4' energy: -119.050 flat angles C4'-P-C4' energy: -131.820 flat angles P-C4'-P energy: -78.364 tors. eta vs tors. theta energy: -157.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1575.173203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.173203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.173203 (E_RNA) where: Base-Base interactions energy: -1019.208 where: short stacking energy: -468.434 Base-Backbone interact. energy: -0.777 local terms energy: -555.188244 where: bonds (distance) C4'-P energy: -125.127 bonds (distance) P-C4' energy: -101.062 flat angles C4'-P-C4' energy: -129.368 flat angles P-C4'-P energy: -79.451 tors. eta vs tors. theta energy: -120.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -1493.910442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.910442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.910442 (E_RNA) where: Base-Base interactions energy: -1002.374 where: short stacking energy: -434.204 Base-Backbone interact. energy: 2.727 local terms energy: -494.263106 where: bonds (distance) C4'-P energy: -109.900 bonds (distance) P-C4' energy: -99.823 flat angles C4'-P-C4' energy: -116.980 flat angles P-C4'-P energy: -72.082 tors. eta vs tors. theta energy: -95.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1094.327130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.327130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.327130 (E_RNA) where: Base-Base interactions energy: -619.454 where: short stacking energy: -302.296 Base-Backbone interact. energy: -0.657 local terms energy: -474.216700 where: bonds (distance) C4'-P energy: -105.488 bonds (distance) P-C4' energy: -129.138 flat angles C4'-P-C4' energy: -109.013 flat angles P-C4'-P energy: -74.594 tors. eta vs tors. theta energy: -55.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -934.021640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.021640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.021640 (E_RNA) where: Base-Base interactions energy: -539.620 where: short stacking energy: -248.406 Base-Backbone interact. energy: 1.360 local terms energy: -395.761847 where: bonds (distance) C4'-P energy: -95.666 bonds (distance) P-C4' energy: -113.180 flat angles C4'-P-C4' energy: -83.581 flat angles P-C4'-P energy: -62.982 tors. eta vs tors. theta energy: -40.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -779.125696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.125696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.125696 (E_RNA) where: Base-Base interactions energy: -410.264 where: short stacking energy: -243.593 Base-Backbone interact. energy: 1.141 local terms energy: -370.003312 where: bonds (distance) C4'-P energy: -104.944 bonds (distance) P-C4' energy: -106.773 flat angles C4'-P-C4' energy: -103.493 flat angles P-C4'-P energy: -41.054 tors. eta vs tors. theta energy: -13.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -581.648833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.648833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.648833 (E_RNA) where: Base-Base interactions energy: -249.583 where: short stacking energy: -190.596 Base-Backbone interact. energy: -0.053 local terms energy: -332.012753 where: bonds (distance) C4'-P energy: -95.179 bonds (distance) P-C4' energy: -93.432 flat angles C4'-P-C4' energy: -68.769 flat angles P-C4'-P energy: -70.427 tors. eta vs tors. theta energy: -4.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -473.482920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.482920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.482920 (E_RNA) where: Base-Base interactions energy: -207.114 where: short stacking energy: -152.796 Base-Backbone interact. energy: 4.438 local terms energy: -270.806762 where: bonds (distance) C4'-P energy: -84.022 bonds (distance) P-C4' energy: -82.244 flat angles C4'-P-C4' energy: -91.769 flat angles P-C4'-P energy: -52.662 tors. eta vs tors. theta energy: 39.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -2076.043570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2076.043570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2076.043570 (E_RNA) where: Base-Base interactions energy: -1444.367 where: short stacking energy: -599.260 Base-Backbone interact. energy: -1.228 local terms energy: -630.448379 where: bonds (distance) C4'-P energy: -122.056 bonds (distance) P-C4' energy: -120.888 flat angles C4'-P-C4' energy: -131.848 flat angles P-C4'-P energy: -78.074 tors. eta vs tors. theta energy: -177.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1923.996651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1923.996651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1923.996651 (E_RNA) where: Base-Base interactions energy: -1285.683 where: short stacking energy: -564.322 Base-Backbone interact. energy: -3.737 local terms energy: -634.576956 where: bonds (distance) C4'-P energy: -115.007 bonds (distance) P-C4' energy: -120.100 flat angles C4'-P-C4' energy: -130.194 flat angles P-C4'-P energy: -96.506 tors. eta vs tors. theta energy: -172.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1846.783700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1846.783700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1846.783700 (E_RNA) where: Base-Base interactions energy: -1258.630 where: short stacking energy: -538.866 Base-Backbone interact. energy: -1.354 local terms energy: -586.799642 where: bonds (distance) C4'-P energy: -108.155 bonds (distance) P-C4' energy: -117.337 flat angles C4'-P-C4' energy: -135.197 flat angles P-C4'-P energy: -73.889 tors. eta vs tors. theta energy: -152.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1599.172120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.172120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.172120 (E_RNA) where: Base-Base interactions energy: -1034.282 where: short stacking energy: -475.785 Base-Backbone interact. energy: -3.804 local terms energy: -561.086066 where: bonds (distance) C4'-P energy: -113.108 bonds (distance) P-C4' energy: -119.016 flat angles C4'-P-C4' energy: -134.288 flat angles P-C4'-P energy: -67.763 tors. eta vs tors. theta energy: -126.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -1529.018056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.018056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.018056 (E_RNA) where: Base-Base interactions energy: -998.246 where: short stacking energy: -452.980 Base-Backbone interact. energy: -1.893 local terms energy: -528.878486 where: bonds (distance) C4'-P energy: -108.653 bonds (distance) P-C4' energy: -107.536 flat angles C4'-P-C4' energy: -118.359 flat angles P-C4'-P energy: -69.424 tors. eta vs tors. theta energy: -124.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -1154.433516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.433516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.433516 (E_RNA) where: Base-Base interactions energy: -692.059 where: short stacking energy: -343.581 Base-Backbone interact. energy: -1.080 local terms energy: -461.295178 where: bonds (distance) C4'-P energy: -103.901 bonds (distance) P-C4' energy: -104.919 flat angles C4'-P-C4' energy: -118.382 flat angles P-C4'-P energy: -59.764 tors. eta vs tors. theta energy: -74.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -977.834498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.834498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.834498 (E_RNA) where: Base-Base interactions energy: -551.636 where: short stacking energy: -258.512 Base-Backbone interact. energy: -3.063 local terms energy: -423.135487 where: bonds (distance) C4'-P energy: -99.207 bonds (distance) P-C4' energy: -106.082 flat angles C4'-P-C4' energy: -111.406 flat angles P-C4'-P energy: -72.015 tors. eta vs tors. theta energy: -34.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -790.135008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.135008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.135008 (E_RNA) where: Base-Base interactions energy: -423.549 where: short stacking energy: -209.485 Base-Backbone interact. energy: 1.617 local terms energy: -368.202925 where: bonds (distance) C4'-P energy: -95.001 bonds (distance) P-C4' energy: -105.705 flat angles C4'-P-C4' energy: -110.962 flat angles P-C4'-P energy: -38.704 tors. eta vs tors. theta energy: -17.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -588.732863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.732863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.732863 (E_RNA) where: Base-Base interactions energy: -256.570 where: short stacking energy: -156.117 Base-Backbone interact. energy: -2.720 local terms energy: -329.442601 where: bonds (distance) C4'-P energy: -94.079 bonds (distance) P-C4' energy: -103.094 flat angles C4'-P-C4' energy: -93.581 flat angles P-C4'-P energy: -38.414 tors. eta vs tors. theta energy: -0.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -460.418179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.418179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.418179 (E_RNA) where: Base-Base interactions energy: -159.410 where: short stacking energy: -129.399 Base-Backbone interact. energy: -1.455 local terms energy: -299.553188 where: bonds (distance) C4'-P energy: -92.591 bonds (distance) P-C4' energy: -92.788 flat angles C4'-P-C4' energy: -98.043 flat angles P-C4'-P energy: -48.703 tors. eta vs tors. theta energy: 32.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -2065.153177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2065.153177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2065.153177 (E_RNA) where: Base-Base interactions energy: -1406.644 where: short stacking energy: -598.590 Base-Backbone interact. energy: 1.287 local terms energy: -659.795992 where: bonds (distance) C4'-P energy: -118.337 bonds (distance) P-C4' energy: -130.276 flat angles C4'-P-C4' energy: -134.857 flat angles P-C4'-P energy: -95.140 tors. eta vs tors. theta energy: -181.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -1929.364235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.364235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.364235 (E_RNA) where: Base-Base interactions energy: -1317.024 where: short stacking energy: -577.338 Base-Backbone interact. energy: -1.332 local terms energy: -611.007566 where: bonds (distance) C4'-P energy: -106.891 bonds (distance) P-C4' energy: -111.207 flat angles C4'-P-C4' energy: -128.586 flat angles P-C4'-P energy: -90.176 tors. eta vs tors. theta energy: -174.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -1845.551849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.551849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.551849 (E_RNA) where: Base-Base interactions energy: -1246.465 where: short stacking energy: -540.391 Base-Backbone interact. energy: -4.786 local terms energy: -594.301141 where: bonds (distance) C4'-P energy: -112.545 bonds (distance) P-C4' energy: -114.000 flat angles C4'-P-C4' energy: -125.616 flat angles P-C4'-P energy: -92.778 tors. eta vs tors. theta energy: -149.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -1601.597718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.597718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.597718 (E_RNA) where: Base-Base interactions energy: -1032.173 where: short stacking energy: -477.998 Base-Backbone interact. energy: -3.914 local terms energy: -565.510914 where: bonds (distance) C4'-P energy: -115.985 bonds (distance) P-C4' energy: -97.535 flat angles C4'-P-C4' energy: -129.237 flat angles P-C4'-P energy: -93.300 tors. eta vs tors. theta energy: -129.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -1496.511676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.511676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.511676 (E_RNA) where: Base-Base interactions energy: -939.987 where: short stacking energy: -442.966 Base-Backbone interact. energy: -0.825 local terms energy: -555.699650 where: bonds (distance) C4'-P energy: -104.668 bonds (distance) P-C4' energy: -113.535 flat angles C4'-P-C4' energy: -136.133 flat angles P-C4'-P energy: -82.051 tors. eta vs tors. theta energy: -119.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -1213.433636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.433636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.433636 (E_RNA) where: Base-Base interactions energy: -754.833 where: short stacking energy: -355.567 Base-Backbone interact. energy: -3.589 local terms energy: -455.010776 where: bonds (distance) C4'-P energy: -110.040 bonds (distance) P-C4' energy: -93.309 flat angles C4'-P-C4' energy: -122.847 flat angles P-C4'-P energy: -57.868 tors. eta vs tors. theta energy: -70.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -889.233768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.233768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.233768 (E_RNA) where: Base-Base interactions energy: -484.431 where: short stacking energy: -249.621 Base-Backbone interact. energy: -0.406 local terms energy: -404.396838 where: bonds (distance) C4'-P energy: -120.250 bonds (distance) P-C4' energy: -113.387 flat angles C4'-P-C4' energy: -101.608 flat angles P-C4'-P energy: -42.760 tors. eta vs tors. theta energy: -26.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -853.429218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.429218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.429218 (E_RNA) where: Base-Base interactions energy: -450.456 where: short stacking energy: -267.233 Base-Backbone interact. energy: -0.867 local terms energy: -402.107069 where: bonds (distance) C4'-P energy: -108.222 bonds (distance) P-C4' energy: -86.450 flat angles C4'-P-C4' energy: -89.600 flat angles P-C4'-P energy: -69.384 tors. eta vs tors. theta energy: -48.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -651.421422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.421422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.421422 (E_RNA) where: Base-Base interactions energy: -317.998 where: short stacking energy: -161.610 Base-Backbone interact. energy: -0.826 local terms energy: -332.598078 where: bonds (distance) C4'-P energy: -94.685 bonds (distance) P-C4' energy: -99.950 flat angles C4'-P-C4' energy: -87.322 flat angles P-C4'-P energy: -68.089 tors. eta vs tors. theta energy: 17.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -471.145751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.145751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.145751 (E_RNA) where: Base-Base interactions energy: -165.504 where: short stacking energy: -118.248 Base-Backbone interact. energy: 4.918 local terms energy: -310.560276 where: bonds (distance) C4'-P energy: -89.247 bonds (distance) P-C4' energy: -105.350 flat angles C4'-P-C4' energy: -69.629 flat angles P-C4'-P energy: -57.486 tors. eta vs tors. theta energy: 11.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -2049.933330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2049.933330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2049.933330 (E_RNA) where: Base-Base interactions energy: -1385.024 where: short stacking energy: -586.927 Base-Backbone interact. energy: -1.118 local terms energy: -663.791128 where: bonds (distance) C4'-P energy: -135.860 bonds (distance) P-C4' energy: -126.508 flat angles C4'-P-C4' energy: -126.658 flat angles P-C4'-P energy: -100.135 tors. eta vs tors. theta energy: -174.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -1922.354420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1922.354420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1922.354420 (E_RNA) where: Base-Base interactions energy: -1307.624 where: short stacking energy: -573.096 Base-Backbone interact. energy: -1.568 local terms energy: -613.162678 where: bonds (distance) C4'-P energy: -109.221 bonds (distance) P-C4' energy: -116.235 flat angles C4'-P-C4' energy: -136.498 flat angles P-C4'-P energy: -88.841 tors. eta vs tors. theta energy: -162.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -1818.737936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.737936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.737936 (E_RNA) where: Base-Base interactions energy: -1215.931 where: short stacking energy: -518.961 Base-Backbone interact. energy: -2.124 local terms energy: -600.682413 where: bonds (distance) C4'-P energy: -112.005 bonds (distance) P-C4' energy: -113.632 flat angles C4'-P-C4' energy: -132.461 flat angles P-C4'-P energy: -88.228 tors. eta vs tors. theta energy: -154.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -1599.270720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.270720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.270720 (E_RNA) where: Base-Base interactions energy: -1042.051 where: short stacking energy: -476.662 Base-Backbone interact. energy: -1.449 local terms energy: -555.770771 where: bonds (distance) C4'-P energy: -126.286 bonds (distance) P-C4' energy: -109.366 flat angles C4'-P-C4' energy: -123.567 flat angles P-C4'-P energy: -79.027 tors. eta vs tors. theta energy: -117.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -1440.731264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.731264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.731264 (E_RNA) where: Base-Base interactions energy: -932.202 where: short stacking energy: -413.943 Base-Backbone interact. energy: -1.284 local terms energy: -507.245001 where: bonds (distance) C4'-P energy: -99.863 bonds (distance) P-C4' energy: -118.418 flat angles C4'-P-C4' energy: -112.945 flat angles P-C4'-P energy: -84.876 tors. eta vs tors. theta energy: -91.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -1100.119227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.119227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.119227 (E_RNA) where: Base-Base interactions energy: -674.836 where: short stacking energy: -321.348 Base-Backbone interact. energy: -1.716 local terms energy: -423.567079 where: bonds (distance) C4'-P energy: -97.641 bonds (distance) P-C4' energy: -93.533 flat angles C4'-P-C4' energy: -101.811 flat angles P-C4'-P energy: -66.345 tors. eta vs tors. theta energy: -64.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -953.174401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.174401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.174401 (E_RNA) where: Base-Base interactions energy: -534.426 where: short stacking energy: -283.170 Base-Backbone interact. energy: -3.175 local terms energy: -415.573381 where: bonds (distance) C4'-P energy: -99.929 bonds (distance) P-C4' energy: -108.232 flat angles C4'-P-C4' energy: -114.377 flat angles P-C4'-P energy: -46.919 tors. eta vs tors. theta energy: -46.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -855.781487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.781487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.781487 (E_RNA) where: Base-Base interactions energy: -456.609 where: short stacking energy: -226.094 Base-Backbone interact. energy: 6.274 local terms energy: -405.446032 where: bonds (distance) C4'-P energy: -106.814 bonds (distance) P-C4' energy: -110.421 flat angles C4'-P-C4' energy: -107.255 flat angles P-C4'-P energy: -49.215 tors. eta vs tors. theta energy: -31.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -697.590011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.590011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.590011 (E_RNA) where: Base-Base interactions energy: -346.817 where: short stacking energy: -196.390 Base-Backbone interact. energy: -1.377 local terms energy: -349.395572 where: bonds (distance) C4'-P energy: -89.979 bonds (distance) P-C4' energy: -114.020 flat angles C4'-P-C4' energy: -82.444 flat angles P-C4'-P energy: -66.912 tors. eta vs tors. theta energy: 3.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -512.384671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.384671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.384671 (E_RNA) where: Base-Base interactions energy: -191.407 where: short stacking energy: -157.301 Base-Backbone interact. energy: 0.484 local terms energy: -321.461236 where: bonds (distance) C4'-P energy: -84.777 bonds (distance) P-C4' energy: -101.485 flat angles C4'-P-C4' energy: -93.489 flat angles P-C4'-P energy: -41.390 tors. eta vs tors. theta energy: -0.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -2074.239139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2074.239139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.239139 (E_RNA) where: Base-Base interactions energy: -1423.259 where: short stacking energy: -586.063 Base-Backbone interact. energy: -1.043 local terms energy: -649.937991 where: bonds (distance) C4'-P energy: -123.563 bonds (distance) P-C4' energy: -125.075 flat angles C4'-P-C4' energy: -131.336 flat angles P-C4'-P energy: -96.450 tors. eta vs tors. theta energy: -173.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -1929.235983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.235983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.235983 (E_RNA) where: Base-Base interactions energy: -1311.437 where: short stacking energy: -566.770 Base-Backbone interact. energy: -0.244 local terms energy: -617.555458 where: bonds (distance) C4'-P energy: -119.235 bonds (distance) P-C4' energy: -105.948 flat angles C4'-P-C4' energy: -141.641 flat angles P-C4'-P energy: -89.513 tors. eta vs tors. theta energy: -161.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -1821.524736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1821.524736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1821.524736 (E_RNA) where: Base-Base interactions energy: -1221.408 where: short stacking energy: -515.938 Base-Backbone interact. energy: -3.407 local terms energy: -596.709906 where: bonds (distance) C4'-P energy: -112.014 bonds (distance) P-C4' energy: -123.208 flat angles C4'-P-C4' energy: -134.760 flat angles P-C4'-P energy: -74.694 tors. eta vs tors. theta energy: -152.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -1586.773432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.773432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.773432 (E_RNA) where: Base-Base interactions energy: -1017.138 where: short stacking energy: -461.485 Base-Backbone interact. energy: 1.318 local terms energy: -570.953423 where: bonds (distance) C4'-P energy: -114.599 bonds (distance) P-C4' energy: -130.479 flat angles C4'-P-C4' energy: -126.187 flat angles P-C4'-P energy: -81.106 tors. eta vs tors. theta energy: -118.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -1463.066418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.066418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.066418 (E_RNA) where: Base-Base interactions energy: -963.416 where: short stacking energy: -422.485 Base-Backbone interact. energy: -1.837 local terms energy: -497.813344 where: bonds (distance) C4'-P energy: -105.879 bonds (distance) P-C4' energy: -106.869 flat angles C4'-P-C4' energy: -108.696 flat angles P-C4'-P energy: -78.142 tors. eta vs tors. theta energy: -98.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -1136.478873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.478873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.478873 (E_RNA) where: Base-Base interactions energy: -690.260 where: short stacking energy: -332.515 Base-Backbone interact. energy: 1.999 local terms energy: -448.217567 where: bonds (distance) C4'-P energy: -103.565 bonds (distance) P-C4' energy: -105.734 flat angles C4'-P-C4' energy: -120.296 flat angles P-C4'-P energy: -40.190 tors. eta vs tors. theta energy: -78.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -946.825360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.825360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.825360 (E_RNA) where: Base-Base interactions energy: -518.966 where: short stacking energy: -270.456 Base-Backbone interact. energy: -0.979 local terms energy: -426.880908 where: bonds (distance) C4'-P energy: -113.139 bonds (distance) P-C4' energy: -115.436 flat angles C4'-P-C4' energy: -102.518 flat angles P-C4'-P energy: -55.024 tors. eta vs tors. theta energy: -40.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -915.118979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.118979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.118979 (E_RNA) where: Base-Base interactions energy: -537.106 where: short stacking energy: -260.346 Base-Backbone interact. energy: 1.615 local terms energy: -379.627998 where: bonds (distance) C4'-P energy: -93.431 bonds (distance) P-C4' energy: -101.070 flat angles C4'-P-C4' energy: -90.532 flat angles P-C4'-P energy: -55.262 tors. eta vs tors. theta energy: -39.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -677.794878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.794878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.794878 (E_RNA) where: Base-Base interactions energy: -312.168 where: short stacking energy: -199.892 Base-Backbone interact. energy: 0.637 local terms energy: -366.264787 where: bonds (distance) C4'-P energy: -89.180 bonds (distance) P-C4' energy: -96.277 flat angles C4'-P-C4' energy: -94.311 flat angles P-C4'-P energy: -68.138 tors. eta vs tors. theta energy: -18.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -497.357572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.357572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.357572 (E_RNA) where: Base-Base interactions energy: -212.312 where: short stacking energy: -133.980 Base-Backbone interact. energy: 1.676 local terms energy: -286.721737 where: bonds (distance) C4'-P energy: -88.735 bonds (distance) P-C4' energy: -112.549 flat angles C4'-P-C4' energy: -78.624 flat angles P-C4'-P energy: -46.003 tors. eta vs tors. theta energy: 39.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -2046.901902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.901902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2046.901902 (E_RNA) where: Base-Base interactions energy: -1399.699 where: short stacking energy: -591.881 Base-Backbone interact. energy: 1.020 local terms energy: -648.222794 where: bonds (distance) C4'-P energy: -128.547 bonds (distance) P-C4' energy: -133.715 flat angles C4'-P-C4' energy: -132.214 flat angles P-C4'-P energy: -80.781 tors. eta vs tors. theta energy: -172.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -1963.871812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1963.871812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1963.871812 (E_RNA) where: Base-Base interactions energy: -1316.045 where: short stacking energy: -577.464 Base-Backbone interact. energy: -2.099 local terms energy: -645.728045 where: bonds (distance) C4'-P energy: -131.271 bonds (distance) P-C4' energy: -119.823 flat angles C4'-P-C4' energy: -135.237 flat angles P-C4'-P energy: -87.554 tors. eta vs tors. theta energy: -171.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -1835.827334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1835.827334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1835.827334 (E_RNA) where: Base-Base interactions energy: -1229.660 where: short stacking energy: -527.835 Base-Backbone interact. energy: -2.266 local terms energy: -603.901891 where: bonds (distance) C4'-P energy: -117.330 bonds (distance) P-C4' energy: -115.845 flat angles C4'-P-C4' energy: -133.769 flat angles P-C4'-P energy: -87.249 tors. eta vs tors. theta energy: -149.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -1592.355088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.355088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.355088 (E_RNA) where: Base-Base interactions energy: -1061.385 where: short stacking energy: -494.489 Base-Backbone interact. energy: -3.577 local terms energy: -527.392635 where: bonds (distance) C4'-P energy: -109.259 bonds (distance) P-C4' energy: -85.403 flat angles C4'-P-C4' energy: -124.160 flat angles P-C4'-P energy: -77.710 tors. eta vs tors. theta energy: -130.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -1447.209749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.209749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.209749 (E_RNA) where: Base-Base interactions energy: -942.534 where: short stacking energy: -406.282 Base-Backbone interact. energy: -1.803 local terms energy: -502.871959 where: bonds (distance) C4'-P energy: -116.641 bonds (distance) P-C4' energy: -99.730 flat angles C4'-P-C4' energy: -120.613 flat angles P-C4'-P energy: -68.837 tors. eta vs tors. theta energy: -97.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -1126.578433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.578433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.578433 (E_RNA) where: Base-Base interactions energy: -619.180 where: short stacking energy: -313.378 Base-Backbone interact. energy: -2.587 local terms energy: -504.811122 where: bonds (distance) C4'-P energy: -110.767 bonds (distance) P-C4' energy: -116.739 flat angles C4'-P-C4' energy: -109.404 flat angles P-C4'-P energy: -84.826 tors. eta vs tors. theta energy: -83.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -869.215524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.215524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.215524 (E_RNA) where: Base-Base interactions energy: -484.265 where: short stacking energy: -266.622 Base-Backbone interact. energy: -2.649 local terms energy: -382.301602 where: bonds (distance) C4'-P energy: -96.431 bonds (distance) P-C4' energy: -107.390 flat angles C4'-P-C4' energy: -95.492 flat angles P-C4'-P energy: -46.445 tors. eta vs tors. theta energy: -36.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -894.918007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.918007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.918007 (E_RNA) where: Base-Base interactions energy: -498.840 where: short stacking energy: -230.230 Base-Backbone interact. energy: -1.962 local terms energy: -394.115186 where: bonds (distance) C4'-P energy: -114.726 bonds (distance) P-C4' energy: -99.984 flat angles C4'-P-C4' energy: -103.212 flat angles P-C4'-P energy: -48.333 tors. eta vs tors. theta energy: -27.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -740.934789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.934789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.934789 (E_RNA) where: Base-Base interactions energy: -348.951 where: short stacking energy: -201.189 Base-Backbone interact. energy: 2.040 local terms energy: -394.023825 where: bonds (distance) C4'-P energy: -113.237 bonds (distance) P-C4' energy: -120.299 flat angles C4'-P-C4' energy: -91.064 flat angles P-C4'-P energy: -60.064 tors. eta vs tors. theta energy: -9.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -540.550748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.550748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.550748 (E_RNA) where: Base-Base interactions energy: -245.129 where: short stacking energy: -134.035 Base-Backbone interact. energy: -1.097 local terms energy: -294.325553 where: bonds (distance) C4'-P energy: -106.063 bonds (distance) P-C4' energy: -97.635 flat angles C4'-P-C4' energy: -86.642 flat angles P-C4'-P energy: -45.566 tors. eta vs tors. theta energy: 41.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -2077.230087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2077.230087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2077.230087 (E_RNA) where: Base-Base interactions energy: -1415.632 where: short stacking energy: -607.366 Base-Backbone interact. energy: -0.179 local terms energy: -661.419163 where: bonds (distance) C4'-P energy: -117.617 bonds (distance) P-C4' energy: -130.946 flat angles C4'-P-C4' energy: -141.437 flat angles P-C4'-P energy: -90.141 tors. eta vs tors. theta energy: -181.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -1917.978082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1917.978082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1917.978082 (E_RNA) where: Base-Base interactions energy: -1287.847 where: short stacking energy: -569.215 Base-Backbone interact. energy: 0.189 local terms energy: -630.319985 where: bonds (distance) C4'-P energy: -117.904 bonds (distance) P-C4' energy: -129.535 flat angles C4'-P-C4' energy: -125.326 flat angles P-C4'-P energy: -87.001 tors. eta vs tors. theta energy: -170.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -1809.681535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.681535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.681535 (E_RNA) where: Base-Base interactions energy: -1215.503 where: short stacking energy: -522.592 Base-Backbone interact. energy: -1.900 local terms energy: -592.279181 where: bonds (distance) C4'-P energy: -97.958 bonds (distance) P-C4' energy: -129.977 flat angles C4'-P-C4' energy: -133.392 flat angles P-C4'-P energy: -76.131 tors. eta vs tors. theta energy: -154.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -1644.086549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.086549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.086549 (E_RNA) where: Base-Base interactions energy: -1064.177 where: short stacking energy: -500.976 Base-Backbone interact. energy: -1.874 local terms energy: -578.036150 where: bonds (distance) C4'-P energy: -103.519 bonds (distance) P-C4' energy: -116.815 flat angles C4'-P-C4' energy: -113.984 flat angles P-C4'-P energy: -93.486 tors. eta vs tors. theta energy: -150.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -1520.762194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.762194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.762194 (E_RNA) where: Base-Base interactions energy: -982.854 where: short stacking energy: -460.105 Base-Backbone interact. energy: -2.414 local terms energy: -535.493846 where: bonds (distance) C4'-P energy: -118.961 bonds (distance) P-C4' energy: -93.610 flat angles C4'-P-C4' energy: -112.432 flat angles P-C4'-P energy: -86.354 tors. eta vs tors. theta energy: -124.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -1118.546600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.546600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.546600 (E_RNA) where: Base-Base interactions energy: -643.177 where: short stacking energy: -311.508 Base-Backbone interact. energy: -1.660 local terms energy: -473.709440 where: bonds (distance) C4'-P energy: -115.295 bonds (distance) P-C4' energy: -109.536 flat angles C4'-P-C4' energy: -111.728 flat angles P-C4'-P energy: -81.080 tors. eta vs tors. theta energy: -56.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -978.955199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.955199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.955199 (E_RNA) where: Base-Base interactions energy: -556.933 where: short stacking energy: -274.734 Base-Backbone interact. energy: -1.547 local terms energy: -420.475508 where: bonds (distance) C4'-P energy: -113.676 bonds (distance) P-C4' energy: -112.335 flat angles C4'-P-C4' energy: -103.603 flat angles P-C4'-P energy: -50.287 tors. eta vs tors. theta energy: -40.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -824.803369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.803369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.803369 (E_RNA) where: Base-Base interactions energy: -421.668 where: short stacking energy: -247.708 Base-Backbone interact. energy: 3.684 local terms energy: -406.819523 where: bonds (distance) C4'-P energy: -93.847 bonds (distance) P-C4' energy: -117.424 flat angles C4'-P-C4' energy: -88.355 flat angles P-C4'-P energy: -79.425 tors. eta vs tors. theta energy: -27.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -673.481962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.481962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.481962 (E_RNA) where: Base-Base interactions energy: -352.622 where: short stacking energy: -214.451 Base-Backbone interact. energy: -2.909 local terms energy: -317.951766 where: bonds (distance) C4'-P energy: -111.667 bonds (distance) P-C4' energy: -74.433 flat angles C4'-P-C4' energy: -81.843 flat angles P-C4'-P energy: -48.098 tors. eta vs tors. theta energy: -1.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -574.036876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.036876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.036876 (E_RNA) where: Base-Base interactions energy: -247.225 where: short stacking energy: -174.183 Base-Backbone interact. energy: -1.681 local terms energy: -325.131209 where: bonds (distance) C4'-P energy: -87.004 bonds (distance) P-C4' energy: -102.738 flat angles C4'-P-C4' energy: -86.948 flat angles P-C4'-P energy: -44.929 tors. eta vs tors. theta energy: -3.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -2082.303619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.303619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.303619 (E_RNA) where: Base-Base interactions energy: -1416.836 where: short stacking energy: -609.975 Base-Backbone interact. energy: -1.663 local terms energy: -663.805090 where: bonds (distance) C4'-P energy: -130.818 bonds (distance) P-C4' energy: -120.958 flat angles C4'-P-C4' energy: -140.996 flat angles P-C4'-P energy: -90.843 tors. eta vs tors. theta energy: -180.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -1927.005782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1927.005782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1927.005782 (E_RNA) where: Base-Base interactions energy: -1300.075 where: short stacking energy: -576.261 Base-Backbone interact. energy: -2.013 local terms energy: -624.917661 where: bonds (distance) C4'-P energy: -127.143 bonds (distance) P-C4' energy: -109.956 flat angles C4'-P-C4' energy: -140.320 flat angles P-C4'-P energy: -83.596 tors. eta vs tors. theta energy: -163.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -1784.515766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1784.515766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.515766 (E_RNA) where: Base-Base interactions energy: -1195.463 where: short stacking energy: -534.550 Base-Backbone interact. energy: -1.712 local terms energy: -587.340655 where: bonds (distance) C4'-P energy: -111.689 bonds (distance) P-C4' energy: -110.987 flat angles C4'-P-C4' energy: -135.810 flat angles P-C4'-P energy: -84.547 tors. eta vs tors. theta energy: -144.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -1656.168381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.168381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.168381 (E_RNA) where: Base-Base interactions energy: -1089.656 where: short stacking energy: -481.874 Base-Backbone interact. energy: -3.574 local terms energy: -562.938888 where: bonds (distance) C4'-P energy: -99.747 bonds (distance) P-C4' energy: -116.265 flat angles C4'-P-C4' energy: -128.801 flat angles P-C4'-P energy: -79.193 tors. eta vs tors. theta energy: -138.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -1433.360830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.360830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.360830 (E_RNA) where: Base-Base interactions energy: -931.982 where: short stacking energy: -415.547 Base-Backbone interact. energy: -3.976 local terms energy: -497.403306 where: bonds (distance) C4'-P energy: -118.582 bonds (distance) P-C4' energy: -110.773 flat angles C4'-P-C4' energy: -109.598 flat angles P-C4'-P energy: -56.300 tors. eta vs tors. theta energy: -102.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -1150.043213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.043213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.043213 (E_RNA) where: Base-Base interactions energy: -671.391 where: short stacking energy: -331.996 Base-Backbone interact. energy: -3.007 local terms energy: -475.644704 where: bonds (distance) C4'-P energy: -113.079 bonds (distance) P-C4' energy: -103.418 flat angles C4'-P-C4' energy: -106.104 flat angles P-C4'-P energy: -73.166 tors. eta vs tors. theta energy: -79.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -964.725498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.725498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.725498 (E_RNA) where: Base-Base interactions energy: -528.888 where: short stacking energy: -282.720 Base-Backbone interact. energy: -3.892 local terms energy: -431.944943 where: bonds (distance) C4'-P energy: -105.106 bonds (distance) P-C4' energy: -117.598 flat angles C4'-P-C4' energy: -104.079 flat angles P-C4'-P energy: -65.797 tors. eta vs tors. theta energy: -39.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -877.667740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.667740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.667740 (E_RNA) where: Base-Base interactions energy: -461.667 where: short stacking energy: -254.405 Base-Backbone interact. energy: -0.892 local terms energy: -415.108861 where: bonds (distance) C4'-P energy: -94.555 bonds (distance) P-C4' energy: -106.681 flat angles C4'-P-C4' energy: -101.113 flat angles P-C4'-P energy: -69.612 tors. eta vs tors. theta energy: -43.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -686.435649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.435649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.435649 (E_RNA) where: Base-Base interactions energy: -313.308 where: short stacking energy: -196.464 Base-Backbone interact. energy: 0.946 local terms energy: -374.073461 where: bonds (distance) C4'-P energy: -94.622 bonds (distance) P-C4' energy: -116.660 flat angles C4'-P-C4' energy: -101.482 flat angles P-C4'-P energy: -56.929 tors. eta vs tors. theta energy: -4.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -508.867667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.867667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.867667 (E_RNA) where: Base-Base interactions energy: -195.189 where: short stacking energy: -140.641 Base-Backbone interact. energy: 1.997 local terms energy: -315.675527 where: bonds (distance) C4'-P energy: -95.347 bonds (distance) P-C4' energy: -87.230 flat angles C4'-P-C4' energy: -79.773 flat angles P-C4'-P energy: -69.341 tors. eta vs tors. theta energy: 16.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)