SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-79e153c5/inputs/seq.fa: 1 curr_seq: _UUAUCUUUUGGACUUUAGUU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUAUCUUUUGGACUUUAGUU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 20 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 105 n_atoms_counter: 105 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 20.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -74.090098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.090098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.090098 (E_RNA) where: Base-Base interactions energy: 0.400 where: short stacking energy: 0.400 Base-Backbone interact. energy: -0.000 local terms energy: -74.490065 where: bonds (distance) C4'-P energy: -19.432 bonds (distance) P-C4' energy: -18.788 flat angles C4'-P-C4' energy: -14.684 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -4.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -115.015046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.015046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.015046 (E_RNA) where: Base-Base interactions energy: -48.227 where: short stacking energy: -45.878 Base-Backbone interact. energy: -0.067 local terms energy: -66.720553 where: bonds (distance) C4'-P energy: -16.605 bonds (distance) P-C4' energy: -15.867 flat angles C4'-P-C4' energy: -13.778 flat angles P-C4'-P energy: -8.708 tors. eta vs tors. theta energy: -11.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -129.022028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.022028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.022028 (E_RNA) where: Base-Base interactions energy: -71.152 where: short stacking energy: -46.729 Base-Backbone interact. energy: 0.440 local terms energy: -58.309986 where: bonds (distance) C4'-P energy: -13.623 bonds (distance) P-C4' energy: -15.564 flat angles C4'-P-C4' energy: -10.782 flat angles P-C4'-P energy: -7.799 tors. eta vs tors. theta energy: -10.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -92.343258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.343258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.343258 (E_RNA) where: Base-Base interactions energy: -32.216 where: short stacking energy: -32.216 Base-Backbone interact. energy: -0.021 local terms energy: -60.106588 where: bonds (distance) C4'-P energy: -14.233 bonds (distance) P-C4' energy: -10.229 flat angles C4'-P-C4' energy: -14.999 flat angles P-C4'-P energy: -8.675 tors. eta vs tors. theta energy: -11.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -92.061050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.061050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.061050 (E_RNA) where: Base-Base interactions energy: -34.345 where: short stacking energy: -30.667 Base-Backbone interact. energy: -0.384 local terms energy: -57.331972 where: bonds (distance) C4'-P energy: -10.676 bonds (distance) P-C4' energy: -16.633 flat angles C4'-P-C4' energy: -14.359 flat angles P-C4'-P energy: -6.354 tors. eta vs tors. theta energy: -9.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -105.620889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.620889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.620889 (E_RNA) where: Base-Base interactions energy: -45.709 where: short stacking energy: -35.892 Base-Backbone interact. energy: -0.009 local terms energy: -59.902062 where: bonds (distance) C4'-P energy: -11.234 bonds (distance) P-C4' energy: -13.266 flat angles C4'-P-C4' energy: -14.410 flat angles P-C4'-P energy: -11.252 tors. eta vs tors. theta energy: -9.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -100.402186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.402186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.402186 (E_RNA) where: Base-Base interactions energy: -57.476 where: short stacking energy: -27.875 Base-Backbone interact. energy: -0.483 local terms energy: -42.443437 where: bonds (distance) C4'-P energy: -5.103 bonds (distance) P-C4' energy: -17.295 flat angles C4'-P-C4' energy: -8.253 flat angles P-C4'-P energy: -8.694 tors. eta vs tors. theta energy: -3.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -83.170328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.170328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.170328 (E_RNA) where: Base-Base interactions energy: -34.019 where: short stacking energy: -23.735 Base-Backbone interact. energy: -0.152 local terms energy: -48.998466 where: bonds (distance) C4'-P energy: -11.954 bonds (distance) P-C4' energy: -16.051 flat angles C4'-P-C4' energy: -11.447 flat angles P-C4'-P energy: -8.856 tors. eta vs tors. theta energy: -0.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -84.642843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.642843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.642843 (E_RNA) where: Base-Base interactions energy: -39.159 where: short stacking energy: -18.107 Base-Backbone interact. energy: -0.513 local terms energy: -44.971240 where: bonds (distance) C4'-P energy: -15.338 bonds (distance) P-C4' energy: -13.328 flat angles C4'-P-C4' energy: -12.241 flat angles P-C4'-P energy: -2.788 tors. eta vs tors. theta energy: -1.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -80.190385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.190385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.190385 (E_RNA) where: Base-Base interactions energy: -25.804 where: short stacking energy: -18.969 Base-Backbone interact. energy: -0.155 local terms energy: -54.230877 where: bonds (distance) C4'-P energy: -13.640 bonds (distance) P-C4' energy: -13.763 flat angles C4'-P-C4' energy: -13.383 flat angles P-C4'-P energy: -9.856 tors. eta vs tors. theta energy: -3.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -73.658130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.658130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.658130 (E_RNA) where: Base-Base interactions energy: -1.951 where: short stacking energy: -1.951 Base-Backbone interact. energy: -0.000 local terms energy: -71.706877 where: bonds (distance) C4'-P energy: -18.327 bonds (distance) P-C4' energy: -18.087 flat angles C4'-P-C4' energy: -14.258 flat angles P-C4'-P energy: -16.505 tors. eta vs tors. theta energy: -4.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -138.048463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.048463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.048463 (E_RNA) where: Base-Base interactions energy: -71.697 where: short stacking energy: -41.355 Base-Backbone interact. energy: -0.436 local terms energy: -65.914968 where: bonds (distance) C4'-P energy: -12.449 bonds (distance) P-C4' energy: -15.311 flat angles C4'-P-C4' energy: -14.178 flat angles P-C4'-P energy: -11.213 tors. eta vs tors. theta energy: -12.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -145.682104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.682104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.682104 (E_RNA) where: Base-Base interactions energy: -79.068 where: short stacking energy: -49.049 Base-Backbone interact. energy: -0.991 local terms energy: -65.623393 where: bonds (distance) C4'-P energy: -17.068 bonds (distance) P-C4' energy: -12.570 flat angles C4'-P-C4' energy: -12.585 flat angles P-C4'-P energy: -9.654 tors. eta vs tors. theta energy: -13.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -124.080806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.080806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.080806 (E_RNA) where: Base-Base interactions energy: -69.558 where: short stacking energy: -38.786 Base-Backbone interact. energy: -0.276 local terms energy: -54.246454 where: bonds (distance) C4'-P energy: -12.258 bonds (distance) P-C4' energy: -13.099 flat angles C4'-P-C4' energy: -11.938 flat angles P-C4'-P energy: -10.747 tors. eta vs tors. theta energy: -6.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -142.076538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.076538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.076538 (E_RNA) where: Base-Base interactions energy: -77.467 where: short stacking energy: -44.977 Base-Backbone interact. energy: -0.225 local terms energy: -64.384623 where: bonds (distance) C4'-P energy: -16.411 bonds (distance) P-C4' energy: -15.702 flat angles C4'-P-C4' energy: -12.759 flat angles P-C4'-P energy: -9.990 tors. eta vs tors. theta energy: -9.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -96.744121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.744121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.744121 (E_RNA) where: Base-Base interactions energy: -36.406 where: short stacking energy: -28.125 Base-Backbone interact. energy: -0.464 local terms energy: -59.873322 where: bonds (distance) C4'-P energy: -11.867 bonds (distance) P-C4' energy: -14.061 flat angles C4'-P-C4' energy: -15.343 flat angles P-C4'-P energy: -9.801 tors. eta vs tors. theta energy: -8.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -99.913530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.913530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.913530 (E_RNA) where: Base-Base interactions energy: -44.232 where: short stacking energy: -24.568 Base-Backbone interact. energy: -1.156 local terms energy: -54.525407 where: bonds (distance) C4'-P energy: -9.327 bonds (distance) P-C4' energy: -16.511 flat angles C4'-P-C4' energy: -16.125 flat angles P-C4'-P energy: -8.353 tors. eta vs tors. theta energy: -4.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -75.908073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.908073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.908073 (E_RNA) where: Base-Base interactions energy: -27.701 where: short stacking energy: -22.114 Base-Backbone interact. energy: -0.316 local terms energy: -47.890981 where: bonds (distance) C4'-P energy: -10.246 bonds (distance) P-C4' energy: -15.562 flat angles C4'-P-C4' energy: -14.203 flat angles P-C4'-P energy: -9.282 tors. eta vs tors. theta energy: 1.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -87.664684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.664684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.664684 (E_RNA) where: Base-Base interactions energy: -39.472 where: short stacking energy: -18.867 Base-Backbone interact. energy: -0.224 local terms energy: -47.968402 where: bonds (distance) C4'-P energy: -12.145 bonds (distance) P-C4' energy: -14.208 flat angles C4'-P-C4' energy: -14.071 flat angles P-C4'-P energy: -6.007 tors. eta vs tors. theta energy: -1.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -76.990639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.990639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.990639 (E_RNA) where: Base-Base interactions energy: -19.927 where: short stacking energy: -19.927 Base-Backbone interact. energy: 0.906 local terms energy: -57.969599 where: bonds (distance) C4'-P energy: -12.166 bonds (distance) P-C4' energy: -16.637 flat angles C4'-P-C4' energy: -11.208 flat angles P-C4'-P energy: -13.667 tors. eta vs tors. theta energy: -4.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -73.830859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.830859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.830859 (E_RNA) where: Base-Base interactions energy: -32.735 where: short stacking energy: -24.204 Base-Backbone interact. energy: -0.078 local terms energy: -41.018644 where: bonds (distance) C4'-P energy: -8.722 bonds (distance) P-C4' energy: -13.740 flat angles C4'-P-C4' energy: -11.843 flat angles P-C4'-P energy: -4.376 tors. eta vs tors. theta energy: -2.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -158.325416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.325416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.325416 (E_RNA) where: Base-Base interactions energy: -91.039 where: short stacking energy: -51.076 Base-Backbone interact. energy: -1.339 local terms energy: -65.946805 where: bonds (distance) C4'-P energy: -13.814 bonds (distance) P-C4' energy: -15.505 flat angles C4'-P-C4' energy: -16.922 flat angles P-C4'-P energy: -8.831 tors. eta vs tors. theta energy: -10.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -148.427889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.427889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.427889 (E_RNA) where: Base-Base interactions energy: -85.846 where: short stacking energy: -52.160 Base-Backbone interact. energy: -0.659 local terms energy: -61.923329 where: bonds (distance) C4'-P energy: -14.667 bonds (distance) P-C4' energy: -14.693 flat angles C4'-P-C4' energy: -11.922 flat angles P-C4'-P energy: -8.327 tors. eta vs tors. theta energy: -12.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -145.026483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.026483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.026483 (E_RNA) where: Base-Base interactions energy: -80.652 where: short stacking energy: -51.432 Base-Backbone interact. energy: 1.431 local terms energy: -65.806104 where: bonds (distance) C4'-P energy: -12.614 bonds (distance) P-C4' energy: -15.273 flat angles C4'-P-C4' energy: -14.817 flat angles P-C4'-P energy: -10.393 tors. eta vs tors. theta energy: -12.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -140.084067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.084067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.084067 (E_RNA) where: Base-Base interactions energy: -72.404 where: short stacking energy: -41.404 Base-Backbone interact. energy: -0.083 local terms energy: -67.597139 where: bonds (distance) C4'-P energy: -14.895 bonds (distance) P-C4' energy: -16.665 flat angles C4'-P-C4' energy: -12.245 flat angles P-C4'-P energy: -11.031 tors. eta vs tors. theta energy: -12.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -85.716226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.716226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.716226 (E_RNA) where: Base-Base interactions energy: -31.267 where: short stacking energy: -27.593 Base-Backbone interact. energy: -0.263 local terms energy: -54.186231 where: bonds (distance) C4'-P energy: -13.533 bonds (distance) P-C4' energy: -13.324 flat angles C4'-P-C4' energy: -14.895 flat angles P-C4'-P energy: -8.773 tors. eta vs tors. theta energy: -3.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -125.441721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.441721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.441721 (E_RNA) where: Base-Base interactions energy: -71.137 where: short stacking energy: -28.978 Base-Backbone interact. energy: -0.246 local terms energy: -54.058330 where: bonds (distance) C4'-P energy: -13.100 bonds (distance) P-C4' energy: -14.580 flat angles C4'-P-C4' energy: -11.908 flat angles P-C4'-P energy: -7.311 tors. eta vs tors. theta energy: -7.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -84.404416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.404416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.404416 (E_RNA) where: Base-Base interactions energy: -27.470 where: short stacking energy: -26.707 Base-Backbone interact. energy: -0.209 local terms energy: -56.725320 where: bonds (distance) C4'-P energy: -12.282 bonds (distance) P-C4' energy: -13.551 flat angles C4'-P-C4' energy: -17.465 flat angles P-C4'-P energy: -6.440 tors. eta vs tors. theta energy: -6.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -82.158691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.158691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.158691 (E_RNA) where: Base-Base interactions energy: -42.116 where: short stacking energy: -26.794 Base-Backbone interact. energy: -0.068 local terms energy: -39.975323 where: bonds (distance) C4'-P energy: -15.835 bonds (distance) P-C4' energy: -8.199 flat angles C4'-P-C4' energy: -4.874 flat angles P-C4'-P energy: -11.966 tors. eta vs tors. theta energy: 0.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -78.785693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.785693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.785693 (E_RNA) where: Base-Base interactions energy: -28.167 where: short stacking energy: -22.945 Base-Backbone interact. energy: -0.173 local terms energy: -50.445889 where: bonds (distance) C4'-P energy: -12.324 bonds (distance) P-C4' energy: -13.564 flat angles C4'-P-C4' energy: -11.122 flat angles P-C4'-P energy: -10.147 tors. eta vs tors. theta energy: -3.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -71.030090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.030090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.030090 (E_RNA) where: Base-Base interactions energy: -30.297 where: short stacking energy: -13.856 Base-Backbone interact. energy: -0.223 local terms energy: -40.510006 where: bonds (distance) C4'-P energy: -11.574 bonds (distance) P-C4' energy: -13.433 flat angles C4'-P-C4' energy: -12.823 flat angles P-C4'-P energy: -6.481 tors. eta vs tors. theta energy: 3.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -160.329887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.329887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.329887 (E_RNA) where: Base-Base interactions energy: -89.091 where: short stacking energy: -49.303 Base-Backbone interact. energy: -0.089 local terms energy: -71.149543 where: bonds (distance) C4'-P energy: -15.647 bonds (distance) P-C4' energy: -13.775 flat angles C4'-P-C4' energy: -16.481 flat angles P-C4'-P energy: -9.446 tors. eta vs tors. theta energy: -15.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -157.936102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.936102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.936102 (E_RNA) where: Base-Base interactions energy: -92.445 where: short stacking energy: -52.424 Base-Backbone interact. energy: -0.122 local terms energy: -65.369124 where: bonds (distance) C4'-P energy: -13.772 bonds (distance) P-C4' energy: -15.906 flat angles C4'-P-C4' energy: -14.997 flat angles P-C4'-P energy: -4.289 tors. eta vs tors. theta energy: -16.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -152.149796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.149796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.149796 (E_RNA) where: Base-Base interactions energy: -84.554 where: short stacking energy: -50.285 Base-Backbone interact. energy: -0.006 local terms energy: -67.590397 where: bonds (distance) C4'-P energy: -10.346 bonds (distance) P-C4' energy: -14.029 flat angles C4'-P-C4' energy: -15.163 flat angles P-C4'-P energy: -9.343 tors. eta vs tors. theta energy: -18.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -108.035794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.035794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.035794 (E_RNA) where: Base-Base interactions energy: -54.130 where: short stacking energy: -29.887 Base-Backbone interact. energy: -0.342 local terms energy: -53.564020 where: bonds (distance) C4'-P energy: -11.181 bonds (distance) P-C4' energy: -15.832 flat angles C4'-P-C4' energy: -10.263 flat angles P-C4'-P energy: -11.948 tors. eta vs tors. theta energy: -4.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -117.403193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.403193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.403193 (E_RNA) where: Base-Base interactions energy: -70.133 where: short stacking energy: -34.822 Base-Backbone interact. energy: -0.041 local terms energy: -47.228686 where: bonds (distance) C4'-P energy: -14.117 bonds (distance) P-C4' energy: -14.308 flat angles C4'-P-C4' energy: -9.988 flat angles P-C4'-P energy: -8.907 tors. eta vs tors. theta energy: 0.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -127.131488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.131488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.131488 (E_RNA) where: Base-Base interactions energy: -80.723 where: short stacking energy: -27.867 Base-Backbone interact. energy: 5.703 local terms energy: -52.111271 where: bonds (distance) C4'-P energy: -14.618 bonds (distance) P-C4' energy: -9.088 flat angles C4'-P-C4' energy: -10.223 flat angles P-C4'-P energy: -8.981 tors. eta vs tors. theta energy: -9.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -71.766126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.766126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.766126 (E_RNA) where: Base-Base interactions energy: -23.350 where: short stacking energy: -13.861 Base-Backbone interact. energy: 1.489 local terms energy: -49.904645 where: bonds (distance) C4'-P energy: -10.849 bonds (distance) P-C4' energy: -15.995 flat angles C4'-P-C4' energy: -16.323 flat angles P-C4'-P energy: -7.482 tors. eta vs tors. theta energy: 0.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -73.768697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.768697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.768697 (E_RNA) where: Base-Base interactions energy: -21.284 where: short stacking energy: -21.276 Base-Backbone interact. energy: -1.209 local terms energy: -51.275329 where: bonds (distance) C4'-P energy: -15.879 bonds (distance) P-C4' energy: -8.034 flat angles C4'-P-C4' energy: -15.254 flat angles P-C4'-P energy: -10.096 tors. eta vs tors. theta energy: -2.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -83.339809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.339809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.339809 (E_RNA) where: Base-Base interactions energy: -28.026 where: short stacking energy: -18.206 Base-Backbone interact. energy: 0.489 local terms energy: -55.802356 where: bonds (distance) C4'-P energy: -11.343 bonds (distance) P-C4' energy: -15.486 flat angles C4'-P-C4' energy: -13.816 flat angles P-C4'-P energy: -10.875 tors. eta vs tors. theta energy: -4.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -73.047995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.047995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.047995 (E_RNA) where: Base-Base interactions energy: -34.195 where: short stacking energy: -27.738 Base-Backbone interact. energy: -0.359 local terms energy: -38.493874 where: bonds (distance) C4'-P energy: -8.840 bonds (distance) P-C4' energy: -10.245 flat angles C4'-P-C4' energy: -8.345 flat angles P-C4'-P energy: -6.439 tors. eta vs tors. theta energy: -4.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -143.641937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.641937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.641937 (E_RNA) where: Base-Base interactions energy: -84.855 where: short stacking energy: -51.728 Base-Backbone interact. energy: -0.203 local terms energy: -58.584030 where: bonds (distance) C4'-P energy: -9.038 bonds (distance) P-C4' energy: -15.858 flat angles C4'-P-C4' energy: -14.971 flat angles P-C4'-P energy: -5.654 tors. eta vs tors. theta energy: -13.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -147.535169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.535169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.535169 (E_RNA) where: Base-Base interactions energy: -82.322 where: short stacking energy: -42.790 Base-Backbone interact. energy: -0.623 local terms energy: -64.590381 where: bonds (distance) C4'-P energy: -13.676 bonds (distance) P-C4' energy: -15.438 flat angles C4'-P-C4' energy: -15.921 flat angles P-C4'-P energy: -6.594 tors. eta vs tors. theta energy: -12.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -147.320873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.320873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.320873 (E_RNA) where: Base-Base interactions energy: -89.034 where: short stacking energy: -49.000 Base-Backbone interact. energy: -0.031 local terms energy: -58.255581 where: bonds (distance) C4'-P energy: -10.382 bonds (distance) P-C4' energy: -8.759 flat angles C4'-P-C4' energy: -15.282 flat angles P-C4'-P energy: -7.915 tors. eta vs tors. theta energy: -15.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -111.665138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.665138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.665138 (E_RNA) where: Base-Base interactions energy: -50.037 where: short stacking energy: -28.898 Base-Backbone interact. energy: 0.523 local terms energy: -62.150477 where: bonds (distance) C4'-P energy: -16.613 bonds (distance) P-C4' energy: -15.407 flat angles C4'-P-C4' energy: -13.081 flat angles P-C4'-P energy: -10.186 tors. eta vs tors. theta energy: -6.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -153.174505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.174505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.174505 (E_RNA) where: Base-Base interactions energy: -82.793 where: short stacking energy: -45.414 Base-Backbone interact. energy: -0.067 local terms energy: -70.314213 where: bonds (distance) C4'-P energy: -15.583 bonds (distance) P-C4' energy: -17.087 flat angles C4'-P-C4' energy: -16.528 flat angles P-C4'-P energy: -7.633 tors. eta vs tors. theta energy: -13.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -88.115278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.115278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.115278 (E_RNA) where: Base-Base interactions energy: -35.783 where: short stacking energy: -22.851 Base-Backbone interact. energy: -1.583 local terms energy: -50.749247 where: bonds (distance) C4'-P energy: -12.138 bonds (distance) P-C4' energy: -13.148 flat angles C4'-P-C4' energy: -15.510 flat angles P-C4'-P energy: -7.275 tors. eta vs tors. theta energy: -2.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -82.061642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.061642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.061642 (E_RNA) where: Base-Base interactions energy: -28.022 where: short stacking energy: -28.022 Base-Backbone interact. energy: -0.049 local terms energy: -53.990253 where: bonds (distance) C4'-P energy: -11.421 bonds (distance) P-C4' energy: -12.986 flat angles C4'-P-C4' energy: -14.425 flat angles P-C4'-P energy: -10.182 tors. eta vs tors. theta energy: -4.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -73.051447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.051447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.051447 (E_RNA) where: Base-Base interactions energy: -26.606 where: short stacking energy: -14.340 Base-Backbone interact. energy: -0.185 local terms energy: -46.260000 where: bonds (distance) C4'-P energy: -11.208 bonds (distance) P-C4' energy: -17.026 flat angles C4'-P-C4' energy: -9.039 flat angles P-C4'-P energy: -10.634 tors. eta vs tors. theta energy: 1.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -75.376099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.376099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.376099 (E_RNA) where: Base-Base interactions energy: -31.416 where: short stacking energy: -21.627 Base-Backbone interact. energy: -0.266 local terms energy: -43.694554 where: bonds (distance) C4'-P energy: -12.924 bonds (distance) P-C4' energy: -10.974 flat angles C4'-P-C4' energy: -6.118 flat angles P-C4'-P energy: -10.264 tors. eta vs tors. theta energy: -3.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -60.886585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -60.886585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -60.886585 (E_RNA) where: Base-Base interactions energy: -14.222 where: short stacking energy: -14.222 Base-Backbone interact. energy: -0.106 local terms energy: -46.559047 where: bonds (distance) C4'-P energy: -13.389 bonds (distance) P-C4' energy: -11.396 flat angles C4'-P-C4' energy: -14.242 flat angles P-C4'-P energy: -6.295 tors. eta vs tors. theta energy: -1.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -164.737030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.737030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.737030 (E_RNA) where: Base-Base interactions energy: -91.160 where: short stacking energy: -55.573 Base-Backbone interact. energy: -0.092 local terms energy: -73.484887 where: bonds (distance) C4'-P energy: -15.101 bonds (distance) P-C4' energy: -15.747 flat angles C4'-P-C4' energy: -17.229 flat angles P-C4'-P energy: -6.986 tors. eta vs tors. theta energy: -18.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -148.948352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.948352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.948352 (E_RNA) where: Base-Base interactions energy: -85.235 where: short stacking energy: -46.647 Base-Backbone interact. energy: -0.268 local terms energy: -63.445033 where: bonds (distance) C4'-P energy: -11.534 bonds (distance) P-C4' energy: -11.811 flat angles C4'-P-C4' energy: -11.379 flat angles P-C4'-P energy: -11.888 tors. eta vs tors. theta energy: -16.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -138.143580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.143580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.143580 (E_RNA) where: Base-Base interactions energy: -78.585 where: short stacking energy: -39.328 Base-Backbone interact. energy: -0.003 local terms energy: -59.555692 where: bonds (distance) C4'-P energy: -16.526 bonds (distance) P-C4' energy: -12.409 flat angles C4'-P-C4' energy: -14.328 flat angles P-C4'-P energy: -5.209 tors. eta vs tors. theta energy: -11.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -145.187683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.187683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.187683 (E_RNA) where: Base-Base interactions energy: -83.348 where: short stacking energy: -40.491 Base-Backbone interact. energy: -0.246 local terms energy: -61.593927 where: bonds (distance) C4'-P energy: -13.909 bonds (distance) P-C4' energy: -15.097 flat angles C4'-P-C4' energy: -12.475 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -7.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -140.669690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.669690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.669690 (E_RNA) where: Base-Base interactions energy: -90.049 where: short stacking energy: -29.640 Base-Backbone interact. energy: -0.632 local terms energy: -49.989401 where: bonds (distance) C4'-P energy: -8.512 bonds (distance) P-C4' energy: -12.663 flat angles C4'-P-C4' energy: -13.743 flat angles P-C4'-P energy: -8.496 tors. eta vs tors. theta energy: -6.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -86.564415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.564415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.564415 (E_RNA) where: Base-Base interactions energy: -33.515 where: short stacking energy: -32.623 Base-Backbone interact. energy: -0.013 local terms energy: -53.035997 where: bonds (distance) C4'-P energy: -15.271 bonds (distance) P-C4' energy: -14.871 flat angles C4'-P-C4' energy: -10.767 flat angles P-C4'-P energy: -8.166 tors. eta vs tors. theta energy: -3.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -84.375405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.375405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.375405 (E_RNA) where: Base-Base interactions energy: -33.400 where: short stacking energy: -20.829 Base-Backbone interact. energy: -0.200 local terms energy: -50.775529 where: bonds (distance) C4'-P energy: -15.903 bonds (distance) P-C4' energy: -11.267 flat angles C4'-P-C4' energy: -10.843 flat angles P-C4'-P energy: -9.808 tors. eta vs tors. theta energy: -2.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -76.109717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.109717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.109717 (E_RNA) where: Base-Base interactions energy: -27.559 where: short stacking energy: -21.741 Base-Backbone interact. energy: -1.092 local terms energy: -47.458785 where: bonds (distance) C4'-P energy: -10.242 bonds (distance) P-C4' energy: -16.336 flat angles C4'-P-C4' energy: -11.660 flat angles P-C4'-P energy: -10.365 tors. eta vs tors. theta energy: 1.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -74.723490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.723490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.723490 (E_RNA) where: Base-Base interactions energy: -28.547 where: short stacking energy: -20.907 Base-Backbone interact. energy: -0.731 local terms energy: -45.445592 where: bonds (distance) C4'-P energy: -13.727 bonds (distance) P-C4' energy: -14.448 flat angles C4'-P-C4' energy: -11.254 flat angles P-C4'-P energy: -5.009 tors. eta vs tors. theta energy: -1.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -59.904447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -59.904447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -59.904447 (E_RNA) where: Base-Base interactions energy: -12.691 where: short stacking energy: -10.601 Base-Backbone interact. energy: -0.016 local terms energy: -47.197759 where: bonds (distance) C4'-P energy: -11.748 bonds (distance) P-C4' energy: -16.643 flat angles C4'-P-C4' energy: -12.100 flat angles P-C4'-P energy: -4.934 tors. eta vs tors. theta energy: -1.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -166.853042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.853042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.853042 (E_RNA) where: Base-Base interactions energy: -90.814 where: short stacking energy: -49.794 Base-Backbone interact. energy: -0.284 local terms energy: -75.754391 where: bonds (distance) C4'-P energy: -14.381 bonds (distance) P-C4' energy: -15.992 flat angles C4'-P-C4' energy: -14.745 flat angles P-C4'-P energy: -10.953 tors. eta vs tors. theta energy: -19.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -152.829854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.829854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.829854 (E_RNA) where: Base-Base interactions energy: -86.169 where: short stacking energy: -52.830 Base-Backbone interact. energy: -0.068 local terms energy: -66.592891 where: bonds (distance) C4'-P energy: -15.549 bonds (distance) P-C4' energy: -14.893 flat angles C4'-P-C4' energy: -11.830 flat angles P-C4'-P energy: -10.637 tors. eta vs tors. theta energy: -13.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -143.639190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.639190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.639190 (E_RNA) where: Base-Base interactions energy: -76.170 where: short stacking energy: -36.518 Base-Backbone interact. energy: -0.302 local terms energy: -67.167477 where: bonds (distance) C4'-P energy: -14.329 bonds (distance) P-C4' energy: -15.695 flat angles C4'-P-C4' energy: -16.362 flat angles P-C4'-P energy: -9.875 tors. eta vs tors. theta energy: -10.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -135.518408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.518408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.518408 (E_RNA) where: Base-Base interactions energy: -76.178 where: short stacking energy: -44.265 Base-Backbone interact. energy: -0.103 local terms energy: -59.236983 where: bonds (distance) C4'-P energy: -13.280 bonds (distance) P-C4' energy: -12.867 flat angles C4'-P-C4' energy: -15.490 flat angles P-C4'-P energy: -7.465 tors. eta vs tors. theta energy: -10.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -158.617388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.617388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.617388 (E_RNA) where: Base-Base interactions energy: -96.665 where: short stacking energy: -43.363 Base-Backbone interact. energy: 0.961 local terms energy: -62.912819 where: bonds (distance) C4'-P energy: -10.754 bonds (distance) P-C4' energy: -15.750 flat angles C4'-P-C4' energy: -15.390 flat angles P-C4'-P energy: -6.726 tors. eta vs tors. theta energy: -14.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -76.869002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.869002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.869002 (E_RNA) where: Base-Base interactions energy: -26.077 where: short stacking energy: -22.981 Base-Backbone interact. energy: -0.199 local terms energy: -50.592100 where: bonds (distance) C4'-P energy: -13.822 bonds (distance) P-C4' energy: -16.168 flat angles C4'-P-C4' energy: -10.825 flat angles P-C4'-P energy: -9.914 tors. eta vs tors. theta energy: 0.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -96.700748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.700748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.700748 (E_RNA) where: Base-Base interactions energy: -48.007 where: short stacking energy: -37.327 Base-Backbone interact. energy: -0.730 local terms energy: -47.963205 where: bonds (distance) C4'-P energy: -12.316 bonds (distance) P-C4' energy: -13.338 flat angles C4'-P-C4' energy: -9.941 flat angles P-C4'-P energy: -7.378 tors. eta vs tors. theta energy: -4.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -75.648716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.648716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.648716 (E_RNA) where: Base-Base interactions energy: -24.005 where: short stacking energy: -20.541 Base-Backbone interact. energy: -0.256 local terms energy: -51.388107 where: bonds (distance) C4'-P energy: -11.969 bonds (distance) P-C4' energy: -14.000 flat angles C4'-P-C4' energy: -11.741 flat angles P-C4'-P energy: -9.230 tors. eta vs tors. theta energy: -4.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -75.725429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.725429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.725429 (E_RNA) where: Base-Base interactions energy: -25.943 where: short stacking energy: -25.943 Base-Backbone interact. energy: -0.034 local terms energy: -49.748175 where: bonds (distance) C4'-P energy: -16.029 bonds (distance) P-C4' energy: -13.592 flat angles C4'-P-C4' energy: -11.033 flat angles P-C4'-P energy: -6.408 tors. eta vs tors. theta energy: -2.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -71.357678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.357678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.357678 (E_RNA) where: Base-Base interactions energy: -24.634 where: short stacking energy: -23.487 Base-Backbone interact. energy: -0.295 local terms energy: -46.429075 where: bonds (distance) C4'-P energy: -12.693 bonds (distance) P-C4' energy: -13.360 flat angles C4'-P-C4' energy: -11.650 flat angles P-C4'-P energy: -5.393 tors. eta vs tors. theta energy: -3.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -167.092141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.092141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.092141 (E_RNA) where: Base-Base interactions energy: -91.473 where: short stacking energy: -53.827 Base-Backbone interact. energy: -0.305 local terms energy: -75.313762 where: bonds (distance) C4'-P energy: -16.141 bonds (distance) P-C4' energy: -14.480 flat angles C4'-P-C4' energy: -16.455 flat angles P-C4'-P energy: -11.409 tors. eta vs tors. theta energy: -16.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -160.726506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.726506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.726506 (E_RNA) where: Base-Base interactions energy: -100.388 where: short stacking energy: -46.929 Base-Backbone interact. energy: -0.184 local terms energy: -60.154622 where: bonds (distance) C4'-P energy: -14.671 bonds (distance) P-C4' energy: -13.331 flat angles C4'-P-C4' energy: -15.102 flat angles P-C4'-P energy: -6.541 tors. eta vs tors. theta energy: -10.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -141.806260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.806260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.806260 (E_RNA) where: Base-Base interactions energy: -84.123 where: short stacking energy: -53.089 Base-Backbone interact. energy: -0.507 local terms energy: -57.175673 where: bonds (distance) C4'-P energy: -12.244 bonds (distance) P-C4' energy: -11.169 flat angles C4'-P-C4' energy: -14.545 flat angles P-C4'-P energy: -5.918 tors. eta vs tors. theta energy: -13.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -157.132082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.132082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.132082 (E_RNA) where: Base-Base interactions energy: -85.745 where: short stacking energy: -40.484 Base-Backbone interact. energy: -1.786 local terms energy: -69.601388 where: bonds (distance) C4'-P energy: -15.235 bonds (distance) P-C4' energy: -14.998 flat angles C4'-P-C4' energy: -16.193 flat angles P-C4'-P energy: -12.077 tors. eta vs tors. theta energy: -11.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -129.161537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.161537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.161537 (E_RNA) where: Base-Base interactions energy: -75.490 where: short stacking energy: -39.311 Base-Backbone interact. energy: -1.040 local terms energy: -52.631309 where: bonds (distance) C4'-P energy: -14.554 bonds (distance) P-C4' energy: -14.328 flat angles C4'-P-C4' energy: -5.932 flat angles P-C4'-P energy: -9.706 tors. eta vs tors. theta energy: -8.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -125.027100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.027100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.027100 (E_RNA) where: Base-Base interactions energy: -73.379 where: short stacking energy: -39.949 Base-Backbone interact. energy: -0.550 local terms energy: -51.098418 where: bonds (distance) C4'-P energy: -14.183 bonds (distance) P-C4' energy: -15.983 flat angles C4'-P-C4' energy: -9.694 flat angles P-C4'-P energy: -7.172 tors. eta vs tors. theta energy: -4.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -83.169438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.169438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.169438 (E_RNA) where: Base-Base interactions energy: -31.555 where: short stacking energy: -31.555 Base-Backbone interact. energy: 0.801 local terms energy: -52.415943 where: bonds (distance) C4'-P energy: -13.756 bonds (distance) P-C4' energy: -13.869 flat angles C4'-P-C4' energy: -14.645 flat angles P-C4'-P energy: -7.545 tors. eta vs tors. theta energy: -2.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -85.322127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.322127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.322127 (E_RNA) where: Base-Base interactions energy: -35.406 where: short stacking energy: -35.406 Base-Backbone interact. energy: -0.134 local terms energy: -49.782327 where: bonds (distance) C4'-P energy: -7.491 bonds (distance) P-C4' energy: -12.572 flat angles C4'-P-C4' energy: -12.488 flat angles P-C4'-P energy: -7.299 tors. eta vs tors. theta energy: -9.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -74.148361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.148361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.148361 (E_RNA) where: Base-Base interactions energy: -22.335 where: short stacking energy: -22.129 Base-Backbone interact. energy: -0.119 local terms energy: -51.693830 where: bonds (distance) C4'-P energy: -13.682 bonds (distance) P-C4' energy: -12.797 flat angles C4'-P-C4' energy: -11.021 flat angles P-C4'-P energy: -10.950 tors. eta vs tors. theta energy: -3.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -71.658226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.658226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.658226 (E_RNA) where: Base-Base interactions energy: -30.695 where: short stacking energy: -25.457 Base-Backbone interact. energy: -0.229 local terms energy: -40.734579 where: bonds (distance) C4'-P energy: -10.921 bonds (distance) P-C4' energy: -12.842 flat angles C4'-P-C4' energy: -14.628 flat angles P-C4'-P energy: -3.008 tors. eta vs tors. theta energy: 0.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -166.677679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.677679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.677679 (E_RNA) where: Base-Base interactions energy: -94.618 where: short stacking energy: -57.837 Base-Backbone interact. energy: -0.037 local terms energy: -72.023054 where: bonds (distance) C4'-P energy: -15.226 bonds (distance) P-C4' energy: -12.598 flat angles C4'-P-C4' energy: -16.820 flat angles P-C4'-P energy: -9.262 tors. eta vs tors. theta energy: -18.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -145.640070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.640070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.640070 (E_RNA) where: Base-Base interactions energy: -84.942 where: short stacking energy: -46.800 Base-Backbone interact. energy: -0.027 local terms energy: -60.670922 where: bonds (distance) C4'-P energy: -16.604 bonds (distance) P-C4' energy: -11.901 flat angles C4'-P-C4' energy: -14.833 flat angles P-C4'-P energy: -9.573 tors. eta vs tors. theta energy: -7.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -140.894020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.894020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.894020 (E_RNA) where: Base-Base interactions energy: -78.291 where: short stacking energy: -39.429 Base-Backbone interact. energy: -0.140 local terms energy: -62.463793 where: bonds (distance) C4'-P energy: -14.142 bonds (distance) P-C4' energy: -16.523 flat angles C4'-P-C4' energy: -14.785 flat angles P-C4'-P energy: -10.138 tors. eta vs tors. theta energy: -6.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -155.569261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.569261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.569261 (E_RNA) where: Base-Base interactions energy: -93.201 where: short stacking energy: -52.537 Base-Backbone interact. energy: -0.028 local terms energy: -62.340167 where: bonds (distance) C4'-P energy: -12.820 bonds (distance) P-C4' energy: -14.180 flat angles C4'-P-C4' energy: -11.761 flat angles P-C4'-P energy: -10.011 tors. eta vs tors. theta energy: -13.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -124.736797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.736797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.736797 (E_RNA) where: Base-Base interactions energy: -68.858 where: short stacking energy: -40.071 Base-Backbone interact. energy: 1.196 local terms energy: -57.075307 where: bonds (distance) C4'-P energy: -15.102 bonds (distance) P-C4' energy: -14.303 flat angles C4'-P-C4' energy: -10.353 flat angles P-C4'-P energy: -8.068 tors. eta vs tors. theta energy: -9.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -124.421849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.421849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.421849 (E_RNA) where: Base-Base interactions energy: -70.397 where: short stacking energy: -40.342 Base-Backbone interact. energy: -0.029 local terms energy: -53.995621 where: bonds (distance) C4'-P energy: -10.016 bonds (distance) P-C4' energy: -13.931 flat angles C4'-P-C4' energy: -13.564 flat angles P-C4'-P energy: -6.226 tors. eta vs tors. theta energy: -10.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -78.767437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.767437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.767437 (E_RNA) where: Base-Base interactions energy: -27.476 where: short stacking energy: -24.906 Base-Backbone interact. energy: -0.237 local terms energy: -51.054547 where: bonds (distance) C4'-P energy: -11.955 bonds (distance) P-C4' energy: -11.791 flat angles C4'-P-C4' energy: -13.242 flat angles P-C4'-P energy: -12.512 tors. eta vs tors. theta energy: -1.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -80.669019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.669019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.669019 (E_RNA) where: Base-Base interactions energy: -44.255 where: short stacking energy: -10.094 Base-Backbone interact. energy: -0.217 local terms energy: -36.197503 where: bonds (distance) C4'-P energy: -12.182 bonds (distance) P-C4' energy: -13.266 flat angles C4'-P-C4' energy: -11.909 flat angles P-C4'-P energy: -1.232 tors. eta vs tors. theta energy: 2.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -75.182228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.182228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.182228 (E_RNA) where: Base-Base interactions energy: -26.486 where: short stacking energy: -20.028 Base-Backbone interact. energy: -1.707 local terms energy: -46.988582 where: bonds (distance) C4'-P energy: -10.692 bonds (distance) P-C4' energy: -14.595 flat angles C4'-P-C4' energy: -11.243 flat angles P-C4'-P energy: -9.548 tors. eta vs tors. theta energy: -0.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -76.278022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.278022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.278022 (E_RNA) where: Base-Base interactions energy: -22.024 where: short stacking energy: -22.024 Base-Backbone interact. energy: -0.238 local terms energy: -54.016243 where: bonds (distance) C4'-P energy: -15.482 bonds (distance) P-C4' energy: -15.799 flat angles C4'-P-C4' energy: -14.891 flat angles P-C4'-P energy: -8.398 tors. eta vs tors. theta energy: 0.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -164.020797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.020797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.020797 (E_RNA) where: Base-Base interactions energy: -91.417 where: short stacking energy: -54.013 Base-Backbone interact. energy: -0.097 local terms energy: -72.507087 where: bonds (distance) C4'-P energy: -14.575 bonds (distance) P-C4' energy: -14.001 flat angles C4'-P-C4' energy: -14.069 flat angles P-C4'-P energy: -11.145 tors. eta vs tors. theta energy: -18.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -145.110975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.110975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.110975 (E_RNA) where: Base-Base interactions energy: -87.936 where: short stacking energy: -38.601 Base-Backbone interact. energy: -0.501 local terms energy: -56.673759 where: bonds (distance) C4'-P energy: -14.679 bonds (distance) P-C4' energy: -14.085 flat angles C4'-P-C4' energy: -15.216 flat angles P-C4'-P energy: -7.669 tors. eta vs tors. theta energy: -5.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -148.072849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.072849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.072849 (E_RNA) where: Base-Base interactions energy: -85.130 where: short stacking energy: -44.583 Base-Backbone interact. energy: -0.491 local terms energy: -62.451238 where: bonds (distance) C4'-P energy: -15.064 bonds (distance) P-C4' energy: -14.014 flat angles C4'-P-C4' energy: -13.810 flat angles P-C4'-P energy: -7.360 tors. eta vs tors. theta energy: -12.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -148.157176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.157176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.157176 (E_RNA) where: Base-Base interactions energy: -81.370 where: short stacking energy: -43.171 Base-Backbone interact. energy: -1.028 local terms energy: -65.759193 where: bonds (distance) C4'-P energy: -15.159 bonds (distance) P-C4' energy: -13.710 flat angles C4'-P-C4' energy: -15.098 flat angles P-C4'-P energy: -9.883 tors. eta vs tors. theta energy: -11.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -122.718113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.718113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.718113 (E_RNA) where: Base-Base interactions energy: -73.640 where: short stacking energy: -26.008 Base-Backbone interact. energy: -0.076 local terms energy: -49.001502 where: bonds (distance) C4'-P energy: -15.345 bonds (distance) P-C4' energy: -9.196 flat angles C4'-P-C4' energy: -14.908 flat angles P-C4'-P energy: -6.832 tors. eta vs tors. theta energy: -2.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -127.642857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.642857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.642857 (E_RNA) where: Base-Base interactions energy: -77.874 where: short stacking energy: -41.506 Base-Backbone interact. energy: -0.187 local terms energy: -49.581915 where: bonds (distance) C4'-P energy: -10.133 bonds (distance) P-C4' energy: -10.365 flat angles C4'-P-C4' energy: -13.587 flat angles P-C4'-P energy: -8.616 tors. eta vs tors. theta energy: -6.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -79.920928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.920928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.920928 (E_RNA) where: Base-Base interactions energy: -24.441 where: short stacking energy: -24.441 Base-Backbone interact. energy: -0.078 local terms energy: -55.401984 where: bonds (distance) C4'-P energy: -16.235 bonds (distance) P-C4' energy: -16.330 flat angles C4'-P-C4' energy: -9.920 flat angles P-C4'-P energy: -7.761 tors. eta vs tors. theta energy: -5.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -83.559819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.559819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.559819 (E_RNA) where: Base-Base interactions energy: -26.651 where: short stacking energy: -17.703 Base-Backbone interact. energy: -0.149 local terms energy: -56.760613 where: bonds (distance) C4'-P energy: -14.464 bonds (distance) P-C4' energy: -13.085 flat angles C4'-P-C4' energy: -13.963 flat angles P-C4'-P energy: -12.441 tors. eta vs tors. theta energy: -2.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -66.551708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.551708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.551708 (E_RNA) where: Base-Base interactions energy: -22.490 where: short stacking energy: -21.845 Base-Backbone interact. energy: 1.085 local terms energy: -45.146863 where: bonds (distance) C4'-P energy: -10.390 bonds (distance) P-C4' energy: -14.296 flat angles C4'-P-C4' energy: -5.437 flat angles P-C4'-P energy: -9.736 tors. eta vs tors. theta energy: -5.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -71.837614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.837614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.837614 (E_RNA) where: Base-Base interactions energy: -28.586 where: short stacking energy: -22.134 Base-Backbone interact. energy: -0.022 local terms energy: -43.229778 where: bonds (distance) C4'-P energy: -10.505 bonds (distance) P-C4' energy: -12.663 flat angles C4'-P-C4' energy: -9.164 flat angles P-C4'-P energy: -7.983 tors. eta vs tors. theta energy: -2.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -149.201044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.201044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.201044 (E_RNA) where: Base-Base interactions energy: -84.566 where: short stacking energy: -49.233 Base-Backbone interact. energy: -0.116 local terms energy: -64.518219 where: bonds (distance) C4'-P energy: -16.074 bonds (distance) P-C4' energy: -15.867 flat angles C4'-P-C4' energy: -13.599 flat angles P-C4'-P energy: -10.255 tors. eta vs tors. theta energy: -8.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -168.610251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.610251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.610251 (E_RNA) where: Base-Base interactions energy: -93.237 where: short stacking energy: -52.207 Base-Backbone interact. energy: -0.055 local terms energy: -75.318352 where: bonds (distance) C4'-P energy: -16.890 bonds (distance) P-C4' energy: -12.612 flat angles C4'-P-C4' energy: -17.952 flat angles P-C4'-P energy: -9.312 tors. eta vs tors. theta energy: -18.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -173.195266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.195266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.195266 (E_RNA) where: Base-Base interactions energy: -116.966 where: short stacking energy: -34.855 Base-Backbone interact. energy: -0.624 local terms energy: -55.605800 where: bonds (distance) C4'-P energy: -10.929 bonds (distance) P-C4' energy: -14.408 flat angles C4'-P-C4' energy: -11.400 flat angles P-C4'-P energy: -11.613 tors. eta vs tors. theta energy: -7.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -134.036838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.036838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.036838 (E_RNA) where: Base-Base interactions energy: -76.823 where: short stacking energy: -36.999 Base-Backbone interact. energy: 0.178 local terms energy: -57.391838 where: bonds (distance) C4'-P energy: -11.413 bonds (distance) P-C4' energy: -12.965 flat angles C4'-P-C4' energy: -13.568 flat angles P-C4'-P energy: -7.488 tors. eta vs tors. theta energy: -11.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -101.403124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.403124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.403124 (E_RNA) where: Base-Base interactions energy: -43.395 where: short stacking energy: -28.733 Base-Backbone interact. energy: -0.095 local terms energy: -57.912937 where: bonds (distance) C4'-P energy: -15.370 bonds (distance) P-C4' energy: -13.938 flat angles C4'-P-C4' energy: -13.675 flat angles P-C4'-P energy: -8.869 tors. eta vs tors. theta energy: -6.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -73.650574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.650574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.650574 (E_RNA) where: Base-Base interactions energy: -20.363 where: short stacking energy: -20.363 Base-Backbone interact. energy: -0.025 local terms energy: -53.263237 where: bonds (distance) C4'-P energy: -15.525 bonds (distance) P-C4' energy: -13.219 flat angles C4'-P-C4' energy: -12.140 flat angles P-C4'-P energy: -8.805 tors. eta vs tors. theta energy: -3.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -83.554343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.554343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.554343 (E_RNA) where: Base-Base interactions energy: -34.716 where: short stacking energy: -27.802 Base-Backbone interact. energy: -0.073 local terms energy: -48.765585 where: bonds (distance) C4'-P energy: -9.184 bonds (distance) P-C4' energy: -11.739 flat angles C4'-P-C4' energy: -11.389 flat angles P-C4'-P energy: -8.745 tors. eta vs tors. theta energy: -7.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -70.611639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.611639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.611639 (E_RNA) where: Base-Base interactions energy: -21.607 where: short stacking energy: -16.704 Base-Backbone interact. energy: -0.108 local terms energy: -48.896999 where: bonds (distance) C4'-P energy: -12.493 bonds (distance) P-C4' energy: -14.345 flat angles C4'-P-C4' energy: -10.354 flat angles P-C4'-P energy: -8.728 tors. eta vs tors. theta energy: -2.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -74.384154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.384154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.384154 (E_RNA) where: Base-Base interactions energy: -23.043 where: short stacking energy: -11.563 Base-Backbone interact. energy: -0.392 local terms energy: -50.949212 where: bonds (distance) C4'-P energy: -13.557 bonds (distance) P-C4' energy: -15.288 flat angles C4'-P-C4' energy: -11.149 flat angles P-C4'-P energy: -12.120 tors. eta vs tors. theta energy: 1.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -65.713647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.713647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.713647 (E_RNA) where: Base-Base interactions energy: -18.371 where: short stacking energy: -15.401 Base-Backbone interact. energy: 1.306 local terms energy: -48.649274 where: bonds (distance) C4'-P energy: -12.634 bonds (distance) P-C4' energy: -15.724 flat angles C4'-P-C4' energy: -14.558 flat angles P-C4'-P energy: -8.989 tors. eta vs tors. theta energy: 3.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -155.183725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.183725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.183725 (E_RNA) where: Base-Base interactions energy: -88.638 where: short stacking energy: -41.121 Base-Backbone interact. energy: -0.105 local terms energy: -66.440855 where: bonds (distance) C4'-P energy: -15.069 bonds (distance) P-C4' energy: -13.876 flat angles C4'-P-C4' energy: -14.327 flat angles P-C4'-P energy: -10.540 tors. eta vs tors. theta energy: -12.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -159.044448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.044448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.044448 (E_RNA) where: Base-Base interactions energy: -85.915 where: short stacking energy: -50.891 Base-Backbone interact. energy: -0.013 local terms energy: -73.116652 where: bonds (distance) C4'-P energy: -13.123 bonds (distance) P-C4' energy: -16.115 flat angles C4'-P-C4' energy: -15.295 flat angles P-C4'-P energy: -12.857 tors. eta vs tors. theta energy: -15.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -153.710365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.710365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.710365 (E_RNA) where: Base-Base interactions energy: -88.191 where: short stacking energy: -44.775 Base-Backbone interact. energy: -0.214 local terms energy: -65.305357 where: bonds (distance) C4'-P energy: -11.124 bonds (distance) P-C4' energy: -15.439 flat angles C4'-P-C4' energy: -17.166 flat angles P-C4'-P energy: -10.411 tors. eta vs tors. theta energy: -11.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -141.893255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.893255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.893255 (E_RNA) where: Base-Base interactions energy: -73.688 where: short stacking energy: -42.306 Base-Backbone interact. energy: -0.367 local terms energy: -67.838041 where: bonds (distance) C4'-P energy: -14.227 bonds (distance) P-C4' energy: -13.750 flat angles C4'-P-C4' energy: -15.528 flat angles P-C4'-P energy: -10.199 tors. eta vs tors. theta energy: -14.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -95.186534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.186534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.186534 (E_RNA) where: Base-Base interactions energy: -32.862 where: short stacking energy: -27.648 Base-Backbone interact. energy: -0.255 local terms energy: -62.070020 where: bonds (distance) C4'-P energy: -12.983 bonds (distance) P-C4' energy: -16.818 flat angles C4'-P-C4' energy: -14.617 flat angles P-C4'-P energy: -8.985 tors. eta vs tors. theta energy: -8.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -99.440951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.440951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.440951 (E_RNA) where: Base-Base interactions energy: -51.128 where: short stacking energy: -27.626 Base-Backbone interact. energy: -0.922 local terms energy: -47.390801 where: bonds (distance) C4'-P energy: -10.002 bonds (distance) P-C4' energy: -16.234 flat angles C4'-P-C4' energy: -14.048 flat angles P-C4'-P energy: -6.191 tors. eta vs tors. theta energy: -0.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -92.563291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.563291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.563291 (E_RNA) where: Base-Base interactions energy: -33.699 where: short stacking energy: -30.896 Base-Backbone interact. energy: -0.080 local terms energy: -58.784123 where: bonds (distance) C4'-P energy: -13.615 bonds (distance) P-C4' energy: -15.667 flat angles C4'-P-C4' energy: -13.667 flat angles P-C4'-P energy: -10.468 tors. eta vs tors. theta energy: -5.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -89.523050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.523050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.523050 (E_RNA) where: Base-Base interactions energy: -37.064 where: short stacking energy: -28.705 Base-Backbone interact. energy: 1.086 local terms energy: -53.545440 where: bonds (distance) C4'-P energy: -11.189 bonds (distance) P-C4' energy: -13.964 flat angles C4'-P-C4' energy: -12.835 flat angles P-C4'-P energy: -9.333 tors. eta vs tors. theta energy: -6.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -78.856841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.856841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.856841 (E_RNA) where: Base-Base interactions energy: -32.065 where: short stacking energy: -32.065 Base-Backbone interact. energy: -1.655 local terms energy: -45.136690 where: bonds (distance) C4'-P energy: -10.606 bonds (distance) P-C4' energy: -9.170 flat angles C4'-P-C4' energy: -14.955 flat angles P-C4'-P energy: -6.726 tors. eta vs tors. theta energy: -3.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -74.239111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.239111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.239111 (E_RNA) where: Base-Base interactions energy: -19.842 where: short stacking energy: -18.952 Base-Backbone interact. energy: -0.238 local terms energy: -54.159441 where: bonds (distance) C4'-P energy: -14.419 bonds (distance) P-C4' energy: -14.350 flat angles C4'-P-C4' energy: -14.212 flat angles P-C4'-P energy: -8.725 tors. eta vs tors. theta energy: -2.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -158.334989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.334989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.334989 (E_RNA) where: Base-Base interactions energy: -98.268 where: short stacking energy: -48.937 Base-Backbone interact. energy: -0.210 local terms energy: -59.856972 where: bonds (distance) C4'-P energy: -11.073 bonds (distance) P-C4' energy: -14.595 flat angles C4'-P-C4' energy: -11.458 flat angles P-C4'-P energy: -10.757 tors. eta vs tors. theta energy: -11.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -153.675185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.675185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.675185 (E_RNA) where: Base-Base interactions energy: -87.759 where: short stacking energy: -49.032 Base-Backbone interact. energy: -0.205 local terms energy: -65.710837 where: bonds (distance) C4'-P energy: -13.745 bonds (distance) P-C4' energy: -13.245 flat angles C4'-P-C4' energy: -14.929 flat angles P-C4'-P energy: -9.311 tors. eta vs tors. theta energy: -14.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -167.619389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.619389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.619389 (E_RNA) where: Base-Base interactions energy: -98.086 where: short stacking energy: -48.589 Base-Backbone interact. energy: -0.407 local terms energy: -69.126357 where: bonds (distance) C4'-P energy: -16.207 bonds (distance) P-C4' energy: -15.206 flat angles C4'-P-C4' energy: -12.742 flat angles P-C4'-P energy: -7.795 tors. eta vs tors. theta energy: -17.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -151.060592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.060592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.060592 (E_RNA) where: Base-Base interactions energy: -86.692 where: short stacking energy: -46.053 Base-Backbone interact. energy: -0.015 local terms energy: -64.353945 where: bonds (distance) C4'-P energy: -11.385 bonds (distance) P-C4' energy: -15.037 flat angles C4'-P-C4' energy: -14.194 flat angles P-C4'-P energy: -9.774 tors. eta vs tors. theta energy: -13.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -130.932152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.932152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.932152 (E_RNA) where: Base-Base interactions energy: -68.426 where: short stacking energy: -44.656 Base-Backbone interact. energy: -1.203 local terms energy: -61.302519 where: bonds (distance) C4'-P energy: -14.518 bonds (distance) P-C4' energy: -12.933 flat angles C4'-P-C4' energy: -13.407 flat angles P-C4'-P energy: -10.099 tors. eta vs tors. theta energy: -10.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -85.979663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.979663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.979663 (E_RNA) where: Base-Base interactions energy: -39.627 where: short stacking energy: -17.022 Base-Backbone interact. energy: -0.375 local terms energy: -45.977729 where: bonds (distance) C4'-P energy: -11.650 bonds (distance) P-C4' energy: -14.941 flat angles C4'-P-C4' energy: -14.006 flat angles P-C4'-P energy: -8.367 tors. eta vs tors. theta energy: 2.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -73.563108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.563108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.563108 (E_RNA) where: Base-Base interactions energy: -26.587 where: short stacking energy: -26.009 Base-Backbone interact. energy: -0.329 local terms energy: -46.647266 where: bonds (distance) C4'-P energy: -12.899 bonds (distance) P-C4' energy: -11.555 flat angles C4'-P-C4' energy: -12.987 flat angles P-C4'-P energy: -9.620 tors. eta vs tors. theta energy: 0.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -73.244210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.244210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.244210 (E_RNA) where: Base-Base interactions energy: -21.743 where: short stacking energy: -21.743 Base-Backbone interact. energy: -0.403 local terms energy: -51.098356 where: bonds (distance) C4'-P energy: -13.024 bonds (distance) P-C4' energy: -14.364 flat angles C4'-P-C4' energy: -12.071 flat angles P-C4'-P energy: -10.220 tors. eta vs tors. theta energy: -1.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -76.767976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.767976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.767976 (E_RNA) where: Base-Base interactions energy: -26.852 where: short stacking energy: -26.852 Base-Backbone interact. energy: -0.139 local terms energy: -49.777294 where: bonds (distance) C4'-P energy: -11.045 bonds (distance) P-C4' energy: -12.912 flat angles C4'-P-C4' energy: -15.453 flat angles P-C4'-P energy: -6.720 tors. eta vs tors. theta energy: -3.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -70.496721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.496721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.496721 (E_RNA) where: Base-Base interactions energy: -18.094 where: short stacking energy: -18.094 Base-Backbone interact. energy: 0.720 local terms energy: -53.123344 where: bonds (distance) C4'-P energy: -15.556 bonds (distance) P-C4' energy: -15.506 flat angles C4'-P-C4' energy: -12.759 flat angles P-C4'-P energy: -8.362 tors. eta vs tors. theta energy: -0.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -167.122791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.122791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.122791 (E_RNA) where: Base-Base interactions energy: -94.737 where: short stacking energy: -56.029 Base-Backbone interact. energy: -0.125 local terms energy: -72.260869 where: bonds (distance) C4'-P energy: -13.297 bonds (distance) P-C4' energy: -13.928 flat angles C4'-P-C4' energy: -15.248 flat angles P-C4'-P energy: -13.007 tors. eta vs tors. theta energy: -16.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -157.039563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.039563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.039563 (E_RNA) where: Base-Base interactions energy: -88.995 where: short stacking energy: -52.280 Base-Backbone interact. energy: 0.972 local terms energy: -69.016673 where: bonds (distance) C4'-P energy: -17.184 bonds (distance) P-C4' energy: -15.113 flat angles C4'-P-C4' energy: -15.300 flat angles P-C4'-P energy: -8.164 tors. eta vs tors. theta energy: -13.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -150.128479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.128479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.128479 (E_RNA) where: Base-Base interactions energy: -87.581 where: short stacking energy: -58.038 Base-Backbone interact. energy: -0.230 local terms energy: -62.317939 where: bonds (distance) C4'-P energy: -10.540 bonds (distance) P-C4' energy: -14.469 flat angles C4'-P-C4' energy: -11.774 flat angles P-C4'-P energy: -6.365 tors. eta vs tors. theta energy: -19.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -135.449001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.449001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.449001 (E_RNA) where: Base-Base interactions energy: -70.971 where: short stacking energy: -41.025 Base-Backbone interact. energy: -0.115 local terms energy: -64.362771 where: bonds (distance) C4'-P energy: -12.704 bonds (distance) P-C4' energy: -16.815 flat angles C4'-P-C4' energy: -14.392 flat angles P-C4'-P energy: -9.561 tors. eta vs tors. theta energy: -10.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -159.730466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.730466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.730466 (E_RNA) where: Base-Base interactions energy: -91.291 where: short stacking energy: -52.568 Base-Backbone interact. energy: -0.000 local terms energy: -68.439397 where: bonds (distance) C4'-P energy: -13.085 bonds (distance) P-C4' energy: -17.337 flat angles C4'-P-C4' energy: -10.762 flat angles P-C4'-P energy: -9.770 tors. eta vs tors. theta energy: -17.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -89.155057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.155057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.155057 (E_RNA) where: Base-Base interactions energy: -38.476 where: short stacking energy: -23.429 Base-Backbone interact. energy: -0.301 local terms energy: -50.377412 where: bonds (distance) C4'-P energy: -12.530 bonds (distance) P-C4' energy: -11.683 flat angles C4'-P-C4' energy: -12.070 flat angles P-C4'-P energy: -11.546 tors. eta vs tors. theta energy: -2.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -76.059575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.059575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.059575 (E_RNA) where: Base-Base interactions energy: -36.986 where: short stacking energy: -35.341 Base-Backbone interact. energy: 6.414 local terms energy: -45.487681 where: bonds (distance) C4'-P energy: -12.288 bonds (distance) P-C4' energy: -6.779 flat angles C4'-P-C4' energy: -15.128 flat angles P-C4'-P energy: -6.770 tors. eta vs tors. theta energy: -4.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -79.605743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.605743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.605743 (E_RNA) where: Base-Base interactions energy: -30.666 where: short stacking energy: -13.378 Base-Backbone interact. energy: -0.075 local terms energy: -48.864951 where: bonds (distance) C4'-P energy: -15.602 bonds (distance) P-C4' energy: -14.686 flat angles C4'-P-C4' energy: -14.205 flat angles P-C4'-P energy: -9.590 tors. eta vs tors. theta energy: 5.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -74.960560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.960560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.960560 (E_RNA) where: Base-Base interactions energy: -34.965 where: short stacking energy: -15.072 Base-Backbone interact. energy: -1.759 local terms energy: -38.237184 where: bonds (distance) C4'-P energy: -10.746 bonds (distance) P-C4' energy: -13.096 flat angles C4'-P-C4' energy: -14.119 flat angles P-C4'-P energy: -6.945 tors. eta vs tors. theta energy: 6.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -69.177909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.177909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.177909 (E_RNA) where: Base-Base interactions energy: -22.991 where: short stacking energy: -22.991 Base-Backbone interact. energy: -0.063 local terms energy: -46.124324 where: bonds (distance) C4'-P energy: -13.173 bonds (distance) P-C4' energy: -14.829 flat angles C4'-P-C4' energy: -10.896 flat angles P-C4'-P energy: -6.746 tors. eta vs tors. theta energy: -0.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -154.013809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.013809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.013809 (E_RNA) where: Base-Base interactions energy: -81.442 where: short stacking energy: -47.439 Base-Backbone interact. energy: -0.022 local terms energy: -72.550206 where: bonds (distance) C4'-P energy: -14.977 bonds (distance) P-C4' energy: -16.449 flat angles C4'-P-C4' energy: -17.084 flat angles P-C4'-P energy: -9.516 tors. eta vs tors. theta energy: -14.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -154.431993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.431993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.431993 (E_RNA) where: Base-Base interactions energy: -88.613 where: short stacking energy: -50.340 Base-Backbone interact. energy: 0.197 local terms energy: -66.015405 where: bonds (distance) C4'-P energy: -16.517 bonds (distance) P-C4' energy: -15.867 flat angles C4'-P-C4' energy: -16.018 flat angles P-C4'-P energy: -5.537 tors. eta vs tors. theta energy: -12.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -130.785441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.785441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.785441 (E_RNA) where: Base-Base interactions energy: -74.743 where: short stacking energy: -38.998 Base-Backbone interact. energy: -1.001 local terms energy: -55.041685 where: bonds (distance) C4'-P energy: -12.523 bonds (distance) P-C4' energy: -12.188 flat angles C4'-P-C4' energy: -11.352 flat angles P-C4'-P energy: -9.455 tors. eta vs tors. theta energy: -9.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -150.452593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.452593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.452593 (E_RNA) where: Base-Base interactions energy: -87.141 where: short stacking energy: -51.898 Base-Backbone interact. energy: -0.250 local terms energy: -63.061373 where: bonds (distance) C4'-P energy: -11.824 bonds (distance) P-C4' energy: -11.242 flat angles C4'-P-C4' energy: -14.895 flat angles P-C4'-P energy: -9.120 tors. eta vs tors. theta energy: -15.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -159.153169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.153169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.153169 (E_RNA) where: Base-Base interactions energy: -100.892 where: short stacking energy: -42.483 Base-Backbone interact. energy: -0.732 local terms energy: -57.529399 where: bonds (distance) C4'-P energy: -9.716 bonds (distance) P-C4' energy: -13.193 flat angles C4'-P-C4' energy: -12.042 flat angles P-C4'-P energy: -12.446 tors. eta vs tors. theta energy: -10.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -89.771200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.771200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.771200 (E_RNA) where: Base-Base interactions energy: -33.664 where: short stacking energy: -23.576 Base-Backbone interact. energy: -0.178 local terms energy: -55.929017 where: bonds (distance) C4'-P energy: -13.958 bonds (distance) P-C4' energy: -15.204 flat angles C4'-P-C4' energy: -15.752 flat angles P-C4'-P energy: -10.937 tors. eta vs tors. theta energy: -0.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -83.794835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.794835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.794835 (E_RNA) where: Base-Base interactions energy: -38.065 where: short stacking energy: -27.646 Base-Backbone interact. energy: -0.091 local terms energy: -45.638784 where: bonds (distance) C4'-P energy: -12.257 bonds (distance) P-C4' energy: -16.241 flat angles C4'-P-C4' energy: -7.490 flat angles P-C4'-P energy: -4.472 tors. eta vs tors. theta energy: -5.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -77.364739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.364739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.364739 (E_RNA) where: Base-Base interactions energy: -28.388 where: short stacking energy: -25.202 Base-Backbone interact. energy: -0.241 local terms energy: -48.735959 where: bonds (distance) C4'-P energy: -7.879 bonds (distance) P-C4' energy: -17.094 flat angles C4'-P-C4' energy: -11.031 flat angles P-C4'-P energy: -11.654 tors. eta vs tors. theta energy: -1.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -78.492624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.492624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.492624 (E_RNA) where: Base-Base interactions energy: -36.786 where: short stacking energy: -15.637 Base-Backbone interact. energy: -0.014 local terms energy: -41.693093 where: bonds (distance) C4'-P energy: -7.498 bonds (distance) P-C4' energy: -15.937 flat angles C4'-P-C4' energy: -10.023 flat angles P-C4'-P energy: -9.095 tors. eta vs tors. theta energy: 0.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -75.316297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.316297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.316297 (E_RNA) where: Base-Base interactions energy: -19.533 where: short stacking energy: -17.943 Base-Backbone interact. energy: -0.790 local terms energy: -54.993285 where: bonds (distance) C4'-P energy: -13.744 bonds (distance) P-C4' energy: -14.541 flat angles C4'-P-C4' energy: -16.536 flat angles P-C4'-P energy: -9.341 tors. eta vs tors. theta energy: -0.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -157.253347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.253347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.253347 (E_RNA) where: Base-Base interactions energy: -85.334 where: short stacking energy: -48.622 Base-Backbone interact. energy: -0.022 local terms energy: -71.898042 where: bonds (distance) C4'-P energy: -13.558 bonds (distance) P-C4' energy: -15.830 flat angles C4'-P-C4' energy: -15.892 flat angles P-C4'-P energy: -11.219 tors. eta vs tors. theta energy: -15.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -158.859991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.859991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.859991 (E_RNA) where: Base-Base interactions energy: -91.852 where: short stacking energy: -42.100 Base-Backbone interact. energy: -0.325 local terms energy: -66.682712 where: bonds (distance) C4'-P energy: -14.136 bonds (distance) P-C4' energy: -15.950 flat angles C4'-P-C4' energy: -16.094 flat angles P-C4'-P energy: -9.183 tors. eta vs tors. theta energy: -11.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -138.390204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.390204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.390204 (E_RNA) where: Base-Base interactions energy: -82.902 where: short stacking energy: -48.326 Base-Backbone interact. energy: 0.281 local terms energy: -55.769396 where: bonds (distance) C4'-P energy: -16.597 bonds (distance) P-C4' energy: -12.658 flat angles C4'-P-C4' energy: -16.140 flat angles P-C4'-P energy: -1.777 tors. eta vs tors. theta energy: -8.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -169.288358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.288358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.288358 (E_RNA) where: Base-Base interactions energy: -103.713 where: short stacking energy: -53.531 Base-Backbone interact. energy: -0.102 local terms energy: -65.473142 where: bonds (distance) C4'-P energy: -15.531 bonds (distance) P-C4' energy: -11.844 flat angles C4'-P-C4' energy: -15.393 flat angles P-C4'-P energy: -7.919 tors. eta vs tors. theta energy: -14.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -141.250798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.250798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.250798 (E_RNA) where: Base-Base interactions energy: -72.598 where: short stacking energy: -44.217 Base-Backbone interact. energy: -0.104 local terms energy: -68.549033 where: bonds (distance) C4'-P energy: -13.847 bonds (distance) P-C4' energy: -16.008 flat angles C4'-P-C4' energy: -15.490 flat angles P-C4'-P energy: -8.678 tors. eta vs tors. theta energy: -14.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -94.144261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.144261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.144261 (E_RNA) where: Base-Base interactions energy: -43.654 where: short stacking energy: -35.096 Base-Backbone interact. energy: -0.214 local terms energy: -50.276026 where: bonds (distance) C4'-P energy: -11.811 bonds (distance) P-C4' energy: -16.016 flat angles C4'-P-C4' energy: -8.073 flat angles P-C4'-P energy: -9.445 tors. eta vs tors. theta energy: -4.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -98.289814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.289814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.289814 (E_RNA) where: Base-Base interactions energy: -48.972 where: short stacking energy: -25.870 Base-Backbone interact. energy: 0.482 local terms energy: -49.799939 where: bonds (distance) C4'-P energy: -13.281 bonds (distance) P-C4' energy: -13.087 flat angles C4'-P-C4' energy: -9.267 flat angles P-C4'-P energy: -10.886 tors. eta vs tors. theta energy: -3.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -77.407791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.407791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.407791 (E_RNA) where: Base-Base interactions energy: -35.642 where: short stacking energy: -24.867 Base-Backbone interact. energy: -0.001 local terms energy: -41.764270 where: bonds (distance) C4'-P energy: -10.332 bonds (distance) P-C4' energy: -11.428 flat angles C4'-P-C4' energy: -10.153 flat angles P-C4'-P energy: -8.654 tors. eta vs tors. theta energy: -1.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -65.794775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.794775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.794775 (E_RNA) where: Base-Base interactions energy: -22.666 where: short stacking energy: -16.207 Base-Backbone interact. energy: -0.574 local terms energy: -42.555188 where: bonds (distance) C4'-P energy: -13.720 bonds (distance) P-C4' energy: -15.992 flat angles C4'-P-C4' energy: -8.544 flat angles P-C4'-P energy: -10.914 tors. eta vs tors. theta energy: 6.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -80.217761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.217761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.217761 (E_RNA) where: Base-Base interactions energy: -25.385 where: short stacking energy: -22.304 Base-Backbone interact. energy: -0.422 local terms energy: -54.410099 where: bonds (distance) C4'-P energy: -9.567 bonds (distance) P-C4' energy: -15.041 flat angles C4'-P-C4' energy: -12.749 flat angles P-C4'-P energy: -9.656 tors. eta vs tors. theta energy: -7.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -158.696705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.696705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.696705 (E_RNA) where: Base-Base interactions energy: -98.007 where: short stacking energy: -48.018 Base-Backbone interact. energy: -0.136 local terms energy: -60.553855 where: bonds (distance) C4'-P energy: -9.354 bonds (distance) P-C4' energy: -14.518 flat angles C4'-P-C4' energy: -14.253 flat angles P-C4'-P energy: -6.479 tors. eta vs tors. theta energy: -15.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -154.606938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.606938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.606938 (E_RNA) where: Base-Base interactions energy: -89.288 where: short stacking energy: -43.131 Base-Backbone interact. energy: 0.169 local terms energy: -65.488540 where: bonds (distance) C4'-P energy: -15.234 bonds (distance) P-C4' energy: -13.470 flat angles C4'-P-C4' energy: -16.040 flat angles P-C4'-P energy: -11.322 tors. eta vs tors. theta energy: -9.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -175.619570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.619570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.619570 (E_RNA) where: Base-Base interactions energy: -112.315 where: short stacking energy: -58.376 Base-Backbone interact. energy: -0.033 local terms energy: -63.271849 where: bonds (distance) C4'-P energy: -14.379 bonds (distance) P-C4' energy: -14.292 flat angles C4'-P-C4' energy: -7.406 flat angles P-C4'-P energy: -12.021 tors. eta vs tors. theta energy: -15.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -131.026035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.026035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.026035 (E_RNA) where: Base-Base interactions energy: -66.915 where: short stacking energy: -37.298 Base-Backbone interact. energy: -0.038 local terms energy: -64.073044 where: bonds (distance) C4'-P energy: -13.927 bonds (distance) P-C4' energy: -16.057 flat angles C4'-P-C4' energy: -14.728 flat angles P-C4'-P energy: -9.056 tors. eta vs tors. theta energy: -10.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -137.235193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.235193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.235193 (E_RNA) where: Base-Base interactions energy: -66.098 where: short stacking energy: -35.548 Base-Backbone interact. energy: -0.011 local terms energy: -71.126980 where: bonds (distance) C4'-P energy: -13.016 bonds (distance) P-C4' energy: -16.389 flat angles C4'-P-C4' energy: -15.081 flat angles P-C4'-P energy: -13.171 tors. eta vs tors. theta energy: -13.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -88.197423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.197423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.197423 (E_RNA) where: Base-Base interactions energy: -32.650 where: short stacking energy: -25.760 Base-Backbone interact. energy: -0.115 local terms energy: -55.432650 where: bonds (distance) C4'-P energy: -14.050 bonds (distance) P-C4' energy: -15.547 flat angles C4'-P-C4' energy: -11.910 flat angles P-C4'-P energy: -9.629 tors. eta vs tors. theta energy: -4.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -82.947023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.947023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.947023 (E_RNA) where: Base-Base interactions energy: -33.588 where: short stacking energy: -20.532 Base-Backbone interact. energy: -0.121 local terms energy: -49.237595 where: bonds (distance) C4'-P energy: -12.315 bonds (distance) P-C4' energy: -16.607 flat angles C4'-P-C4' energy: -10.104 flat angles P-C4'-P energy: -7.979 tors. eta vs tors. theta energy: -2.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -83.215454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.215454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.215454 (E_RNA) where: Base-Base interactions energy: -27.323 where: short stacking energy: -24.793 Base-Backbone interact. energy: 0.193 local terms energy: -56.085176 where: bonds (distance) C4'-P energy: -14.086 bonds (distance) P-C4' energy: -15.604 flat angles C4'-P-C4' energy: -14.360 flat angles P-C4'-P energy: -8.311 tors. eta vs tors. theta energy: -3.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -68.160215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.160215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.160215 (E_RNA) where: Base-Base interactions energy: -27.612 where: short stacking energy: -25.773 Base-Backbone interact. energy: -0.032 local terms energy: -40.516059 where: bonds (distance) C4'-P energy: -9.533 bonds (distance) P-C4' energy: -11.686 flat angles C4'-P-C4' energy: -10.894 flat angles P-C4'-P energy: -4.849 tors. eta vs tors. theta energy: -3.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -70.348559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.348559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.348559 (E_RNA) where: Base-Base interactions energy: -31.793 where: short stacking energy: -31.793 Base-Backbone interact. energy: -0.249 local terms energy: -38.306849 where: bonds (distance) C4'-P energy: -13.405 bonds (distance) P-C4' energy: -11.442 flat angles C4'-P-C4' energy: -4.870 flat angles P-C4'-P energy: -7.776 tors. eta vs tors. theta energy: -0.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -165.183354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.183354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.183354 (E_RNA) where: Base-Base interactions energy: -92.197 where: short stacking energy: -47.609 Base-Backbone interact. energy: -0.018 local terms energy: -72.967606 where: bonds (distance) C4'-P energy: -15.660 bonds (distance) P-C4' energy: -13.542 flat angles C4'-P-C4' energy: -16.407 flat angles P-C4'-P energy: -11.550 tors. eta vs tors. theta energy: -15.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -166.816258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.816258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.816258 (E_RNA) where: Base-Base interactions energy: -103.263 where: short stacking energy: -49.356 Base-Backbone interact. energy: -0.284 local terms energy: -63.268936 where: bonds (distance) C4'-P energy: -15.078 bonds (distance) P-C4' energy: -11.627 flat angles C4'-P-C4' energy: -12.880 flat angles P-C4'-P energy: -10.336 tors. eta vs tors. theta energy: -13.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -138.284063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.284063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.284063 (E_RNA) where: Base-Base interactions energy: -75.729 where: short stacking energy: -47.416 Base-Backbone interact. energy: -0.084 local terms energy: -62.470835 where: bonds (distance) C4'-P energy: -10.560 bonds (distance) P-C4' energy: -15.156 flat angles C4'-P-C4' energy: -15.132 flat angles P-C4'-P energy: -8.628 tors. eta vs tors. theta energy: -12.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -115.970659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.970659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.970659 (E_RNA) where: Base-Base interactions energy: -58.689 where: short stacking energy: -26.009 Base-Backbone interact. energy: -0.119 local terms energy: -57.162654 where: bonds (distance) C4'-P energy: -16.535 bonds (distance) P-C4' energy: -16.422 flat angles C4'-P-C4' energy: -9.858 flat angles P-C4'-P energy: -9.876 tors. eta vs tors. theta energy: -4.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -132.117118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.117118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.117118 (E_RNA) where: Base-Base interactions energy: -65.840 where: short stacking energy: -38.459 Base-Backbone interact. energy: -0.046 local terms energy: -66.230364 where: bonds (distance) C4'-P energy: -15.614 bonds (distance) P-C4' energy: -13.279 flat angles C4'-P-C4' energy: -16.674 flat angles P-C4'-P energy: -8.958 tors. eta vs tors. theta energy: -11.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -86.370581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.370581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.370581 (E_RNA) where: Base-Base interactions energy: -39.180 where: short stacking energy: -30.055 Base-Backbone interact. energy: -0.018 local terms energy: -47.173059 where: bonds (distance) C4'-P energy: -13.835 bonds (distance) P-C4' energy: -12.902 flat angles C4'-P-C4' energy: -8.070 flat angles P-C4'-P energy: -5.703 tors. eta vs tors. theta energy: -6.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -79.934116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.934116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.934116 (E_RNA) where: Base-Base interactions energy: -41.104 where: short stacking energy: -25.630 Base-Backbone interact. energy: -0.409 local terms energy: -38.421479 where: bonds (distance) C4'-P energy: -14.443 bonds (distance) P-C4' energy: -13.183 flat angles C4'-P-C4' energy: -9.341 flat angles P-C4'-P energy: -1.146 tors. eta vs tors. theta energy: -0.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -74.940012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.940012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.940012 (E_RNA) where: Base-Base interactions energy: -24.934 where: short stacking energy: -20.172 Base-Backbone interact. energy: -0.143 local terms energy: -49.862655 where: bonds (distance) C4'-P energy: -11.115 bonds (distance) P-C4' energy: -14.538 flat angles C4'-P-C4' energy: -14.517 flat angles P-C4'-P energy: -7.224 tors. eta vs tors. theta energy: -2.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -81.564345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.564345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.564345 (E_RNA) where: Base-Base interactions energy: -32.799 where: short stacking energy: -27.713 Base-Backbone interact. energy: -0.215 local terms energy: -48.549881 where: bonds (distance) C4'-P energy: -6.764 bonds (distance) P-C4' energy: -15.744 flat angles C4'-P-C4' energy: -13.824 flat angles P-C4'-P energy: -5.500 tors. eta vs tors. theta energy: -6.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -72.539802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.539802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.539802 (E_RNA) where: Base-Base interactions energy: -22.168 where: short stacking energy: -22.168 Base-Backbone interact. energy: -0.158 local terms energy: -50.213549 where: bonds (distance) C4'-P energy: -16.952 bonds (distance) P-C4' energy: -14.100 flat angles C4'-P-C4' energy: -11.759 flat angles P-C4'-P energy: -5.419 tors. eta vs tors. theta energy: -1.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -188.333663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.333663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.333663 (E_RNA) where: Base-Base interactions energy: -119.841 where: short stacking energy: -62.880 Base-Backbone interact. energy: -0.001 local terms energy: -68.491824 where: bonds (distance) C4'-P energy: -12.784 bonds (distance) P-C4' energy: -16.404 flat angles C4'-P-C4' energy: -15.674 flat angles P-C4'-P energy: -7.420 tors. eta vs tors. theta energy: -16.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -158.549611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.549611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.549611 (E_RNA) where: Base-Base interactions energy: -85.332 where: short stacking energy: -48.103 Base-Backbone interact. energy: -0.100 local terms energy: -73.117579 where: bonds (distance) C4'-P energy: -14.879 bonds (distance) P-C4' energy: -14.867 flat angles C4'-P-C4' energy: -17.294 flat angles P-C4'-P energy: -12.760 tors. eta vs tors. theta energy: -13.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -149.562059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.562059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.562059 (E_RNA) where: Base-Base interactions energy: -89.775 where: short stacking energy: -53.601 Base-Backbone interact. energy: -0.009 local terms energy: -59.778630 where: bonds (distance) C4'-P energy: -13.515 bonds (distance) P-C4' energy: -13.429 flat angles C4'-P-C4' energy: -11.772 flat angles P-C4'-P energy: -3.398 tors. eta vs tors. theta energy: -17.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -120.820804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.820804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.820804 (E_RNA) where: Base-Base interactions energy: -66.265 where: short stacking energy: -26.688 Base-Backbone interact. energy: -0.022 local terms energy: -54.533910 where: bonds (distance) C4'-P energy: -15.186 bonds (distance) P-C4' energy: -13.670 flat angles C4'-P-C4' energy: -16.413 flat angles P-C4'-P energy: -9.776 tors. eta vs tors. theta energy: 0.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -131.511973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.511973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.511973 (E_RNA) where: Base-Base interactions energy: -70.113 where: short stacking energy: -38.891 Base-Backbone interact. energy: -0.091 local terms energy: -61.308376 where: bonds (distance) C4'-P energy: -14.258 bonds (distance) P-C4' energy: -16.146 flat angles C4'-P-C4' energy: -15.582 flat angles P-C4'-P energy: -9.356 tors. eta vs tors. theta energy: -5.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -85.774096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.774096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.774096 (E_RNA) where: Base-Base interactions energy: -26.210 where: short stacking energy: -18.418 Base-Backbone interact. energy: -0.033 local terms energy: -59.530771 where: bonds (distance) C4'-P energy: -12.680 bonds (distance) P-C4' energy: -15.661 flat angles C4'-P-C4' energy: -13.972 flat angles P-C4'-P energy: -10.747 tors. eta vs tors. theta energy: -6.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -91.683157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.683157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.683157 (E_RNA) where: Base-Base interactions energy: -41.564 where: short stacking energy: -41.389 Base-Backbone interact. energy: -0.002 local terms energy: -50.117101 where: bonds (distance) C4'-P energy: -12.772 bonds (distance) P-C4' energy: -11.566 flat angles C4'-P-C4' energy: -11.924 flat angles P-C4'-P energy: -3.258 tors. eta vs tors. theta energy: -10.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -102.516064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.516064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.516064 (E_RNA) where: Base-Base interactions energy: -49.571 where: short stacking energy: -27.657 Base-Backbone interact. energy: -0.001 local terms energy: -52.943961 where: bonds (distance) C4'-P energy: -10.733 bonds (distance) P-C4' energy: -13.337 flat angles C4'-P-C4' energy: -14.585 flat angles P-C4'-P energy: -7.251 tors. eta vs tors. theta energy: -7.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -82.532830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.532830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.532830 (E_RNA) where: Base-Base interactions energy: -33.734 where: short stacking energy: -23.498 Base-Backbone interact. energy: 0.633 local terms energy: -49.432238 where: bonds (distance) C4'-P energy: -13.495 bonds (distance) P-C4' energy: -12.772 flat angles C4'-P-C4' energy: -14.079 flat angles P-C4'-P energy: -5.498 tors. eta vs tors. theta energy: -3.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -75.902718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.902718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.902718 (E_RNA) where: Base-Base interactions energy: -30.967 where: short stacking energy: -18.677 Base-Backbone interact. energy: -0.124 local terms energy: -44.811536 where: bonds (distance) C4'-P energy: -16.464 bonds (distance) P-C4' energy: -7.596 flat angles C4'-P-C4' energy: -13.561 flat angles P-C4'-P energy: -6.858 tors. eta vs tors. theta energy: -0.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -190.079457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.079457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.079457 (E_RNA) where: Base-Base interactions energy: -116.659 where: short stacking energy: -59.639 Base-Backbone interact. energy: -0.007 local terms energy: -73.413025 where: bonds (distance) C4'-P energy: -13.442 bonds (distance) P-C4' energy: -14.620 flat angles C4'-P-C4' energy: -15.703 flat angles P-C4'-P energy: -12.093 tors. eta vs tors. theta energy: -17.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -149.792849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.792849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.792849 (E_RNA) where: Base-Base interactions energy: -78.596 where: short stacking energy: -45.493 Base-Backbone interact. energy: -0.777 local terms energy: -70.419656 where: bonds (distance) C4'-P energy: -16.576 bonds (distance) P-C4' energy: -13.475 flat angles C4'-P-C4' energy: -16.118 flat angles P-C4'-P energy: -12.106 tors. eta vs tors. theta energy: -12.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -149.296530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.296530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.296530 (E_RNA) where: Base-Base interactions energy: -81.739 where: short stacking energy: -49.761 Base-Backbone interact. energy: -0.036 local terms energy: -67.521312 where: bonds (distance) C4'-P energy: -15.748 bonds (distance) P-C4' energy: -15.077 flat angles C4'-P-C4' energy: -14.312 flat angles P-C4'-P energy: -11.404 tors. eta vs tors. theta energy: -10.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -129.579384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.579384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.579384 (E_RNA) where: Base-Base interactions energy: -67.177 where: short stacking energy: -32.518 Base-Backbone interact. energy: -0.380 local terms energy: -62.022363 where: bonds (distance) C4'-P energy: -8.299 bonds (distance) P-C4' energy: -16.097 flat angles C4'-P-C4' energy: -14.678 flat angles P-C4'-P energy: -11.806 tors. eta vs tors. theta energy: -11.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -125.793388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.793388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.793388 (E_RNA) where: Base-Base interactions energy: -65.718 where: short stacking energy: -39.467 Base-Backbone interact. energy: -0.005 local terms energy: -60.071148 where: bonds (distance) C4'-P energy: -16.207 bonds (distance) P-C4' energy: -15.638 flat angles C4'-P-C4' energy: -14.959 flat angles P-C4'-P energy: -6.915 tors. eta vs tors. theta energy: -6.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -87.540522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.540522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.540522 (E_RNA) where: Base-Base interactions energy: -30.896 where: short stacking energy: -30.896 Base-Backbone interact. energy: -0.112 local terms energy: -56.532726 where: bonds (distance) C4'-P energy: -12.846 bonds (distance) P-C4' energy: -15.311 flat angles C4'-P-C4' energy: -14.915 flat angles P-C4'-P energy: -9.545 tors. eta vs tors. theta energy: -3.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -77.501922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.501922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.501922 (E_RNA) where: Base-Base interactions energy: -24.488 where: short stacking energy: -22.891 Base-Backbone interact. energy: -0.670 local terms energy: -52.344419 where: bonds (distance) C4'-P energy: -14.393 bonds (distance) P-C4' energy: -13.249 flat angles C4'-P-C4' energy: -12.731 flat angles P-C4'-P energy: -10.382 tors. eta vs tors. theta energy: -1.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -86.521491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.521491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.521491 (E_RNA) where: Base-Base interactions energy: -37.865 where: short stacking energy: -23.277 Base-Backbone interact. energy: -0.193 local terms energy: -48.463504 where: bonds (distance) C4'-P energy: -13.247 bonds (distance) P-C4' energy: -16.851 flat angles C4'-P-C4' energy: -14.063 flat angles P-C4'-P energy: -0.507 tors. eta vs tors. theta energy: -3.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -74.036409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.036409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.036409 (E_RNA) where: Base-Base interactions energy: -20.090 where: short stacking energy: -20.090 Base-Backbone interact. energy: -0.202 local terms energy: -53.743989 where: bonds (distance) C4'-P energy: -7.534 bonds (distance) P-C4' energy: -12.930 flat angles C4'-P-C4' energy: -15.916 flat angles P-C4'-P energy: -11.871 tors. eta vs tors. theta energy: -5.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -68.626816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.626816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.626816 (E_RNA) where: Base-Base interactions energy: -22.818 where: short stacking energy: -17.634 Base-Backbone interact. energy: -0.119 local terms energy: -45.689803 where: bonds (distance) C4'-P energy: -14.569 bonds (distance) P-C4' energy: -8.023 flat angles C4'-P-C4' energy: -6.404 flat angles P-C4'-P energy: -11.089 tors. eta vs tors. theta energy: -5.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -200.441980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.441980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.441980 (E_RNA) where: Base-Base interactions energy: -123.308 where: short stacking energy: -56.607 Base-Backbone interact. energy: -0.108 local terms energy: -77.026511 where: bonds (distance) C4'-P energy: -15.118 bonds (distance) P-C4' energy: -17.538 flat angles C4'-P-C4' energy: -17.235 flat angles P-C4'-P energy: -11.825 tors. eta vs tors. theta energy: -15.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -152.053221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.053221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.053221 (E_RNA) where: Base-Base interactions energy: -93.968 where: short stacking energy: -46.905 Base-Backbone interact. energy: 0.069 local terms energy: -58.154250 where: bonds (distance) C4'-P energy: -16.150 bonds (distance) P-C4' energy: -14.678 flat angles C4'-P-C4' energy: -10.141 flat angles P-C4'-P energy: -4.740 tors. eta vs tors. theta energy: -12.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -142.265233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.265233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.265233 (E_RNA) where: Base-Base interactions energy: -73.970 where: short stacking energy: -41.654 Base-Backbone interact. energy: -0.306 local terms energy: -67.989266 where: bonds (distance) C4'-P energy: -14.253 bonds (distance) P-C4' energy: -15.011 flat angles C4'-P-C4' energy: -14.699 flat angles P-C4'-P energy: -10.150 tors. eta vs tors. theta energy: -13.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -142.081007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.081007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.081007 (E_RNA) where: Base-Base interactions energy: -76.627 where: short stacking energy: -49.425 Base-Backbone interact. energy: -0.045 local terms energy: -65.409282 where: bonds (distance) C4'-P energy: -9.543 bonds (distance) P-C4' energy: -17.094 flat angles C4'-P-C4' energy: -14.310 flat angles P-C4'-P energy: -9.778 tors. eta vs tors. theta energy: -14.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -128.095623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.095623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.095623 (E_RNA) where: Base-Base interactions energy: -73.795 where: short stacking energy: -36.790 Base-Backbone interact. energy: -0.508 local terms energy: -53.792859 where: bonds (distance) C4'-P energy: -16.277 bonds (distance) P-C4' energy: -11.379 flat angles C4'-P-C4' energy: -12.840 flat angles P-C4'-P energy: -5.511 tors. eta vs tors. theta energy: -7.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -92.015029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.015029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.015029 (E_RNA) where: Base-Base interactions energy: -45.048 where: short stacking energy: -42.045 Base-Backbone interact. energy: -0.027 local terms energy: -46.939449 where: bonds (distance) C4'-P energy: -6.177 bonds (distance) P-C4' energy: -10.695 flat angles C4'-P-C4' energy: -14.610 flat angles P-C4'-P energy: -7.878 tors. eta vs tors. theta energy: -7.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -73.675217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.675217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.675217 (E_RNA) where: Base-Base interactions energy: -27.815 where: short stacking energy: -27.815 Base-Backbone interact. energy: -0.145 local terms energy: -45.714696 where: bonds (distance) C4'-P energy: -8.412 bonds (distance) P-C4' energy: -14.734 flat angles C4'-P-C4' energy: -12.953 flat angles P-C4'-P energy: -8.231 tors. eta vs tors. theta energy: -1.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -79.032983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.032983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.032983 (E_RNA) where: Base-Base interactions energy: -25.521 where: short stacking energy: -23.824 Base-Backbone interact. energy: -0.211 local terms energy: -53.301271 where: bonds (distance) C4'-P energy: -14.704 bonds (distance) P-C4' energy: -16.246 flat angles C4'-P-C4' energy: -9.912 flat angles P-C4'-P energy: -8.883 tors. eta vs tors. theta energy: -3.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -75.583497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.583497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.583497 (E_RNA) where: Base-Base interactions energy: -31.813 where: short stacking energy: -23.828 Base-Backbone interact. energy: 0.064 local terms energy: -43.834617 where: bonds (distance) C4'-P energy: -13.389 bonds (distance) P-C4' energy: -16.336 flat angles C4'-P-C4' energy: -6.598 flat angles P-C4'-P energy: -3.919 tors. eta vs tors. theta energy: -3.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -69.519223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.519223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.519223 (E_RNA) where: Base-Base interactions energy: -32.533 where: short stacking energy: -21.537 Base-Backbone interact. energy: -0.180 local terms energy: -36.807034 where: bonds (distance) C4'-P energy: -9.728 bonds (distance) P-C4' energy: -5.502 flat angles C4'-P-C4' energy: -8.761 flat angles P-C4'-P energy: -8.540 tors. eta vs tors. theta energy: -4.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -192.375439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.375439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.375439 (E_RNA) where: Base-Base interactions energy: -117.839 where: short stacking energy: -59.429 Base-Backbone interact. energy: -0.105 local terms energy: -74.432108 where: bonds (distance) C4'-P energy: -14.624 bonds (distance) P-C4' energy: -14.452 flat angles C4'-P-C4' energy: -16.482 flat angles P-C4'-P energy: -12.091 tors. eta vs tors. theta energy: -16.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -141.770151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.770151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.770151 (E_RNA) where: Base-Base interactions energy: -85.677 where: short stacking energy: -45.055 Base-Backbone interact. energy: -0.115 local terms energy: -55.978653 where: bonds (distance) C4'-P energy: -13.256 bonds (distance) P-C4' energy: -15.273 flat angles C4'-P-C4' energy: -10.046 flat angles P-C4'-P energy: -9.316 tors. eta vs tors. theta energy: -8.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -147.603868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.603868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.603868 (E_RNA) where: Base-Base interactions energy: -90.590 where: short stacking energy: -32.740 Base-Backbone interact. energy: -0.741 local terms energy: -56.272741 where: bonds (distance) C4'-P energy: -10.948 bonds (distance) P-C4' energy: -13.482 flat angles C4'-P-C4' energy: -12.591 flat angles P-C4'-P energy: -11.748 tors. eta vs tors. theta energy: -7.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -136.828948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.828948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.828948 (E_RNA) where: Base-Base interactions energy: -72.430 where: short stacking energy: -38.413 Base-Backbone interact. energy: -0.122 local terms energy: -64.276480 where: bonds (distance) C4'-P energy: -14.013 bonds (distance) P-C4' energy: -13.736 flat angles C4'-P-C4' energy: -14.107 flat angles P-C4'-P energy: -8.812 tors. eta vs tors. theta energy: -13.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -87.400861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.400861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.400861 (E_RNA) where: Base-Base interactions energy: -37.951 where: short stacking energy: -34.063 Base-Backbone interact. energy: -0.134 local terms energy: -49.315039 where: bonds (distance) C4'-P energy: -5.543 bonds (distance) P-C4' energy: -17.767 flat angles C4'-P-C4' energy: -10.379 flat angles P-C4'-P energy: -9.030 tors. eta vs tors. theta energy: -6.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -89.218757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.218757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.218757 (E_RNA) where: Base-Base interactions energy: -33.704 where: short stacking energy: -30.575 Base-Backbone interact. energy: -0.258 local terms energy: -55.256571 where: bonds (distance) C4'-P energy: -13.602 bonds (distance) P-C4' energy: -17.352 flat angles C4'-P-C4' energy: -9.910 flat angles P-C4'-P energy: -7.979 tors. eta vs tors. theta energy: -6.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -75.255698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.255698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.255698 (E_RNA) where: Base-Base interactions energy: -18.302 where: short stacking energy: -18.783 Base-Backbone interact. energy: -0.131 local terms energy: -56.822380 where: bonds (distance) C4'-P energy: -12.891 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -13.367 flat angles P-C4'-P energy: -10.377 tors. eta vs tors. theta energy: -3.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -99.935159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.935159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.935159 (E_RNA) where: Base-Base interactions energy: -44.801 where: short stacking energy: -29.389 Base-Backbone interact. energy: 1.741 local terms energy: -56.874426 where: bonds (distance) C4'-P energy: -12.974 bonds (distance) P-C4' energy: -16.146 flat angles C4'-P-C4' energy: -8.433 flat angles P-C4'-P energy: -8.461 tors. eta vs tors. theta energy: -10.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -79.000774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.000774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.000774 (E_RNA) where: Base-Base interactions energy: -34.736 where: short stacking energy: -16.429 Base-Backbone interact. energy: -0.087 local terms energy: -44.177760 where: bonds (distance) C4'-P energy: -12.791 bonds (distance) P-C4' energy: -13.454 flat angles C4'-P-C4' energy: -7.425 flat angles P-C4'-P energy: -9.354 tors. eta vs tors. theta energy: -1.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -71.259144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.259144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.259144 (E_RNA) where: Base-Base interactions energy: -26.477 where: short stacking energy: -26.477 Base-Backbone interact. energy: -0.536 local terms energy: -44.245924 where: bonds (distance) C4'-P energy: -8.171 bonds (distance) P-C4' energy: -12.465 flat angles C4'-P-C4' energy: -15.436 flat angles P-C4'-P energy: -7.749 tors. eta vs tors. theta energy: -0.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -194.417847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -194.417847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -194.417847 (E_RNA) where: Base-Base interactions energy: -122.637 where: short stacking energy: -62.989 Base-Backbone interact. energy: -1.347 local terms energy: -70.433517 where: bonds (distance) C4'-P energy: -12.813 bonds (distance) P-C4' energy: -15.607 flat angles C4'-P-C4' energy: -14.930 flat angles P-C4'-P energy: -9.609 tors. eta vs tors. theta energy: -17.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -143.295450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.295450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.295450 (E_RNA) where: Base-Base interactions energy: -77.069 where: short stacking energy: -37.482 Base-Backbone interact. energy: -1.311 local terms energy: -64.915345 where: bonds (distance) C4'-P energy: -13.347 bonds (distance) P-C4' energy: -15.314 flat angles C4'-P-C4' energy: -12.829 flat angles P-C4'-P energy: -12.480 tors. eta vs tors. theta energy: -10.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -134.435106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.435106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.435106 (E_RNA) where: Base-Base interactions energy: -73.441 where: short stacking energy: -39.380 Base-Backbone interact. energy: -0.079 local terms energy: -60.914854 where: bonds (distance) C4'-P energy: -15.336 bonds (distance) P-C4' energy: -12.419 flat angles C4'-P-C4' energy: -12.425 flat angles P-C4'-P energy: -11.142 tors. eta vs tors. theta energy: -9.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -142.547908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.547908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.547908 (E_RNA) where: Base-Base interactions energy: -82.100 where: short stacking energy: -33.067 Base-Backbone interact. energy: -1.312 local terms energy: -59.135907 where: bonds (distance) C4'-P energy: -15.867 bonds (distance) P-C4' energy: -15.762 flat angles C4'-P-C4' energy: -16.246 flat angles P-C4'-P energy: -7.330 tors. eta vs tors. theta energy: -3.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -88.416304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.416304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.416304 (E_RNA) where: Base-Base interactions energy: -33.103 where: short stacking energy: -33.236 Base-Backbone interact. energy: -0.057 local terms energy: -55.256122 where: bonds (distance) C4'-P energy: -15.528 bonds (distance) P-C4' energy: -12.337 flat angles C4'-P-C4' energy: -11.186 flat angles P-C4'-P energy: -10.608 tors. eta vs tors. theta energy: -5.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -89.026287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.026287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.026287 (E_RNA) where: Base-Base interactions energy: -33.920 where: short stacking energy: -33.920 Base-Backbone interact. energy: -0.040 local terms energy: -55.065989 where: bonds (distance) C4'-P energy: -10.124 bonds (distance) P-C4' energy: -14.941 flat angles C4'-P-C4' energy: -11.466 flat angles P-C4'-P energy: -10.740 tors. eta vs tors. theta energy: -7.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -84.332213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.332213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.332213 (E_RNA) where: Base-Base interactions energy: -41.710 where: short stacking energy: -18.036 Base-Backbone interact. energy: -0.255 local terms energy: -42.366743 where: bonds (distance) C4'-P energy: -12.886 bonds (distance) P-C4' energy: -16.540 flat angles C4'-P-C4' energy: -8.323 flat angles P-C4'-P energy: -6.238 tors. eta vs tors. theta energy: 1.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -103.038282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -103.038282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -103.038282 (E_RNA) where: Base-Base interactions energy: -39.744 where: short stacking energy: -24.414 Base-Backbone interact. energy: -0.028 local terms energy: -63.266047 where: bonds (distance) C4'-P energy: -16.915 bonds (distance) P-C4' energy: -16.582 flat angles C4'-P-C4' energy: -11.694 flat angles P-C4'-P energy: -10.344 tors. eta vs tors. theta energy: -7.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -71.069358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.069358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.069358 (E_RNA) where: Base-Base interactions energy: -22.267 where: short stacking energy: -20.416 Base-Backbone interact. energy: -1.130 local terms energy: -47.672350 where: bonds (distance) C4'-P energy: -13.115 bonds (distance) P-C4' energy: -13.955 flat angles C4'-P-C4' energy: -13.773 flat angles P-C4'-P energy: -9.384 tors. eta vs tors. theta energy: 2.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -68.104953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.104953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.104953 (E_RNA) where: Base-Base interactions energy: -19.656 where: short stacking energy: -19.656 Base-Backbone interact. energy: -0.138 local terms energy: -48.311032 where: bonds (distance) C4'-P energy: -11.190 bonds (distance) P-C4' energy: -13.409 flat angles C4'-P-C4' energy: -13.255 flat angles P-C4'-P energy: -10.582 tors. eta vs tors. theta energy: 0.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -192.508036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.508036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.508036 (E_RNA) where: Base-Base interactions energy: -118.496 where: short stacking energy: -61.820 Base-Backbone interact. energy: -0.053 local terms energy: -73.959095 where: bonds (distance) C4'-P energy: -13.714 bonds (distance) P-C4' energy: -17.348 flat angles C4'-P-C4' energy: -16.169 flat angles P-C4'-P energy: -10.887 tors. eta vs tors. theta energy: -15.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -146.180898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.180898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.180898 (E_RNA) where: Base-Base interactions energy: -79.992 where: short stacking energy: -46.679 Base-Backbone interact. energy: -0.050 local terms energy: -66.139314 where: bonds (distance) C4'-P energy: -14.551 bonds (distance) P-C4' energy: -16.013 flat angles C4'-P-C4' energy: -13.532 flat angles P-C4'-P energy: -10.189 tors. eta vs tors. theta energy: -11.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -148.644181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.644181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.644181 (E_RNA) where: Base-Base interactions energy: -85.909 where: short stacking energy: -44.873 Base-Backbone interact. energy: -0.005 local terms energy: -62.730342 where: bonds (distance) C4'-P energy: -14.519 bonds (distance) P-C4' energy: -12.885 flat angles C4'-P-C4' energy: -13.204 flat angles P-C4'-P energy: -10.265 tors. eta vs tors. theta energy: -11.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -102.548420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.548420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.548420 (E_RNA) where: Base-Base interactions energy: -42.912 where: short stacking energy: -42.500 Base-Backbone interact. energy: -0.275 local terms energy: -59.361398 where: bonds (distance) C4'-P energy: -13.753 bonds (distance) P-C4' energy: -12.481 flat angles C4'-P-C4' energy: -12.377 flat angles P-C4'-P energy: -8.290 tors. eta vs tors. theta energy: -12.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -133.970316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.970316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.970316 (E_RNA) where: Base-Base interactions energy: -74.436 where: short stacking energy: -44.005 Base-Backbone interact. energy: -0.210 local terms energy: -59.323980 where: bonds (distance) C4'-P energy: -12.706 bonds (distance) P-C4' energy: -16.129 flat angles C4'-P-C4' energy: -11.329 flat angles P-C4'-P energy: -9.987 tors. eta vs tors. theta energy: -9.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -105.879543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.879543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.879543 (E_RNA) where: Base-Base interactions energy: -54.153 where: short stacking energy: -32.216 Base-Backbone interact. energy: -0.192 local terms energy: -51.534938 where: bonds (distance) C4'-P energy: -12.449 bonds (distance) P-C4' energy: -14.265 flat angles C4'-P-C4' energy: -7.011 flat angles P-C4'-P energy: -13.473 tors. eta vs tors. theta energy: -4.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -78.632945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.632945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.632945 (E_RNA) where: Base-Base interactions energy: -35.795 where: short stacking energy: -13.873 Base-Backbone interact. energy: -0.030 local terms energy: -42.808283 where: bonds (distance) C4'-P energy: -13.284 bonds (distance) P-C4' energy: -16.442 flat angles C4'-P-C4' energy: -9.300 flat angles P-C4'-P energy: -4.827 tors. eta vs tors. theta energy: 1.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -74.848239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.848239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.848239 (E_RNA) where: Base-Base interactions energy: -26.324 where: short stacking energy: -24.718 Base-Backbone interact. energy: -0.037 local terms energy: -48.487283 where: bonds (distance) C4'-P energy: -10.216 bonds (distance) P-C4' energy: -13.215 flat angles C4'-P-C4' energy: -12.259 flat angles P-C4'-P energy: -8.894 tors. eta vs tors. theta energy: -3.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -69.012569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.012569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.012569 (E_RNA) where: Base-Base interactions energy: -24.192 where: short stacking energy: -11.763 Base-Backbone interact. energy: 0.815 local terms energy: -45.635252 where: bonds (distance) C4'-P energy: -12.911 bonds (distance) P-C4' energy: -14.806 flat angles C4'-P-C4' energy: -11.543 flat angles P-C4'-P energy: -11.717 tors. eta vs tors. theta energy: 5.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -73.687856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.687856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.687856 (E_RNA) where: Base-Base interactions energy: -25.152 where: short stacking energy: -24.476 Base-Backbone interact. energy: -0.197 local terms energy: -48.338583 where: bonds (distance) C4'-P energy: -9.504 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -13.884 flat angles P-C4'-P energy: -6.122 tors. eta vs tors. theta energy: -2.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -188.755453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.755453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.755453 (E_RNA) where: Base-Base interactions energy: -119.104 where: short stacking energy: -55.328 Base-Backbone interact. energy: 0.927 local terms energy: -70.578740 where: bonds (distance) C4'-P energy: -11.740 bonds (distance) P-C4' energy: -16.167 flat angles C4'-P-C4' energy: -15.961 flat angles P-C4'-P energy: -10.190 tors. eta vs tors. theta energy: -16.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -150.662257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.662257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.662257 (E_RNA) where: Base-Base interactions energy: -78.532 where: short stacking energy: -42.209 Base-Backbone interact. energy: -0.121 local terms energy: -72.008692 where: bonds (distance) C4'-P energy: -16.311 bonds (distance) P-C4' energy: -15.677 flat angles C4'-P-C4' energy: -16.421 flat angles P-C4'-P energy: -7.943 tors. eta vs tors. theta energy: -15.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -99.452289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.452289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.452289 (E_RNA) where: Base-Base interactions energy: -38.452 where: short stacking energy: -37.418 Base-Backbone interact. energy: -0.032 local terms energy: -60.968295 where: bonds (distance) C4'-P energy: -13.632 bonds (distance) P-C4' energy: -14.060 flat angles C4'-P-C4' energy: -13.756 flat angles P-C4'-P energy: -8.357 tors. eta vs tors. theta energy: -11.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -135.406867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.406867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.406867 (E_RNA) where: Base-Base interactions energy: -74.823 where: short stacking energy: -46.037 Base-Backbone interact. energy: -0.022 local terms energy: -60.561788 where: bonds (distance) C4'-P energy: -8.622 bonds (distance) P-C4' energy: -16.529 flat angles C4'-P-C4' energy: -13.052 flat angles P-C4'-P energy: -7.856 tors. eta vs tors. theta energy: -14.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -122.273596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.273596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.273596 (E_RNA) where: Base-Base interactions energy: -62.280 where: short stacking energy: -34.667 Base-Backbone interact. energy: -0.126 local terms energy: -59.867950 where: bonds (distance) C4'-P energy: -14.945 bonds (distance) P-C4' energy: -14.345 flat angles C4'-P-C4' energy: -12.427 flat angles P-C4'-P energy: -8.968 tors. eta vs tors. theta energy: -9.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -98.224846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -98.224846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.224846 (E_RNA) where: Base-Base interactions energy: -36.511 where: short stacking energy: -36.511 Base-Backbone interact. energy: -0.151 local terms energy: -61.563053 where: bonds (distance) C4'-P energy: -15.752 bonds (distance) P-C4' energy: -14.686 flat angles C4'-P-C4' energy: -13.197 flat angles P-C4'-P energy: -10.244 tors. eta vs tors. theta energy: -7.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -83.511233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.511233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.511233 (E_RNA) where: Base-Base interactions energy: -32.327 where: short stacking energy: -26.241 Base-Backbone interact. energy: -0.008 local terms energy: -51.175548 where: bonds (distance) C4'-P energy: -12.062 bonds (distance) P-C4' energy: -14.540 flat angles C4'-P-C4' energy: -14.017 flat angles P-C4'-P energy: -7.273 tors. eta vs tors. theta energy: -3.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -108.664049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.664049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.664049 (E_RNA) where: Base-Base interactions energy: -57.056 where: short stacking energy: -29.635 Base-Backbone interact. energy: -1.047 local terms energy: -50.561630 where: bonds (distance) C4'-P energy: -13.007 bonds (distance) P-C4' energy: -14.854 flat angles C4'-P-C4' energy: -11.840 flat angles P-C4'-P energy: -9.265 tors. eta vs tors. theta energy: -1.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -79.993189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.993189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.993189 (E_RNA) where: Base-Base interactions energy: -35.409 where: short stacking energy: -22.834 Base-Backbone interact. energy: -0.841 local terms energy: -43.742356 where: bonds (distance) C4'-P energy: -11.227 bonds (distance) P-C4' energy: -16.041 flat angles C4'-P-C4' energy: -7.768 flat angles P-C4'-P energy: -6.811 tors. eta vs tors. theta energy: -1.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -64.906625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.906625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.906625 (E_RNA) where: Base-Base interactions energy: -17.186 where: short stacking energy: -16.591 Base-Backbone interact. energy: 1.567 local terms energy: -49.287425 where: bonds (distance) C4'-P energy: -15.230 bonds (distance) P-C4' energy: -15.436 flat angles C4'-P-C4' energy: -10.478 flat angles P-C4'-P energy: -8.693 tors. eta vs tors. theta energy: 0.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -185.094665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.094665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.094665 (E_RNA) where: Base-Base interactions energy: -110.402 where: short stacking energy: -63.245 Base-Backbone interact. energy: -0.033 local terms energy: -74.660121 where: bonds (distance) C4'-P energy: -13.177 bonds (distance) P-C4' energy: -11.330 flat angles C4'-P-C4' energy: -16.960 flat angles P-C4'-P energy: -12.719 tors. eta vs tors. theta energy: -20.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -161.980860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.980860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.980860 (E_RNA) where: Base-Base interactions energy: -100.814 where: short stacking energy: -50.148 Base-Backbone interact. energy: -0.026 local terms energy: -61.140792 where: bonds (distance) C4'-P energy: -12.340 bonds (distance) P-C4' energy: -12.454 flat angles C4'-P-C4' energy: -11.145 flat angles P-C4'-P energy: -11.908 tors. eta vs tors. theta energy: -13.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -116.469241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -116.469241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -116.469241 (E_RNA) where: Base-Base interactions energy: -64.169 where: short stacking energy: -26.567 Base-Backbone interact. energy: -0.103 local terms energy: -52.197851 where: bonds (distance) C4'-P energy: -14.256 bonds (distance) P-C4' energy: -16.262 flat angles C4'-P-C4' energy: -11.242 flat angles P-C4'-P energy: -6.772 tors. eta vs tors. theta energy: -3.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -129.624130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.624130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.624130 (E_RNA) where: Base-Base interactions energy: -69.040 where: short stacking energy: -44.492 Base-Backbone interact. energy: -0.051 local terms energy: -60.533212 where: bonds (distance) C4'-P energy: -13.818 bonds (distance) P-C4' energy: -10.435 flat angles C4'-P-C4' energy: -14.458 flat angles P-C4'-P energy: -8.282 tors. eta vs tors. theta energy: -13.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -139.149425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.149425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.149425 (E_RNA) where: Base-Base interactions energy: -81.459 where: short stacking energy: -37.323 Base-Backbone interact. energy: -0.010 local terms energy: -57.680663 where: bonds (distance) C4'-P energy: -14.012 bonds (distance) P-C4' energy: -16.673 flat angles C4'-P-C4' energy: -13.817 flat angles P-C4'-P energy: -4.904 tors. eta vs tors. theta energy: -8.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -91.372555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.372555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.372555 (E_RNA) where: Base-Base interactions energy: -39.591 where: short stacking energy: -23.543 Base-Backbone interact. energy: -1.120 local terms energy: -50.661364 where: bonds (distance) C4'-P energy: -14.498 bonds (distance) P-C4' energy: -15.103 flat angles C4'-P-C4' energy: -13.875 flat angles P-C4'-P energy: -7.223 tors. eta vs tors. theta energy: 0.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -85.563519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.563519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.563519 (E_RNA) where: Base-Base interactions energy: -31.558 where: short stacking energy: -29.737 Base-Backbone interact. energy: -0.003 local terms energy: -54.002735 where: bonds (distance) C4'-P energy: -8.621 bonds (distance) P-C4' energy: -14.305 flat angles C4'-P-C4' energy: -8.776 flat angles P-C4'-P energy: -12.075 tors. eta vs tors. theta energy: -10.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -78.224572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.224572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.224572 (E_RNA) where: Base-Base interactions energy: -36.419 where: short stacking energy: -17.146 Base-Backbone interact. energy: -0.385 local terms energy: -41.420891 where: bonds (distance) C4'-P energy: -5.048 bonds (distance) P-C4' energy: -14.588 flat angles C4'-P-C4' energy: -11.318 flat angles P-C4'-P energy: -7.696 tors. eta vs tors. theta energy: -2.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -107.749495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -107.749495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -107.749495 (E_RNA) where: Base-Base interactions energy: -58.524 where: short stacking energy: -29.551 Base-Backbone interact. energy: -0.221 local terms energy: -49.004540 where: bonds (distance) C4'-P energy: -13.492 bonds (distance) P-C4' energy: -12.652 flat angles C4'-P-C4' energy: -11.416 flat angles P-C4'-P energy: -5.429 tors. eta vs tors. theta energy: -6.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -70.974594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.974594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.974594 (E_RNA) where: Base-Base interactions energy: -17.216 where: short stacking energy: -16.188 Base-Backbone interact. energy: -0.041 local terms energy: -53.717513 where: bonds (distance) C4'-P energy: -15.297 bonds (distance) P-C4' energy: -16.520 flat angles C4'-P-C4' energy: -12.803 flat angles P-C4'-P energy: -5.744 tors. eta vs tors. theta energy: -3.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -193.665858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.665858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.665858 (E_RNA) where: Base-Base interactions energy: -124.681 where: short stacking energy: -53.751 Base-Backbone interact. energy: -0.143 local terms energy: -68.841595 where: bonds (distance) C4'-P energy: -15.540 bonds (distance) P-C4' energy: -11.403 flat angles C4'-P-C4' energy: -15.334 flat angles P-C4'-P energy: -11.238 tors. eta vs tors. theta energy: -15.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -168.374063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.374063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.374063 (E_RNA) where: Base-Base interactions energy: -103.609 where: short stacking energy: -49.442 Base-Backbone interact. energy: -0.031 local terms energy: -64.733968 where: bonds (distance) C4'-P energy: -9.694 bonds (distance) P-C4' energy: -16.446 flat angles C4'-P-C4' energy: -16.444 flat angles P-C4'-P energy: -7.469 tors. eta vs tors. theta energy: -14.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -142.995166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.995166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.995166 (E_RNA) where: Base-Base interactions energy: -80.827 where: short stacking energy: -38.693 Base-Backbone interact. energy: -0.392 local terms energy: -61.775912 where: bonds (distance) C4'-P energy: -13.230 bonds (distance) P-C4' energy: -15.717 flat angles C4'-P-C4' energy: -15.213 flat angles P-C4'-P energy: -5.337 tors. eta vs tors. theta energy: -12.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -143.707663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.707663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.707663 (E_RNA) where: Base-Base interactions energy: -77.253 where: short stacking energy: -46.388 Base-Backbone interact. energy: -1.631 local terms energy: -64.823852 where: bonds (distance) C4'-P energy: -13.007 bonds (distance) P-C4' energy: -13.898 flat angles C4'-P-C4' energy: -16.188 flat angles P-C4'-P energy: -9.097 tors. eta vs tors. theta energy: -12.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -87.618432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.618432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.618432 (E_RNA) where: Base-Base interactions energy: -33.010 where: short stacking energy: -29.563 Base-Backbone interact. energy: 0.222 local terms energy: -54.829956 where: bonds (distance) C4'-P energy: -14.802 bonds (distance) P-C4' energy: -15.870 flat angles C4'-P-C4' energy: -10.723 flat angles P-C4'-P energy: -9.574 tors. eta vs tors. theta energy: -3.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -130.702781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.702781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.702781 (E_RNA) where: Base-Base interactions energy: -74.530 where: short stacking energy: -43.203 Base-Backbone interact. energy: -0.009 local terms energy: -56.164182 where: bonds (distance) C4'-P energy: -10.733 bonds (distance) P-C4' energy: -14.606 flat angles C4'-P-C4' energy: -10.321 flat angles P-C4'-P energy: -9.431 tors. eta vs tors. theta energy: -11.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -89.461093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.461093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.461093 (E_RNA) where: Base-Base interactions energy: -34.481 where: short stacking energy: -24.972 Base-Backbone interact. energy: -0.117 local terms energy: -54.862437 where: bonds (distance) C4'-P energy: -10.767 bonds (distance) P-C4' energy: -14.922 flat angles C4'-P-C4' energy: -11.156 flat angles P-C4'-P energy: -9.323 tors. eta vs tors. theta energy: -8.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -81.050535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.050535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.050535 (E_RNA) where: Base-Base interactions energy: -37.196 where: short stacking energy: -22.312 Base-Backbone interact. energy: 0.223 local terms energy: -44.077864 where: bonds (distance) C4'-P energy: -12.722 bonds (distance) P-C4' energy: -13.444 flat angles C4'-P-C4' energy: -9.563 flat angles P-C4'-P energy: -5.615 tors. eta vs tors. theta energy: -2.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -76.104631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.104631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.104631 (E_RNA) where: Base-Base interactions energy: -18.901 where: short stacking energy: -18.832 Base-Backbone interact. energy: -0.650 local terms energy: -56.553686 where: bonds (distance) C4'-P energy: -12.671 bonds (distance) P-C4' energy: -15.019 flat angles C4'-P-C4' energy: -12.947 flat angles P-C4'-P energy: -13.205 tors. eta vs tors. theta energy: -2.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -80.109251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.109251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.109251 (E_RNA) where: Base-Base interactions energy: -38.497 where: short stacking energy: -20.185 Base-Backbone interact. energy: -0.197 local terms energy: -41.415831 where: bonds (distance) C4'-P energy: -5.753 bonds (distance) P-C4' energy: -13.652 flat angles C4'-P-C4' energy: -11.905 flat angles P-C4'-P energy: -6.105 tors. eta vs tors. theta energy: -4.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -190.563664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.563664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.563664 (E_RNA) where: Base-Base interactions energy: -124.282 where: short stacking energy: -57.285 Base-Backbone interact. energy: -0.018 local terms energy: -66.263699 where: bonds (distance) C4'-P energy: -15.520 bonds (distance) P-C4' energy: -14.646 flat angles C4'-P-C4' energy: -10.114 flat angles P-C4'-P energy: -10.041 tors. eta vs tors. theta energy: -15.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -157.885301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.885301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.885301 (E_RNA) where: Base-Base interactions energy: -92.442 where: short stacking energy: -47.837 Base-Backbone interact. energy: -0.277 local terms energy: -65.165447 where: bonds (distance) C4'-P energy: -13.090 bonds (distance) P-C4' energy: -14.018 flat angles C4'-P-C4' energy: -15.607 flat angles P-C4'-P energy: -10.782 tors. eta vs tors. theta energy: -11.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -150.814484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.814484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.814484 (E_RNA) where: Base-Base interactions energy: -85.974 where: short stacking energy: -46.780 Base-Backbone interact. energy: -0.239 local terms energy: -64.601339 where: bonds (distance) C4'-P energy: -14.588 bonds (distance) P-C4' energy: -16.999 flat angles C4'-P-C4' energy: -12.084 flat angles P-C4'-P energy: -10.058 tors. eta vs tors. theta energy: -10.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -128.235019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.235019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.235019 (E_RNA) where: Base-Base interactions energy: -73.439 where: short stacking energy: -29.776 Base-Backbone interact. energy: 2.391 local terms energy: -57.187063 where: bonds (distance) C4'-P energy: -13.499 bonds (distance) P-C4' energy: -17.556 flat angles C4'-P-C4' energy: -15.621 flat angles P-C4'-P energy: -8.707 tors. eta vs tors. theta energy: -1.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -89.698770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.698770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.698770 (E_RNA) where: Base-Base interactions energy: -31.579 where: short stacking energy: -23.027 Base-Backbone interact. energy: -0.103 local terms energy: -58.015951 where: bonds (distance) C4'-P energy: -13.748 bonds (distance) P-C4' energy: -15.717 flat angles C4'-P-C4' energy: -13.553 flat angles P-C4'-P energy: -5.760 tors. eta vs tors. theta energy: -9.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -85.837362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.837362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.837362 (E_RNA) where: Base-Base interactions energy: -29.327 where: short stacking energy: -29.327 Base-Backbone interact. energy: -0.012 local terms energy: -56.497856 where: bonds (distance) C4'-P energy: -12.156 bonds (distance) P-C4' energy: -15.045 flat angles C4'-P-C4' energy: -13.227 flat angles P-C4'-P energy: -10.579 tors. eta vs tors. theta energy: -5.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -115.708650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.708650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.708650 (E_RNA) where: Base-Base interactions energy: -64.173 where: short stacking energy: -31.469 Base-Backbone interact. energy: -0.118 local terms energy: -51.417242 where: bonds (distance) C4'-P energy: -14.543 bonds (distance) P-C4' energy: -13.905 flat angles C4'-P-C4' energy: -12.575 flat angles P-C4'-P energy: -7.902 tors. eta vs tors. theta energy: -2.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -88.226896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.226896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.226896 (E_RNA) where: Base-Base interactions energy: -32.267 where: short stacking energy: -29.021 Base-Backbone interact. energy: -0.080 local terms energy: -55.879939 where: bonds (distance) C4'-P energy: -10.675 bonds (distance) P-C4' energy: -16.661 flat angles C4'-P-C4' energy: -9.310 flat angles P-C4'-P energy: -11.866 tors. eta vs tors. theta energy: -7.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -70.599070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.599070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.599070 (E_RNA) where: Base-Base interactions energy: -17.301 where: short stacking energy: -16.206 Base-Backbone interact. energy: -0.863 local terms energy: -52.434427 where: bonds (distance) C4'-P energy: -15.048 bonds (distance) P-C4' energy: -15.358 flat angles C4'-P-C4' energy: -7.522 flat angles P-C4'-P energy: -9.190 tors. eta vs tors. theta energy: -5.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -67.950023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.950023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.950023 (E_RNA) where: Base-Base interactions energy: -20.800 where: short stacking energy: -18.434 Base-Backbone interact. energy: -0.131 local terms energy: -47.019303 where: bonds (distance) C4'-P energy: -12.705 bonds (distance) P-C4' energy: -14.392 flat angles C4'-P-C4' energy: -11.667 flat angles P-C4'-P energy: -5.153 tors. eta vs tors. theta energy: -3.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -178.854747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.854747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.854747 (E_RNA) where: Base-Base interactions energy: -108.625 where: short stacking energy: -48.603 Base-Backbone interact. energy: -1.350 local terms energy: -68.879053 where: bonds (distance) C4'-P energy: -13.650 bonds (distance) P-C4' energy: -14.905 flat angles C4'-P-C4' energy: -15.131 flat angles P-C4'-P energy: -12.222 tors. eta vs tors. theta energy: -12.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -156.014146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.014146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.014146 (E_RNA) where: Base-Base interactions energy: -93.692 where: short stacking energy: -46.961 Base-Backbone interact. energy: -0.174 local terms energy: -62.149015 where: bonds (distance) C4'-P energy: -12.021 bonds (distance) P-C4' energy: -15.941 flat angles C4'-P-C4' energy: -12.062 flat angles P-C4'-P energy: -8.306 tors. eta vs tors. theta energy: -13.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -146.214981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.214981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.214981 (E_RNA) where: Base-Base interactions energy: -83.229 where: short stacking energy: -48.983 Base-Backbone interact. energy: -0.056 local terms energy: -62.930590 where: bonds (distance) C4'-P energy: -11.190 bonds (distance) P-C4' energy: -15.918 flat angles C4'-P-C4' energy: -11.808 flat angles P-C4'-P energy: -10.245 tors. eta vs tors. theta energy: -13.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -134.696627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.696627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.696627 (E_RNA) where: Base-Base interactions energy: -71.555 where: short stacking energy: -39.175 Base-Backbone interact. energy: -0.298 local terms energy: -62.843941 where: bonds (distance) C4'-P energy: -14.858 bonds (distance) P-C4' energy: -16.314 flat angles C4'-P-C4' energy: -13.922 flat angles P-C4'-P energy: -10.867 tors. eta vs tors. theta energy: -6.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -91.017496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.017496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.017496 (E_RNA) where: Base-Base interactions energy: -37.095 where: short stacking energy: -37.095 Base-Backbone interact. energy: -0.025 local terms energy: -53.896553 where: bonds (distance) C4'-P energy: -10.266 bonds (distance) P-C4' energy: -13.848 flat angles C4'-P-C4' energy: -13.511 flat angles P-C4'-P energy: -6.883 tors. eta vs tors. theta energy: -9.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -86.763244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.763244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.763244 (E_RNA) where: Base-Base interactions energy: -30.155 where: short stacking energy: -27.754 Base-Backbone interact. energy: -0.060 local terms energy: -56.548247 where: bonds (distance) C4'-P energy: -10.036 bonds (distance) P-C4' energy: -16.936 flat angles C4'-P-C4' energy: -15.320 flat angles P-C4'-P energy: -9.592 tors. eta vs tors. theta energy: -4.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -94.016053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.016053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.016053 (E_RNA) where: Base-Base interactions energy: -49.083 where: short stacking energy: -22.796 Base-Backbone interact. energy: 0.422 local terms energy: -45.355362 where: bonds (distance) C4'-P energy: -13.763 bonds (distance) P-C4' energy: -15.779 flat angles C4'-P-C4' energy: -5.621 flat angles P-C4'-P energy: -8.593 tors. eta vs tors. theta energy: -1.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -81.301090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.301090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.301090 (E_RNA) where: Base-Base interactions energy: -34.163 where: short stacking energy: -24.399 Base-Backbone interact. energy: -0.146 local terms energy: -46.991402 where: bonds (distance) C4'-P energy: -7.465 bonds (distance) P-C4' energy: -15.172 flat angles C4'-P-C4' energy: -13.575 flat angles P-C4'-P energy: -8.870 tors. eta vs tors. theta energy: -1.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -71.162958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.162958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.162958 (E_RNA) where: Base-Base interactions energy: -27.564 where: short stacking energy: -18.322 Base-Backbone interact. energy: -0.256 local terms energy: -43.342826 where: bonds (distance) C4'-P energy: -10.726 bonds (distance) P-C4' energy: -15.569 flat angles C4'-P-C4' energy: -9.429 flat angles P-C4'-P energy: -7.251 tors. eta vs tors. theta energy: -0.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -77.746821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.746821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.746821 (E_RNA) where: Base-Base interactions energy: -22.135 where: short stacking energy: -21.817 Base-Backbone interact. energy: -0.475 local terms energy: -55.136639 where: bonds (distance) C4'-P energy: -14.761 bonds (distance) P-C4' energy: -16.038 flat angles C4'-P-C4' energy: -14.319 flat angles P-C4'-P energy: -5.207 tors. eta vs tors. theta energy: -4.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -179.691427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.691427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.691427 (E_RNA) where: Base-Base interactions energy: -115.616 where: short stacking energy: -54.570 Base-Backbone interact. energy: -0.407 local terms energy: -63.668764 where: bonds (distance) C4'-P energy: -14.936 bonds (distance) P-C4' energy: -11.510 flat angles C4'-P-C4' energy: -12.724 flat angles P-C4'-P energy: -10.223 tors. eta vs tors. theta energy: -14.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -152.160070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.160070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.160070 (E_RNA) where: Base-Base interactions energy: -92.093 where: short stacking energy: -41.639 Base-Backbone interact. energy: -0.217 local terms energy: -59.849874 where: bonds (distance) C4'-P energy: -15.363 bonds (distance) P-C4' energy: -14.678 flat angles C4'-P-C4' energy: -11.491 flat angles P-C4'-P energy: -8.300 tors. eta vs tors. theta energy: -10.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -138.451231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.451231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.451231 (E_RNA) where: Base-Base interactions energy: -81.467 where: short stacking energy: -42.666 Base-Backbone interact. energy: -0.020 local terms energy: -56.964412 where: bonds (distance) C4'-P energy: -14.378 bonds (distance) P-C4' energy: -14.781 flat angles C4'-P-C4' energy: -12.384 flat angles P-C4'-P energy: -8.407 tors. eta vs tors. theta energy: -7.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -138.031649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.031649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.031649 (E_RNA) where: Base-Base interactions energy: -78.064 where: short stacking energy: -34.050 Base-Backbone interact. energy: -0.066 local terms energy: -59.901566 where: bonds (distance) C4'-P energy: -16.990 bonds (distance) P-C4' energy: -14.024 flat angles C4'-P-C4' energy: -11.971 flat angles P-C4'-P energy: -6.805 tors. eta vs tors. theta energy: -10.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -93.185402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.185402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.185402 (E_RNA) where: Base-Base interactions energy: -39.469 where: short stacking energy: -38.899 Base-Backbone interact. energy: -0.093 local terms energy: -53.623373 where: bonds (distance) C4'-P energy: -10.039 bonds (distance) P-C4' energy: -14.839 flat angles C4'-P-C4' energy: -15.062 flat angles P-C4'-P energy: -6.595 tors. eta vs tors. theta energy: -7.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -83.955049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.955049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.955049 (E_RNA) where: Base-Base interactions energy: -32.490 where: short stacking energy: -31.654 Base-Backbone interact. energy: -0.017 local terms energy: -51.447766 where: bonds (distance) C4'-P energy: -10.349 bonds (distance) P-C4' energy: -9.903 flat angles C4'-P-C4' energy: -14.330 flat angles P-C4'-P energy: -8.711 tors. eta vs tors. theta energy: -8.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -78.718042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.718042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.718042 (E_RNA) where: Base-Base interactions energy: -29.161 where: short stacking energy: -29.161 Base-Backbone interact. energy: -0.110 local terms energy: -49.446986 where: bonds (distance) C4'-P energy: -14.944 bonds (distance) P-C4' energy: -16.647 flat angles C4'-P-C4' energy: -6.158 flat angles P-C4'-P energy: -11.631 tors. eta vs tors. theta energy: -0.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -75.674250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.674250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.674250 (E_RNA) where: Base-Base interactions energy: -31.890 where: short stacking energy: -16.481 Base-Backbone interact. energy: -0.428 local terms energy: -43.356772 where: bonds (distance) C4'-P energy: -10.324 bonds (distance) P-C4' energy: -16.086 flat angles C4'-P-C4' energy: -5.338 flat angles P-C4'-P energy: -7.541 tors. eta vs tors. theta energy: -4.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -86.077521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.077521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.077521 (E_RNA) where: Base-Base interactions energy: -35.029 where: short stacking energy: -15.163 Base-Backbone interact. energy: -0.038 local terms energy: -51.011042 where: bonds (distance) C4'-P energy: -16.037 bonds (distance) P-C4' energy: -13.920 flat angles C4'-P-C4' energy: -14.528 flat angles P-C4'-P energy: -8.354 tors. eta vs tors. theta energy: 1.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -76.992316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.992316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.992316 (E_RNA) where: Base-Base interactions energy: -26.854 where: short stacking energy: -26.854 Base-Backbone interact. energy: -0.167 local terms energy: -49.972096 where: bonds (distance) C4'-P energy: -16.336 bonds (distance) P-C4' energy: -13.479 flat angles C4'-P-C4' energy: -10.625 flat angles P-C4'-P energy: -5.497 tors. eta vs tors. theta energy: -4.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -186.449543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.449543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.449543 (E_RNA) where: Base-Base interactions energy: -115.508 where: short stacking energy: -53.182 Base-Backbone interact. energy: -0.619 local terms energy: -70.322992 where: bonds (distance) C4'-P energy: -13.864 bonds (distance) P-C4' energy: -13.815 flat angles C4'-P-C4' energy: -16.990 flat angles P-C4'-P energy: -11.988 tors. eta vs tors. theta energy: -13.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -157.582467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.582467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.582467 (E_RNA) where: Base-Base interactions energy: -94.337 where: short stacking energy: -45.293 Base-Backbone interact. energy: -0.192 local terms energy: -63.053705 where: bonds (distance) C4'-P energy: -12.531 bonds (distance) P-C4' energy: -15.040 flat angles C4'-P-C4' energy: -13.590 flat angles P-C4'-P energy: -10.193 tors. eta vs tors. theta energy: -11.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -143.015778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.015778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.015778 (E_RNA) where: Base-Base interactions energy: -89.055 where: short stacking energy: -43.520 Base-Backbone interact. energy: -1.063 local terms energy: -52.897602 where: bonds (distance) C4'-P energy: -14.075 bonds (distance) P-C4' energy: -11.942 flat angles C4'-P-C4' energy: -13.479 flat angles P-C4'-P energy: -7.586 tors. eta vs tors. theta energy: -5.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -144.110208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.110208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.110208 (E_RNA) where: Base-Base interactions energy: -84.204 where: short stacking energy: -35.724 Base-Backbone interact. energy: 0.424 local terms energy: -60.330063 where: bonds (distance) C4'-P energy: -15.309 bonds (distance) P-C4' energy: -17.323 flat angles C4'-P-C4' energy: -10.491 flat angles P-C4'-P energy: -5.877 tors. eta vs tors. theta energy: -11.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -102.154146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.154146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.154146 (E_RNA) where: Base-Base interactions energy: -42.598 where: short stacking energy: -34.274 Base-Backbone interact. energy: -0.009 local terms energy: -59.547271 where: bonds (distance) C4'-P energy: -14.533 bonds (distance) P-C4' energy: -11.652 flat angles C4'-P-C4' energy: -14.842 flat angles P-C4'-P energy: -11.432 tors. eta vs tors. theta energy: -7.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -95.497960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.497960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.497960 (E_RNA) where: Base-Base interactions energy: -44.182 where: short stacking energy: -30.225 Base-Backbone interact. energy: -0.067 local terms energy: -51.248188 where: bonds (distance) C4'-P energy: -12.294 bonds (distance) P-C4' energy: -9.856 flat angles C4'-P-C4' energy: -13.886 flat angles P-C4'-P energy: -11.379 tors. eta vs tors. theta energy: -3.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -81.693103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.693103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.693103 (E_RNA) where: Base-Base interactions energy: -28.270 where: short stacking energy: -22.651 Base-Backbone interact. energy: -0.094 local terms energy: -53.328493 where: bonds (distance) C4'-P energy: -11.686 bonds (distance) P-C4' energy: -16.936 flat angles C4'-P-C4' energy: -11.148 flat angles P-C4'-P energy: -5.575 tors. eta vs tors. theta energy: -7.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -94.784299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.784299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.784299 (E_RNA) where: Base-Base interactions energy: -39.309 where: short stacking energy: -34.443 Base-Backbone interact. energy: -0.490 local terms energy: -54.984986 where: bonds (distance) C4'-P energy: -13.992 bonds (distance) P-C4' energy: -16.311 flat angles C4'-P-C4' energy: -6.366 flat angles P-C4'-P energy: -8.668 tors. eta vs tors. theta energy: -9.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -67.727891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.727891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.727891 (E_RNA) where: Base-Base interactions energy: -30.690 where: short stacking energy: -15.914 Base-Backbone interact. energy: -0.128 local terms energy: -36.909919 where: bonds (distance) C4'-P energy: -11.305 bonds (distance) P-C4' energy: -12.217 flat angles C4'-P-C4' energy: -9.483 flat angles P-C4'-P energy: -5.467 tors. eta vs tors. theta energy: 1.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -71.288123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.288123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.288123 (E_RNA) where: Base-Base interactions energy: -23.343 where: short stacking energy: -20.077 Base-Backbone interact. energy: -0.144 local terms energy: -47.801785 where: bonds (distance) C4'-P energy: -10.709 bonds (distance) P-C4' energy: -16.164 flat angles C4'-P-C4' energy: -9.448 flat angles P-C4'-P energy: -8.750 tors. eta vs tors. theta energy: -2.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -198.970754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.970754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.970754 (E_RNA) where: Base-Base interactions energy: -125.885 where: short stacking energy: -60.127 Base-Backbone interact. energy: -0.049 local terms energy: -73.036860 where: bonds (distance) C4'-P energy: -15.296 bonds (distance) P-C4' energy: -14.388 flat angles C4'-P-C4' energy: -15.963 flat angles P-C4'-P energy: -9.252 tors. eta vs tors. theta energy: -18.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -157.034353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.034353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.034353 (E_RNA) where: Base-Base interactions energy: -96.485 where: short stacking energy: -46.687 Base-Backbone interact. energy: 0.209 local terms energy: -60.757804 where: bonds (distance) C4'-P energy: -14.791 bonds (distance) P-C4' energy: -13.413 flat angles C4'-P-C4' energy: -13.725 flat angles P-C4'-P energy: -5.905 tors. eta vs tors. theta energy: -12.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -146.669460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.669460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.669460 (E_RNA) where: Base-Base interactions energy: -82.654 where: short stacking energy: -45.923 Base-Backbone interact. energy: -0.206 local terms energy: -63.810071 where: bonds (distance) C4'-P energy: -16.088 bonds (distance) P-C4' energy: -12.609 flat angles C4'-P-C4' energy: -13.394 flat angles P-C4'-P energy: -9.180 tors. eta vs tors. theta energy: -12.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -140.290172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.290172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.290172 (E_RNA) where: Base-Base interactions energy: -87.776 where: short stacking energy: -39.089 Base-Backbone interact. energy: 0.251 local terms energy: -52.764317 where: bonds (distance) C4'-P energy: -12.773 bonds (distance) P-C4' energy: -8.904 flat angles C4'-P-C4' energy: -12.067 flat angles P-C4'-P energy: -5.070 tors. eta vs tors. theta energy: -13.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -88.919640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.919640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.919640 (E_RNA) where: Base-Base interactions energy: -25.799 where: short stacking energy: -25.799 Base-Backbone interact. energy: 0.017 local terms energy: -63.137045 where: bonds (distance) C4'-P energy: -17.122 bonds (distance) P-C4' energy: -15.812 flat angles C4'-P-C4' energy: -12.061 flat angles P-C4'-P energy: -11.591 tors. eta vs tors. theta energy: -6.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -82.862152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.862152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.862152 (E_RNA) where: Base-Base interactions energy: -38.809 where: short stacking energy: -21.305 Base-Backbone interact. energy: -0.227 local terms energy: -43.826421 where: bonds (distance) C4'-P energy: -11.366 bonds (distance) P-C4' energy: -15.183 flat angles C4'-P-C4' energy: -8.630 flat angles P-C4'-P energy: -7.993 tors. eta vs tors. theta energy: -0.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -112.585473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.585473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.585473 (E_RNA) where: Base-Base interactions energy: -53.333 where: short stacking energy: -22.890 Base-Backbone interact. energy: -0.146 local terms energy: -59.106875 where: bonds (distance) C4'-P energy: -15.533 bonds (distance) P-C4' energy: -11.716 flat angles C4'-P-C4' energy: -15.206 flat angles P-C4'-P energy: -9.503 tors. eta vs tors. theta energy: -7.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -75.089778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.089778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.089778 (E_RNA) where: Base-Base interactions energy: -26.459 where: short stacking energy: -8.929 Base-Backbone interact. energy: -0.093 local terms energy: -48.537932 where: bonds (distance) C4'-P energy: -15.246 bonds (distance) P-C4' energy: -15.100 flat angles C4'-P-C4' energy: -13.652 flat angles P-C4'-P energy: -5.363 tors. eta vs tors. theta energy: 0.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -84.621543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.621543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.621543 (E_RNA) where: Base-Base interactions energy: -34.429 where: short stacking energy: -19.224 Base-Backbone interact. energy: 0.058 local terms energy: -50.250283 where: bonds (distance) C4'-P energy: -16.351 bonds (distance) P-C4' energy: -12.648 flat angles C4'-P-C4' energy: -12.681 flat angles P-C4'-P energy: -8.740 tors. eta vs tors. theta energy: 0.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -68.441221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.441221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.441221 (E_RNA) where: Base-Base interactions energy: -19.556 where: short stacking energy: -16.906 Base-Backbone interact. energy: -0.824 local terms energy: -48.060363 where: bonds (distance) C4'-P energy: -12.981 bonds (distance) P-C4' energy: -12.504 flat angles C4'-P-C4' energy: -12.801 flat angles P-C4'-P energy: -9.782 tors. eta vs tors. theta energy: 0.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -196.415070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.415070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.415070 (E_RNA) where: Base-Base interactions energy: -119.129 where: short stacking energy: -58.931 Base-Backbone interact. energy: -0.019 local terms energy: -77.266779 where: bonds (distance) C4'-P energy: -15.322 bonds (distance) P-C4' energy: -16.371 flat angles C4'-P-C4' energy: -15.695 flat angles P-C4'-P energy: -10.865 tors. eta vs tors. theta energy: -19.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -164.476346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.476346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.476346 (E_RNA) where: Base-Base interactions energy: -97.015 where: short stacking energy: -47.752 Base-Backbone interact. energy: -0.082 local terms energy: -67.379332 where: bonds (distance) C4'-P energy: -14.172 bonds (distance) P-C4' energy: -14.593 flat angles C4'-P-C4' energy: -15.208 flat angles P-C4'-P energy: -9.049 tors. eta vs tors. theta energy: -14.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -160.055237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.055237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.055237 (E_RNA) where: Base-Base interactions energy: -97.487 where: short stacking energy: -45.953 Base-Backbone interact. energy: -0.016 local terms energy: -62.552511 where: bonds (distance) C4'-P energy: -13.851 bonds (distance) P-C4' energy: -14.844 flat angles C4'-P-C4' energy: -11.244 flat angles P-C4'-P energy: -11.604 tors. eta vs tors. theta energy: -11.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -147.078501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.078501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.078501 (E_RNA) where: Base-Base interactions energy: -77.815 where: short stacking energy: -40.546 Base-Backbone interact. energy: -0.079 local terms energy: -69.185076 where: bonds (distance) C4'-P energy: -13.136 bonds (distance) P-C4' energy: -17.268 flat angles C4'-P-C4' energy: -14.541 flat angles P-C4'-P energy: -11.320 tors. eta vs tors. theta energy: -12.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -94.057586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.057586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.057586 (E_RNA) where: Base-Base interactions energy: -40.624 where: short stacking energy: -31.220 Base-Backbone interact. energy: -1.004 local terms energy: -52.429783 where: bonds (distance) C4'-P energy: -16.711 bonds (distance) P-C4' energy: -9.236 flat angles C4'-P-C4' energy: -14.120 flat angles P-C4'-P energy: -6.489 tors. eta vs tors. theta energy: -5.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -88.832983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.832983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.832983 (E_RNA) where: Base-Base interactions energy: -41.409 where: short stacking energy: -37.210 Base-Backbone interact. energy: 0.597 local terms energy: -48.020963 where: bonds (distance) C4'-P energy: -10.117 bonds (distance) P-C4' energy: -7.956 flat angles C4'-P-C4' energy: -12.256 flat angles P-C4'-P energy: -10.624 tors. eta vs tors. theta energy: -7.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -72.584327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.584327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.584327 (E_RNA) where: Base-Base interactions energy: -25.626 where: short stacking energy: -25.626 Base-Backbone interact. energy: -0.175 local terms energy: -46.783078 where: bonds (distance) C4'-P energy: -12.318 bonds (distance) P-C4' energy: -12.511 flat angles C4'-P-C4' energy: -7.712 flat angles P-C4'-P energy: -8.674 tors. eta vs tors. theta energy: -5.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -94.392624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.392624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.392624 (E_RNA) where: Base-Base interactions energy: -53.758 where: short stacking energy: -24.046 Base-Backbone interact. energy: -0.670 local terms energy: -39.965015 where: bonds (distance) C4'-P energy: -13.710 bonds (distance) P-C4' energy: -11.891 flat angles C4'-P-C4' energy: -5.200 flat angles P-C4'-P energy: -7.990 tors. eta vs tors. theta energy: -1.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -71.122494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.122494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.122494 (E_RNA) where: Base-Base interactions energy: -29.926 where: short stacking energy: -22.321 Base-Backbone interact. energy: -1.499 local terms energy: -39.697593 where: bonds (distance) C4'-P energy: -12.302 bonds (distance) P-C4' energy: -11.299 flat angles C4'-P-C4' energy: -10.119 flat angles P-C4'-P energy: -5.844 tors. eta vs tors. theta energy: -0.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -69.560182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.560182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.560182 (E_RNA) where: Base-Base interactions energy: -20.741 where: short stacking energy: -20.741 Base-Backbone interact. energy: -0.074 local terms energy: -48.744947 where: bonds (distance) C4'-P energy: -15.797 bonds (distance) P-C4' energy: -9.515 flat angles C4'-P-C4' energy: -10.597 flat angles P-C4'-P energy: -5.918 tors. eta vs tors. theta energy: -6.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -196.802584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.802584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.802584 (E_RNA) where: Base-Base interactions energy: -120.884 where: short stacking energy: -60.183 Base-Backbone interact. energy: -0.327 local terms energy: -75.591802 where: bonds (distance) C4'-P energy: -16.613 bonds (distance) P-C4' energy: -13.725 flat angles C4'-P-C4' energy: -14.732 flat angles P-C4'-P energy: -11.925 tors. eta vs tors. theta energy: -18.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -158.619757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.619757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.619757 (E_RNA) where: Base-Base interactions energy: -95.712 where: short stacking energy: -40.565 Base-Backbone interact. energy: -0.067 local terms energy: -62.840107 where: bonds (distance) C4'-P energy: -12.432 bonds (distance) P-C4' energy: -15.287 flat angles C4'-P-C4' energy: -14.437 flat angles P-C4'-P energy: -10.567 tors. eta vs tors. theta energy: -10.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -155.764343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.764343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.764343 (E_RNA) where: Base-Base interactions energy: -101.607 where: short stacking energy: -48.181 Base-Backbone interact. energy: -0.101 local terms energy: -54.056602 where: bonds (distance) C4'-P energy: -13.240 bonds (distance) P-C4' energy: -15.046 flat angles C4'-P-C4' energy: -13.837 flat angles P-C4'-P energy: -0.624 tors. eta vs tors. theta energy: -11.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -142.617265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.617265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.617265 (E_RNA) where: Base-Base interactions energy: -73.751 where: short stacking energy: -41.986 Base-Backbone interact. energy: -0.109 local terms energy: -68.757542 where: bonds (distance) C4'-P energy: -17.701 bonds (distance) P-C4' energy: -13.342 flat angles C4'-P-C4' energy: -14.839 flat angles P-C4'-P energy: -10.427 tors. eta vs tors. theta energy: -12.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -88.650428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.650428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.650428 (E_RNA) where: Base-Base interactions energy: -31.329 where: short stacking energy: -30.820 Base-Backbone interact. energy: -0.117 local terms energy: -57.204828 where: bonds (distance) C4'-P energy: -10.072 bonds (distance) P-C4' energy: -17.102 flat angles C4'-P-C4' energy: -11.689 flat angles P-C4'-P energy: -13.215 tors. eta vs tors. theta energy: -5.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -88.552613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.552613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.552613 (E_RNA) where: Base-Base interactions energy: -36.276 where: short stacking energy: -26.766 Base-Backbone interact. energy: -0.240 local terms energy: -52.036383 where: bonds (distance) C4'-P energy: -14.328 bonds (distance) P-C4' energy: -15.298 flat angles C4'-P-C4' energy: -11.907 flat angles P-C4'-P energy: -6.423 tors. eta vs tors. theta energy: -4.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -77.098433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.098433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.098433 (E_RNA) where: Base-Base interactions energy: -23.963 where: short stacking energy: -23.359 Base-Backbone interact. energy: 0.018 local terms energy: -53.153559 where: bonds (distance) C4'-P energy: -16.079 bonds (distance) P-C4' energy: -13.100 flat angles C4'-P-C4' energy: -9.207 flat angles P-C4'-P energy: -9.537 tors. eta vs tors. theta energy: -5.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -73.940937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.940937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.940937 (E_RNA) where: Base-Base interactions energy: -29.301 where: short stacking energy: -24.424 Base-Backbone interact. energy: -0.421 local terms energy: -44.219083 where: bonds (distance) C4'-P energy: -11.920 bonds (distance) P-C4' energy: -10.846 flat angles C4'-P-C4' energy: -10.071 flat angles P-C4'-P energy: -8.353 tors. eta vs tors. theta energy: -3.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -70.108534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.108534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.108534 (E_RNA) where: Base-Base interactions energy: -20.773 where: short stacking energy: -19.908 Base-Backbone interact. energy: 0.534 local terms energy: -49.869774 where: bonds (distance) C4'-P energy: -10.516 bonds (distance) P-C4' energy: -16.389 flat angles C4'-P-C4' energy: -10.657 flat angles P-C4'-P energy: -8.296 tors. eta vs tors. theta energy: -4.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -72.387449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.387449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.387449 (E_RNA) where: Base-Base interactions energy: -26.759 where: short stacking energy: -17.713 Base-Backbone interact. energy: 1.699 local terms energy: -47.327207 where: bonds (distance) C4'-P energy: -12.046 bonds (distance) P-C4' energy: -15.719 flat angles C4'-P-C4' energy: -15.017 flat angles P-C4'-P energy: -4.139 tors. eta vs tors. theta energy: -0.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -195.458553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.458553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.458553 (E_RNA) where: Base-Base interactions energy: -122.050 where: short stacking energy: -67.515 Base-Backbone interact. energy: -0.009 local terms energy: -73.399074 where: bonds (distance) C4'-P energy: -14.714 bonds (distance) P-C4' energy: -15.591 flat angles C4'-P-C4' energy: -14.719 flat angles P-C4'-P energy: -9.372 tors. eta vs tors. theta energy: -19.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -165.571778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.571778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.571778 (E_RNA) where: Base-Base interactions energy: -97.656 where: short stacking energy: -54.295 Base-Backbone interact. energy: -1.462 local terms energy: -66.454051 where: bonds (distance) C4'-P energy: -14.629 bonds (distance) P-C4' energy: -12.867 flat angles C4'-P-C4' energy: -15.105 flat angles P-C4'-P energy: -10.469 tors. eta vs tors. theta energy: -13.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -157.684080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.684080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.684080 (E_RNA) where: Base-Base interactions energy: -91.950 where: short stacking energy: -51.662 Base-Backbone interact. energy: -0.097 local terms energy: -65.637650 where: bonds (distance) C4'-P energy: -15.226 bonds (distance) P-C4' energy: -9.524 flat angles C4'-P-C4' energy: -16.568 flat angles P-C4'-P energy: -6.357 tors. eta vs tors. theta energy: -17.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -149.039002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.039002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.039002 (E_RNA) where: Base-Base interactions energy: -88.364 where: short stacking energy: -44.910 Base-Backbone interact. energy: -0.023 local terms energy: -60.651345 where: bonds (distance) C4'-P energy: -14.631 bonds (distance) P-C4' energy: -14.118 flat angles C4'-P-C4' energy: -12.906 flat angles P-C4'-P energy: -6.811 tors. eta vs tors. theta energy: -12.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -99.699129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.699129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.699129 (E_RNA) where: Base-Base interactions energy: -51.287 where: short stacking energy: -25.337 Base-Backbone interact. energy: -0.254 local terms energy: -48.158610 where: bonds (distance) C4'-P energy: -13.971 bonds (distance) P-C4' energy: -16.731 flat angles C4'-P-C4' energy: -12.352 flat angles P-C4'-P energy: -7.194 tors. eta vs tors. theta energy: 2.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -99.792762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.792762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.792762 (E_RNA) where: Base-Base interactions energy: -49.992 where: short stacking energy: -30.693 Base-Backbone interact. energy: -0.704 local terms energy: -49.097216 where: bonds (distance) C4'-P energy: -12.875 bonds (distance) P-C4' energy: -11.813 flat angles C4'-P-C4' energy: -12.992 flat angles P-C4'-P energy: -8.886 tors. eta vs tors. theta energy: -2.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -75.134849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.134849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.134849 (E_RNA) where: Base-Base interactions energy: -26.676 where: short stacking energy: -23.239 Base-Backbone interact. energy: -0.135 local terms energy: -48.323919 where: bonds (distance) C4'-P energy: -12.870 bonds (distance) P-C4' energy: -15.692 flat angles C4'-P-C4' energy: -8.070 flat angles P-C4'-P energy: -8.792 tors. eta vs tors. theta energy: -2.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -78.679405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.679405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.679405 (E_RNA) where: Base-Base interactions energy: -28.168 where: short stacking energy: -28.168 Base-Backbone interact. energy: -0.004 local terms energy: -50.507346 where: bonds (distance) C4'-P energy: -14.739 bonds (distance) P-C4' energy: -10.365 flat angles C4'-P-C4' energy: -12.951 flat angles P-C4'-P energy: -7.502 tors. eta vs tors. theta energy: -4.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -72.074653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.074653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.074653 (E_RNA) where: Base-Base interactions energy: -23.947 where: short stacking energy: -23.947 Base-Backbone interact. energy: -0.080 local terms energy: -48.047578 where: bonds (distance) C4'-P energy: -11.310 bonds (distance) P-C4' energy: -10.854 flat angles C4'-P-C4' energy: -12.901 flat angles P-C4'-P energy: -9.107 tors. eta vs tors. theta energy: -3.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -67.785018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.785018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.785018 (E_RNA) where: Base-Base interactions energy: -15.189 where: short stacking energy: -14.386 Base-Backbone interact. energy: -0.637 local terms energy: -51.958464 where: bonds (distance) C4'-P energy: -16.285 bonds (distance) P-C4' energy: -15.797 flat angles C4'-P-C4' energy: -8.662 flat angles P-C4'-P energy: -9.005 tors. eta vs tors. theta energy: -2.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -193.021445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.021445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.021445 (E_RNA) where: Base-Base interactions energy: -119.879 where: short stacking energy: -61.418 Base-Backbone interact. energy: 0.141 local terms energy: -73.283659 where: bonds (distance) C4'-P energy: -15.698 bonds (distance) P-C4' energy: -15.183 flat angles C4'-P-C4' energy: -15.090 flat angles P-C4'-P energy: -11.573 tors. eta vs tors. theta energy: -15.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -162.334150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.334150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.334150 (E_RNA) where: Base-Base interactions energy: -95.108 where: short stacking energy: -47.703 Base-Backbone interact. energy: -0.820 local terms energy: -66.405841 where: bonds (distance) C4'-P energy: -15.192 bonds (distance) P-C4' energy: -15.015 flat angles C4'-P-C4' energy: -14.806 flat angles P-C4'-P energy: -9.335 tors. eta vs tors. theta energy: -12.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -151.191976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.191976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.191976 (E_RNA) where: Base-Base interactions energy: -83.515 where: short stacking energy: -45.089 Base-Backbone interact. energy: -0.145 local terms energy: -67.532172 where: bonds (distance) C4'-P energy: -14.518 bonds (distance) P-C4' energy: -17.207 flat angles C4'-P-C4' energy: -13.317 flat angles P-C4'-P energy: -8.695 tors. eta vs tors. theta energy: -13.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -151.601344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.601344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.601344 (E_RNA) where: Base-Base interactions energy: -94.986 where: short stacking energy: -41.906 Base-Backbone interact. energy: -0.268 local terms energy: -56.347619 where: bonds (distance) C4'-P energy: -11.872 bonds (distance) P-C4' energy: -12.526 flat angles C4'-P-C4' energy: -12.435 flat angles P-C4'-P energy: -5.881 tors. eta vs tors. theta energy: -13.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -95.505021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.505021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.505021 (E_RNA) where: Base-Base interactions energy: -44.242 where: short stacking energy: -32.163 Base-Backbone interact. energy: -0.193 local terms energy: -51.069787 where: bonds (distance) C4'-P energy: -14.066 bonds (distance) P-C4' energy: -13.852 flat angles C4'-P-C4' energy: -14.856 flat angles P-C4'-P energy: -5.141 tors. eta vs tors. theta energy: -3.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -92.530860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.530860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.530860 (E_RNA) where: Base-Base interactions energy: -46.629 where: short stacking energy: -20.593 Base-Backbone interact. energy: -0.182 local terms energy: -45.719491 where: bonds (distance) C4'-P energy: -11.908 bonds (distance) P-C4' energy: -13.287 flat angles C4'-P-C4' energy: -12.790 flat angles P-C4'-P energy: -4.603 tors. eta vs tors. theta energy: -3.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -92.482723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.482723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.482723 (E_RNA) where: Base-Base interactions energy: -38.383 where: short stacking energy: -23.102 Base-Backbone interact. energy: -0.111 local terms energy: -53.988190 where: bonds (distance) C4'-P energy: -16.220 bonds (distance) P-C4' energy: -15.935 flat angles C4'-P-C4' energy: -12.633 flat angles P-C4'-P energy: -5.477 tors. eta vs tors. theta energy: -3.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -82.239557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.239557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.239557 (E_RNA) where: Base-Base interactions energy: -35.747 where: short stacking energy: -28.857 Base-Backbone interact. energy: 0.263 local terms energy: -46.755922 where: bonds (distance) C4'-P energy: -14.774 bonds (distance) P-C4' energy: -12.391 flat angles C4'-P-C4' energy: -10.721 flat angles P-C4'-P energy: -6.744 tors. eta vs tors. theta energy: -2.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -71.985298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.985298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.985298 (E_RNA) where: Base-Base interactions energy: -24.849 where: short stacking energy: -18.689 Base-Backbone interact. energy: -1.045 local terms energy: -46.091780 where: bonds (distance) C4'-P energy: -8.925 bonds (distance) P-C4' energy: -12.712 flat angles C4'-P-C4' energy: -16.575 flat angles P-C4'-P energy: -4.689 tors. eta vs tors. theta energy: -3.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -73.107942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.107942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.107942 (E_RNA) where: Base-Base interactions energy: -24.046 where: short stacking energy: -23.045 Base-Backbone interact. energy: -0.166 local terms energy: -48.895807 where: bonds (distance) C4'-P energy: -11.745 bonds (distance) P-C4' energy: -14.204 flat angles C4'-P-C4' energy: -12.217 flat angles P-C4'-P energy: -5.144 tors. eta vs tors. theta energy: -5.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -189.967548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.967548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.967548 (E_RNA) where: Base-Base interactions energy: -115.333 where: short stacking energy: -60.661 Base-Backbone interact. energy: 0.107 local terms energy: -74.741807 where: bonds (distance) C4'-P energy: -12.977 bonds (distance) P-C4' energy: -16.364 flat angles C4'-P-C4' energy: -17.504 flat angles P-C4'-P energy: -10.194 tors. eta vs tors. theta energy: -17.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -168.441134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.441134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.441134 (E_RNA) where: Base-Base interactions energy: -103.332 where: short stacking energy: -46.024 Base-Backbone interact. energy: -0.375 local terms energy: -64.734652 where: bonds (distance) C4'-P energy: -13.326 bonds (distance) P-C4' energy: -16.146 flat angles C4'-P-C4' energy: -14.291 flat angles P-C4'-P energy: -8.517 tors. eta vs tors. theta energy: -12.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -140.176133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.176133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.176133 (E_RNA) where: Base-Base interactions energy: -74.601 where: short stacking energy: -36.273 Base-Backbone interact. energy: -0.171 local terms energy: -65.404323 where: bonds (distance) C4'-P energy: -12.494 bonds (distance) P-C4' energy: -15.613 flat angles C4'-P-C4' energy: -15.544 flat angles P-C4'-P energy: -12.117 tors. eta vs tors. theta energy: -9.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -145.103372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.103372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.103372 (E_RNA) where: Base-Base interactions energy: -83.231 where: short stacking energy: -32.376 Base-Backbone interact. energy: -0.185 local terms energy: -61.687155 where: bonds (distance) C4'-P energy: -16.419 bonds (distance) P-C4' energy: -12.030 flat angles C4'-P-C4' energy: -12.870 flat angles P-C4'-P energy: -6.527 tors. eta vs tors. theta energy: -13.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -105.958351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -105.958351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -105.958351 (E_RNA) where: Base-Base interactions energy: -43.489 where: short stacking energy: -43.489 Base-Backbone interact. energy: 0.148 local terms energy: -62.616650 where: bonds (distance) C4'-P energy: -15.466 bonds (distance) P-C4' energy: -13.892 flat angles C4'-P-C4' energy: -12.492 flat angles P-C4'-P energy: -8.700 tors. eta vs tors. theta energy: -12.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -101.033733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -101.033733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -101.033733 (E_RNA) where: Base-Base interactions energy: -48.343 where: short stacking energy: -25.235 Base-Backbone interact. energy: -0.236 local terms energy: -52.454689 where: bonds (distance) C4'-P energy: -11.157 bonds (distance) P-C4' energy: -13.840 flat angles C4'-P-C4' energy: -13.715 flat angles P-C4'-P energy: -10.659 tors. eta vs tors. theta energy: -3.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -84.808811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.808811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.808811 (E_RNA) where: Base-Base interactions energy: -32.876 where: short stacking energy: -32.876 Base-Backbone interact. energy: -0.111 local terms energy: -51.822051 where: bonds (distance) C4'-P energy: -13.807 bonds (distance) P-C4' energy: -15.846 flat angles C4'-P-C4' energy: -11.152 flat angles P-C4'-P energy: -6.354 tors. eta vs tors. theta energy: -4.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -84.761668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.761668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.761668 (E_RNA) where: Base-Base interactions energy: -33.416 where: short stacking energy: -29.032 Base-Backbone interact. energy: 0.023 local terms energy: -51.368177 where: bonds (distance) C4'-P energy: -9.932 bonds (distance) P-C4' energy: -15.824 flat angles C4'-P-C4' energy: -13.266 flat angles P-C4'-P energy: -8.480 tors. eta vs tors. theta energy: -3.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -71.231177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.231177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.231177 (E_RNA) where: Base-Base interactions energy: -26.381 where: short stacking energy: -11.458 Base-Backbone interact. energy: -0.132 local terms energy: -44.718111 where: bonds (distance) C4'-P energy: -11.467 bonds (distance) P-C4' energy: -12.186 flat angles C4'-P-C4' energy: -15.220 flat angles P-C4'-P energy: -8.824 tors. eta vs tors. theta energy: 2.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -63.971235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -63.971235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -63.971235 (E_RNA) where: Base-Base interactions energy: -18.391 where: short stacking energy: -18.391 Base-Backbone interact. energy: 2.332 local terms energy: -47.912238 where: bonds (distance) C4'-P energy: -12.092 bonds (distance) P-C4' energy: -9.784 flat angles C4'-P-C4' energy: -11.548 flat angles P-C4'-P energy: -11.369 tors. eta vs tors. theta energy: -3.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -193.618850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.618850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.618850 (E_RNA) where: Base-Base interactions energy: -119.419 where: short stacking energy: -61.163 Base-Backbone interact. energy: -0.003 local terms energy: -74.197186 where: bonds (distance) C4'-P energy: -14.013 bonds (distance) P-C4' energy: -12.347 flat angles C4'-P-C4' energy: -15.299 flat angles P-C4'-P energy: -12.577 tors. eta vs tors. theta energy: -19.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -160.723379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.723379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.723379 (E_RNA) where: Base-Base interactions energy: -95.959 where: short stacking energy: -45.644 Base-Backbone interact. energy: -0.100 local terms energy: -64.664672 where: bonds (distance) C4'-P energy: -12.630 bonds (distance) P-C4' energy: -13.941 flat angles C4'-P-C4' energy: -15.429 flat angles P-C4'-P energy: -10.544 tors. eta vs tors. theta energy: -12.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -170.285220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.285220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.285220 (E_RNA) where: Base-Base interactions energy: -105.631 where: short stacking energy: -46.662 Base-Backbone interact. energy: -0.788 local terms energy: -63.865985 where: bonds (distance) C4'-P energy: -16.153 bonds (distance) P-C4' energy: -15.928 flat angles C4'-P-C4' energy: -11.294 flat angles P-C4'-P energy: -7.635 tors. eta vs tors. theta energy: -12.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -152.027069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.027069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.027069 (E_RNA) where: Base-Base interactions energy: -89.285 where: short stacking energy: -41.507 Base-Backbone interact. energy: 0.006 local terms energy: -62.747911 where: bonds (distance) C4'-P energy: -13.745 bonds (distance) P-C4' energy: -14.824 flat angles C4'-P-C4' energy: -14.399 flat angles P-C4'-P energy: -6.373 tors. eta vs tors. theta energy: -13.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -90.908411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.908411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.908411 (E_RNA) where: Base-Base interactions energy: -36.484 where: short stacking energy: -36.484 Base-Backbone interact. energy: -0.058 local terms energy: -54.366419 where: bonds (distance) C4'-P energy: -12.912 bonds (distance) P-C4' energy: -16.735 flat angles C4'-P-C4' energy: -11.414 flat angles P-C4'-P energy: -5.701 tors. eta vs tors. theta energy: -7.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -93.990874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.990874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.990874 (E_RNA) where: Base-Base interactions energy: -34.949 where: short stacking energy: -34.875 Base-Backbone interact. energy: 0.053 local terms energy: -59.095016 where: bonds (distance) C4'-P energy: -12.055 bonds (distance) P-C4' energy: -15.103 flat angles C4'-P-C4' energy: -14.249 flat angles P-C4'-P energy: -5.835 tors. eta vs tors. theta energy: -11.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -124.614983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.614983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.614983 (E_RNA) where: Base-Base interactions energy: -70.031 where: short stacking energy: -31.250 Base-Backbone interact. energy: -0.177 local terms energy: -54.407322 where: bonds (distance) C4'-P energy: -15.577 bonds (distance) P-C4' energy: -13.419 flat angles C4'-P-C4' energy: -12.631 flat angles P-C4'-P energy: -7.445 tors. eta vs tors. theta energy: -5.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -74.045106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.045106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.045106 (E_RNA) where: Base-Base interactions energy: -27.069 where: short stacking energy: -26.766 Base-Backbone interact. energy: -0.042 local terms energy: -46.933368 where: bonds (distance) C4'-P energy: -13.045 bonds (distance) P-C4' energy: -13.727 flat angles C4'-P-C4' energy: -9.430 flat angles P-C4'-P energy: -7.498 tors. eta vs tors. theta energy: -3.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -71.461133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.461133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.461133 (E_RNA) where: Base-Base interactions energy: -23.472 where: short stacking energy: -23.472 Base-Backbone interact. energy: -0.065 local terms energy: -47.924901 where: bonds (distance) C4'-P energy: -12.180 bonds (distance) P-C4' energy: -13.934 flat angles C4'-P-C4' energy: -13.065 flat angles P-C4'-P energy: -3.681 tors. eta vs tors. theta energy: -5.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -76.859304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.859304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.859304 (E_RNA) where: Base-Base interactions energy: -32.701 where: short stacking energy: -23.514 Base-Backbone interact. energy: -0.107 local terms energy: -44.051211 where: bonds (distance) C4'-P energy: -9.632 bonds (distance) P-C4' energy: -11.475 flat angles C4'-P-C4' energy: -13.990 flat angles P-C4'-P energy: -5.949 tors. eta vs tors. theta energy: -3.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -189.271213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.271213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.271213 (E_RNA) where: Base-Base interactions energy: -108.881 where: short stacking energy: -59.038 Base-Backbone interact. energy: -0.006 local terms energy: -80.384047 where: bonds (distance) C4'-P energy: -15.905 bonds (distance) P-C4' energy: -14.379 flat angles C4'-P-C4' energy: -17.307 flat angles P-C4'-P energy: -13.773 tors. eta vs tors. theta energy: -19.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -155.350581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.350581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.350581 (E_RNA) where: Base-Base interactions energy: -95.725 where: short stacking energy: -50.368 Base-Backbone interact. energy: 1.253 local terms energy: -60.878863 where: bonds (distance) C4'-P energy: -12.787 bonds (distance) P-C4' energy: -13.743 flat angles C4'-P-C4' energy: -11.899 flat angles P-C4'-P energy: -6.448 tors. eta vs tors. theta energy: -16.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -160.419283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.419283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.419283 (E_RNA) where: Base-Base interactions energy: -99.555 where: short stacking energy: -45.155 Base-Backbone interact. energy: -1.231 local terms energy: -59.633529 where: bonds (distance) C4'-P energy: -14.242 bonds (distance) P-C4' energy: -14.715 flat angles C4'-P-C4' energy: -15.017 flat angles P-C4'-P energy: -2.230 tors. eta vs tors. theta energy: -13.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -146.333187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.333187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.333187 (E_RNA) where: Base-Base interactions energy: -87.146 where: short stacking energy: -34.235 Base-Backbone interact. energy: -0.402 local terms energy: -58.785586 where: bonds (distance) C4'-P energy: -12.845 bonds (distance) P-C4' energy: -15.975 flat angles C4'-P-C4' energy: -12.256 flat angles P-C4'-P energy: -8.772 tors. eta vs tors. theta energy: -8.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -84.920859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.920859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.920859 (E_RNA) where: Base-Base interactions energy: -41.606 where: short stacking energy: -33.849 Base-Backbone interact. energy: 3.294 local terms energy: -46.608729 where: bonds (distance) C4'-P energy: -12.422 bonds (distance) P-C4' energy: -13.027 flat angles C4'-P-C4' energy: -10.532 flat angles P-C4'-P energy: -3.022 tors. eta vs tors. theta energy: -7.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -90.587149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.587149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.587149 (E_RNA) where: Base-Base interactions energy: -32.705 where: short stacking energy: -30.617 Base-Backbone interact. energy: -0.005 local terms energy: -57.877397 where: bonds (distance) C4'-P energy: -12.630 bonds (distance) P-C4' energy: -14.021 flat angles C4'-P-C4' energy: -13.472 flat angles P-C4'-P energy: -11.797 tors. eta vs tors. theta energy: -5.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -127.082475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.082475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.082475 (E_RNA) where: Base-Base interactions energy: -78.744 where: short stacking energy: -28.689 Base-Backbone interact. energy: -0.107 local terms energy: -48.231828 where: bonds (distance) C4'-P energy: -15.756 bonds (distance) P-C4' energy: -12.393 flat angles C4'-P-C4' energy: -9.012 flat angles P-C4'-P energy: -6.637 tors. eta vs tors. theta energy: -4.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -78.237768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.237768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.237768 (E_RNA) where: Base-Base interactions energy: -34.020 where: short stacking energy: -21.973 Base-Backbone interact. energy: 0.504 local terms energy: -44.721403 where: bonds (distance) C4'-P energy: -12.432 bonds (distance) P-C4' energy: -14.876 flat angles C4'-P-C4' energy: -7.400 flat angles P-C4'-P energy: -7.533 tors. eta vs tors. theta energy: -2.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -72.713969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.713969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.713969 (E_RNA) where: Base-Base interactions energy: -27.811 where: short stacking energy: -26.401 Base-Backbone interact. energy: -0.015 local terms energy: -44.888354 where: bonds (distance) C4'-P energy: -13.717 bonds (distance) P-C4' energy: -8.719 flat angles C4'-P-C4' energy: -13.169 flat angles P-C4'-P energy: -7.606 tors. eta vs tors. theta energy: -1.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -78.014351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.014351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.014351 (E_RNA) where: Base-Base interactions energy: -28.993 where: short stacking energy: -17.741 Base-Backbone interact. energy: -0.069 local terms energy: -48.952282 where: bonds (distance) C4'-P energy: -14.404 bonds (distance) P-C4' energy: -11.545 flat angles C4'-P-C4' energy: -12.622 flat angles P-C4'-P energy: -11.140 tors. eta vs tors. theta energy: 0.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -189.927917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.927917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.927917 (E_RNA) where: Base-Base interactions energy: -118.238 where: short stacking energy: -61.486 Base-Backbone interact. energy: -0.240 local terms energy: -71.449568 where: bonds (distance) C4'-P energy: -12.913 bonds (distance) P-C4' energy: -14.385 flat angles C4'-P-C4' energy: -14.142 flat angles P-C4'-P energy: -11.165 tors. eta vs tors. theta energy: -18.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -164.268085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.268085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.268085 (E_RNA) where: Base-Base interactions energy: -104.022 where: short stacking energy: -46.944 Base-Backbone interact. energy: -0.132 local terms energy: -60.113353 where: bonds (distance) C4'-P energy: -14.314 bonds (distance) P-C4' energy: -14.467 flat angles C4'-P-C4' energy: -13.285 flat angles P-C4'-P energy: -7.219 tors. eta vs tors. theta energy: -10.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -145.087834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.087834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.087834 (E_RNA) where: Base-Base interactions energy: -81.222 where: short stacking energy: -47.408 Base-Backbone interact. energy: -0.303 local terms energy: -63.562535 where: bonds (distance) C4'-P energy: -12.978 bonds (distance) P-C4' energy: -17.193 flat angles C4'-P-C4' energy: -14.606 flat angles P-C4'-P energy: -9.133 tors. eta vs tors. theta energy: -9.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -137.393518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.393518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.393518 (E_RNA) where: Base-Base interactions energy: -82.530 where: short stacking energy: -43.012 Base-Backbone interact. energy: -0.076 local terms energy: -54.788282 where: bonds (distance) C4'-P energy: -13.629 bonds (distance) P-C4' energy: -8.398 flat angles C4'-P-C4' energy: -12.159 flat angles P-C4'-P energy: -12.188 tors. eta vs tors. theta energy: -8.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -100.671975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.671975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.671975 (E_RNA) where: Base-Base interactions energy: -43.429 where: short stacking energy: -43.429 Base-Backbone interact. energy: -0.008 local terms energy: -57.234387 where: bonds (distance) C4'-P energy: -9.508 bonds (distance) P-C4' energy: -14.458 flat angles C4'-P-C4' energy: -12.986 flat angles P-C4'-P energy: -6.355 tors. eta vs tors. theta energy: -13.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -127.289931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.289931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.289931 (E_RNA) where: Base-Base interactions energy: -71.832 where: short stacking energy: -29.074 Base-Backbone interact. energy: 0.294 local terms energy: -55.751613 where: bonds (distance) C4'-P energy: -11.786 bonds (distance) P-C4' energy: -14.483 flat angles C4'-P-C4' energy: -13.145 flat angles P-C4'-P energy: -5.192 tors. eta vs tors. theta energy: -11.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -88.217999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.217999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.217999 (E_RNA) where: Base-Base interactions energy: -31.078 where: short stacking energy: -31.078 Base-Backbone interact. energy: -0.024 local terms energy: -57.115863 where: bonds (distance) C4'-P energy: -12.440 bonds (distance) P-C4' energy: -13.400 flat angles C4'-P-C4' energy: -15.286 flat angles P-C4'-P energy: -13.584 tors. eta vs tors. theta energy: -2.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -75.072254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.072254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.072254 (E_RNA) where: Base-Base interactions energy: -23.958 where: short stacking energy: -18.640 Base-Backbone interact. energy: -0.225 local terms energy: -50.888914 where: bonds (distance) C4'-P energy: -12.071 bonds (distance) P-C4' energy: -11.094 flat angles C4'-P-C4' energy: -16.823 flat angles P-C4'-P energy: -10.358 tors. eta vs tors. theta energy: -0.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -79.359310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.359310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.359310 (E_RNA) where: Base-Base interactions energy: -31.312 where: short stacking energy: -31.312 Base-Backbone interact. energy: -0.001 local terms energy: -48.045667 where: bonds (distance) C4'-P energy: -11.066 bonds (distance) P-C4' energy: -13.240 flat angles C4'-P-C4' energy: -10.765 flat angles P-C4'-P energy: -4.651 tors. eta vs tors. theta energy: -8.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -69.390275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.390275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.390275 (E_RNA) where: Base-Base interactions energy: -31.301 where: short stacking energy: -15.988 Base-Backbone interact. energy: -0.152 local terms energy: -37.937810 where: bonds (distance) C4'-P energy: -13.839 bonds (distance) P-C4' energy: -11.905 flat angles C4'-P-C4' energy: -8.534 flat angles P-C4'-P energy: -4.505 tors. eta vs tors. theta energy: 0.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -190.863798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.863798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.863798 (E_RNA) where: Base-Base interactions energy: -115.235 where: short stacking energy: -60.339 Base-Backbone interact. energy: -0.008 local terms energy: -75.621322 where: bonds (distance) C4'-P energy: -11.694 bonds (distance) P-C4' energy: -14.465 flat angles C4'-P-C4' energy: -18.030 flat angles P-C4'-P energy: -12.423 tors. eta vs tors. theta energy: -19.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -173.373055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.373055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.373055 (E_RNA) where: Base-Base interactions energy: -105.334 where: short stacking energy: -42.120 Base-Backbone interact. energy: -1.176 local terms energy: -66.863279 where: bonds (distance) C4'-P energy: -10.446 bonds (distance) P-C4' energy: -16.302 flat angles C4'-P-C4' energy: -14.155 flat angles P-C4'-P energy: -10.542 tors. eta vs tors. theta energy: -15.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -130.640406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.640406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.640406 (E_RNA) where: Base-Base interactions energy: -67.549 where: short stacking energy: -37.203 Base-Backbone interact. energy: -0.174 local terms energy: -62.917711 where: bonds (distance) C4'-P energy: -14.866 bonds (distance) P-C4' energy: -14.653 flat angles C4'-P-C4' energy: -13.871 flat angles P-C4'-P energy: -8.379 tors. eta vs tors. theta energy: -11.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -147.202873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.202873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.202873 (E_RNA) where: Base-Base interactions energy: -81.700 where: short stacking energy: -42.484 Base-Backbone interact. energy: -0.075 local terms energy: -65.427746 where: bonds (distance) C4'-P energy: -15.590 bonds (distance) P-C4' energy: -15.870 flat angles C4'-P-C4' energy: -16.023 flat angles P-C4'-P energy: -11.900 tors. eta vs tors. theta energy: -6.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -102.698555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.698555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.698555 (E_RNA) where: Base-Base interactions energy: -48.167 where: short stacking energy: -32.991 Base-Backbone interact. energy: -0.025 local terms energy: -54.506358 where: bonds (distance) C4'-P energy: -13.496 bonds (distance) P-C4' energy: -15.484 flat angles C4'-P-C4' energy: -9.591 flat angles P-C4'-P energy: -4.967 tors. eta vs tors. theta energy: -10.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -90.231235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.231235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.231235 (E_RNA) where: Base-Base interactions energy: -31.899 where: short stacking energy: -32.999 Base-Backbone interact. energy: -0.103 local terms energy: -58.229469 where: bonds (distance) C4'-P energy: -12.907 bonds (distance) P-C4' energy: -16.188 flat angles C4'-P-C4' energy: -10.308 flat angles P-C4'-P energy: -7.664 tors. eta vs tors. theta energy: -11.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -79.917219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.917219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.917219 (E_RNA) where: Base-Base interactions energy: -25.917 where: short stacking energy: -25.917 Base-Backbone interact. energy: 0.604 local terms energy: -54.604325 where: bonds (distance) C4'-P energy: -15.011 bonds (distance) P-C4' energy: -16.700 flat angles C4'-P-C4' energy: -14.717 flat angles P-C4'-P energy: -5.459 tors. eta vs tors. theta energy: -2.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -88.077761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.077761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.077761 (E_RNA) where: Base-Base interactions energy: -34.537 where: short stacking energy: -31.361 Base-Backbone interact. energy: 0.647 local terms energy: -54.188427 where: bonds (distance) C4'-P energy: -8.547 bonds (distance) P-C4' energy: -15.051 flat angles C4'-P-C4' energy: -10.443 flat angles P-C4'-P energy: -10.054 tors. eta vs tors. theta energy: -10.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -95.922783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.922783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.922783 (E_RNA) where: Base-Base interactions energy: -50.073 where: short stacking energy: -39.430 Base-Backbone interact. energy: -0.995 local terms energy: -44.854509 where: bonds (distance) C4'-P energy: -9.041 bonds (distance) P-C4' energy: -12.203 flat angles C4'-P-C4' energy: -12.536 flat angles P-C4'-P energy: -4.226 tors. eta vs tors. theta energy: -6.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -74.369115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.369115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.369115 (E_RNA) where: Base-Base interactions energy: -24.412 where: short stacking energy: -23.626 Base-Backbone interact. energy: 0.545 local terms energy: -50.502542 where: bonds (distance) C4'-P energy: -10.743 bonds (distance) P-C4' energy: -12.716 flat angles C4'-P-C4' energy: -11.103 flat angles P-C4'-P energy: -5.728 tors. eta vs tors. theta energy: -10.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -200.773640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -200.773640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -200.773640 (E_RNA) where: Base-Base interactions energy: -126.630 where: short stacking energy: -62.532 Base-Backbone interact. energy: -0.001 local terms energy: -74.142930 where: bonds (distance) C4'-P energy: -14.411 bonds (distance) P-C4' energy: -14.844 flat angles C4'-P-C4' energy: -16.910 flat angles P-C4'-P energy: -10.352 tors. eta vs tors. theta energy: -17.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -185.751407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.751407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.751407 (E_RNA) where: Base-Base interactions energy: -120.844 where: short stacking energy: -53.155 Base-Backbone interact. energy: 0.103 local terms energy: -65.010740 where: bonds (distance) C4'-P energy: -10.460 bonds (distance) P-C4' energy: -12.395 flat angles C4'-P-C4' energy: -15.141 flat angles P-C4'-P energy: -9.860 tors. eta vs tors. theta energy: -17.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -139.327033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.327033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.327033 (E_RNA) where: Base-Base interactions energy: -83.915 where: short stacking energy: -42.063 Base-Backbone interact. energy: -0.202 local terms energy: -55.209527 where: bonds (distance) C4'-P energy: -13.583 bonds (distance) P-C4' energy: -13.006 flat angles C4'-P-C4' energy: -11.079 flat angles P-C4'-P energy: -8.788 tors. eta vs tors. theta energy: -8.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -157.836399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.836399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.836399 (E_RNA) where: Base-Base interactions energy: -101.553 where: short stacking energy: -41.396 Base-Backbone interact. energy: -0.638 local terms energy: -55.644995 where: bonds (distance) C4'-P energy: -12.059 bonds (distance) P-C4' energy: -13.491 flat angles C4'-P-C4' energy: -13.501 flat angles P-C4'-P energy: -4.044 tors. eta vs tors. theta energy: -12.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -102.388340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.388340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.388340 (E_RNA) where: Base-Base interactions energy: -49.323 where: short stacking energy: -28.288 Base-Backbone interact. energy: 2.846 local terms energy: -55.912215 where: bonds (distance) C4'-P energy: -14.134 bonds (distance) P-C4' energy: -15.278 flat angles C4'-P-C4' energy: -9.161 flat angles P-C4'-P energy: -10.046 tors. eta vs tors. theta energy: -7.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -89.810011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.810011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.810011 (E_RNA) where: Base-Base interactions energy: -31.888 where: short stacking energy: -31.888 Base-Backbone interact. energy: -0.062 local terms energy: -57.859958 where: bonds (distance) C4'-P energy: -13.564 bonds (distance) P-C4' energy: -16.238 flat angles C4'-P-C4' energy: -11.293 flat angles P-C4'-P energy: -10.723 tors. eta vs tors. theta energy: -6.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -84.319988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.319988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.319988 (E_RNA) where: Base-Base interactions energy: -35.318 where: short stacking energy: -20.290 Base-Backbone interact. energy: -0.184 local terms energy: -48.817686 where: bonds (distance) C4'-P energy: -15.662 bonds (distance) P-C4' energy: -14.121 flat angles C4'-P-C4' energy: -9.929 flat angles P-C4'-P energy: -3.904 tors. eta vs tors. theta energy: -5.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -74.276448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.276448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.276448 (E_RNA) where: Base-Base interactions energy: -20.608 where: short stacking energy: -20.608 Base-Backbone interact. energy: -0.057 local terms energy: -53.611343 where: bonds (distance) C4'-P energy: -14.241 bonds (distance) P-C4' energy: -13.331 flat angles C4'-P-C4' energy: -16.698 flat angles P-C4'-P energy: -6.240 tors. eta vs tors. theta energy: -3.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -77.401452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.401452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.401452 (E_RNA) where: Base-Base interactions energy: -25.805 where: short stacking energy: -21.810 Base-Backbone interact. energy: -0.081 local terms energy: -51.515576 where: bonds (distance) C4'-P energy: -12.465 bonds (distance) P-C4' energy: -14.213 flat angles C4'-P-C4' energy: -12.838 flat angles P-C4'-P energy: -6.415 tors. eta vs tors. theta energy: -5.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -86.482743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.482743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.482743 (E_RNA) where: Base-Base interactions energy: -29.590 where: short stacking energy: -29.580 Base-Backbone interact. energy: -0.279 local terms energy: -56.613710 where: bonds (distance) C4'-P energy: -11.153 bonds (distance) P-C4' energy: -16.647 flat angles C4'-P-C4' energy: -13.833 flat angles P-C4'-P energy: -10.503 tors. eta vs tors. theta energy: -4.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -182.968675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.968675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.968675 (E_RNA) where: Base-Base interactions energy: -116.494 where: short stacking energy: -52.892 Base-Backbone interact. energy: 0.151 local terms energy: -66.625636 where: bonds (distance) C4'-P energy: -14.452 bonds (distance) P-C4' energy: -15.371 flat angles C4'-P-C4' energy: -15.749 flat angles P-C4'-P energy: -7.275 tors. eta vs tors. theta energy: -13.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -190.002769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.002769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.002769 (E_RNA) where: Base-Base interactions energy: -120.237 where: short stacking energy: -60.662 Base-Backbone interact. energy: -0.265 local terms energy: -69.500095 where: bonds (distance) C4'-P energy: -11.648 bonds (distance) P-C4' energy: -12.703 flat angles C4'-P-C4' energy: -14.159 flat angles P-C4'-P energy: -13.042 tors. eta vs tors. theta energy: -17.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -136.706275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.706275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.706275 (E_RNA) where: Base-Base interactions energy: -77.367 where: short stacking energy: -36.010 Base-Backbone interact. energy: -0.110 local terms energy: -59.229742 where: bonds (distance) C4'-P energy: -12.944 bonds (distance) P-C4' energy: -15.627 flat angles C4'-P-C4' energy: -12.125 flat angles P-C4'-P energy: -11.322 tors. eta vs tors. theta energy: -7.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -153.906188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.906188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.906188 (E_RNA) where: Base-Base interactions energy: -88.140 where: short stacking energy: -38.782 Base-Backbone interact. energy: -0.013 local terms energy: -65.752931 where: bonds (distance) C4'-P energy: -13.231 bonds (distance) P-C4' energy: -16.597 flat angles C4'-P-C4' energy: -13.194 flat angles P-C4'-P energy: -9.639 tors. eta vs tors. theta energy: -13.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -85.835839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.835839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.835839 (E_RNA) where: Base-Base interactions energy: -32.555 where: short stacking energy: -22.248 Base-Backbone interact. energy: 0.035 local terms energy: -53.315033 where: bonds (distance) C4'-P energy: -16.509 bonds (distance) P-C4' energy: -12.834 flat angles C4'-P-C4' energy: -8.482 flat angles P-C4'-P energy: -6.474 tors. eta vs tors. theta energy: -9.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -99.793022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -99.793022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -99.793022 (E_RNA) where: Base-Base interactions energy: -55.917 where: short stacking energy: -23.779 Base-Backbone interact. energy: -0.241 local terms energy: -43.635533 where: bonds (distance) C4'-P energy: -5.724 bonds (distance) P-C4' energy: -13.268 flat angles C4'-P-C4' energy: -12.279 flat angles P-C4'-P energy: -6.643 tors. eta vs tors. theta energy: -5.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -89.283059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.283059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.283059 (E_RNA) where: Base-Base interactions energy: -26.521 where: short stacking energy: -26.521 Base-Backbone interact. energy: -0.049 local terms energy: -62.713378 where: bonds (distance) C4'-P energy: -14.911 bonds (distance) P-C4' energy: -15.374 flat angles C4'-P-C4' energy: -17.276 flat angles P-C4'-P energy: -7.094 tors. eta vs tors. theta energy: -8.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -80.861789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.861789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.861789 (E_RNA) where: Base-Base interactions energy: -29.695 where: short stacking energy: -25.244 Base-Backbone interact. energy: -0.132 local terms energy: -51.035320 where: bonds (distance) C4'-P energy: -13.942 bonds (distance) P-C4' energy: -10.831 flat angles C4'-P-C4' energy: -14.142 flat angles P-C4'-P energy: -8.070 tors. eta vs tors. theta energy: -4.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -65.384097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.384097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.384097 (E_RNA) where: Base-Base interactions energy: -22.180 where: short stacking energy: -10.884 Base-Backbone interact. energy: 0.134 local terms energy: -43.338268 where: bonds (distance) C4'-P energy: -14.340 bonds (distance) P-C4' energy: -15.544 flat angles C4'-P-C4' energy: -5.425 flat angles P-C4'-P energy: -10.508 tors. eta vs tors. theta energy: 2.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -65.832432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.832432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.832432 (E_RNA) where: Base-Base interactions energy: -15.026 where: short stacking energy: -16.226 Base-Backbone interact. energy: -0.019 local terms energy: -50.787391 where: bonds (distance) C4'-P energy: -15.591 bonds (distance) P-C4' energy: -15.777 flat angles C4'-P-C4' energy: -11.745 flat angles P-C4'-P energy: -4.010 tors. eta vs tors. theta energy: -3.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -187.221369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.221369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.221369 (E_RNA) where: Base-Base interactions energy: -112.618 where: short stacking energy: -54.192 Base-Backbone interact. energy: -0.060 local terms energy: -74.544077 where: bonds (distance) C4'-P energy: -14.544 bonds (distance) P-C4' energy: -16.826 flat angles C4'-P-C4' energy: -14.145 flat angles P-C4'-P energy: -11.666 tors. eta vs tors. theta energy: -17.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -184.496179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.496179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.496179 (E_RNA) where: Base-Base interactions energy: -115.671 where: short stacking energy: -59.811 Base-Backbone interact. energy: 1.628 local terms energy: -70.452875 where: bonds (distance) C4'-P energy: -16.365 bonds (distance) P-C4' energy: -14.551 flat angles C4'-P-C4' energy: -13.158 flat angles P-C4'-P energy: -7.492 tors. eta vs tors. theta energy: -18.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -155.964881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.964881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.964881 (E_RNA) where: Base-Base interactions energy: -107.422 where: short stacking energy: -30.902 Base-Backbone interact. energy: 0.114 local terms energy: -48.656108 where: bonds (distance) C4'-P energy: -12.396 bonds (distance) P-C4' energy: -11.982 flat angles C4'-P-C4' energy: -13.528 flat angles P-C4'-P energy: -5.459 tors. eta vs tors. theta energy: -5.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -146.745297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.745297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.745297 (E_RNA) where: Base-Base interactions energy: -84.985 where: short stacking energy: -44.989 Base-Backbone interact. energy: -0.781 local terms energy: -60.979097 where: bonds (distance) C4'-P energy: -10.044 bonds (distance) P-C4' energy: -15.311 flat angles C4'-P-C4' energy: -15.798 flat angles P-C4'-P energy: -7.391 tors. eta vs tors. theta energy: -12.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -86.349143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.349143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.349143 (E_RNA) where: Base-Base interactions energy: -36.853 where: short stacking energy: -24.913 Base-Backbone interact. energy: -0.173 local terms energy: -49.322548 where: bonds (distance) C4'-P energy: -13.443 bonds (distance) P-C4' energy: -14.191 flat angles C4'-P-C4' energy: -13.133 flat angles P-C4'-P energy: -7.184 tors. eta vs tors. theta energy: -1.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -82.375032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.375032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.375032 (E_RNA) where: Base-Base interactions energy: -33.547 where: short stacking energy: -19.405 Base-Backbone interact. energy: -0.106 local terms energy: -48.722436 where: bonds (distance) C4'-P energy: -6.840 bonds (distance) P-C4' energy: -16.177 flat angles C4'-P-C4' energy: -15.440 flat angles P-C4'-P energy: -7.012 tors. eta vs tors. theta energy: -3.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -75.835416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.835416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.835416 (E_RNA) where: Base-Base interactions energy: -22.480 where: short stacking energy: -22.480 Base-Backbone interact. energy: 0.333 local terms energy: -53.687757 where: bonds (distance) C4'-P energy: -12.386 bonds (distance) P-C4' energy: -16.274 flat angles C4'-P-C4' energy: -16.147 flat angles P-C4'-P energy: -7.491 tors. eta vs tors. theta energy: -1.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -80.104431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.104431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.104431 (E_RNA) where: Base-Base interactions energy: -27.978 where: short stacking energy: -28.580 Base-Backbone interact. energy: -0.006 local terms energy: -52.120890 where: bonds (distance) C4'-P energy: -14.190 bonds (distance) P-C4' energy: -13.736 flat angles C4'-P-C4' energy: -13.692 flat angles P-C4'-P energy: -3.045 tors. eta vs tors. theta energy: -7.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -67.566698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.566698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.566698 (E_RNA) where: Base-Base interactions energy: -20.058 where: short stacking energy: -18.215 Base-Backbone interact. energy: -0.093 local terms energy: -47.415705 where: bonds (distance) C4'-P energy: -10.812 bonds (distance) P-C4' energy: -15.268 flat angles C4'-P-C4' energy: -10.734 flat angles P-C4'-P energy: -7.741 tors. eta vs tors. theta energy: -2.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -79.212774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.212774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.212774 (E_RNA) where: Base-Base interactions energy: -38.569 where: short stacking energy: -20.305 Base-Backbone interact. energy: 1.136 local terms energy: -41.779751 where: bonds (distance) C4'-P energy: -11.496 bonds (distance) P-C4' energy: -14.121 flat angles C4'-P-C4' energy: -10.693 flat angles P-C4'-P energy: -5.653 tors. eta vs tors. theta energy: 0.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -185.135113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.135113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.135113 (E_RNA) where: Base-Base interactions energy: -112.200 where: short stacking energy: -53.012 Base-Backbone interact. energy: -0.593 local terms energy: -72.341920 where: bonds (distance) C4'-P energy: -14.903 bonds (distance) P-C4' energy: -14.611 flat angles C4'-P-C4' energy: -16.336 flat angles P-C4'-P energy: -9.791 tors. eta vs tors. theta energy: -16.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -175.786557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.786557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.786557 (E_RNA) where: Base-Base interactions energy: -104.220 where: short stacking energy: -55.692 Base-Backbone interact. energy: -0.423 local terms energy: -71.144082 where: bonds (distance) C4'-P energy: -13.222 bonds (distance) P-C4' energy: -13.497 flat angles C4'-P-C4' energy: -15.132 flat angles P-C4'-P energy: -9.478 tors. eta vs tors. theta energy: -19.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -144.895056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.895056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.895056 (E_RNA) where: Base-Base interactions energy: -87.842 where: short stacking energy: -35.425 Base-Backbone interact. energy: -0.251 local terms energy: -56.801866 where: bonds (distance) C4'-P energy: -11.518 bonds (distance) P-C4' energy: -13.682 flat angles C4'-P-C4' energy: -9.599 flat angles P-C4'-P energy: -11.961 tors. eta vs tors. theta energy: -10.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -141.017090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.017090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.017090 (E_RNA) where: Base-Base interactions energy: -84.597 where: short stacking energy: -42.670 Base-Backbone interact. energy: -0.444 local terms energy: -55.975212 where: bonds (distance) C4'-P energy: -11.339 bonds (distance) P-C4' energy: -12.676 flat angles C4'-P-C4' energy: -12.137 flat angles P-C4'-P energy: -11.051 tors. eta vs tors. theta energy: -8.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -114.729602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.729602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.729602 (E_RNA) where: Base-Base interactions energy: -64.331 where: short stacking energy: -25.498 Base-Backbone interact. energy: -0.568 local terms energy: -49.830456 where: bonds (distance) C4'-P energy: -13.546 bonds (distance) P-C4' energy: -15.913 flat angles C4'-P-C4' energy: -9.103 flat angles P-C4'-P energy: -11.458 tors. eta vs tors. theta energy: 0.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -83.095805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.095805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.095805 (E_RNA) where: Base-Base interactions energy: -31.020 where: short stacking energy: -25.272 Base-Backbone interact. energy: -1.153 local terms energy: -50.922503 where: bonds (distance) C4'-P energy: -14.953 bonds (distance) P-C4' energy: -15.076 flat angles C4'-P-C4' energy: -14.189 flat angles P-C4'-P energy: -8.907 tors. eta vs tors. theta energy: 2.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -90.753845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.753845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.753845 (E_RNA) where: Base-Base interactions energy: -29.807 where: short stacking energy: -29.807 Base-Backbone interact. energy: -0.118 local terms energy: -60.828849 where: bonds (distance) C4'-P energy: -13.003 bonds (distance) P-C4' energy: -13.103 flat angles C4'-P-C4' energy: -15.566 flat angles P-C4'-P energy: -12.616 tors. eta vs tors. theta energy: -6.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -71.569183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.569183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.569183 (E_RNA) where: Base-Base interactions energy: -24.078 where: short stacking energy: -19.571 Base-Backbone interact. energy: -0.463 local terms energy: -47.028467 where: bonds (distance) C4'-P energy: -9.972 bonds (distance) P-C4' energy: -11.761 flat angles C4'-P-C4' energy: -12.276 flat angles P-C4'-P energy: -9.020 tors. eta vs tors. theta energy: -4.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -72.318290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.318290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.318290 (E_RNA) where: Base-Base interactions energy: -26.352 where: short stacking energy: -21.789 Base-Backbone interact. energy: -0.217 local terms energy: -45.749233 where: bonds (distance) C4'-P energy: -10.067 bonds (distance) P-C4' energy: -15.646 flat angles C4'-P-C4' energy: -10.511 flat angles P-C4'-P energy: -9.178 tors. eta vs tors. theta energy: -0.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -64.768450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.768450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.768450 (E_RNA) where: Base-Base interactions energy: -24.680 where: short stacking energy: -18.764 Base-Backbone interact. energy: -0.326 local terms energy: -39.762507 where: bonds (distance) C4'-P energy: -9.259 bonds (distance) P-C4' energy: -13.472 flat angles C4'-P-C4' energy: -11.133 flat angles P-C4'-P energy: -3.568 tors. eta vs tors. theta energy: -2.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -180.942617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.942617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.942617 (E_RNA) where: Base-Base interactions energy: -112.488 where: short stacking energy: -50.843 Base-Backbone interact. energy: -0.874 local terms energy: -67.580388 where: bonds (distance) C4'-P energy: -14.609 bonds (distance) P-C4' energy: -14.078 flat angles C4'-P-C4' energy: -12.418 flat angles P-C4'-P energy: -8.459 tors. eta vs tors. theta energy: -18.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -149.351037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.351037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.351037 (E_RNA) where: Base-Base interactions energy: -88.664 where: short stacking energy: -45.159 Base-Backbone interact. energy: -1.240 local terms energy: -59.446862 where: bonds (distance) C4'-P energy: -13.947 bonds (distance) P-C4' energy: -15.557 flat angles C4'-P-C4' energy: -15.379 flat angles P-C4'-P energy: -6.238 tors. eta vs tors. theta energy: -8.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -171.388257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.388257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.388257 (E_RNA) where: Base-Base interactions energy: -106.699 where: short stacking energy: -54.051 Base-Backbone interact. energy: -0.006 local terms energy: -64.683106 where: bonds (distance) C4'-P energy: -14.197 bonds (distance) P-C4' energy: -14.782 flat angles C4'-P-C4' energy: -15.133 flat angles P-C4'-P energy: -4.039 tors. eta vs tors. theta energy: -16.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -144.241276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.241276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.241276 (E_RNA) where: Base-Base interactions energy: -80.780 where: short stacking energy: -42.429 Base-Backbone interact. energy: -2.312 local terms energy: -61.149141 where: bonds (distance) C4'-P energy: -12.805 bonds (distance) P-C4' energy: -14.333 flat angles C4'-P-C4' energy: -15.550 flat angles P-C4'-P energy: -7.949 tors. eta vs tors. theta energy: -10.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -149.928873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.928873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.928873 (E_RNA) where: Base-Base interactions energy: -93.801 where: short stacking energy: -26.443 Base-Backbone interact. energy: -0.657 local terms energy: -55.470665 where: bonds (distance) C4'-P energy: -12.581 bonds (distance) P-C4' energy: -17.127 flat angles C4'-P-C4' energy: -17.752 flat angles P-C4'-P energy: -8.447 tors. eta vs tors. theta energy: 0.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -86.185785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.185785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.185785 (E_RNA) where: Base-Base interactions energy: -45.989 where: short stacking energy: -24.700 Base-Backbone interact. energy: -0.354 local terms energy: -39.842697 where: bonds (distance) C4'-P energy: -15.866 bonds (distance) P-C4' energy: -10.902 flat angles C4'-P-C4' energy: -9.327 flat angles P-C4'-P energy: -5.954 tors. eta vs tors. theta energy: 2.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -79.204553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.204553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.204553 (E_RNA) where: Base-Base interactions energy: -28.680 where: short stacking energy: -28.680 Base-Backbone interact. energy: -0.109 local terms energy: -50.415524 where: bonds (distance) C4'-P energy: -14.828 bonds (distance) P-C4' energy: -11.690 flat angles C4'-P-C4' energy: -11.988 flat angles P-C4'-P energy: -10.816 tors. eta vs tors. theta energy: -1.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -72.032961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.032961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.032961 (E_RNA) where: Base-Base interactions energy: -25.617 where: short stacking energy: -21.629 Base-Backbone interact. energy: -0.084 local terms energy: -46.331886 where: bonds (distance) C4'-P energy: -15.983 bonds (distance) P-C4' energy: -10.593 flat angles C4'-P-C4' energy: -12.230 flat angles P-C4'-P energy: -5.185 tors. eta vs tors. theta energy: -2.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -73.728945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.728945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.728945 (E_RNA) where: Base-Base interactions energy: -23.293 where: short stacking energy: -22.538 Base-Backbone interact. energy: -0.171 local terms energy: -50.265175 where: bonds (distance) C4'-P energy: -12.784 bonds (distance) P-C4' energy: -15.178 flat angles C4'-P-C4' energy: -14.238 flat angles P-C4'-P energy: -3.972 tors. eta vs tors. theta energy: -4.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -68.847298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.847298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.847298 (E_RNA) where: Base-Base interactions energy: -23.284 where: short stacking energy: -23.284 Base-Backbone interact. energy: -0.367 local terms energy: -45.195819 where: bonds (distance) C4'-P energy: -11.057 bonds (distance) P-C4' energy: -12.307 flat angles C4'-P-C4' energy: -14.213 flat angles P-C4'-P energy: -4.711 tors. eta vs tors. theta energy: -2.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -190.148867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.148867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.148867 (E_RNA) where: Base-Base interactions energy: -117.605 where: short stacking energy: -59.602 Base-Backbone interact. energy: -0.002 local terms energy: -72.541887 where: bonds (distance) C4'-P energy: -12.759 bonds (distance) P-C4' energy: -12.914 flat angles C4'-P-C4' energy: -15.622 flat angles P-C4'-P energy: -11.024 tors. eta vs tors. theta energy: -20.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -142.884682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.884682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.884682 (E_RNA) where: Base-Base interactions energy: -81.924 where: short stacking energy: -41.679 Base-Backbone interact. energy: -0.014 local terms energy: -60.946794 where: bonds (distance) C4'-P energy: -14.592 bonds (distance) P-C4' energy: -13.141 flat angles C4'-P-C4' energy: -15.028 flat angles P-C4'-P energy: -8.732 tors. eta vs tors. theta energy: -9.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -168.215401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.215401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.215401 (E_RNA) where: Base-Base interactions energy: -100.193 where: short stacking energy: -44.592 Base-Backbone interact. energy: -0.099 local terms energy: -67.923086 where: bonds (distance) C4'-P energy: -14.174 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -13.596 flat angles P-C4'-P energy: -6.535 tors. eta vs tors. theta energy: -17.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -146.089252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.089252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.089252 (E_RNA) where: Base-Base interactions energy: -83.657 where: short stacking energy: -41.236 Base-Backbone interact. energy: -0.152 local terms energy: -62.280013 where: bonds (distance) C4'-P energy: -14.621 bonds (distance) P-C4' energy: -16.538 flat angles C4'-P-C4' energy: -12.558 flat angles P-C4'-P energy: -9.815 tors. eta vs tors. theta energy: -8.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -154.560291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.560291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.560291 (E_RNA) where: Base-Base interactions energy: -96.335 where: short stacking energy: -34.615 Base-Backbone interact. energy: -0.548 local terms energy: -57.677228 where: bonds (distance) C4'-P energy: -15.644 bonds (distance) P-C4' energy: -17.034 flat angles C4'-P-C4' energy: -7.966 flat angles P-C4'-P energy: -8.805 tors. eta vs tors. theta energy: -8.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -102.275598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.275598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.275598 (E_RNA) where: Base-Base interactions energy: -55.423 where: short stacking energy: -37.388 Base-Backbone interact. energy: 1.248 local terms energy: -48.100200 where: bonds (distance) C4'-P energy: -8.631 bonds (distance) P-C4' energy: -16.843 flat angles C4'-P-C4' energy: -12.682 flat angles P-C4'-P energy: -7.585 tors. eta vs tors. theta energy: -2.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -86.412675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.412675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.412675 (E_RNA) where: Base-Base interactions energy: -33.867 where: short stacking energy: -31.218 Base-Backbone interact. energy: -0.029 local terms energy: -52.516224 where: bonds (distance) C4'-P energy: -13.261 bonds (distance) P-C4' energy: -13.679 flat angles C4'-P-C4' energy: -10.206 flat angles P-C4'-P energy: -9.290 tors. eta vs tors. theta energy: -6.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -71.405795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.405795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.405795 (E_RNA) where: Base-Base interactions energy: -22.997 where: short stacking energy: -21.141 Base-Backbone interact. energy: 2.789 local terms energy: -51.198691 where: bonds (distance) C4'-P energy: -11.699 bonds (distance) P-C4' energy: -16.883 flat angles C4'-P-C4' energy: -12.706 flat angles P-C4'-P energy: -7.512 tors. eta vs tors. theta energy: -2.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -80.800779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.800779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.800779 (E_RNA) where: Base-Base interactions energy: -30.427 where: short stacking energy: -28.644 Base-Backbone interact. energy: -0.458 local terms energy: -49.916248 where: bonds (distance) C4'-P energy: -14.999 bonds (distance) P-C4' energy: -11.778 flat angles C4'-P-C4' energy: -9.986 flat angles P-C4'-P energy: -9.123 tors. eta vs tors. theta energy: -4.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -78.398472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.398472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.398472 (E_RNA) where: Base-Base interactions energy: -28.111 where: short stacking energy: -28.111 Base-Backbone interact. energy: -0.079 local terms energy: -50.208059 where: bonds (distance) C4'-P energy: -11.553 bonds (distance) P-C4' energy: -15.303 flat angles C4'-P-C4' energy: -12.614 flat angles P-C4'-P energy: -7.360 tors. eta vs tors. theta energy: -3.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -183.219777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.219777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.219777 (E_RNA) where: Base-Base interactions energy: -108.137 where: short stacking energy: -50.925 Base-Backbone interact. energy: -0.000 local terms energy: -75.082649 where: bonds (distance) C4'-P energy: -15.363 bonds (distance) P-C4' energy: -14.612 flat angles C4'-P-C4' energy: -16.875 flat angles P-C4'-P energy: -9.387 tors. eta vs tors. theta energy: -18.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -180.248287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.248287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.248287 (E_RNA) where: Base-Base interactions energy: -113.458 where: short stacking energy: -59.787 Base-Backbone interact. energy: 0.683 local terms energy: -67.472637 where: bonds (distance) C4'-P energy: -13.131 bonds (distance) P-C4' energy: -12.750 flat angles C4'-P-C4' energy: -16.435 flat angles P-C4'-P energy: -7.186 tors. eta vs tors. theta energy: -17.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -151.026550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.026550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.026550 (E_RNA) where: Base-Base interactions energy: -87.987 where: short stacking energy: -47.645 Base-Backbone interact. energy: -0.018 local terms energy: -63.020993 where: bonds (distance) C4'-P energy: -13.363 bonds (distance) P-C4' energy: -15.459 flat angles C4'-P-C4' energy: -13.991 flat angles P-C4'-P energy: -9.895 tors. eta vs tors. theta energy: -10.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -137.644205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.644205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.644205 (E_RNA) where: Base-Base interactions energy: -85.015 where: short stacking energy: -32.310 Base-Backbone interact. energy: -0.797 local terms energy: -51.832514 where: bonds (distance) C4'-P energy: -11.488 bonds (distance) P-C4' energy: -16.633 flat angles C4'-P-C4' energy: -14.504 flat angles P-C4'-P energy: -9.135 tors. eta vs tors. theta energy: -0.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -129.271182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.271182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.271182 (E_RNA) where: Base-Base interactions energy: -70.912 where: short stacking energy: -33.051 Base-Backbone interact. energy: -0.058 local terms energy: -58.300748 where: bonds (distance) C4'-P energy: -13.586 bonds (distance) P-C4' energy: -14.130 flat angles C4'-P-C4' energy: -14.250 flat angles P-C4'-P energy: -7.547 tors. eta vs tors. theta energy: -8.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -84.447288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.447288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.447288 (E_RNA) where: Base-Base interactions energy: -28.574 where: short stacking energy: -25.567 Base-Backbone interact. energy: -0.218 local terms energy: -55.654901 where: bonds (distance) C4'-P energy: -16.303 bonds (distance) P-C4' energy: -13.262 flat angles C4'-P-C4' energy: -16.300 flat angles P-C4'-P energy: -3.160 tors. eta vs tors. theta energy: -6.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -90.406230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.406230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.406230 (E_RNA) where: Base-Base interactions energy: -42.671 where: short stacking energy: -38.061 Base-Backbone interact. energy: -0.414 local terms energy: -47.320494 where: bonds (distance) C4'-P energy: -12.915 bonds (distance) P-C4' energy: -14.716 flat angles C4'-P-C4' energy: -9.272 flat angles P-C4'-P energy: -2.287 tors. eta vs tors. theta energy: -8.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -84.785081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.785081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.785081 (E_RNA) where: Base-Base interactions energy: -31.284 where: short stacking energy: -31.284 Base-Backbone interact. energy: -0.139 local terms energy: -53.362578 where: bonds (distance) C4'-P energy: -9.207 bonds (distance) P-C4' energy: -16.199 flat angles C4'-P-C4' energy: -10.960 flat angles P-C4'-P energy: -9.981 tors. eta vs tors. theta energy: -7.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -71.154038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.154038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.154038 (E_RNA) where: Base-Base interactions energy: -28.963 where: short stacking energy: -23.969 Base-Backbone interact. energy: -0.160 local terms energy: -42.031607 where: bonds (distance) C4'-P energy: -13.258 bonds (distance) P-C4' energy: -13.541 flat angles C4'-P-C4' energy: -9.633 flat angles P-C4'-P energy: -4.477 tors. eta vs tors. theta energy: -1.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -64.672452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.672452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.672452 (E_RNA) where: Base-Base interactions energy: -13.490 where: short stacking energy: -8.640 Base-Backbone interact. energy: -0.496 local terms energy: -50.686239 where: bonds (distance) C4'-P energy: -13.197 bonds (distance) P-C4' energy: -15.823 flat angles C4'-P-C4' energy: -11.836 flat angles P-C4'-P energy: -11.938 tors. eta vs tors. theta energy: 2.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -190.592545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.592545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.592545 (E_RNA) where: Base-Base interactions energy: -122.579 where: short stacking energy: -60.773 Base-Backbone interact. energy: -0.013 local terms energy: -68.000846 where: bonds (distance) C4'-P energy: -14.602 bonds (distance) P-C4' energy: -12.313 flat angles C4'-P-C4' energy: -14.501 flat angles P-C4'-P energy: -8.850 tors. eta vs tors. theta energy: -17.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -176.407161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -176.407161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -176.407161 (E_RNA) where: Base-Base interactions energy: -103.815 where: short stacking energy: -44.074 Base-Backbone interact. energy: -0.553 local terms energy: -72.038952 where: bonds (distance) C4'-P energy: -15.383 bonds (distance) P-C4' energy: -14.011 flat angles C4'-P-C4' energy: -13.677 flat angles P-C4'-P energy: -11.441 tors. eta vs tors. theta energy: -17.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -155.118217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.118217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.118217 (E_RNA) where: Base-Base interactions energy: -91.277 where: short stacking energy: -47.159 Base-Backbone interact. energy: -0.003 local terms energy: -63.837773 where: bonds (distance) C4'-P energy: -13.437 bonds (distance) P-C4' energy: -15.261 flat angles C4'-P-C4' energy: -14.008 flat angles P-C4'-P energy: -11.026 tors. eta vs tors. theta energy: -10.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -149.924780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.924780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.924780 (E_RNA) where: Base-Base interactions energy: -96.801 where: short stacking energy: -37.079 Base-Backbone interact. energy: -1.059 local terms energy: -52.065046 where: bonds (distance) C4'-P energy: -13.148 bonds (distance) P-C4' energy: -12.842 flat angles C4'-P-C4' energy: -11.333 flat angles P-C4'-P energy: -8.811 tors. eta vs tors. theta energy: -5.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -117.474272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.474272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.474272 (E_RNA) where: Base-Base interactions energy: -69.660 where: short stacking energy: -35.186 Base-Backbone interact. energy: -0.101 local terms energy: -47.713025 where: bonds (distance) C4'-P energy: -15.343 bonds (distance) P-C4' energy: -10.491 flat angles C4'-P-C4' energy: -10.725 flat angles P-C4'-P energy: -3.221 tors. eta vs tors. theta energy: -7.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -87.843367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.843367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.843367 (E_RNA) where: Base-Base interactions energy: -41.647 where: short stacking energy: -25.227 Base-Backbone interact. energy: -1.020 local terms energy: -45.176629 where: bonds (distance) C4'-P energy: -7.083 bonds (distance) P-C4' energy: -14.001 flat angles C4'-P-C4' energy: -16.176 flat angles P-C4'-P energy: -2.571 tors. eta vs tors. theta energy: -5.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -79.459686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.459686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.459686 (E_RNA) where: Base-Base interactions energy: -30.554 where: short stacking energy: -28.222 Base-Backbone interact. energy: -0.013 local terms energy: -48.892497 where: bonds (distance) C4'-P energy: -15.487 bonds (distance) P-C4' energy: -13.419 flat angles C4'-P-C4' energy: -5.864 flat angles P-C4'-P energy: -10.619 tors. eta vs tors. theta energy: -3.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -73.649570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.649570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.649570 (E_RNA) where: Base-Base interactions energy: -26.481 where: short stacking energy: -17.274 Base-Backbone interact. energy: -0.231 local terms energy: -46.938156 where: bonds (distance) C4'-P energy: -12.300 bonds (distance) P-C4' energy: -10.122 flat angles C4'-P-C4' energy: -12.481 flat angles P-C4'-P energy: -8.233 tors. eta vs tors. theta energy: -3.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -72.856150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.856150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.856150 (E_RNA) where: Base-Base interactions energy: -21.317 where: short stacking energy: -22.347 Base-Backbone interact. energy: -0.277 local terms energy: -51.262293 where: bonds (distance) C4'-P energy: -14.415 bonds (distance) P-C4' energy: -13.232 flat angles C4'-P-C4' energy: -11.884 flat angles P-C4'-P energy: -8.373 tors. eta vs tors. theta energy: -3.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -70.059557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.059557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.059557 (E_RNA) where: Base-Base interactions energy: -23.629 where: short stacking energy: -18.388 Base-Backbone interact. energy: -0.110 local terms energy: -46.320467 where: bonds (distance) C4'-P energy: -12.379 bonds (distance) P-C4' energy: -16.060 flat angles C4'-P-C4' energy: -9.408 flat angles P-C4'-P energy: -7.878 tors. eta vs tors. theta energy: -0.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -193.341290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.341290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.341290 (E_RNA) where: Base-Base interactions energy: -121.219 where: short stacking energy: -61.482 Base-Backbone interact. energy: -0.659 local terms energy: -71.463664 where: bonds (distance) C4'-P energy: -14.358 bonds (distance) P-C4' energy: -16.217 flat angles C4'-P-C4' energy: -15.648 flat angles P-C4'-P energy: -7.612 tors. eta vs tors. theta energy: -17.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -142.830484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.830484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.830484 (E_RNA) where: Base-Base interactions energy: -84.242 where: short stacking energy: -32.492 Base-Backbone interact. energy: -0.602 local terms energy: -57.985560 where: bonds (distance) C4'-P energy: -13.765 bonds (distance) P-C4' energy: -14.152 flat angles C4'-P-C4' energy: -16.164 flat angles P-C4'-P energy: -9.293 tors. eta vs tors. theta energy: -4.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -166.857697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.857697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.857697 (E_RNA) where: Base-Base interactions energy: -99.853 where: short stacking energy: -53.744 Base-Backbone interact. energy: -0.023 local terms energy: -66.982219 where: bonds (distance) C4'-P energy: -14.407 bonds (distance) P-C4' energy: -13.951 flat angles C4'-P-C4' energy: -14.583 flat angles P-C4'-P energy: -12.806 tors. eta vs tors. theta energy: -11.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -145.065088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.065088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.065088 (E_RNA) where: Base-Base interactions energy: -95.646 where: short stacking energy: -33.355 Base-Backbone interact. energy: -0.886 local terms energy: -48.533479 where: bonds (distance) C4'-P energy: -10.917 bonds (distance) P-C4' energy: -14.498 flat angles C4'-P-C4' energy: -11.191 flat angles P-C4'-P energy: -5.497 tors. eta vs tors. theta energy: -6.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -95.433491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.433491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.433491 (E_RNA) where: Base-Base interactions energy: -38.345 where: short stacking energy: -30.559 Base-Backbone interact. energy: -0.268 local terms energy: -56.820365 where: bonds (distance) C4'-P energy: -14.394 bonds (distance) P-C4' energy: -14.980 flat angles C4'-P-C4' energy: -13.449 flat angles P-C4'-P energy: -6.880 tors. eta vs tors. theta energy: -7.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -90.902821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.902821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.902821 (E_RNA) where: Base-Base interactions energy: -35.416 where: short stacking energy: -35.211 Base-Backbone interact. energy: -0.068 local terms energy: -55.418026 where: bonds (distance) C4'-P energy: -14.812 bonds (distance) P-C4' energy: -7.801 flat angles C4'-P-C4' energy: -16.117 flat angles P-C4'-P energy: -11.166 tors. eta vs tors. theta energy: -5.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -79.461955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.461955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.461955 (E_RNA) where: Base-Base interactions energy: -36.075 where: short stacking energy: -18.775 Base-Backbone interact. energy: 0.252 local terms energy: -43.639364 where: bonds (distance) C4'-P energy: -5.099 bonds (distance) P-C4' energy: -12.403 flat angles C4'-P-C4' energy: -15.666 flat angles P-C4'-P energy: -9.643 tors. eta vs tors. theta energy: -0.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -87.051453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.051453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.051453 (E_RNA) where: Base-Base interactions energy: -41.047 where: short stacking energy: -26.291 Base-Backbone interact. energy: -0.150 local terms energy: -45.853630 where: bonds (distance) C4'-P energy: -14.283 bonds (distance) P-C4' energy: -12.730 flat angles C4'-P-C4' energy: -11.309 flat angles P-C4'-P energy: -8.799 tors. eta vs tors. theta energy: 1.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -74.392463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.392463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.392463 (E_RNA) where: Base-Base interactions energy: -19.520 where: short stacking energy: -16.350 Base-Backbone interact. energy: -0.913 local terms energy: -53.959656 where: bonds (distance) C4'-P energy: -14.865 bonds (distance) P-C4' energy: -14.253 flat angles C4'-P-C4' energy: -13.817 flat angles P-C4'-P energy: -8.922 tors. eta vs tors. theta energy: -2.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -68.051053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.051053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.051053 (E_RNA) where: Base-Base interactions energy: -18.416 where: short stacking energy: -18.416 Base-Backbone interact. energy: -0.144 local terms energy: -49.490785 where: bonds (distance) C4'-P energy: -5.707 bonds (distance) P-C4' energy: -12.043 flat angles C4'-P-C4' energy: -13.885 flat angles P-C4'-P energy: -8.106 tors. eta vs tors. theta energy: -9.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -195.486472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.486472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.486472 (E_RNA) where: Base-Base interactions energy: -119.724 where: short stacking energy: -57.955 Base-Backbone interact. energy: -0.033 local terms energy: -75.729446 where: bonds (distance) C4'-P energy: -15.185 bonds (distance) P-C4' energy: -14.892 flat angles C4'-P-C4' energy: -18.110 flat angles P-C4'-P energy: -10.060 tors. eta vs tors. theta energy: -17.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -146.023822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.023822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.023822 (E_RNA) where: Base-Base interactions energy: -89.741 where: short stacking energy: -41.405 Base-Backbone interact. energy: -1.128 local terms energy: -55.154700 where: bonds (distance) C4'-P energy: -14.455 bonds (distance) P-C4' energy: -16.081 flat angles C4'-P-C4' energy: -15.878 flat angles P-C4'-P energy: -4.564 tors. eta vs tors. theta energy: -4.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -156.793637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.793637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.793637 (E_RNA) where: Base-Base interactions energy: -89.484 where: short stacking energy: -52.378 Base-Backbone interact. energy: -0.073 local terms energy: -67.236613 where: bonds (distance) C4'-P energy: -11.641 bonds (distance) P-C4' energy: -13.519 flat angles C4'-P-C4' energy: -16.892 flat angles P-C4'-P energy: -10.493 tors. eta vs tors. theta energy: -14.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -146.624335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.624335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.624335 (E_RNA) where: Base-Base interactions energy: -87.621 where: short stacking energy: -40.734 Base-Backbone interact. energy: 1.321 local terms energy: -60.324277 where: bonds (distance) C4'-P energy: -14.286 bonds (distance) P-C4' energy: -14.603 flat angles C4'-P-C4' energy: -10.439 flat angles P-C4'-P energy: -12.753 tors. eta vs tors. theta energy: -8.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -88.810700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.810700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.810700 (E_RNA) where: Base-Base interactions energy: -36.542 where: short stacking energy: -24.417 Base-Backbone interact. energy: -0.084 local terms energy: -52.184093 where: bonds (distance) C4'-P energy: -14.982 bonds (distance) P-C4' energy: -11.325 flat angles C4'-P-C4' energy: -10.783 flat angles P-C4'-P energy: -11.232 tors. eta vs tors. theta energy: -3.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -83.542830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.542830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.542830 (E_RNA) where: Base-Base interactions energy: -33.148 where: short stacking energy: -34.048 Base-Backbone interact. energy: -0.119 local terms energy: -50.275971 where: bonds (distance) C4'-P energy: -13.737 bonds (distance) P-C4' energy: -13.511 flat angles C4'-P-C4' energy: -11.029 flat angles P-C4'-P energy: -5.183 tors. eta vs tors. theta energy: -6.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -82.545363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.545363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.545363 (E_RNA) where: Base-Base interactions energy: -34.204 where: short stacking energy: -19.245 Base-Backbone interact. energy: -0.331 local terms energy: -48.010141 where: bonds (distance) C4'-P energy: -12.017 bonds (distance) P-C4' energy: -14.860 flat angles C4'-P-C4' energy: -9.956 flat angles P-C4'-P energy: -11.162 tors. eta vs tors. theta energy: -0.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -75.618792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.618792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.618792 (E_RNA) where: Base-Base interactions energy: -30.403 where: short stacking energy: -23.264 Base-Backbone interact. energy: -0.009 local terms energy: -45.206929 where: bonds (distance) C4'-P energy: -8.458 bonds (distance) P-C4' energy: -12.221 flat angles C4'-P-C4' energy: -10.027 flat angles P-C4'-P energy: -8.669 tors. eta vs tors. theta energy: -5.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -80.323252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.323252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.323252 (E_RNA) where: Base-Base interactions energy: -36.841 where: short stacking energy: -15.567 Base-Backbone interact. energy: 0.968 local terms energy: -44.449727 where: bonds (distance) C4'-P energy: -14.465 bonds (distance) P-C4' energy: -10.218 flat angles C4'-P-C4' energy: -13.454 flat angles P-C4'-P energy: -10.067 tors. eta vs tors. theta energy: 3.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -64.306022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.306022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.306022 (E_RNA) where: Base-Base interactions energy: -26.198 where: short stacking energy: -21.791 Base-Backbone interact. energy: -0.177 local terms energy: -37.931102 where: bonds (distance) C4'-P energy: -13.346 bonds (distance) P-C4' energy: -13.699 flat angles C4'-P-C4' energy: -12.345 flat angles P-C4'-P energy: -2.534 tors. eta vs tors. theta energy: 3.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -174.106102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.106102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.106102 (E_RNA) where: Base-Base interactions energy: -100.071 where: short stacking energy: -47.916 Base-Backbone interact. energy: -1.000 local terms energy: -73.035055 where: bonds (distance) C4'-P energy: -17.486 bonds (distance) P-C4' energy: -15.271 flat angles C4'-P-C4' energy: -13.505 flat angles P-C4'-P energy: -11.612 tors. eta vs tors. theta energy: -15.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -158.751391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.751391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.751391 (E_RNA) where: Base-Base interactions energy: -93.098 where: short stacking energy: -52.320 Base-Backbone interact. energy: -0.002 local terms energy: -65.651281 where: bonds (distance) C4'-P energy: -11.165 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -13.173 flat angles P-C4'-P energy: -9.451 tors. eta vs tors. theta energy: -15.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -168.283206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.283206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.283206 (E_RNA) where: Base-Base interactions energy: -102.735 where: short stacking energy: -47.797 Base-Backbone interact. energy: -0.885 local terms energy: -64.663788 where: bonds (distance) C4'-P energy: -14.056 bonds (distance) P-C4' energy: -15.294 flat angles C4'-P-C4' energy: -16.623 flat angles P-C4'-P energy: -6.772 tors. eta vs tors. theta energy: -11.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -148.414957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.414957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.414957 (E_RNA) where: Base-Base interactions energy: -88.145 where: short stacking energy: -50.566 Base-Backbone interact. energy: -0.143 local terms energy: -60.127299 where: bonds (distance) C4'-P energy: -12.754 bonds (distance) P-C4' energy: -15.695 flat angles C4'-P-C4' energy: -13.739 flat angles P-C4'-P energy: -7.162 tors. eta vs tors. theta energy: -10.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -86.739513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.739513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.739513 (E_RNA) where: Base-Base interactions energy: -34.563 where: short stacking energy: -34.482 Base-Backbone interact. energy: -0.264 local terms energy: -51.912496 where: bonds (distance) C4'-P energy: -7.473 bonds (distance) P-C4' energy: -14.713 flat angles C4'-P-C4' energy: -15.426 flat angles P-C4'-P energy: -8.874 tors. eta vs tors. theta energy: -5.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -79.358066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.358066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.358066 (E_RNA) where: Base-Base interactions energy: -33.842 where: short stacking energy: -29.305 Base-Backbone interact. energy: 0.387 local terms energy: -45.903594 where: bonds (distance) C4'-P energy: -11.656 bonds (distance) P-C4' energy: -16.425 flat angles C4'-P-C4' energy: -9.732 flat angles P-C4'-P energy: -3.870 tors. eta vs tors. theta energy: -4.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -79.125445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.125445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.125445 (E_RNA) where: Base-Base interactions energy: -26.861 where: short stacking energy: -26.338 Base-Backbone interact. energy: 0.780 local terms energy: -53.044392 where: bonds (distance) C4'-P energy: -11.471 bonds (distance) P-C4' energy: -13.321 flat angles C4'-P-C4' energy: -12.549 flat angles P-C4'-P energy: -9.517 tors. eta vs tors. theta energy: -6.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -80.655889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.655889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.655889 (E_RNA) where: Base-Base interactions energy: -37.601 where: short stacking energy: -20.969 Base-Backbone interact. energy: -0.045 local terms energy: -43.009560 where: bonds (distance) C4'-P energy: -14.070 bonds (distance) P-C4' energy: -11.652 flat angles C4'-P-C4' energy: -12.077 flat angles P-C4'-P energy: -6.676 tors. eta vs tors. theta energy: 1.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -72.948309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.948309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.948309 (E_RNA) where: Base-Base interactions energy: -19.567 where: short stacking energy: -19.567 Base-Backbone interact. energy: -0.257 local terms energy: -53.124466 where: bonds (distance) C4'-P energy: -14.745 bonds (distance) P-C4' energy: -16.045 flat angles C4'-P-C4' energy: -11.617 flat angles P-C4'-P energy: -8.070 tors. eta vs tors. theta energy: -2.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -93.115780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.115780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.115780 (E_RNA) where: Base-Base interactions energy: -50.310 where: short stacking energy: -23.762 Base-Backbone interact. energy: -0.092 local terms energy: -42.712987 where: bonds (distance) C4'-P energy: -12.878 bonds (distance) P-C4' energy: -10.801 flat angles C4'-P-C4' energy: -11.520 flat angles P-C4'-P energy: -8.033 tors. eta vs tors. theta energy: 0.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -192.962761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.962761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.962761 (E_RNA) where: Base-Base interactions energy: -119.623 where: short stacking energy: -53.014 Base-Backbone interact. energy: -0.001 local terms energy: -73.338153 where: bonds (distance) C4'-P energy: -14.315 bonds (distance) P-C4' energy: -16.315 flat angles C4'-P-C4' energy: -14.417 flat angles P-C4'-P energy: -12.985 tors. eta vs tors. theta energy: -15.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -155.856362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.856362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.856362 (E_RNA) where: Base-Base interactions energy: -88.126 where: short stacking energy: -51.813 Base-Backbone interact. energy: -0.002 local terms energy: -67.729228 where: bonds (distance) C4'-P energy: -14.323 bonds (distance) P-C4' energy: -17.553 flat angles C4'-P-C4' energy: -13.760 flat angles P-C4'-P energy: -9.837 tors. eta vs tors. theta energy: -12.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -158.986413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.986413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.986413 (E_RNA) where: Base-Base interactions energy: -91.703 where: short stacking energy: -49.407 Base-Backbone interact. energy: -0.039 local terms energy: -67.244058 where: bonds (distance) C4'-P energy: -6.876 bonds (distance) P-C4' energy: -16.442 flat angles C4'-P-C4' energy: -15.768 flat angles P-C4'-P energy: -12.216 tors. eta vs tors. theta energy: -15.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -144.687965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.687965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.687965 (E_RNA) where: Base-Base interactions energy: -88.939 where: short stacking energy: -40.091 Base-Backbone interact. energy: -0.073 local terms energy: -55.675074 where: bonds (distance) C4'-P energy: -14.766 bonds (distance) P-C4' energy: -15.156 flat angles C4'-P-C4' energy: -9.275 flat angles P-C4'-P energy: -7.265 tors. eta vs tors. theta energy: -9.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -93.361759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.361759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.361759 (E_RNA) where: Base-Base interactions energy: -37.461 where: short stacking energy: -27.102 Base-Backbone interact. energy: -0.161 local terms energy: -55.739307 where: bonds (distance) C4'-P energy: -13.376 bonds (distance) P-C4' energy: -14.930 flat angles C4'-P-C4' energy: -12.549 flat angles P-C4'-P energy: -12.750 tors. eta vs tors. theta energy: -2.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -94.544844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.544844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.544844 (E_RNA) where: Base-Base interactions energy: -43.162 where: short stacking energy: -25.926 Base-Backbone interact. energy: 0.349 local terms energy: -51.731986 where: bonds (distance) C4'-P energy: -12.908 bonds (distance) P-C4' energy: -16.389 flat angles C4'-P-C4' energy: -16.260 flat angles P-C4'-P energy: -6.267 tors. eta vs tors. theta energy: 0.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -79.744364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.744364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.744364 (E_RNA) where: Base-Base interactions energy: -30.289 where: short stacking energy: -29.361 Base-Backbone interact. energy: -0.152 local terms energy: -49.302824 where: bonds (distance) C4'-P energy: -13.963 bonds (distance) P-C4' energy: -11.968 flat angles C4'-P-C4' energy: -13.618 flat angles P-C4'-P energy: -9.758 tors. eta vs tors. theta energy: 0.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -79.787708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.787708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.787708 (E_RNA) where: Base-Base interactions energy: -26.573 where: short stacking energy: -18.117 Base-Backbone interact. energy: -0.556 local terms energy: -52.658979 where: bonds (distance) C4'-P energy: -10.186 bonds (distance) P-C4' energy: -16.943 flat angles C4'-P-C4' energy: -14.171 flat angles P-C4'-P energy: -8.971 tors. eta vs tors. theta energy: -2.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -75.983891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.983891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.983891 (E_RNA) where: Base-Base interactions energy: -20.519 where: short stacking energy: -21.519 Base-Backbone interact. energy: -0.134 local terms energy: -55.331107 where: bonds (distance) C4'-P energy: -13.479 bonds (distance) P-C4' energy: -14.867 flat angles C4'-P-C4' energy: -15.415 flat angles P-C4'-P energy: -8.622 tors. eta vs tors. theta energy: -2.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -67.627579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.627579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.627579 (E_RNA) where: Base-Base interactions energy: -21.773 where: short stacking energy: -21.084 Base-Backbone interact. energy: -0.227 local terms energy: -45.628039 where: bonds (distance) C4'-P energy: -12.663 bonds (distance) P-C4' energy: -14.478 flat angles C4'-P-C4' energy: -7.643 flat angles P-C4'-P energy: -11.883 tors. eta vs tors. theta energy: 1.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -187.712406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.712406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.712406 (E_RNA) where: Base-Base interactions energy: -112.256 where: short stacking energy: -65.697 Base-Backbone interact. energy: -0.074 local terms energy: -75.382476 where: bonds (distance) C4'-P energy: -11.769 bonds (distance) P-C4' energy: -17.255 flat angles C4'-P-C4' energy: -15.272 flat angles P-C4'-P energy: -13.067 tors. eta vs tors. theta energy: -18.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -166.927740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.927740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.927740 (E_RNA) where: Base-Base interactions energy: -104.383 where: short stacking energy: -48.591 Base-Backbone interact. energy: -1.740 local terms energy: -60.804470 where: bonds (distance) C4'-P energy: -10.847 bonds (distance) P-C4' energy: -14.997 flat angles C4'-P-C4' energy: -14.707 flat angles P-C4'-P energy: -9.495 tors. eta vs tors. theta energy: -10.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -164.722526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.722526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.722526 (E_RNA) where: Base-Base interactions energy: -105.024 where: short stacking energy: -46.048 Base-Backbone interact. energy: -0.091 local terms energy: -59.608225 where: bonds (distance) C4'-P energy: -13.871 bonds (distance) P-C4' energy: -12.618 flat angles C4'-P-C4' energy: -12.596 flat angles P-C4'-P energy: -6.161 tors. eta vs tors. theta energy: -14.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -132.593615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.593615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.593615 (E_RNA) where: Base-Base interactions energy: -79.602 where: short stacking energy: -41.428 Base-Backbone interact. energy: -0.145 local terms energy: -52.847392 where: bonds (distance) C4'-P energy: -14.365 bonds (distance) P-C4' energy: -11.924 flat angles C4'-P-C4' energy: -13.043 flat angles P-C4'-P energy: -6.857 tors. eta vs tors. theta energy: -6.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -95.303261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.303261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.303261 (E_RNA) where: Base-Base interactions energy: -34.534 where: short stacking energy: -34.336 Base-Backbone interact. energy: 0.441 local terms energy: -61.209973 where: bonds (distance) C4'-P energy: -13.532 bonds (distance) P-C4' energy: -15.981 flat angles C4'-P-C4' energy: -16.002 flat angles P-C4'-P energy: -6.286 tors. eta vs tors. theta energy: -9.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -91.539123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.539123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.539123 (E_RNA) where: Base-Base interactions energy: -40.376 where: short stacking energy: -28.308 Base-Backbone interact. energy: 0.742 local terms energy: -51.904635 where: bonds (distance) C4'-P energy: -13.387 bonds (distance) P-C4' energy: -12.530 flat angles C4'-P-C4' energy: -14.106 flat angles P-C4'-P energy: -7.138 tors. eta vs tors. theta energy: -4.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -76.058153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.058153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.058153 (E_RNA) where: Base-Base interactions energy: -30.229 where: short stacking energy: -29.181 Base-Backbone interact. energy: -0.005 local terms energy: -45.823480 where: bonds (distance) C4'-P energy: -13.214 bonds (distance) P-C4' energy: -11.052 flat angles C4'-P-C4' energy: -11.561 flat angles P-C4'-P energy: -9.974 tors. eta vs tors. theta energy: -0.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -77.728220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.728220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.728220 (E_RNA) where: Base-Base interactions energy: -29.864 where: short stacking energy: -21.407 Base-Backbone interact. energy: -0.776 local terms energy: -47.088318 where: bonds (distance) C4'-P energy: -9.633 bonds (distance) P-C4' energy: -15.958 flat angles C4'-P-C4' energy: -14.356 flat angles P-C4'-P energy: -8.770 tors. eta vs tors. theta energy: 1.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -73.881941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.881941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.881941 (E_RNA) where: Base-Base interactions energy: -29.657 where: short stacking energy: -25.088 Base-Backbone interact. energy: 2.793 local terms energy: -47.018306 where: bonds (distance) C4'-P energy: -10.587 bonds (distance) P-C4' energy: -12.727 flat angles C4'-P-C4' energy: -12.980 flat angles P-C4'-P energy: -7.326 tors. eta vs tors. theta energy: -3.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -67.443515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.443515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.443515 (E_RNA) where: Base-Base interactions energy: -22.394 where: short stacking energy: -15.470 Base-Backbone interact. energy: -0.185 local terms energy: -44.865270 where: bonds (distance) C4'-P energy: -9.818 bonds (distance) P-C4' energy: -10.192 flat angles C4'-P-C4' energy: -15.808 flat angles P-C4'-P energy: -7.162 tors. eta vs tors. theta energy: -1.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -179.630222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.630222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.630222 (E_RNA) where: Base-Base interactions energy: -102.877 where: short stacking energy: -53.062 Base-Backbone interact. energy: -0.283 local terms energy: -76.469677 where: bonds (distance) C4'-P energy: -16.525 bonds (distance) P-C4' energy: -16.640 flat angles C4'-P-C4' energy: -16.343 flat angles P-C4'-P energy: -11.160 tors. eta vs tors. theta energy: -15.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -161.234924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.234924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.234924 (E_RNA) where: Base-Base interactions energy: -94.682 where: short stacking energy: -41.810 Base-Backbone interact. energy: 1.369 local terms energy: -67.922097 where: bonds (distance) C4'-P energy: -16.037 bonds (distance) P-C4' energy: -14.116 flat angles C4'-P-C4' energy: -13.433 flat angles P-C4'-P energy: -8.436 tors. eta vs tors. theta energy: -15.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -191.811696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.811696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.811696 (E_RNA) where: Base-Base interactions energy: -120.422 where: short stacking energy: -49.793 Base-Backbone interact. energy: -0.436 local terms energy: -70.953745 where: bonds (distance) C4'-P energy: -15.512 bonds (distance) P-C4' energy: -12.446 flat angles C4'-P-C4' energy: -16.915 flat angles P-C4'-P energy: -9.037 tors. eta vs tors. theta energy: -17.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -137.223085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.223085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.223085 (E_RNA) where: Base-Base interactions energy: -75.580 where: short stacking energy: -41.938 Base-Backbone interact. energy: 0.055 local terms energy: -61.698826 where: bonds (distance) C4'-P energy: -12.921 bonds (distance) P-C4' energy: -12.895 flat angles C4'-P-C4' energy: -11.995 flat angles P-C4'-P energy: -9.705 tors. eta vs tors. theta energy: -14.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -102.640074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.640074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.640074 (E_RNA) where: Base-Base interactions energy: -41.800 where: short stacking energy: -30.813 Base-Backbone interact. energy: -1.433 local terms energy: -59.406703 where: bonds (distance) C4'-P energy: -13.691 bonds (distance) P-C4' energy: -14.063 flat angles C4'-P-C4' energy: -17.110 flat angles P-C4'-P energy: -9.037 tors. eta vs tors. theta energy: -5.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -85.672751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.672751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.672751 (E_RNA) where: Base-Base interactions energy: -35.623 where: short stacking energy: -32.623 Base-Backbone interact. energy: -0.068 local terms energy: -49.981592 where: bonds (distance) C4'-P energy: -9.340 bonds (distance) P-C4' energy: -14.382 flat angles C4'-P-C4' energy: -13.395 flat angles P-C4'-P energy: -8.433 tors. eta vs tors. theta energy: -4.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -87.445373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.445373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.445373 (E_RNA) where: Base-Base interactions energy: -32.497 where: short stacking energy: -32.497 Base-Backbone interact. energy: -0.099 local terms energy: -54.849170 where: bonds (distance) C4'-P energy: -11.330 bonds (distance) P-C4' energy: -14.734 flat angles C4'-P-C4' energy: -9.560 flat angles P-C4'-P energy: -8.234 tors. eta vs tors. theta energy: -10.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -73.328018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.328018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.328018 (E_RNA) where: Base-Base interactions energy: -24.810 where: short stacking energy: -24.810 Base-Backbone interact. energy: -0.412 local terms energy: -48.106493 where: bonds (distance) C4'-P energy: -12.554 bonds (distance) P-C4' energy: -14.818 flat angles C4'-P-C4' energy: -10.508 flat angles P-C4'-P energy: -5.116 tors. eta vs tors. theta energy: -5.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -68.131990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.131990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.131990 (E_RNA) where: Base-Base interactions energy: -27.882 where: short stacking energy: -20.003 Base-Backbone interact. energy: -0.700 local terms energy: -39.549987 where: bonds (distance) C4'-P energy: -13.363 bonds (distance) P-C4' energy: -13.527 flat angles C4'-P-C4' energy: -4.826 flat angles P-C4'-P energy: -7.953 tors. eta vs tors. theta energy: 0.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -78.473348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.473348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.473348 (E_RNA) where: Base-Base interactions energy: -27.580 where: short stacking energy: -27.580 Base-Backbone interact. energy: -0.120 local terms energy: -50.773117 where: bonds (distance) C4'-P energy: -9.785 bonds (distance) P-C4' energy: -14.616 flat angles C4'-P-C4' energy: -9.258 flat angles P-C4'-P energy: -9.112 tors. eta vs tors. theta energy: -8.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -179.123718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.123718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.123718 (E_RNA) where: Base-Base interactions energy: -113.538 where: short stacking energy: -49.115 Base-Backbone interact. energy: -0.030 local terms energy: -65.556045 where: bonds (distance) C4'-P energy: -13.191 bonds (distance) P-C4' energy: -16.125 flat angles C4'-P-C4' energy: -12.975 flat angles P-C4'-P energy: -10.345 tors. eta vs tors. theta energy: -12.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -192.577981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.577981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.577981 (E_RNA) where: Base-Base interactions energy: -122.061 where: short stacking energy: -48.818 Base-Backbone interact. energy: -0.340 local terms energy: -70.177049 where: bonds (distance) C4'-P energy: -11.960 bonds (distance) P-C4' energy: -15.748 flat angles C4'-P-C4' energy: -13.481 flat angles P-C4'-P energy: -12.577 tors. eta vs tors. theta energy: -16.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -151.842826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.842826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.842826 (E_RNA) where: Base-Base interactions energy: -90.880 where: short stacking energy: -39.436 Base-Backbone interact. energy: -0.270 local terms energy: -60.692277 where: bonds (distance) C4'-P energy: -12.385 bonds (distance) P-C4' energy: -15.459 flat angles C4'-P-C4' energy: -14.692 flat angles P-C4'-P energy: -10.272 tors. eta vs tors. theta energy: -7.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -111.795911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -111.795911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -111.795911 (E_RNA) where: Base-Base interactions energy: -48.067 where: short stacking energy: -35.852 Base-Backbone interact. energy: -0.109 local terms energy: -63.619975 where: bonds (distance) C4'-P energy: -13.649 bonds (distance) P-C4' energy: -16.958 flat angles C4'-P-C4' energy: -17.612 flat angles P-C4'-P energy: -8.335 tors. eta vs tors. theta energy: -7.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -144.404765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.404765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.404765 (E_RNA) where: Base-Base interactions energy: -81.852 where: short stacking energy: -47.193 Base-Backbone interact. energy: -0.036 local terms energy: -62.517077 where: bonds (distance) C4'-P energy: -14.519 bonds (distance) P-C4' energy: -12.009 flat angles C4'-P-C4' energy: -13.134 flat angles P-C4'-P energy: -6.104 tors. eta vs tors. theta energy: -16.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -82.006709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.006709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.006709 (E_RNA) where: Base-Base interactions energy: -25.134 where: short stacking energy: -25.134 Base-Backbone interact. energy: -0.173 local terms energy: -56.700275 where: bonds (distance) C4'-P energy: -14.004 bonds (distance) P-C4' energy: -16.572 flat angles C4'-P-C4' energy: -12.238 flat angles P-C4'-P energy: -11.210 tors. eta vs tors. theta energy: -2.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -69.611276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.611276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.611276 (E_RNA) where: Base-Base interactions energy: -25.179 where: short stacking energy: -25.179 Base-Backbone interact. energy: -0.107 local terms energy: -44.324530 where: bonds (distance) C4'-P energy: -12.688 bonds (distance) P-C4' energy: -12.729 flat angles C4'-P-C4' energy: -10.550 flat angles P-C4'-P energy: -4.005 tors. eta vs tors. theta energy: -4.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -73.656441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.656441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.656441 (E_RNA) where: Base-Base interactions energy: -23.841 where: short stacking energy: -23.841 Base-Backbone interact. energy: -0.101 local terms energy: -49.714016 where: bonds (distance) C4'-P energy: -14.104 bonds (distance) P-C4' energy: -15.159 flat angles C4'-P-C4' energy: -10.794 flat angles P-C4'-P energy: -6.362 tors. eta vs tors. theta energy: -3.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -71.131124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.131124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.131124 (E_RNA) where: Base-Base interactions energy: -26.778 where: short stacking energy: -24.041 Base-Backbone interact. energy: -0.021 local terms energy: -44.332115 where: bonds (distance) C4'-P energy: -13.421 bonds (distance) P-C4' energy: -15.463 flat angles C4'-P-C4' energy: -6.738 flat angles P-C4'-P energy: -6.523 tors. eta vs tors. theta energy: -2.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -73.733379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.733379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.733379 (E_RNA) where: Base-Base interactions energy: -23.072 where: short stacking energy: -23.072 Base-Backbone interact. energy: -0.103 local terms energy: -50.557764 where: bonds (distance) C4'-P energy: -12.485 bonds (distance) P-C4' energy: -14.182 flat angles C4'-P-C4' energy: -12.447 flat angles P-C4'-P energy: -4.009 tors. eta vs tors. theta energy: -7.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -192.058750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.058750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.058750 (E_RNA) where: Base-Base interactions energy: -127.641 where: short stacking energy: -55.279 Base-Backbone interact. energy: -0.414 local terms energy: -64.003572 where: bonds (distance) C4'-P energy: -13.165 bonds (distance) P-C4' energy: -16.284 flat angles C4'-P-C4' energy: -9.891 flat angles P-C4'-P energy: -9.625 tors. eta vs tors. theta energy: -15.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -193.817757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.817757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.817757 (E_RNA) where: Base-Base interactions energy: -118.142 where: short stacking energy: -60.448 Base-Backbone interact. energy: -0.003 local terms energy: -75.672592 where: bonds (distance) C4'-P energy: -15.545 bonds (distance) P-C4' energy: -13.842 flat angles C4'-P-C4' energy: -13.286 flat angles P-C4'-P energy: -13.120 tors. eta vs tors. theta energy: -19.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -159.823411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.823411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.823411 (E_RNA) where: Base-Base interactions energy: -90.786 where: short stacking energy: -48.319 Base-Backbone interact. energy: -0.086 local terms energy: -68.950991 where: bonds (distance) C4'-P energy: -16.241 bonds (distance) P-C4' energy: -14.782 flat angles C4'-P-C4' energy: -15.489 flat angles P-C4'-P energy: -9.889 tors. eta vs tors. theta energy: -12.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -120.997455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.997455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.997455 (E_RNA) where: Base-Base interactions energy: -60.166 where: short stacking energy: -39.512 Base-Backbone interact. energy: -1.748 local terms energy: -59.082704 where: bonds (distance) C4'-P energy: -10.748 bonds (distance) P-C4' energy: -15.064 flat angles C4'-P-C4' energy: -11.147 flat angles P-C4'-P energy: -8.852 tors. eta vs tors. theta energy: -13.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -84.115672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.115672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.115672 (E_RNA) where: Base-Base interactions energy: -33.739 where: short stacking energy: -33.739 Base-Backbone interact. energy: -0.029 local terms energy: -50.348369 where: bonds (distance) C4'-P energy: -14.928 bonds (distance) P-C4' energy: -12.590 flat angles C4'-P-C4' energy: -10.678 flat angles P-C4'-P energy: -8.231 tors. eta vs tors. theta energy: -3.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -130.356180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -130.356180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -130.356180 (E_RNA) where: Base-Base interactions energy: -78.132 where: short stacking energy: -35.449 Base-Backbone interact. energy: -0.606 local terms energy: -51.618620 where: bonds (distance) C4'-P energy: -10.390 bonds (distance) P-C4' energy: -10.445 flat angles C4'-P-C4' energy: -13.327 flat angles P-C4'-P energy: -9.389 tors. eta vs tors. theta energy: -8.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -91.669911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.669911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.669911 (E_RNA) where: Base-Base interactions energy: -41.214 where: short stacking energy: -26.120 Base-Backbone interact. energy: -0.601 local terms energy: -49.854785 where: bonds (distance) C4'-P energy: -13.247 bonds (distance) P-C4' energy: -11.775 flat angles C4'-P-C4' energy: -13.738 flat angles P-C4'-P energy: -7.007 tors. eta vs tors. theta energy: -4.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -79.456002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.456002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.456002 (E_RNA) where: Base-Base interactions energy: -26.549 where: short stacking energy: -26.460 Base-Backbone interact. energy: -0.213 local terms energy: -52.694002 where: bonds (distance) C4'-P energy: -11.454 bonds (distance) P-C4' energy: -15.248 flat angles C4'-P-C4' energy: -14.043 flat angles P-C4'-P energy: -9.094 tors. eta vs tors. theta energy: -2.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -82.154836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.154836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.154836 (E_RNA) where: Base-Base interactions energy: -29.417 where: short stacking energy: -29.417 Base-Backbone interact. energy: -0.102 local terms energy: -52.635651 where: bonds (distance) C4'-P energy: -13.330 bonds (distance) P-C4' energy: -12.588 flat angles C4'-P-C4' energy: -11.643 flat angles P-C4'-P energy: -6.029 tors. eta vs tors. theta energy: -9.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -66.032833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.032833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.032833 (E_RNA) where: Base-Base interactions energy: -24.329 where: short stacking energy: -24.329 Base-Backbone interact. energy: -0.165 local terms energy: -41.539256 where: bonds (distance) C4'-P energy: -9.665 bonds (distance) P-C4' energy: -10.831 flat angles C4'-P-C4' energy: -10.835 flat angles P-C4'-P energy: -8.774 tors. eta vs tors. theta energy: -1.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -184.908098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.908098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.908098 (E_RNA) where: Base-Base interactions energy: -120.202 where: short stacking energy: -47.458 Base-Backbone interact. energy: -0.382 local terms energy: -64.324553 where: bonds (distance) C4'-P energy: -14.286 bonds (distance) P-C4' energy: -16.661 flat angles C4'-P-C4' energy: -14.083 flat angles P-C4'-P energy: -7.492 tors. eta vs tors. theta energy: -11.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -190.191644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -190.191644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -190.191644 (E_RNA) where: Base-Base interactions energy: -111.429 where: short stacking energy: -59.991 Base-Backbone interact. energy: -0.012 local terms energy: -78.750581 where: bonds (distance) C4'-P energy: -16.616 bonds (distance) P-C4' energy: -12.827 flat angles C4'-P-C4' energy: -15.239 flat angles P-C4'-P energy: -11.989 tors. eta vs tors. theta energy: -22.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -171.678004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.678004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.678004 (E_RNA) where: Base-Base interactions energy: -108.601 where: short stacking energy: -42.489 Base-Backbone interact. energy: -0.291 local terms energy: -62.785228 where: bonds (distance) C4'-P energy: -14.750 bonds (distance) P-C4' energy: -12.380 flat angles C4'-P-C4' energy: -16.514 flat angles P-C4'-P energy: -8.610 tors. eta vs tors. theta energy: -10.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -95.271845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.271845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.271845 (E_RNA) where: Base-Base interactions energy: -32.656 where: short stacking energy: -32.656 Base-Backbone interact. energy: -2.025 local terms energy: -60.590735 where: bonds (distance) C4'-P energy: -12.015 bonds (distance) P-C4' energy: -13.912 flat angles C4'-P-C4' energy: -15.185 flat angles P-C4'-P energy: -8.591 tors. eta vs tors. theta energy: -10.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -91.169183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.169183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.169183 (E_RNA) where: Base-Base interactions energy: -35.119 where: short stacking energy: -14.094 Base-Backbone interact. energy: -2.551 local terms energy: -53.499005 where: bonds (distance) C4'-P energy: -15.167 bonds (distance) P-C4' energy: -15.973 flat angles C4'-P-C4' energy: -15.398 flat angles P-C4'-P energy: -8.267 tors. eta vs tors. theta energy: 1.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -135.591000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.591000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.591000 (E_RNA) where: Base-Base interactions energy: -88.620 where: short stacking energy: -37.834 Base-Backbone interact. energy: -0.483 local terms energy: -46.487144 where: bonds (distance) C4'-P energy: -11.363 bonds (distance) P-C4' energy: -13.372 flat angles C4'-P-C4' energy: -12.911 flat angles P-C4'-P energy: -6.774 tors. eta vs tors. theta energy: -2.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -91.263025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.263025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.263025 (E_RNA) where: Base-Base interactions energy: -37.614 where: short stacking energy: -35.030 Base-Backbone interact. energy: -0.264 local terms energy: -53.384901 where: bonds (distance) C4'-P energy: -9.899 bonds (distance) P-C4' energy: -13.365 flat angles C4'-P-C4' energy: -13.811 flat angles P-C4'-P energy: -8.006 tors. eta vs tors. theta energy: -8.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -106.614156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.614156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.614156 (E_RNA) where: Base-Base interactions energy: -55.527 where: short stacking energy: -29.806 Base-Backbone interact. energy: -1.126 local terms energy: -49.961700 where: bonds (distance) C4'-P energy: -10.344 bonds (distance) P-C4' energy: -12.855 flat angles C4'-P-C4' energy: -10.927 flat angles P-C4'-P energy: -11.503 tors. eta vs tors. theta energy: -4.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -74.631682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.631682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.631682 (E_RNA) where: Base-Base interactions energy: -36.373 where: short stacking energy: -23.309 Base-Backbone interact. energy: 1.137 local terms energy: -39.395739 where: bonds (distance) C4'-P energy: -10.781 bonds (distance) P-C4' energy: -10.733 flat angles C4'-P-C4' energy: -6.621 flat angles P-C4'-P energy: -7.786 tors. eta vs tors. theta energy: -3.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -68.492153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.492153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.492153 (E_RNA) where: Base-Base interactions energy: -20.322 where: short stacking energy: -20.186 Base-Backbone interact. energy: 3.566 local terms energy: -51.735943 where: bonds (distance) C4'-P energy: -16.339 bonds (distance) P-C4' energy: -14.373 flat angles C4'-P-C4' energy: -13.512 flat angles P-C4'-P energy: -5.974 tors. eta vs tors. theta energy: -1.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -193.238516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.238516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.238516 (E_RNA) where: Base-Base interactions energy: -119.040 where: short stacking energy: -63.708 Base-Backbone interact. energy: -0.007 local terms energy: -74.191517 where: bonds (distance) C4'-P energy: -14.854 bonds (distance) P-C4' energy: -16.883 flat angles C4'-P-C4' energy: -15.634 flat angles P-C4'-P energy: -9.150 tors. eta vs tors. theta energy: -17.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -187.588418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.588418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.588418 (E_RNA) where: Base-Base interactions energy: -121.261 where: short stacking energy: -45.424 Base-Backbone interact. energy: -0.376 local terms energy: -65.951491 where: bonds (distance) C4'-P energy: -14.071 bonds (distance) P-C4' energy: -12.886 flat angles C4'-P-C4' energy: -14.980 flat angles P-C4'-P energy: -6.228 tors. eta vs tors. theta energy: -17.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -169.378751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.378751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.378751 (E_RNA) where: Base-Base interactions energy: -112.534 where: short stacking energy: -35.139 Base-Backbone interact. energy: -0.622 local terms energy: -56.221922 where: bonds (distance) C4'-P energy: -13.980 bonds (distance) P-C4' energy: -12.602 flat angles C4'-P-C4' energy: -14.833 flat angles P-C4'-P energy: -7.549 tors. eta vs tors. theta energy: -7.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -102.407897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -102.407897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -102.407897 (E_RNA) where: Base-Base interactions energy: -46.653 where: short stacking energy: -40.060 Base-Backbone interact. energy: -0.119 local terms energy: -55.636411 where: bonds (distance) C4'-P energy: -11.533 bonds (distance) P-C4' energy: -13.355 flat angles C4'-P-C4' energy: -14.681 flat angles P-C4'-P energy: -6.140 tors. eta vs tors. theta energy: -9.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -143.965546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.965546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.965546 (E_RNA) where: Base-Base interactions energy: -79.032 where: short stacking energy: -38.478 Base-Backbone interact. energy: 0.120 local terms energy: -65.052873 where: bonds (distance) C4'-P energy: -13.379 bonds (distance) P-C4' energy: -15.564 flat angles C4'-P-C4' energy: -16.545 flat angles P-C4'-P energy: -7.079 tors. eta vs tors. theta energy: -12.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -100.704911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -100.704911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -100.704911 (E_RNA) where: Base-Base interactions energy: -51.720 where: short stacking energy: -33.594 Base-Backbone interact. energy: -0.054 local terms energy: -48.930909 where: bonds (distance) C4'-P energy: -4.359 bonds (distance) P-C4' energy: -13.948 flat angles C4'-P-C4' energy: -14.327 flat angles P-C4'-P energy: -10.221 tors. eta vs tors. theta energy: -6.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -104.484316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.484316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.484316 (E_RNA) where: Base-Base interactions energy: -43.154 where: short stacking energy: -31.281 Base-Backbone interact. energy: -0.206 local terms energy: -61.124443 where: bonds (distance) C4'-P energy: -17.449 bonds (distance) P-C4' energy: -10.287 flat angles C4'-P-C4' energy: -14.294 flat angles P-C4'-P energy: -10.532 tors. eta vs tors. theta energy: -8.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -87.484684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.484684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.484684 (E_RNA) where: Base-Base interactions energy: -30.146 where: short stacking energy: -24.731 Base-Backbone interact. energy: -0.312 local terms energy: -57.026634 where: bonds (distance) C4'-P energy: -14.125 bonds (distance) P-C4' energy: -15.013 flat angles C4'-P-C4' energy: -10.358 flat angles P-C4'-P energy: -8.877 tors. eta vs tors. theta energy: -8.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -76.716832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.716832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.716832 (E_RNA) where: Base-Base interactions energy: -19.963 where: short stacking energy: -19.820 Base-Backbone interact. energy: -0.470 local terms energy: -56.283335 where: bonds (distance) C4'-P energy: -16.365 bonds (distance) P-C4' energy: -15.928 flat angles C4'-P-C4' energy: -13.168 flat angles P-C4'-P energy: -9.214 tors. eta vs tors. theta energy: -1.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -70.169610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.169610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.169610 (E_RNA) where: Base-Base interactions energy: -22.764 where: short stacking energy: -15.576 Base-Backbone interact. energy: 0.580 local terms energy: -47.985640 where: bonds (distance) C4'-P energy: -12.087 bonds (distance) P-C4' energy: -15.613 flat angles C4'-P-C4' energy: -12.187 flat angles P-C4'-P energy: -7.431 tors. eta vs tors. theta energy: -0.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -186.870349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.870349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.870349 (E_RNA) where: Base-Base interactions energy: -117.222 where: short stacking energy: -58.916 Base-Backbone interact. energy: -0.002 local terms energy: -69.645806 where: bonds (distance) C4'-P energy: -13.379 bonds (distance) P-C4' energy: -14.293 flat angles C4'-P-C4' energy: -14.682 flat angles P-C4'-P energy: -9.696 tors. eta vs tors. theta energy: -17.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -191.667463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.667463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.667463 (E_RNA) where: Base-Base interactions energy: -130.711 where: short stacking energy: -55.633 Base-Backbone interact. energy: 0.190 local terms energy: -61.146390 where: bonds (distance) C4'-P energy: -14.670 bonds (distance) P-C4' energy: -13.259 flat angles C4'-P-C4' energy: -10.375 flat angles P-C4'-P energy: -6.314 tors. eta vs tors. theta energy: -16.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -172.485044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.485044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.485044 (E_RNA) where: Base-Base interactions energy: -115.909 where: short stacking energy: -39.830 Base-Backbone interact. energy: -0.851 local terms energy: -55.725036 where: bonds (distance) C4'-P energy: -12.150 bonds (distance) P-C4' energy: -13.539 flat angles C4'-P-C4' energy: -15.361 flat angles P-C4'-P energy: -8.881 tors. eta vs tors. theta energy: -5.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -132.617744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.617744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.617744 (E_RNA) where: Base-Base interactions energy: -77.726 where: short stacking energy: -33.107 Base-Backbone interact. energy: -0.201 local terms energy: -54.691536 where: bonds (distance) C4'-P energy: -15.342 bonds (distance) P-C4' energy: -13.472 flat angles C4'-P-C4' energy: -14.536 flat angles P-C4'-P energy: -5.141 tors. eta vs tors. theta energy: -6.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -92.594562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.594562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.594562 (E_RNA) where: Base-Base interactions energy: -35.519 where: short stacking energy: -32.293 Base-Backbone interact. energy: -0.042 local terms energy: -57.032934 where: bonds (distance) C4'-P energy: -11.281 bonds (distance) P-C4' energy: -16.858 flat angles C4'-P-C4' energy: -12.798 flat angles P-C4'-P energy: -5.320 tors. eta vs tors. theta energy: -10.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -79.542776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.542776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.542776 (E_RNA) where: Base-Base interactions energy: -28.169 where: short stacking energy: -28.076 Base-Backbone interact. energy: -0.119 local terms energy: -51.254953 where: bonds (distance) C4'-P energy: -6.040 bonds (distance) P-C4' energy: -15.079 flat angles C4'-P-C4' energy: -13.679 flat angles P-C4'-P energy: -10.228 tors. eta vs tors. theta energy: -6.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -94.182664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.182664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.182664 (E_RNA) where: Base-Base interactions energy: -46.916 where: short stacking energy: -22.964 Base-Backbone interact. energy: -0.008 local terms energy: -47.258934 where: bonds (distance) C4'-P energy: -14.264 bonds (distance) P-C4' energy: -14.864 flat angles C4'-P-C4' energy: -13.119 flat angles P-C4'-P energy: -2.882 tors. eta vs tors. theta energy: -2.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -70.616137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.616137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.616137 (E_RNA) where: Base-Base interactions energy: -21.215 where: short stacking energy: -17.694 Base-Backbone interact. energy: 1.503 local terms energy: -50.904054 where: bonds (distance) C4'-P energy: -13.682 bonds (distance) P-C4' energy: -15.702 flat angles C4'-P-C4' energy: -11.991 flat angles P-C4'-P energy: -9.827 tors. eta vs tors. theta energy: 0.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -70.303661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.303661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.303661 (E_RNA) where: Base-Base interactions energy: -25.377 where: short stacking energy: -24.980 Base-Backbone interact. energy: -0.352 local terms energy: -44.574823 where: bonds (distance) C4'-P energy: -12.821 bonds (distance) P-C4' energy: -12.215 flat angles C4'-P-C4' energy: -12.036 flat angles P-C4'-P energy: -8.507 tors. eta vs tors. theta energy: 1.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -67.950566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.950566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.950566 (E_RNA) where: Base-Base interactions energy: -25.436 where: short stacking energy: -22.346 Base-Backbone interact. energy: -0.074 local terms energy: -42.440158 where: bonds (distance) C4'-P energy: -8.954 bonds (distance) P-C4' energy: -12.065 flat angles C4'-P-C4' energy: -14.046 flat angles P-C4'-P energy: -4.641 tors. eta vs tors. theta energy: -2.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -198.187311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -198.187311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -198.187311 (E_RNA) where: Base-Base interactions energy: -130.452 where: short stacking energy: -51.659 Base-Backbone interact. energy: 0.389 local terms energy: -68.124413 where: bonds (distance) C4'-P energy: -14.837 bonds (distance) P-C4' energy: -16.647 flat angles C4'-P-C4' energy: -12.317 flat angles P-C4'-P energy: -11.649 tors. eta vs tors. theta energy: -12.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -186.086287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.086287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.086287 (E_RNA) where: Base-Base interactions energy: -123.152 where: short stacking energy: -55.705 Base-Backbone interact. energy: 0.078 local terms energy: -63.012046 where: bonds (distance) C4'-P energy: -14.358 bonds (distance) P-C4' energy: -7.656 flat angles C4'-P-C4' energy: -15.002 flat angles P-C4'-P energy: -11.050 tors. eta vs tors. theta energy: -14.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -157.382498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.382498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.382498 (E_RNA) where: Base-Base interactions energy: -96.571 where: short stacking energy: -36.317 Base-Backbone interact. energy: -0.668 local terms energy: -60.143992 where: bonds (distance) C4'-P energy: -12.298 bonds (distance) P-C4' energy: -14.408 flat angles C4'-P-C4' energy: -12.859 flat angles P-C4'-P energy: -12.504 tors. eta vs tors. theta energy: -8.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -137.830256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -137.830256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -137.830256 (E_RNA) where: Base-Base interactions energy: -75.566 where: short stacking energy: -39.035 Base-Backbone interact. energy: -0.102 local terms energy: -62.162260 where: bonds (distance) C4'-P energy: -12.535 bonds (distance) P-C4' energy: -13.831 flat angles C4'-P-C4' energy: -16.623 flat angles P-C4'-P energy: -8.580 tors. eta vs tors. theta energy: -10.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -143.447198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.447198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.447198 (E_RNA) where: Base-Base interactions energy: -84.885 where: short stacking energy: -35.205 Base-Backbone interact. energy: 0.356 local terms energy: -58.918374 where: bonds (distance) C4'-P energy: -13.301 bonds (distance) P-C4' energy: -12.940 flat angles C4'-P-C4' energy: -17.510 flat angles P-C4'-P energy: -9.617 tors. eta vs tors. theta energy: -5.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -83.537793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.537793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.537793 (E_RNA) where: Base-Base interactions energy: -29.526 where: short stacking energy: -29.726 Base-Backbone interact. energy: -0.101 local terms energy: -53.910818 where: bonds (distance) C4'-P energy: -14.754 bonds (distance) P-C4' energy: -10.176 flat angles C4'-P-C4' energy: -13.243 flat angles P-C4'-P energy: -10.110 tors. eta vs tors. theta energy: -5.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -75.809243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.809243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.809243 (E_RNA) where: Base-Base interactions energy: -23.642 where: short stacking energy: -23.163 Base-Backbone interact. energy: -0.104 local terms energy: -52.063437 where: bonds (distance) C4'-P energy: -11.136 bonds (distance) P-C4' energy: -13.225 flat angles C4'-P-C4' energy: -15.029 flat angles P-C4'-P energy: -6.391 tors. eta vs tors. theta energy: -6.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -71.174347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.174347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.174347 (E_RNA) where: Base-Base interactions energy: -22.623 where: short stacking energy: -18.052 Base-Backbone interact. energy: -0.271 local terms energy: -48.280809 where: bonds (distance) C4'-P energy: -11.276 bonds (distance) P-C4' energy: -14.405 flat angles C4'-P-C4' energy: -11.176 flat angles P-C4'-P energy: -11.164 tors. eta vs tors. theta energy: -0.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -72.401627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.401627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.401627 (E_RNA) where: Base-Base interactions energy: -28.425 where: short stacking energy: -21.426 Base-Backbone interact. energy: -0.241 local terms energy: -43.735444 where: bonds (distance) C4'-P energy: -13.003 bonds (distance) P-C4' energy: -11.842 flat angles C4'-P-C4' energy: -9.359 flat angles P-C4'-P energy: -10.095 tors. eta vs tors. theta energy: 0.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -64.392300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.392300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.392300 (E_RNA) where: Base-Base interactions energy: -22.096 where: short stacking energy: -22.096 Base-Backbone interact. energy: -0.124 local terms energy: -42.172477 where: bonds (distance) C4'-P energy: -11.256 bonds (distance) P-C4' energy: -11.124 flat angles C4'-P-C4' energy: -12.969 flat angles P-C4'-P energy: -8.019 tors. eta vs tors. theta energy: 1.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -180.968590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.968590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.968590 (E_RNA) where: Base-Base interactions energy: -117.072 where: short stacking energy: -49.738 Base-Backbone interact. energy: -1.023 local terms energy: -62.872707 where: bonds (distance) C4'-P energy: -15.983 bonds (distance) P-C4' energy: -16.110 flat angles C4'-P-C4' energy: -17.233 flat angles P-C4'-P energy: -3.829 tors. eta vs tors. theta energy: -9.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -170.539929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.539929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.539929 (E_RNA) where: Base-Base interactions energy: -106.771 where: short stacking energy: -45.042 Base-Backbone interact. energy: -0.437 local terms energy: -63.332504 where: bonds (distance) C4'-P energy: -12.684 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -15.134 flat angles P-C4'-P energy: -10.625 tors. eta vs tors. theta energy: -9.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -165.180455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.180455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.180455 (E_RNA) where: Base-Base interactions energy: -88.924 where: short stacking energy: -44.446 Base-Backbone interact. energy: -0.038 local terms energy: -76.218829 where: bonds (distance) C4'-P energy: -17.379 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -15.911 flat angles P-C4'-P energy: -10.468 tors. eta vs tors. theta energy: -16.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -144.345943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.345943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.345943 (E_RNA) where: Base-Base interactions energy: -83.586 where: short stacking energy: -38.217 Base-Backbone interact. energy: -0.142 local terms energy: -60.618486 where: bonds (distance) C4'-P energy: -15.748 bonds (distance) P-C4' energy: -13.303 flat angles C4'-P-C4' energy: -15.502 flat angles P-C4'-P energy: -8.346 tors. eta vs tors. theta energy: -7.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -143.220138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.220138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.220138 (E_RNA) where: Base-Base interactions energy: -89.691 where: short stacking energy: -30.109 Base-Backbone interact. energy: -0.898 local terms energy: -52.631079 where: bonds (distance) C4'-P energy: -14.390 bonds (distance) P-C4' energy: -15.950 flat angles C4'-P-C4' energy: -11.154 flat angles P-C4'-P energy: -8.279 tors. eta vs tors. theta energy: -2.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -80.179629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.179629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.179629 (E_RNA) where: Base-Base interactions energy: -32.979 where: short stacking energy: -28.395 Base-Backbone interact. energy: -0.338 local terms energy: -46.862571 where: bonds (distance) C4'-P energy: -12.883 bonds (distance) P-C4' energy: -12.281 flat angles C4'-P-C4' energy: -12.029 flat angles P-C4'-P energy: -11.085 tors. eta vs tors. theta energy: 1.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -74.569943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.569943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.569943 (E_RNA) where: Base-Base interactions energy: -29.620 where: short stacking energy: -26.748 Base-Backbone interact. energy: -1.023 local terms energy: -43.927586 where: bonds (distance) C4'-P energy: -14.509 bonds (distance) P-C4' energy: -11.036 flat angles C4'-P-C4' energy: -8.815 flat angles P-C4'-P energy: -6.921 tors. eta vs tors. theta energy: -2.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -82.281177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.281177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.281177 (E_RNA) where: Base-Base interactions energy: -32.151 where: short stacking energy: -18.363 Base-Backbone interact. energy: -0.956 local terms energy: -49.174027 where: bonds (distance) C4'-P energy: -14.865 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -9.052 flat angles P-C4'-P energy: -10.752 tors. eta vs tors. theta energy: 1.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -74.386809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.386809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.386809 (E_RNA) where: Base-Base interactions energy: -26.809 where: short stacking energy: -17.298 Base-Backbone interact. energy: 0.510 local terms energy: -48.086950 where: bonds (distance) C4'-P energy: -11.343 bonds (distance) P-C4' energy: -15.125 flat angles C4'-P-C4' energy: -14.265 flat angles P-C4'-P energy: -6.330 tors. eta vs tors. theta energy: -1.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -68.764525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.764525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.764525 (E_RNA) where: Base-Base interactions energy: -29.241 where: short stacking energy: -21.305 Base-Backbone interact. energy: -0.138 local terms energy: -39.385206 where: bonds (distance) C4'-P energy: -11.666 bonds (distance) P-C4' energy: -9.255 flat angles C4'-P-C4' energy: -12.568 flat angles P-C4'-P energy: -5.211 tors. eta vs tors. theta energy: -0.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -161.496120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.496120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.496120 (E_RNA) where: Base-Base interactions energy: -100.832 where: short stacking energy: -45.006 Base-Backbone interact. energy: -0.464 local terms energy: -60.199304 where: bonds (distance) C4'-P energy: -14.722 bonds (distance) P-C4' energy: -16.020 flat angles C4'-P-C4' energy: -13.909 flat angles P-C4'-P energy: -9.901 tors. eta vs tors. theta energy: -5.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -169.360506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.360506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.360506 (E_RNA) where: Base-Base interactions energy: -109.166 where: short stacking energy: -41.163 Base-Backbone interact. energy: -0.871 local terms energy: -59.323521 where: bonds (distance) C4'-P energy: -16.587 bonds (distance) P-C4' energy: -13.353 flat angles C4'-P-C4' energy: -10.759 flat angles P-C4'-P energy: -12.250 tors. eta vs tors. theta energy: -6.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -165.261147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.261147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.261147 (E_RNA) where: Base-Base interactions energy: -106.521 where: short stacking energy: -48.669 Base-Backbone interact. energy: -0.220 local terms energy: -58.520066 where: bonds (distance) C4'-P energy: -11.774 bonds (distance) P-C4' energy: -13.244 flat angles C4'-P-C4' energy: -12.804 flat angles P-C4'-P energy: -8.605 tors. eta vs tors. theta energy: -12.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -150.016569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.016569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.016569 (E_RNA) where: Base-Base interactions energy: -91.561 where: short stacking energy: -30.119 Base-Backbone interact. energy: -0.133 local terms energy: -58.321801 where: bonds (distance) C4'-P energy: -13.554 bonds (distance) P-C4' energy: -14.454 flat angles C4'-P-C4' energy: -15.995 flat angles P-C4'-P energy: -8.311 tors. eta vs tors. theta energy: -6.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -159.360496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -159.360496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -159.360496 (E_RNA) where: Base-Base interactions energy: -104.232 where: short stacking energy: -34.759 Base-Backbone interact. energy: 0.360 local terms energy: -55.487798 where: bonds (distance) C4'-P energy: -12.494 bonds (distance) P-C4' energy: -12.171 flat angles C4'-P-C4' energy: -14.620 flat angles P-C4'-P energy: -9.164 tors. eta vs tors. theta energy: -7.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -77.874384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.874384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.874384 (E_RNA) where: Base-Base interactions energy: -28.592 where: short stacking energy: -21.998 Base-Backbone interact. energy: -0.069 local terms energy: -49.213900 where: bonds (distance) C4'-P energy: -13.265 bonds (distance) P-C4' energy: -13.513 flat angles C4'-P-C4' energy: -15.188 flat angles P-C4'-P energy: -3.979 tors. eta vs tors. theta energy: -3.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -87.283934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.283934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.283934 (E_RNA) where: Base-Base interactions energy: -30.269 where: short stacking energy: -21.813 Base-Backbone interact. energy: -0.067 local terms energy: -56.947296 where: bonds (distance) C4'-P energy: -15.530 bonds (distance) P-C4' energy: -16.985 flat angles C4'-P-C4' energy: -11.928 flat angles P-C4'-P energy: -7.489 tors. eta vs tors. theta energy: -5.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -73.715367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.715367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.715367 (E_RNA) where: Base-Base interactions energy: -20.217 where: short stacking energy: -17.396 Base-Backbone interact. energy: 0.815 local terms energy: -54.313326 where: bonds (distance) C4'-P energy: -10.291 bonds (distance) P-C4' energy: -16.640 flat angles C4'-P-C4' energy: -12.701 flat angles P-C4'-P energy: -9.025 tors. eta vs tors. theta energy: -5.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -76.022069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.022069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.022069 (E_RNA) where: Base-Base interactions energy: -24.883 where: short stacking energy: -24.883 Base-Backbone interact. energy: -0.936 local terms energy: -50.202953 where: bonds (distance) C4'-P energy: -16.153 bonds (distance) P-C4' energy: -16.404 flat angles C4'-P-C4' energy: -13.055 flat angles P-C4'-P energy: -0.845 tors. eta vs tors. theta energy: -3.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -66.311850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.311850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.311850 (E_RNA) where: Base-Base interactions energy: -23.966 where: short stacking energy: -10.033 Base-Backbone interact. energy: -0.327 local terms energy: -42.018907 where: bonds (distance) C4'-P energy: -14.154 bonds (distance) P-C4' energy: -14.327 flat angles C4'-P-C4' energy: -6.208 flat angles P-C4'-P energy: -9.133 tors. eta vs tors. theta energy: 1.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -166.014536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.014536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.014536 (E_RNA) where: Base-Base interactions energy: -103.585 where: short stacking energy: -30.119 Base-Backbone interact. energy: -1.413 local terms energy: -61.016552 where: bonds (distance) C4'-P energy: -15.788 bonds (distance) P-C4' energy: -13.070 flat angles C4'-P-C4' energy: -14.574 flat angles P-C4'-P energy: -10.800 tors. eta vs tors. theta energy: -6.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -188.454839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.454839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.454839 (E_RNA) where: Base-Base interactions energy: -116.541 where: short stacking energy: -53.755 Base-Backbone interact. energy: 0.377 local terms energy: -72.291036 where: bonds (distance) C4'-P energy: -15.193 bonds (distance) P-C4' energy: -15.846 flat angles C4'-P-C4' energy: -13.886 flat angles P-C4'-P energy: -9.783 tors. eta vs tors. theta energy: -17.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -150.727740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.727740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.727740 (E_RNA) where: Base-Base interactions energy: -93.722 where: short stacking energy: -49.681 Base-Backbone interact. energy: -0.113 local terms energy: -56.892979 where: bonds (distance) C4'-P energy: -12.641 bonds (distance) P-C4' energy: -14.258 flat angles C4'-P-C4' energy: -10.557 flat angles P-C4'-P energy: -7.436 tors. eta vs tors. theta energy: -12.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -153.687032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.687032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.687032 (E_RNA) where: Base-Base interactions energy: -94.078 where: short stacking energy: -46.245 Base-Backbone interact. energy: -0.133 local terms energy: -59.475873 where: bonds (distance) C4'-P energy: -14.270 bonds (distance) P-C4' energy: -14.293 flat angles C4'-P-C4' energy: -10.271 flat angles P-C4'-P energy: -9.157 tors. eta vs tors. theta energy: -11.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -140.808550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.808550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.808550 (E_RNA) where: Base-Base interactions energy: -85.562 where: short stacking energy: -38.917 Base-Backbone interact. energy: -0.397 local terms energy: -54.849739 where: bonds (distance) C4'-P energy: -10.446 bonds (distance) P-C4' energy: -11.600 flat angles C4'-P-C4' energy: -15.260 flat angles P-C4'-P energy: -10.023 tors. eta vs tors. theta energy: -7.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -82.086925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.086925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.086925 (E_RNA) where: Base-Base interactions energy: -27.915 where: short stacking energy: -23.428 Base-Backbone interact. energy: -0.123 local terms energy: -54.048925 where: bonds (distance) C4'-P energy: -13.911 bonds (distance) P-C4' energy: -14.389 flat angles C4'-P-C4' energy: -10.148 flat angles P-C4'-P energy: -10.416 tors. eta vs tors. theta energy: -5.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -80.172784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.172784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.172784 (E_RNA) where: Base-Base interactions energy: -36.061 where: short stacking energy: -26.659 Base-Backbone interact. energy: 0.220 local terms energy: -44.331509 where: bonds (distance) C4'-P energy: -8.324 bonds (distance) P-C4' energy: -12.173 flat angles C4'-P-C4' energy: -13.263 flat angles P-C4'-P energy: -6.539 tors. eta vs tors. theta energy: -4.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -81.518209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.518209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.518209 (E_RNA) where: Base-Base interactions energy: -29.459 where: short stacking energy: -29.459 Base-Backbone interact. energy: -0.029 local terms energy: -52.030402 where: bonds (distance) C4'-P energy: -10.478 bonds (distance) P-C4' energy: -14.396 flat angles C4'-P-C4' energy: -11.992 flat angles P-C4'-P energy: -8.949 tors. eta vs tors. theta energy: -6.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -80.809241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.809241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.809241 (E_RNA) where: Base-Base interactions energy: -24.613 where: short stacking energy: -24.613 Base-Backbone interact. energy: -0.166 local terms energy: -56.030841 where: bonds (distance) C4'-P energy: -12.244 bonds (distance) P-C4' energy: -10.680 flat angles C4'-P-C4' energy: -14.870 flat angles P-C4'-P energy: -11.934 tors. eta vs tors. theta energy: -6.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -70.746745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.746745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.746745 (E_RNA) where: Base-Base interactions energy: -24.719 where: short stacking energy: -17.531 Base-Backbone interact. energy: -0.052 local terms energy: -45.976220 where: bonds (distance) C4'-P energy: -13.222 bonds (distance) P-C4' energy: -15.794 flat angles C4'-P-C4' energy: -11.625 flat angles P-C4'-P energy: -3.697 tors. eta vs tors. theta energy: -1.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -181.686391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.686391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.686391 (E_RNA) where: Base-Base interactions energy: -113.996 where: short stacking energy: -58.004 Base-Backbone interact. energy: -0.048 local terms energy: -67.642558 where: bonds (distance) C4'-P energy: -13.835 bonds (distance) P-C4' energy: -13.900 flat angles C4'-P-C4' energy: -14.123 flat angles P-C4'-P energy: -9.876 tors. eta vs tors. theta energy: -15.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -165.407262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.407262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.407262 (E_RNA) where: Base-Base interactions energy: -95.362 where: short stacking energy: -38.002 Base-Backbone interact. energy: -0.287 local terms energy: -69.758240 where: bonds (distance) C4'-P energy: -15.975 bonds (distance) P-C4' energy: -14.320 flat angles C4'-P-C4' energy: -15.580 flat angles P-C4'-P energy: -10.878 tors. eta vs tors. theta energy: -13.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -163.330557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.330557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.330557 (E_RNA) where: Base-Base interactions energy: -104.118 where: short stacking energy: -41.125 Base-Backbone interact. energy: -0.170 local terms energy: -59.042209 where: bonds (distance) C4'-P energy: -10.697 bonds (distance) P-C4' energy: -16.898 flat angles C4'-P-C4' energy: -12.621 flat angles P-C4'-P energy: -8.791 tors. eta vs tors. theta energy: -10.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -161.309339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.309339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.309339 (E_RNA) where: Base-Base interactions energy: -107.480 where: short stacking energy: -38.232 Base-Backbone interact. energy: 1.624 local terms energy: -55.453589 where: bonds (distance) C4'-P energy: -12.837 bonds (distance) P-C4' energy: -11.813 flat angles C4'-P-C4' energy: -11.577 flat angles P-C4'-P energy: -10.078 tors. eta vs tors. theta energy: -9.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -144.827150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.827150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.827150 (E_RNA) where: Base-Base interactions energy: -98.624 where: short stacking energy: -37.067 Base-Backbone interact. energy: 1.030 local terms energy: -47.233102 where: bonds (distance) C4'-P energy: -12.434 bonds (distance) P-C4' energy: -14.831 flat angles C4'-P-C4' energy: -9.962 flat angles P-C4'-P energy: -3.255 tors. eta vs tors. theta energy: -6.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -85.298287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.298287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.298287 (E_RNA) where: Base-Base interactions energy: -31.354 where: short stacking energy: -28.188 Base-Backbone interact. energy: 0.180 local terms energy: -54.124960 where: bonds (distance) C4'-P energy: -12.199 bonds (distance) P-C4' energy: -14.610 flat angles C4'-P-C4' energy: -12.598 flat angles P-C4'-P energy: -11.387 tors. eta vs tors. theta energy: -3.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -122.487242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -122.487242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -122.487242 (E_RNA) where: Base-Base interactions energy: -72.895 where: short stacking energy: -32.392 Base-Backbone interact. energy: -0.160 local terms energy: -49.432511 where: bonds (distance) C4'-P energy: -12.245 bonds (distance) P-C4' energy: -13.020 flat angles C4'-P-C4' energy: -14.264 flat angles P-C4'-P energy: -2.471 tors. eta vs tors. theta energy: -7.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -78.535899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.535899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.535899 (E_RNA) where: Base-Base interactions energy: -31.883 where: short stacking energy: -27.553 Base-Backbone interact. energy: 0.964 local terms energy: -47.617704 where: bonds (distance) C4'-P energy: -12.932 bonds (distance) P-C4' energy: -11.766 flat angles C4'-P-C4' energy: -12.727 flat angles P-C4'-P energy: -4.155 tors. eta vs tors. theta energy: -6.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -104.356393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -104.356393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -104.356393 (E_RNA) where: Base-Base interactions energy: -59.026 where: short stacking energy: -26.755 Base-Backbone interact. energy: -0.141 local terms energy: -45.189567 where: bonds (distance) C4'-P energy: -10.886 bonds (distance) P-C4' energy: -12.949 flat angles C4'-P-C4' energy: -11.553 flat angles P-C4'-P energy: -9.529 tors. eta vs tors. theta energy: -0.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -70.360374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.360374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.360374 (E_RNA) where: Base-Base interactions energy: -23.644 where: short stacking energy: -22.609 Base-Backbone interact. energy: -0.194 local terms energy: -46.522091 where: bonds (distance) C4'-P energy: -14.076 bonds (distance) P-C4' energy: -11.684 flat angles C4'-P-C4' energy: -12.868 flat angles P-C4'-P energy: -4.752 tors. eta vs tors. theta energy: -3.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -187.969217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.969217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.969217 (E_RNA) where: Base-Base interactions energy: -120.933 where: short stacking energy: -56.085 Base-Backbone interact. energy: 1.255 local terms energy: -68.290859 where: bonds (distance) C4'-P energy: -11.792 bonds (distance) P-C4' energy: -15.980 flat angles C4'-P-C4' energy: -13.606 flat angles P-C4'-P energy: -9.751 tors. eta vs tors. theta energy: -17.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -172.265322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.265322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.265322 (E_RNA) where: Base-Base interactions energy: -112.296 where: short stacking energy: -43.582 Base-Backbone interact. energy: -0.253 local terms energy: -59.715756 where: bonds (distance) C4'-P energy: -13.557 bonds (distance) P-C4' energy: -14.560 flat angles C4'-P-C4' energy: -15.163 flat angles P-C4'-P energy: -5.956 tors. eta vs tors. theta energy: -10.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -162.985563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.985563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.985563 (E_RNA) where: Base-Base interactions energy: -102.282 where: short stacking energy: -56.813 Base-Backbone interact. energy: -0.830 local terms energy: -59.873487 where: bonds (distance) C4'-P energy: -13.504 bonds (distance) P-C4' energy: -11.992 flat angles C4'-P-C4' energy: -14.981 flat angles P-C4'-P energy: -3.294 tors. eta vs tors. theta energy: -16.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -132.301271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.301271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.301271 (E_RNA) where: Base-Base interactions energy: -70.039 where: short stacking energy: -35.384 Base-Backbone interact. energy: -0.218 local terms energy: -62.043586 where: bonds (distance) C4'-P energy: -13.010 bonds (distance) P-C4' energy: -16.995 flat angles C4'-P-C4' energy: -13.346 flat angles P-C4'-P energy: -10.287 tors. eta vs tors. theta energy: -8.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -150.187756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.187756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.187756 (E_RNA) where: Base-Base interactions energy: -95.181 where: short stacking energy: -44.387 Base-Backbone interact. energy: 0.202 local terms energy: -55.209024 where: bonds (distance) C4'-P energy: -13.516 bonds (distance) P-C4' energy: -15.691 flat angles C4'-P-C4' energy: -8.338 flat angles P-C4'-P energy: -6.573 tors. eta vs tors. theta energy: -11.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -128.228818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.228818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.228818 (E_RNA) where: Base-Base interactions energy: -70.475 where: short stacking energy: -34.209 Base-Backbone interact. energy: -0.005 local terms energy: -57.749082 where: bonds (distance) C4'-P energy: -14.609 bonds (distance) P-C4' energy: -14.674 flat angles C4'-P-C4' energy: -13.728 flat angles P-C4'-P energy: -4.309 tors. eta vs tors. theta energy: -10.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -97.123372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -97.123372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -97.123372 (E_RNA) where: Base-Base interactions energy: -48.154 where: short stacking energy: -19.609 Base-Backbone interact. energy: -0.162 local terms energy: -48.807759 where: bonds (distance) C4'-P energy: -13.640 bonds (distance) P-C4' energy: -15.100 flat angles C4'-P-C4' energy: -14.330 flat angles P-C4'-P energy: -9.202 tors. eta vs tors. theta energy: 3.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -81.671823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.671823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.671823 (E_RNA) where: Base-Base interactions energy: -34.416 where: short stacking energy: -13.612 Base-Backbone interact. energy: -0.237 local terms energy: -47.018698 where: bonds (distance) C4'-P energy: -10.925 bonds (distance) P-C4' energy: -9.816 flat angles C4'-P-C4' energy: -16.580 flat angles P-C4'-P energy: -9.859 tors. eta vs tors. theta energy: 0.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -70.664132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.664132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.664132 (E_RNA) where: Base-Base interactions energy: -23.607 where: short stacking energy: -22.926 Base-Backbone interact. energy: -0.023 local terms energy: -47.034323 where: bonds (distance) C4'-P energy: -15.379 bonds (distance) P-C4' energy: -14.892 flat angles C4'-P-C4' energy: -11.757 flat angles P-C4'-P energy: -2.854 tors. eta vs tors. theta energy: -2.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -65.264266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.264266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.264266 (E_RNA) where: Base-Base interactions energy: -20.001 where: short stacking energy: -14.156 Base-Backbone interact. energy: -0.167 local terms energy: -45.095999 where: bonds (distance) C4'-P energy: -13.628 bonds (distance) P-C4' energy: -13.877 flat angles C4'-P-C4' energy: -8.018 flat angles P-C4'-P energy: -10.093 tors. eta vs tors. theta energy: 0.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -186.605200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.605200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.605200 (E_RNA) where: Base-Base interactions energy: -123.357 where: short stacking energy: -49.650 Base-Backbone interact. energy: -0.206 local terms energy: -63.042040 where: bonds (distance) C4'-P energy: -15.076 bonds (distance) P-C4' energy: -13.891 flat angles C4'-P-C4' energy: -11.584 flat angles P-C4'-P energy: -11.013 tors. eta vs tors. theta energy: -11.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -179.081946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.081946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.081946 (E_RNA) where: Base-Base interactions energy: -109.861 where: short stacking energy: -57.185 Base-Backbone interact. energy: 0.921 local terms energy: -70.141118 where: bonds (distance) C4'-P energy: -14.792 bonds (distance) P-C4' energy: -15.836 flat angles C4'-P-C4' energy: -14.111 flat angles P-C4'-P energy: -10.252 tors. eta vs tors. theta energy: -15.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -168.350162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.350162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.350162 (E_RNA) where: Base-Base interactions energy: -103.881 where: short stacking energy: -52.778 Base-Backbone interact. energy: -0.655 local terms energy: -63.813985 where: bonds (distance) C4'-P energy: -11.729 bonds (distance) P-C4' energy: -13.088 flat angles C4'-P-C4' energy: -15.482 flat angles P-C4'-P energy: -10.107 tors. eta vs tors. theta energy: -13.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -151.084587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.084587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.084587 (E_RNA) where: Base-Base interactions energy: -94.696 where: short stacking energy: -45.568 Base-Backbone interact. energy: -0.364 local terms energy: -56.024452 where: bonds (distance) C4'-P energy: -11.815 bonds (distance) P-C4' energy: -13.961 flat angles C4'-P-C4' energy: -11.531 flat angles P-C4'-P energy: -7.709 tors. eta vs tors. theta energy: -11.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -135.098287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.098287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.098287 (E_RNA) where: Base-Base interactions energy: -84.420 where: short stacking energy: -38.731 Base-Backbone interact. energy: -0.417 local terms energy: -50.261248 where: bonds (distance) C4'-P energy: -10.710 bonds (distance) P-C4' energy: -15.076 flat angles C4'-P-C4' energy: -11.221 flat angles P-C4'-P energy: -7.339 tors. eta vs tors. theta energy: -5.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -155.054937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.054937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.054937 (E_RNA) where: Base-Base interactions energy: -98.508 where: short stacking energy: -39.524 Base-Backbone interact. energy: -0.075 local terms energy: -56.471711 where: bonds (distance) C4'-P energy: -14.659 bonds (distance) P-C4' energy: -12.012 flat angles C4'-P-C4' energy: -11.925 flat angles P-C4'-P energy: -7.435 tors. eta vs tors. theta energy: -10.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -119.428478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.428478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.428478 (E_RNA) where: Base-Base interactions energy: -67.126 where: short stacking energy: -29.522 Base-Backbone interact. energy: -0.309 local terms energy: -51.993316 where: bonds (distance) C4'-P energy: -12.138 bonds (distance) P-C4' energy: -16.016 flat angles C4'-P-C4' energy: -14.808 flat angles P-C4'-P energy: -7.642 tors. eta vs tors. theta energy: -1.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -87.980226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.980226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.980226 (E_RNA) where: Base-Base interactions energy: -41.218 where: short stacking energy: -23.722 Base-Backbone interact. energy: 0.707 local terms energy: -47.470040 where: bonds (distance) C4'-P energy: -14.771 bonds (distance) P-C4' energy: -14.393 flat angles C4'-P-C4' energy: -10.025 flat angles P-C4'-P energy: -9.824 tors. eta vs tors. theta energy: 1.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -86.151104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.151104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.151104 (E_RNA) where: Base-Base interactions energy: -28.776 where: short stacking energy: -25.876 Base-Backbone interact. energy: -0.052 local terms energy: -57.322827 where: bonds (distance) C4'-P energy: -12.946 bonds (distance) P-C4' energy: -14.417 flat angles C4'-P-C4' energy: -15.898 flat angles P-C4'-P energy: -9.782 tors. eta vs tors. theta energy: -4.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -65.338940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.338940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.338940 (E_RNA) where: Base-Base interactions energy: -23.659 where: short stacking energy: -22.246 Base-Backbone interact. energy: -0.096 local terms energy: -41.583622 where: bonds (distance) C4'-P energy: -8.871 bonds (distance) P-C4' energy: -11.575 flat angles C4'-P-C4' energy: -10.067 flat angles P-C4'-P energy: -6.001 tors. eta vs tors. theta energy: -5.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -189.893693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.893693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.893693 (E_RNA) where: Base-Base interactions energy: -124.502 where: short stacking energy: -54.425 Base-Backbone interact. energy: -0.440 local terms energy: -64.950774 where: bonds (distance) C4'-P energy: -12.710 bonds (distance) P-C4' energy: -14.839 flat angles C4'-P-C4' energy: -14.872 flat angles P-C4'-P energy: -9.542 tors. eta vs tors. theta energy: -12.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -169.405097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -169.405097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -169.405097 (E_RNA) where: Base-Base interactions energy: -94.683 where: short stacking energy: -47.734 Base-Backbone interact. energy: -0.069 local terms energy: -74.652738 where: bonds (distance) C4'-P energy: -16.878 bonds (distance) P-C4' energy: -16.054 flat angles C4'-P-C4' energy: -15.346 flat angles P-C4'-P energy: -9.917 tors. eta vs tors. theta energy: -16.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -180.895076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.895076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.895076 (E_RNA) where: Base-Base interactions energy: -116.562 where: short stacking energy: -54.908 Base-Backbone interact. energy: -0.125 local terms energy: -64.207597 where: bonds (distance) C4'-P energy: -10.200 bonds (distance) P-C4' energy: -15.117 flat angles C4'-P-C4' energy: -15.868 flat angles P-C4'-P energy: -7.592 tors. eta vs tors. theta energy: -15.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -141.314109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.314109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.314109 (E_RNA) where: Base-Base interactions energy: -81.524 where: short stacking energy: -39.520 Base-Backbone interact. energy: -0.162 local terms energy: -59.628877 where: bonds (distance) C4'-P energy: -14.028 bonds (distance) P-C4' energy: -15.110 flat angles C4'-P-C4' energy: -13.163 flat angles P-C4'-P energy: -5.887 tors. eta vs tors. theta energy: -11.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -147.148613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.148613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.148613 (E_RNA) where: Base-Base interactions energy: -88.450 where: short stacking energy: -42.175 Base-Backbone interact. energy: -0.112 local terms energy: -58.586887 where: bonds (distance) C4'-P energy: -13.206 bonds (distance) P-C4' energy: -16.968 flat angles C4'-P-C4' energy: -13.609 flat angles P-C4'-P energy: -7.400 tors. eta vs tors. theta energy: -7.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -132.946667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.946667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.946667 (E_RNA) where: Base-Base interactions energy: -74.727 where: short stacking energy: -30.104 Base-Backbone interact. energy: -0.050 local terms energy: -58.169400 where: bonds (distance) C4'-P energy: -12.941 bonds (distance) P-C4' energy: -13.605 flat angles C4'-P-C4' energy: -12.918 flat angles P-C4'-P energy: -7.803 tors. eta vs tors. theta energy: -10.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -119.266110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -119.266110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -119.266110 (E_RNA) where: Base-Base interactions energy: -62.483 where: short stacking energy: -30.005 Base-Backbone interact. energy: -0.792 local terms energy: -55.991263 where: bonds (distance) C4'-P energy: -10.486 bonds (distance) P-C4' energy: -16.830 flat angles C4'-P-C4' energy: -11.428 flat angles P-C4'-P energy: -11.288 tors. eta vs tors. theta energy: -5.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -78.650803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.650803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.650803 (E_RNA) where: Base-Base interactions energy: -32.357 where: short stacking energy: -26.105 Base-Backbone interact. energy: -0.067 local terms energy: -46.227203 where: bonds (distance) C4'-P energy: -12.461 bonds (distance) P-C4' energy: -10.651 flat angles C4'-P-C4' energy: -8.056 flat angles P-C4'-P energy: -10.510 tors. eta vs tors. theta energy: -4.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -71.856411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.856411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.856411 (E_RNA) where: Base-Base interactions energy: -26.704 where: short stacking energy: -26.704 Base-Backbone interact. energy: -0.100 local terms energy: -45.052080 where: bonds (distance) C4'-P energy: -12.472 bonds (distance) P-C4' energy: -14.627 flat angles C4'-P-C4' energy: -9.878 flat angles P-C4'-P energy: -7.565 tors. eta vs tors. theta energy: -0.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -65.278428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.278428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.278428 (E_RNA) where: Base-Base interactions energy: -16.498 where: short stacking energy: -16.498 Base-Backbone interact. energy: -0.294 local terms energy: -48.487316 where: bonds (distance) C4'-P energy: -13.126 bonds (distance) P-C4' energy: -14.606 flat angles C4'-P-C4' energy: -13.615 flat angles P-C4'-P energy: -7.634 tors. eta vs tors. theta energy: 0.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -182.998110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.998110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.998110 (E_RNA) where: Base-Base interactions energy: -112.857 where: short stacking energy: -54.702 Base-Backbone interact. energy: -0.830 local terms energy: -69.310668 where: bonds (distance) C4'-P energy: -13.354 bonds (distance) P-C4' energy: -11.165 flat angles C4'-P-C4' energy: -16.481 flat angles P-C4'-P energy: -11.770 tors. eta vs tors. theta energy: -16.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -178.230145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.230145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.230145 (E_RNA) where: Base-Base interactions energy: -116.844 where: short stacking energy: -51.745 Base-Backbone interact. energy: -0.577 local terms energy: -60.809096 where: bonds (distance) C4'-P energy: -13.901 bonds (distance) P-C4' energy: -14.085 flat angles C4'-P-C4' energy: -14.556 flat angles P-C4'-P energy: -7.387 tors. eta vs tors. theta energy: -10.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -191.676820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.676820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.676820 (E_RNA) where: Base-Base interactions energy: -116.835 where: short stacking energy: -68.504 Base-Backbone interact. energy: -0.035 local terms energy: -74.807103 where: bonds (distance) C4'-P energy: -15.657 bonds (distance) P-C4' energy: -13.895 flat angles C4'-P-C4' energy: -15.824 flat angles P-C4'-P energy: -11.967 tors. eta vs tors. theta energy: -17.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -139.810266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -139.810266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -139.810266 (E_RNA) where: Base-Base interactions energy: -81.170 where: short stacking energy: -43.018 Base-Backbone interact. energy: 0.402 local terms energy: -59.042828 where: bonds (distance) C4'-P energy: -14.438 bonds (distance) P-C4' energy: -13.918 flat angles C4'-P-C4' energy: -11.800 flat angles P-C4'-P energy: -7.561 tors. eta vs tors. theta energy: -11.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -132.695923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.695923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.695923 (E_RNA) where: Base-Base interactions energy: -85.782 where: short stacking energy: -44.723 Base-Backbone interact. energy: -0.082 local terms energy: -46.832345 where: bonds (distance) C4'-P energy: -11.322 bonds (distance) P-C4' energy: -10.966 flat angles C4'-P-C4' energy: -10.125 flat angles P-C4'-P energy: -3.892 tors. eta vs tors. theta energy: -10.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -144.275436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.275436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.275436 (E_RNA) where: Base-Base interactions energy: -81.770 where: short stacking energy: -33.942 Base-Backbone interact. energy: -0.142 local terms energy: -62.363705 where: bonds (distance) C4'-P energy: -14.420 bonds (distance) P-C4' energy: -18.039 flat angles C4'-P-C4' energy: -15.725 flat angles P-C4'-P energy: -3.684 tors. eta vs tors. theta energy: -10.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -90.898587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.898587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.898587 (E_RNA) where: Base-Base interactions energy: -39.237 where: short stacking energy: -39.237 Base-Backbone interact. energy: -0.011 local terms energy: -51.650315 where: bonds (distance) C4'-P energy: -13.896 bonds (distance) P-C4' energy: -10.142 flat angles C4'-P-C4' energy: -9.824 flat angles P-C4'-P energy: -10.366 tors. eta vs tors. theta energy: -7.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -79.911003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.911003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.911003 (E_RNA) where: Base-Base interactions energy: -29.494 where: short stacking energy: -22.590 Base-Backbone interact. energy: -0.288 local terms energy: -50.129400 where: bonds (distance) C4'-P energy: -15.185 bonds (distance) P-C4' energy: -13.813 flat angles C4'-P-C4' energy: -14.382 flat angles P-C4'-P energy: -5.139 tors. eta vs tors. theta energy: -1.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -66.595663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.595663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.595663 (E_RNA) where: Base-Base interactions energy: -21.297 where: short stacking energy: -21.125 Base-Backbone interact. energy: 1.999 local terms energy: -47.297675 where: bonds (distance) C4'-P energy: -14.369 bonds (distance) P-C4' energy: -13.408 flat angles C4'-P-C4' energy: -8.331 flat angles P-C4'-P energy: -10.223 tors. eta vs tors. theta energy: -0.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -65.573851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.573851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.573851 (E_RNA) where: Base-Base interactions energy: -27.283 where: short stacking energy: -17.690 Base-Backbone interact. energy: -0.538 local terms energy: -37.752521 where: bonds (distance) C4'-P energy: -10.541 bonds (distance) P-C4' energy: -12.809 flat angles C4'-P-C4' energy: -11.408 flat angles P-C4'-P energy: -4.782 tors. eta vs tors. theta energy: 1.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -180.020681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.020681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.020681 (E_RNA) where: Base-Base interactions energy: -110.966 where: short stacking energy: -55.486 Base-Backbone interact. energy: 0.554 local terms energy: -69.608519 where: bonds (distance) C4'-P energy: -13.790 bonds (distance) P-C4' energy: -13.908 flat angles C4'-P-C4' energy: -15.736 flat angles P-C4'-P energy: -10.167 tors. eta vs tors. theta energy: -16.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -184.530994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.530994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.530994 (E_RNA) where: Base-Base interactions energy: -109.237 where: short stacking energy: -53.841 Base-Backbone interact. energy: -0.061 local terms energy: -75.232451 where: bonds (distance) C4'-P energy: -16.019 bonds (distance) P-C4' energy: -16.766 flat angles C4'-P-C4' energy: -16.187 flat angles P-C4'-P energy: -10.769 tors. eta vs tors. theta energy: -15.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -165.737043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.737043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.737043 (E_RNA) where: Base-Base interactions energy: -105.103 where: short stacking energy: -42.260 Base-Backbone interact. energy: -0.374 local terms energy: -60.259670 where: bonds (distance) C4'-P energy: -15.259 bonds (distance) P-C4' energy: -15.330 flat angles C4'-P-C4' energy: -16.351 flat angles P-C4'-P energy: -6.411 tors. eta vs tors. theta energy: -6.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -140.109977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.109977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.109977 (E_RNA) where: Base-Base interactions energy: -79.048 where: short stacking energy: -34.005 Base-Backbone interact. energy: -0.426 local terms energy: -60.635837 where: bonds (distance) C4'-P energy: -15.174 bonds (distance) P-C4' energy: -14.849 flat angles C4'-P-C4' energy: -11.926 flat angles P-C4'-P energy: -10.578 tors. eta vs tors. theta energy: -8.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -123.281371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.281371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.281371 (E_RNA) where: Base-Base interactions energy: -70.147 where: short stacking energy: -39.094 Base-Backbone interact. energy: -1.245 local terms energy: -51.889942 where: bonds (distance) C4'-P energy: -14.626 bonds (distance) P-C4' energy: -11.989 flat angles C4'-P-C4' energy: -14.850 flat angles P-C4'-P energy: -4.024 tors. eta vs tors. theta energy: -6.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -150.998269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.998269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.998269 (E_RNA) where: Base-Base interactions energy: -91.799 where: short stacking energy: -33.307 Base-Backbone interact. energy: -0.397 local terms energy: -58.801997 where: bonds (distance) C4'-P energy: -13.607 bonds (distance) P-C4' energy: -14.779 flat angles C4'-P-C4' energy: -14.460 flat angles P-C4'-P energy: -10.624 tors. eta vs tors. theta energy: -5.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -91.871569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.871569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.871569 (E_RNA) where: Base-Base interactions energy: -35.471 where: short stacking energy: -35.471 Base-Backbone interact. energy: -1.028 local terms energy: -55.372134 where: bonds (distance) C4'-P energy: -11.872 bonds (distance) P-C4' energy: -13.254 flat angles C4'-P-C4' energy: -14.382 flat angles P-C4'-P energy: -9.894 tors. eta vs tors. theta energy: -5.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -78.321028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.321028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.321028 (E_RNA) where: Base-Base interactions energy: -35.388 where: short stacking energy: -17.185 Base-Backbone interact. energy: -0.196 local terms energy: -42.737569 where: bonds (distance) C4'-P energy: -7.373 bonds (distance) P-C4' energy: -10.214 flat angles C4'-P-C4' energy: -14.047 flat angles P-C4'-P energy: -8.698 tors. eta vs tors. theta energy: -2.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -73.508084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.508084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.508084 (E_RNA) where: Base-Base interactions energy: -22.923 where: short stacking energy: -22.923 Base-Backbone interact. energy: -0.268 local terms energy: -50.317165 where: bonds (distance) C4'-P energy: -13.318 bonds (distance) P-C4' energy: -16.030 flat angles C4'-P-C4' energy: -12.853 flat angles P-C4'-P energy: -6.419 tors. eta vs tors. theta energy: -1.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -67.744973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.744973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.744973 (E_RNA) where: Base-Base interactions energy: -24.402 where: short stacking energy: -19.301 Base-Backbone interact. energy: -0.357 local terms energy: -42.986684 where: bonds (distance) C4'-P energy: -10.594 bonds (distance) P-C4' energy: -15.755 flat angles C4'-P-C4' energy: -7.842 flat angles P-C4'-P energy: -7.187 tors. eta vs tors. theta energy: -1.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -193.882565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.882565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.882565 (E_RNA) where: Base-Base interactions energy: -119.301 where: short stacking energy: -60.135 Base-Backbone interact. energy: -0.639 local terms energy: -73.942672 where: bonds (distance) C4'-P energy: -12.396 bonds (distance) P-C4' energy: -16.407 flat angles C4'-P-C4' energy: -15.755 flat angles P-C4'-P energy: -10.181 tors. eta vs tors. theta energy: -19.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -184.179095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.179095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.179095 (E_RNA) where: Base-Base interactions energy: -125.715 where: short stacking energy: -43.404 Base-Backbone interact. energy: -0.160 local terms energy: -58.304196 where: bonds (distance) C4'-P energy: -13.061 bonds (distance) P-C4' energy: -15.730 flat angles C4'-P-C4' energy: -11.310 flat angles P-C4'-P energy: -10.081 tors. eta vs tors. theta energy: -8.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -146.781175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.781175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.781175 (E_RNA) where: Base-Base interactions energy: -88.456 where: short stacking energy: -45.125 Base-Backbone interact. energy: -0.138 local terms energy: -58.187458 where: bonds (distance) C4'-P energy: -11.832 bonds (distance) P-C4' energy: -15.153 flat angles C4'-P-C4' energy: -10.429 flat angles P-C4'-P energy: -7.174 tors. eta vs tors. theta energy: -13.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -162.578208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.578208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.578208 (E_RNA) where: Base-Base interactions energy: -99.544 where: short stacking energy: -55.158 Base-Backbone interact. energy: -0.254 local terms energy: -62.780467 where: bonds (distance) C4'-P energy: -13.416 bonds (distance) P-C4' energy: -15.416 flat angles C4'-P-C4' energy: -14.620 flat angles P-C4'-P energy: -5.176 tors. eta vs tors. theta energy: -14.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -161.014298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.014298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.014298 (E_RNA) where: Base-Base interactions energy: -109.912 where: short stacking energy: -38.316 Base-Backbone interact. energy: -0.378 local terms energy: -50.723826 where: bonds (distance) C4'-P energy: -13.140 bonds (distance) P-C4' energy: -12.226 flat angles C4'-P-C4' energy: -9.945 flat angles P-C4'-P energy: -10.161 tors. eta vs tors. theta energy: -5.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -133.650483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.650483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.650483 (E_RNA) where: Base-Base interactions energy: -77.988 where: short stacking energy: -38.470 Base-Backbone interact. energy: -0.058 local terms energy: -55.604433 where: bonds (distance) C4'-P energy: -9.261 bonds (distance) P-C4' energy: -14.420 flat angles C4'-P-C4' energy: -16.135 flat angles P-C4'-P energy: -6.367 tors. eta vs tors. theta energy: -9.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -78.002198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.002198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.002198 (E_RNA) where: Base-Base interactions energy: -25.685 where: short stacking energy: -25.685 Base-Backbone interact. energy: 0.785 local terms energy: -53.102714 where: bonds (distance) C4'-P energy: -15.531 bonds (distance) P-C4' energy: -15.340 flat angles C4'-P-C4' energy: -12.414 flat angles P-C4'-P energy: -5.629 tors. eta vs tors. theta energy: -4.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -78.975162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.975162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.975162 (E_RNA) where: Base-Base interactions energy: -26.838 where: short stacking energy: -26.838 Base-Backbone interact. energy: -0.193 local terms energy: -51.943485 where: bonds (distance) C4'-P energy: -12.350 bonds (distance) P-C4' energy: -14.576 flat angles C4'-P-C4' energy: -10.226 flat angles P-C4'-P energy: -7.960 tors. eta vs tors. theta energy: -6.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -70.280945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.280945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.280945 (E_RNA) where: Base-Base interactions energy: -28.143 where: short stacking energy: -22.225 Base-Backbone interact. energy: -0.084 local terms energy: -42.053595 where: bonds (distance) C4'-P energy: -7.994 bonds (distance) P-C4' energy: -10.410 flat angles C4'-P-C4' energy: -14.407 flat angles P-C4'-P energy: -9.253 tors. eta vs tors. theta energy: 0.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -70.019791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.019791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.019791 (E_RNA) where: Base-Base interactions energy: -19.062 where: short stacking energy: -19.062 Base-Backbone interact. energy: -0.659 local terms energy: -50.299008 where: bonds (distance) C4'-P energy: -13.399 bonds (distance) P-C4' energy: -10.861 flat angles C4'-P-C4' energy: -14.802 flat angles P-C4'-P energy: -8.627 tors. eta vs tors. theta energy: -2.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -181.784928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.784928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.784928 (E_RNA) where: Base-Base interactions energy: -115.289 where: short stacking energy: -59.366 Base-Backbone interact. energy: 0.196 local terms energy: -66.692343 where: bonds (distance) C4'-P energy: -13.388 bonds (distance) P-C4' energy: -13.669 flat angles C4'-P-C4' energy: -14.111 flat angles P-C4'-P energy: -11.986 tors. eta vs tors. theta energy: -13.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -189.452305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.452305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.452305 (E_RNA) where: Base-Base interactions energy: -129.921 where: short stacking energy: -54.395 Base-Backbone interact. energy: -0.174 local terms energy: -59.357057 where: bonds (distance) C4'-P energy: -14.223 bonds (distance) P-C4' energy: -11.504 flat angles C4'-P-C4' energy: -10.332 flat angles P-C4'-P energy: -8.527 tors. eta vs tors. theta energy: -14.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -154.881906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.881906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.881906 (E_RNA) where: Base-Base interactions energy: -89.890 where: short stacking energy: -46.954 Base-Backbone interact. energy: -0.192 local terms energy: -64.799662 where: bonds (distance) C4'-P energy: -12.386 bonds (distance) P-C4' energy: -12.856 flat angles C4'-P-C4' energy: -16.517 flat angles P-C4'-P energy: -7.156 tors. eta vs tors. theta energy: -15.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -152.410583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.410583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.410583 (E_RNA) where: Base-Base interactions energy: -87.828 where: short stacking energy: -37.841 Base-Backbone interact. energy: -1.175 local terms energy: -63.407575 where: bonds (distance) C4'-P energy: -14.994 bonds (distance) P-C4' energy: -14.321 flat angles C4'-P-C4' energy: -15.634 flat angles P-C4'-P energy: -11.116 tors. eta vs tors. theta energy: -7.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -123.192880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.192880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.192880 (E_RNA) where: Base-Base interactions energy: -69.960 where: short stacking energy: -32.248 Base-Backbone interact. energy: -0.192 local terms energy: -53.040371 where: bonds (distance) C4'-P energy: -16.071 bonds (distance) P-C4' energy: -13.462 flat angles C4'-P-C4' energy: -11.093 flat angles P-C4'-P energy: -6.955 tors. eta vs tors. theta energy: -5.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -131.737158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.737158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.737158 (E_RNA) where: Base-Base interactions energy: -77.034 where: short stacking energy: -44.425 Base-Backbone interact. energy: 0.157 local terms energy: -54.859555 where: bonds (distance) C4'-P energy: -11.359 bonds (distance) P-C4' energy: -12.695 flat angles C4'-P-C4' energy: -14.220 flat angles P-C4'-P energy: -8.110 tors. eta vs tors. theta energy: -8.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -72.293086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.293086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.293086 (E_RNA) where: Base-Base interactions energy: -27.953 where: short stacking energy: -18.242 Base-Backbone interact. energy: -0.161 local terms energy: -44.179286 where: bonds (distance) C4'-P energy: -10.328 bonds (distance) P-C4' energy: -10.853 flat angles C4'-P-C4' energy: -9.527 flat angles P-C4'-P energy: -10.208 tors. eta vs tors. theta energy: -3.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -79.004934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.004934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.004934 (E_RNA) where: Base-Base interactions energy: -35.377 where: short stacking energy: -34.362 Base-Backbone interact. energy: -0.289 local terms energy: -43.338224 where: bonds (distance) C4'-P energy: -13.124 bonds (distance) P-C4' energy: -11.706 flat angles C4'-P-C4' energy: -10.338 flat angles P-C4'-P energy: -3.603 tors. eta vs tors. theta energy: -4.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -81.897103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.897103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.897103 (E_RNA) where: Base-Base interactions energy: -33.089 where: short stacking energy: -20.658 Base-Backbone interact. energy: 1.533 local terms energy: -50.340697 where: bonds (distance) C4'-P energy: -13.712 bonds (distance) P-C4' energy: -16.217 flat angles C4'-P-C4' energy: -13.065 flat angles P-C4'-P energy: -9.163 tors. eta vs tors. theta energy: 1.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -65.192805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -65.192805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -65.192805 (E_RNA) where: Base-Base interactions energy: -17.187 where: short stacking energy: -10.690 Base-Backbone interact. energy: -0.015 local terms energy: -47.991026 where: bonds (distance) C4'-P energy: -12.359 bonds (distance) P-C4' energy: -13.925 flat angles C4'-P-C4' energy: -14.249 flat angles P-C4'-P energy: -0.636 tors. eta vs tors. theta energy: -6.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -192.658085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.658085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.658085 (E_RNA) where: Base-Base interactions energy: -120.380 where: short stacking energy: -61.284 Base-Backbone interact. energy: -0.271 local terms energy: -72.007638 where: bonds (distance) C4'-P energy: -12.999 bonds (distance) P-C4' energy: -14.695 flat angles C4'-P-C4' energy: -13.191 flat angles P-C4'-P energy: -12.520 tors. eta vs tors. theta energy: -18.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -179.160700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.160700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.160700 (E_RNA) where: Base-Base interactions energy: -108.540 where: short stacking energy: -56.308 Base-Backbone interact. energy: -0.355 local terms energy: -70.265145 where: bonds (distance) C4'-P energy: -12.448 bonds (distance) P-C4' energy: -17.743 flat angles C4'-P-C4' energy: -13.154 flat angles P-C4'-P energy: -10.463 tors. eta vs tors. theta energy: -16.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -152.148846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.148846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.148846 (E_RNA) where: Base-Base interactions energy: -93.531 where: short stacking energy: -35.818 Base-Backbone interact. energy: 1.110 local terms energy: -59.727643 where: bonds (distance) C4'-P energy: -16.406 bonds (distance) P-C4' energy: -11.773 flat angles C4'-P-C4' energy: -15.789 flat angles P-C4'-P energy: -9.323 tors. eta vs tors. theta energy: -6.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -163.096617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.096617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.096617 (E_RNA) where: Base-Base interactions energy: -89.627 where: short stacking energy: -52.569 Base-Backbone interact. energy: -0.074 local terms energy: -73.395503 where: bonds (distance) C4'-P energy: -15.743 bonds (distance) P-C4' energy: -16.883 flat angles C4'-P-C4' energy: -17.510 flat angles P-C4'-P energy: -5.707 tors. eta vs tors. theta energy: -17.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -117.630375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.630375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.630375 (E_RNA) where: Base-Base interactions energy: -59.966 where: short stacking energy: -34.740 Base-Backbone interact. energy: -0.165 local terms energy: -57.499024 where: bonds (distance) C4'-P energy: -10.663 bonds (distance) P-C4' energy: -16.582 flat angles C4'-P-C4' energy: -11.311 flat angles P-C4'-P energy: -7.369 tors. eta vs tors. theta energy: -11.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -125.913243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.913243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.913243 (E_RNA) where: Base-Base interactions energy: -71.808 where: short stacking energy: -32.144 Base-Backbone interact. energy: -0.086 local terms energy: -54.019069 where: bonds (distance) C4'-P energy: -14.915 bonds (distance) P-C4' energy: -13.405 flat angles C4'-P-C4' energy: -13.054 flat angles P-C4'-P energy: -6.932 tors. eta vs tors. theta energy: -5.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -89.172763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.172763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.172763 (E_RNA) where: Base-Base interactions energy: -38.959 where: short stacking energy: -27.634 Base-Backbone interact. energy: -0.003 local terms energy: -50.210791 where: bonds (distance) C4'-P energy: -14.133 bonds (distance) P-C4' energy: -16.446 flat angles C4'-P-C4' energy: -10.508 flat angles P-C4'-P energy: -5.265 tors. eta vs tors. theta energy: -3.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -78.601623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.601623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.601623 (E_RNA) where: Base-Base interactions energy: -28.810 where: short stacking energy: -22.535 Base-Backbone interact. energy: -0.054 local terms energy: -49.737383 where: bonds (distance) C4'-P energy: -12.398 bonds (distance) P-C4' energy: -13.124 flat angles C4'-P-C4' energy: -13.639 flat angles P-C4'-P energy: -8.502 tors. eta vs tors. theta energy: -2.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -73.574674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.574674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.574674 (E_RNA) where: Base-Base interactions energy: -24.152 where: short stacking energy: -20.845 Base-Backbone interact. energy: -0.262 local terms energy: -49.160065 where: bonds (distance) C4'-P energy: -12.779 bonds (distance) P-C4' energy: -15.208 flat angles C4'-P-C4' energy: -12.068 flat angles P-C4'-P energy: -7.774 tors. eta vs tors. theta energy: -1.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -67.538027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.538027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.538027 (E_RNA) where: Base-Base interactions energy: -27.451 where: short stacking energy: -23.350 Base-Backbone interact. energy: -0.287 local terms energy: -39.799443 where: bonds (distance) C4'-P energy: -16.194 bonds (distance) P-C4' energy: -13.492 flat angles C4'-P-C4' energy: -0.594 flat angles P-C4'-P energy: -8.634 tors. eta vs tors. theta energy: -0.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -195.624917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.624917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.624917 (E_RNA) where: Base-Base interactions energy: -120.920 where: short stacking energy: -61.463 Base-Backbone interact. energy: 2.292 local terms energy: -76.996549 where: bonds (distance) C4'-P energy: -13.135 bonds (distance) P-C4' energy: -15.346 flat angles C4'-P-C4' energy: -16.720 flat angles P-C4'-P energy: -14.160 tors. eta vs tors. theta energy: -17.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -167.730022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.730022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.730022 (E_RNA) where: Base-Base interactions energy: -98.412 where: short stacking energy: -49.308 Base-Backbone interact. energy: -0.104 local terms energy: -69.214552 where: bonds (distance) C4'-P energy: -13.719 bonds (distance) P-C4' energy: -16.950 flat angles C4'-P-C4' energy: -15.488 flat angles P-C4'-P energy: -9.744 tors. eta vs tors. theta energy: -13.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -148.795336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.795336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.795336 (E_RNA) where: Base-Base interactions energy: -97.036 where: short stacking energy: -48.590 Base-Backbone interact. energy: -0.617 local terms energy: -51.141973 where: bonds (distance) C4'-P energy: -13.897 bonds (distance) P-C4' energy: -11.213 flat angles C4'-P-C4' energy: -15.929 flat angles P-C4'-P energy: -0.325 tors. eta vs tors. theta energy: -9.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -155.629916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.629916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.629916 (E_RNA) where: Base-Base interactions energy: -92.746 where: short stacking energy: -49.844 Base-Backbone interact. energy: -0.403 local terms energy: -62.481287 where: bonds (distance) C4'-P energy: -12.290 bonds (distance) P-C4' energy: -11.794 flat angles C4'-P-C4' energy: -12.011 flat angles P-C4'-P energy: -12.424 tors. eta vs tors. theta energy: -13.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -106.592358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.592358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.592358 (E_RNA) where: Base-Base interactions energy: -56.855 where: short stacking energy: -31.580 Base-Backbone interact. energy: -0.177 local terms energy: -49.559688 where: bonds (distance) C4'-P energy: -14.899 bonds (distance) P-C4' energy: -14.767 flat angles C4'-P-C4' energy: -13.467 flat angles P-C4'-P energy: -3.100 tors. eta vs tors. theta energy: -3.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -91.650019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.650019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.650019 (E_RNA) where: Base-Base interactions energy: -49.545 where: short stacking energy: -23.506 Base-Backbone interact. energy: -0.206 local terms energy: -41.898738 where: bonds (distance) C4'-P energy: -11.329 bonds (distance) P-C4' energy: -9.208 flat angles C4'-P-C4' energy: -8.573 flat angles P-C4'-P energy: -8.963 tors. eta vs tors. theta energy: -3.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -120.216263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -120.216263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -120.216263 (E_RNA) where: Base-Base interactions energy: -65.709 where: short stacking energy: -29.040 Base-Backbone interact. energy: -0.070 local terms energy: -54.437561 where: bonds (distance) C4'-P energy: -14.419 bonds (distance) P-C4' energy: -12.042 flat angles C4'-P-C4' energy: -11.785 flat angles P-C4'-P energy: -9.330 tors. eta vs tors. theta energy: -6.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -85.696941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.696941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.696941 (E_RNA) where: Base-Base interactions energy: -29.116 where: short stacking energy: -25.506 Base-Backbone interact. energy: -0.275 local terms energy: -56.306307 where: bonds (distance) C4'-P energy: -8.753 bonds (distance) P-C4' energy: -15.240 flat angles C4'-P-C4' energy: -16.185 flat angles P-C4'-P energy: -11.307 tors. eta vs tors. theta energy: -4.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -74.257859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.257859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.257859 (E_RNA) where: Base-Base interactions energy: -18.854 where: short stacking energy: -18.854 Base-Backbone interact. energy: -0.257 local terms energy: -55.146621 where: bonds (distance) C4'-P energy: -13.211 bonds (distance) P-C4' energy: -16.576 flat angles C4'-P-C4' energy: -13.872 flat angles P-C4'-P energy: -8.439 tors. eta vs tors. theta energy: -3.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -70.558619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.558619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.558619 (E_RNA) where: Base-Base interactions energy: -22.510 where: short stacking energy: -20.592 Base-Backbone interact. energy: -0.421 local terms energy: -47.628208 where: bonds (distance) C4'-P energy: -8.473 bonds (distance) P-C4' energy: -13.708 flat angles C4'-P-C4' energy: -9.564 flat angles P-C4'-P energy: -11.392 tors. eta vs tors. theta energy: -4.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -189.214645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.214645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.214645 (E_RNA) where: Base-Base interactions energy: -116.055 where: short stacking energy: -59.984 Base-Backbone interact. energy: -0.052 local terms energy: -73.107309 where: bonds (distance) C4'-P energy: -11.851 bonds (distance) P-C4' energy: -14.276 flat angles C4'-P-C4' energy: -16.130 flat angles P-C4'-P energy: -11.822 tors. eta vs tors. theta energy: -19.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -184.293205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.293205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.293205 (E_RNA) where: Base-Base interactions energy: -114.463 where: short stacking energy: -58.849 Base-Backbone interact. energy: -0.915 local terms energy: -68.914662 where: bonds (distance) C4'-P energy: -9.902 bonds (distance) P-C4' energy: -13.893 flat angles C4'-P-C4' energy: -15.076 flat angles P-C4'-P energy: -8.328 tors. eta vs tors. theta energy: -21.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -149.058673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.058673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.058673 (E_RNA) where: Base-Base interactions energy: -87.604 where: short stacking energy: -52.137 Base-Backbone interact. energy: -0.183 local terms energy: -61.270745 where: bonds (distance) C4'-P energy: -13.268 bonds (distance) P-C4' energy: -15.398 flat angles C4'-P-C4' energy: -13.301 flat angles P-C4'-P energy: -4.859 tors. eta vs tors. theta energy: -14.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -154.051118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.051118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.051118 (E_RNA) where: Base-Base interactions energy: -87.746 where: short stacking energy: -47.183 Base-Backbone interact. energy: -0.005 local terms energy: -66.300313 where: bonds (distance) C4'-P energy: -13.413 bonds (distance) P-C4' energy: -16.392 flat angles C4'-P-C4' energy: -14.723 flat angles P-C4'-P energy: -11.520 tors. eta vs tors. theta energy: -10.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -132.848298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.848298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.848298 (E_RNA) where: Base-Base interactions energy: -78.534 where: short stacking energy: -37.958 Base-Backbone interact. energy: 1.212 local terms energy: -55.526274 where: bonds (distance) C4'-P energy: -14.019 bonds (distance) P-C4' energy: -14.359 flat angles C4'-P-C4' energy: -8.860 flat angles P-C4'-P energy: -10.395 tors. eta vs tors. theta energy: -7.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -108.185271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -108.185271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -108.185271 (E_RNA) where: Base-Base interactions energy: -52.067 where: short stacking energy: -32.038 Base-Backbone interact. energy: -0.349 local terms energy: -55.768671 where: bonds (distance) C4'-P energy: -15.173 bonds (distance) P-C4' energy: -14.773 flat angles C4'-P-C4' energy: -12.920 flat angles P-C4'-P energy: -9.257 tors. eta vs tors. theta energy: -3.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -115.431600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.431600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.431600 (E_RNA) where: Base-Base interactions energy: -62.106 where: short stacking energy: -31.773 Base-Backbone interact. energy: -0.168 local terms energy: -53.157702 where: bonds (distance) C4'-P energy: -12.178 bonds (distance) P-C4' energy: -11.932 flat angles C4'-P-C4' energy: -13.160 flat angles P-C4'-P energy: -8.868 tors. eta vs tors. theta energy: -7.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -78.993139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.993139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.993139 (E_RNA) where: Base-Base interactions energy: -30.983 where: short stacking energy: -30.945 Base-Backbone interact. energy: -0.086 local terms energy: -47.924493 where: bonds (distance) C4'-P energy: -11.844 bonds (distance) P-C4' energy: -11.287 flat angles C4'-P-C4' energy: -14.573 flat angles P-C4'-P energy: -7.164 tors. eta vs tors. theta energy: -3.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -90.287761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.287761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.287761 (E_RNA) where: Base-Base interactions energy: -37.084 where: short stacking energy: -29.260 Base-Backbone interact. energy: -0.077 local terms energy: -53.126798 where: bonds (distance) C4'-P energy: -15.363 bonds (distance) P-C4' energy: -13.828 flat angles C4'-P-C4' energy: -11.245 flat angles P-C4'-P energy: -10.577 tors. eta vs tors. theta energy: -2.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -72.563501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.563501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.563501 (E_RNA) where: Base-Base interactions energy: -20.989 where: short stacking energy: -18.076 Base-Backbone interact. energy: -0.104 local terms energy: -51.470862 where: bonds (distance) C4'-P energy: -14.821 bonds (distance) P-C4' energy: -13.685 flat angles C4'-P-C4' energy: -9.179 flat angles P-C4'-P energy: -10.454 tors. eta vs tors. theta energy: -3.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -184.295474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.295474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.295474 (E_RNA) where: Base-Base interactions energy: -122.559 where: short stacking energy: -54.170 Base-Backbone interact. energy: -0.755 local terms energy: -60.981367 where: bonds (distance) C4'-P energy: -10.933 bonds (distance) P-C4' energy: -12.155 flat angles C4'-P-C4' energy: -14.028 flat angles P-C4'-P energy: -4.123 tors. eta vs tors. theta energy: -19.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -178.477838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -178.477838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -178.477838 (E_RNA) where: Base-Base interactions energy: -111.476 where: short stacking energy: -49.909 Base-Backbone interact. energy: -0.132 local terms energy: -66.869766 where: bonds (distance) C4'-P energy: -13.119 bonds (distance) P-C4' energy: -12.648 flat angles C4'-P-C4' energy: -14.018 flat angles P-C4'-P energy: -11.554 tors. eta vs tors. theta energy: -15.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -146.703333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.703333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.703333 (E_RNA) where: Base-Base interactions energy: -85.523 where: short stacking energy: -37.838 Base-Backbone interact. energy: 0.668 local terms energy: -61.847811 where: bonds (distance) C4'-P energy: -14.324 bonds (distance) P-C4' energy: -15.378 flat angles C4'-P-C4' energy: -14.512 flat angles P-C4'-P energy: -7.753 tors. eta vs tors. theta energy: -9.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -138.867272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.867272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.867272 (E_RNA) where: Base-Base interactions energy: -81.879 where: short stacking energy: -38.049 Base-Backbone interact. energy: -0.105 local terms energy: -56.883516 where: bonds (distance) C4'-P energy: -9.566 bonds (distance) P-C4' energy: -12.201 flat angles C4'-P-C4' energy: -13.169 flat angles P-C4'-P energy: -9.616 tors. eta vs tors. theta energy: -12.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -147.096153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.096153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.096153 (E_RNA) where: Base-Base interactions energy: -80.556 where: short stacking energy: -37.124 Base-Backbone interact. energy: -0.706 local terms energy: -65.834507 where: bonds (distance) C4'-P energy: -15.101 bonds (distance) P-C4' energy: -16.464 flat angles C4'-P-C4' energy: -15.121 flat angles P-C4'-P energy: -12.354 tors. eta vs tors. theta energy: -6.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -123.784204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.784204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.784204 (E_RNA) where: Base-Base interactions energy: -72.007 where: short stacking energy: -36.929 Base-Backbone interact. energy: -0.230 local terms energy: -51.547653 where: bonds (distance) C4'-P energy: -14.117 bonds (distance) P-C4' energy: -9.273 flat angles C4'-P-C4' energy: -14.195 flat angles P-C4'-P energy: -8.637 tors. eta vs tors. theta energy: -5.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -94.429416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.429416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.429416 (E_RNA) where: Base-Base interactions energy: -47.681 where: short stacking energy: -25.621 Base-Backbone interact. energy: 0.128 local terms energy: -46.876114 where: bonds (distance) C4'-P energy: -10.369 bonds (distance) P-C4' energy: -11.410 flat angles C4'-P-C4' energy: -10.304 flat angles P-C4'-P energy: -7.771 tors. eta vs tors. theta energy: -7.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -72.534698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.534698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.534698 (E_RNA) where: Base-Base interactions energy: -25.817 where: short stacking energy: -25.817 Base-Backbone interact. energy: -0.544 local terms energy: -46.173549 where: bonds (distance) C4'-P energy: -10.286 bonds (distance) P-C4' energy: -14.539 flat angles C4'-P-C4' energy: -11.557 flat angles P-C4'-P energy: -5.547 tors. eta vs tors. theta energy: -4.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -70.903838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.903838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.903838 (E_RNA) where: Base-Base interactions energy: -23.614 where: short stacking energy: -18.167 Base-Backbone interact. energy: -0.096 local terms energy: -47.194010 where: bonds (distance) C4'-P energy: -13.301 bonds (distance) P-C4' energy: -13.256 flat angles C4'-P-C4' energy: -14.688 flat angles P-C4'-P energy: -8.554 tors. eta vs tors. theta energy: 2.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -72.630386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.630386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.630386 (E_RNA) where: Base-Base interactions energy: -20.665 where: short stacking energy: -20.665 Base-Backbone interact. energy: -0.054 local terms energy: -51.911671 where: bonds (distance) C4'-P energy: -15.044 bonds (distance) P-C4' energy: -13.577 flat angles C4'-P-C4' energy: -9.444 flat angles P-C4'-P energy: -9.215 tors. eta vs tors. theta energy: -4.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -186.407530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.407530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.407530 (E_RNA) where: Base-Base interactions energy: -115.927 where: short stacking energy: -53.783 Base-Backbone interact. energy: -0.063 local terms energy: -70.417295 where: bonds (distance) C4'-P energy: -15.590 bonds (distance) P-C4' energy: -14.622 flat angles C4'-P-C4' energy: -15.138 flat angles P-C4'-P energy: -10.991 tors. eta vs tors. theta energy: -14.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -186.803304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.803304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.803304 (E_RNA) where: Base-Base interactions energy: -124.098 where: short stacking energy: -45.692 Base-Backbone interact. energy: -0.006 local terms energy: -62.698775 where: bonds (distance) C4'-P energy: -11.363 bonds (distance) P-C4' energy: -16.068 flat angles C4'-P-C4' energy: -9.703 flat angles P-C4'-P energy: -8.847 tors. eta vs tors. theta energy: -16.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -146.036124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.036124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.036124 (E_RNA) where: Base-Base interactions energy: -91.399 where: short stacking energy: -50.128 Base-Backbone interact. energy: -0.534 local terms energy: -54.103056 where: bonds (distance) C4'-P energy: -13.151 bonds (distance) P-C4' energy: -9.042 flat angles C4'-P-C4' energy: -13.888 flat angles P-C4'-P energy: -7.483 tors. eta vs tors. theta energy: -10.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -149.386801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.386801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.386801 (E_RNA) where: Base-Base interactions energy: -77.799 where: short stacking energy: -34.592 Base-Backbone interact. energy: -0.071 local terms energy: -71.516645 where: bonds (distance) C4'-P energy: -16.161 bonds (distance) P-C4' energy: -15.508 flat angles C4'-P-C4' energy: -17.483 flat angles P-C4'-P energy: -13.403 tors. eta vs tors. theta energy: -8.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -148.752242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.752242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.752242 (E_RNA) where: Base-Base interactions energy: -90.388 where: short stacking energy: -40.972 Base-Backbone interact. energy: -0.891 local terms energy: -57.472981 where: bonds (distance) C4'-P energy: -11.988 bonds (distance) P-C4' energy: -12.157 flat angles C4'-P-C4' energy: -15.133 flat angles P-C4'-P energy: -9.746 tors. eta vs tors. theta energy: -8.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -126.743172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.743172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.743172 (E_RNA) where: Base-Base interactions energy: -66.617 where: short stacking energy: -36.861 Base-Backbone interact. energy: -0.287 local terms energy: -59.839484 where: bonds (distance) C4'-P energy: -14.221 bonds (distance) P-C4' energy: -15.576 flat angles C4'-P-C4' energy: -15.013 flat angles P-C4'-P energy: -6.839 tors. eta vs tors. theta energy: -8.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -82.122711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.122711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.122711 (E_RNA) where: Base-Base interactions energy: -36.564 where: short stacking energy: -24.216 Base-Backbone interact. energy: -0.231 local terms energy: -45.328118 where: bonds (distance) C4'-P energy: -9.525 bonds (distance) P-C4' energy: -10.845 flat angles C4'-P-C4' energy: -15.448 flat angles P-C4'-P energy: -6.628 tors. eta vs tors. theta energy: -2.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -80.452634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.452634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.452634 (E_RNA) where: Base-Base interactions energy: -28.286 where: short stacking energy: -28.220 Base-Backbone interact. energy: -1.080 local terms energy: -51.086717 where: bonds (distance) C4'-P energy: -9.670 bonds (distance) P-C4' energy: -16.223 flat angles C4'-P-C4' energy: -14.030 flat angles P-C4'-P energy: -7.223 tors. eta vs tors. theta energy: -3.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -68.268647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.268647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.268647 (E_RNA) where: Base-Base interactions energy: -23.392 where: short stacking energy: -20.189 Base-Backbone interact. energy: 0.420 local terms energy: -45.296452 where: bonds (distance) C4'-P energy: -13.458 bonds (distance) P-C4' energy: -16.035 flat angles C4'-P-C4' energy: -10.233 flat angles P-C4'-P energy: -9.037 tors. eta vs tors. theta energy: 3.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -74.172194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.172194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.172194 (E_RNA) where: Base-Base interactions energy: -28.325 where: short stacking energy: -28.325 Base-Backbone interact. energy: -0.129 local terms energy: -45.718743 where: bonds (distance) C4'-P energy: -7.012 bonds (distance) P-C4' energy: -12.734 flat angles C4'-P-C4' energy: -12.052 flat angles P-C4'-P energy: -8.224 tors. eta vs tors. theta energy: -5.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -181.454673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.454673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.454673 (E_RNA) where: Base-Base interactions energy: -105.196 where: short stacking energy: -59.492 Base-Backbone interact. energy: -0.843 local terms energy: -75.414974 where: bonds (distance) C4'-P energy: -15.317 bonds (distance) P-C4' energy: -14.162 flat angles C4'-P-C4' energy: -18.241 flat angles P-C4'-P energy: -9.437 tors. eta vs tors. theta energy: -18.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -146.073130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.073130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.073130 (E_RNA) where: Base-Base interactions energy: -87.237 where: short stacking energy: -55.675 Base-Backbone interact. energy: -0.064 local terms energy: -58.772165 where: bonds (distance) C4'-P energy: -12.414 bonds (distance) P-C4' energy: -13.137 flat angles C4'-P-C4' energy: -10.865 flat angles P-C4'-P energy: -8.654 tors. eta vs tors. theta energy: -13.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -151.240587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.240587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.240587 (E_RNA) where: Base-Base interactions energy: -83.150 where: short stacking energy: -45.896 Base-Backbone interact. energy: -0.005 local terms energy: -68.085534 where: bonds (distance) C4'-P energy: -15.967 bonds (distance) P-C4' energy: -16.410 flat angles C4'-P-C4' energy: -12.824 flat angles P-C4'-P energy: -10.133 tors. eta vs tors. theta energy: -12.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -153.623208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.623208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.623208 (E_RNA) where: Base-Base interactions energy: -100.350 where: short stacking energy: -50.627 Base-Backbone interact. energy: -0.008 local terms energy: -53.265649 where: bonds (distance) C4'-P energy: -10.577 bonds (distance) P-C4' energy: -14.741 flat angles C4'-P-C4' energy: -13.182 flat angles P-C4'-P energy: -2.202 tors. eta vs tors. theta energy: -12.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -133.232849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.232849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.232849 (E_RNA) where: Base-Base interactions energy: -75.824 where: short stacking energy: -35.877 Base-Backbone interact. energy: -0.080 local terms energy: -57.328754 where: bonds (distance) C4'-P energy: -12.134 bonds (distance) P-C4' energy: -13.091 flat angles C4'-P-C4' energy: -12.316 flat angles P-C4'-P energy: -8.749 tors. eta vs tors. theta energy: -11.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -77.332201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.332201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.332201 (E_RNA) where: Base-Base interactions energy: -28.282 where: short stacking energy: -23.370 Base-Backbone interact. energy: -0.530 local terms energy: -48.520165 where: bonds (distance) C4'-P energy: -16.314 bonds (distance) P-C4' energy: -12.128 flat angles C4'-P-C4' energy: -11.710 flat angles P-C4'-P energy: -4.801 tors. eta vs tors. theta energy: -3.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -125.575681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.575681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.575681 (E_RNA) where: Base-Base interactions energy: -82.168 where: short stacking energy: -38.900 Base-Backbone interact. energy: -0.201 local terms energy: -43.205991 where: bonds (distance) C4'-P energy: -13.007 bonds (distance) P-C4' energy: -9.218 flat angles C4'-P-C4' energy: -10.065 flat angles P-C4'-P energy: -7.054 tors. eta vs tors. theta energy: -3.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -81.997863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.997863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.997863 (E_RNA) where: Base-Base interactions energy: -28.442 where: short stacking energy: -26.060 Base-Backbone interact. energy: 0.893 local terms energy: -54.448903 where: bonds (distance) C4'-P energy: -8.350 bonds (distance) P-C4' energy: -16.277 flat angles C4'-P-C4' energy: -15.880 flat angles P-C4'-P energy: -9.927 tors. eta vs tors. theta energy: -4.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -71.062551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.062551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.062551 (E_RNA) where: Base-Base interactions energy: -23.125 where: short stacking energy: -14.862 Base-Backbone interact. energy: -0.230 local terms energy: -47.707441 where: bonds (distance) C4'-P energy: -13.947 bonds (distance) P-C4' energy: -8.415 flat angles C4'-P-C4' energy: -14.203 flat angles P-C4'-P energy: -10.582 tors. eta vs tors. theta energy: -0.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -75.709923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.709923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.709923 (E_RNA) where: Base-Base interactions energy: -21.351 where: short stacking energy: -21.351 Base-Backbone interact. energy: -0.002 local terms energy: -54.357389 where: bonds (distance) C4'-P energy: -13.293 bonds (distance) P-C4' energy: -15.775 flat angles C4'-P-C4' energy: -10.928 flat angles P-C4'-P energy: -9.480 tors. eta vs tors. theta energy: -4.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -187.238587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.238587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.238587 (E_RNA) where: Base-Base interactions energy: -114.746 where: short stacking energy: -54.950 Base-Backbone interact. energy: -1.301 local terms energy: -71.191744 where: bonds (distance) C4'-P energy: -14.141 bonds (distance) P-C4' energy: -16.174 flat angles C4'-P-C4' energy: -10.352 flat angles P-C4'-P energy: -10.587 tors. eta vs tors. theta energy: -19.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -153.237039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.237039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.237039 (E_RNA) where: Base-Base interactions energy: -90.451 where: short stacking energy: -36.371 Base-Backbone interact. energy: 0.243 local terms energy: -63.029420 where: bonds (distance) C4'-P energy: -14.890 bonds (distance) P-C4' energy: -12.949 flat angles C4'-P-C4' energy: -15.420 flat angles P-C4'-P energy: -9.313 tors. eta vs tors. theta energy: -10.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -149.366637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.366637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.366637 (E_RNA) where: Base-Base interactions energy: -79.733 where: short stacking energy: -43.894 Base-Backbone interact. energy: -0.098 local terms energy: -69.535582 where: bonds (distance) C4'-P energy: -12.485 bonds (distance) P-C4' energy: -15.942 flat angles C4'-P-C4' energy: -17.476 flat angles P-C4'-P energy: -10.638 tors. eta vs tors. theta energy: -12.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -153.235738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.235738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.235738 (E_RNA) where: Base-Base interactions energy: -88.551 where: short stacking energy: -42.121 Base-Backbone interact. energy: -0.079 local terms energy: -64.605695 where: bonds (distance) C4'-P energy: -15.425 bonds (distance) P-C4' energy: -16.417 flat angles C4'-P-C4' energy: -13.615 flat angles P-C4'-P energy: -7.395 tors. eta vs tors. theta energy: -11.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -132.714027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.714027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.714027 (E_RNA) where: Base-Base interactions energy: -75.824 where: short stacking energy: -29.682 Base-Backbone interact. energy: -1.277 local terms energy: -55.612912 where: bonds (distance) C4'-P energy: -13.256 bonds (distance) P-C4' energy: -15.011 flat angles C4'-P-C4' energy: -12.805 flat angles P-C4'-P energy: -6.855 tors. eta vs tors. theta energy: -7.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -80.554264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.554264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.554264 (E_RNA) where: Base-Base interactions energy: -26.730 where: short stacking energy: -24.241 Base-Backbone interact. energy: -0.222 local terms energy: -53.601827 where: bonds (distance) C4'-P energy: -13.910 bonds (distance) P-C4' energy: -16.600 flat angles C4'-P-C4' energy: -13.987 flat angles P-C4'-P energy: -6.389 tors. eta vs tors. theta energy: -2.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -117.463145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -117.463145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -117.463145 (E_RNA) where: Base-Base interactions energy: -63.286 where: short stacking energy: -39.928 Base-Backbone interact. energy: -0.037 local terms energy: -54.140806 where: bonds (distance) C4'-P energy: -11.387 bonds (distance) P-C4' energy: -12.105 flat angles C4'-P-C4' energy: -13.206 flat angles P-C4'-P energy: -8.297 tors. eta vs tors. theta energy: -9.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -72.620969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.620969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.620969 (E_RNA) where: Base-Base interactions energy: -22.517 where: short stacking energy: -18.438 Base-Backbone interact. energy: -0.241 local terms energy: -49.863539 where: bonds (distance) C4'-P energy: -15.876 bonds (distance) P-C4' energy: -12.688 flat angles C4'-P-C4' energy: -11.947 flat angles P-C4'-P energy: -8.194 tors. eta vs tors. theta energy: -1.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -82.252483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.252483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.252483 (E_RNA) where: Base-Base interactions energy: -31.622 where: short stacking energy: -28.607 Base-Backbone interact. energy: -0.699 local terms energy: -49.931545 where: bonds (distance) C4'-P energy: -13.813 bonds (distance) P-C4' energy: -7.424 flat angles C4'-P-C4' energy: -11.450 flat angles P-C4'-P energy: -11.365 tors. eta vs tors. theta energy: -5.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -67.799991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.799991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.799991 (E_RNA) where: Base-Base interactions energy: -13.071 where: short stacking energy: -13.071 Base-Backbone interact. energy: -0.021 local terms energy: -54.708816 where: bonds (distance) C4'-P energy: -14.787 bonds (distance) P-C4' energy: -14.628 flat angles C4'-P-C4' energy: -11.664 flat angles P-C4'-P energy: -10.729 tors. eta vs tors. theta energy: -2.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -185.059971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.059971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.059971 (E_RNA) where: Base-Base interactions energy: -115.159 where: short stacking energy: -57.775 Base-Backbone interact. energy: -0.769 local terms energy: -69.132116 where: bonds (distance) C4'-P energy: -12.911 bonds (distance) P-C4' energy: -17.104 flat angles C4'-P-C4' energy: -12.911 flat angles P-C4'-P energy: -10.146 tors. eta vs tors. theta energy: -16.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -148.415118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.415118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.415118 (E_RNA) where: Base-Base interactions energy: -82.451 where: short stacking energy: -45.354 Base-Backbone interact. energy: -0.019 local terms energy: -65.946018 where: bonds (distance) C4'-P energy: -15.057 bonds (distance) P-C4' energy: -14.458 flat angles C4'-P-C4' energy: -15.390 flat angles P-C4'-P energy: -9.262 tors. eta vs tors. theta energy: -11.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -152.758542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.758542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.758542 (E_RNA) where: Base-Base interactions energy: -98.430 where: short stacking energy: -34.423 Base-Backbone interact. energy: -0.404 local terms energy: -53.924380 where: bonds (distance) C4'-P energy: -10.552 bonds (distance) P-C4' energy: -12.845 flat angles C4'-P-C4' energy: -14.132 flat angles P-C4'-P energy: -10.532 tors. eta vs tors. theta energy: -5.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -145.270366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.270366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.270366 (E_RNA) where: Base-Base interactions energy: -86.962 where: short stacking energy: -37.851 Base-Backbone interact. energy: -1.176 local terms energy: -57.132734 where: bonds (distance) C4'-P energy: -13.090 bonds (distance) P-C4' energy: -13.371 flat angles C4'-P-C4' energy: -12.943 flat angles P-C4'-P energy: -6.738 tors. eta vs tors. theta energy: -10.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -128.355972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -128.355972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -128.355972 (E_RNA) where: Base-Base interactions energy: -75.571 where: short stacking energy: -34.552 Base-Backbone interact. energy: 0.410 local terms energy: -53.195411 where: bonds (distance) C4'-P energy: -14.120 bonds (distance) P-C4' energy: -16.933 flat angles C4'-P-C4' energy: -14.479 flat angles P-C4'-P energy: -2.352 tors. eta vs tors. theta energy: -5.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -106.407035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.407035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.407035 (E_RNA) where: Base-Base interactions energy: -50.187 where: short stacking energy: -26.554 Base-Backbone interact. energy: -0.172 local terms energy: -56.047317 where: bonds (distance) C4'-P energy: -16.328 bonds (distance) P-C4' energy: -13.235 flat angles C4'-P-C4' energy: -13.035 flat angles P-C4'-P energy: -8.158 tors. eta vs tors. theta energy: -5.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -71.478087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.478087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.478087 (E_RNA) where: Base-Base interactions energy: -18.888 where: short stacking energy: -10.322 Base-Backbone interact. energy: -0.163 local terms energy: -52.427771 where: bonds (distance) C4'-P energy: -12.262 bonds (distance) P-C4' energy: -14.730 flat angles C4'-P-C4' energy: -12.070 flat angles P-C4'-P energy: -11.409 tors. eta vs tors. theta energy: -1.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -90.984795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.984795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.984795 (E_RNA) where: Base-Base interactions energy: -52.237 where: short stacking energy: -25.696 Base-Backbone interact. energy: -0.563 local terms energy: -38.184999 where: bonds (distance) C4'-P energy: -6.643 bonds (distance) P-C4' energy: -13.938 flat angles C4'-P-C4' energy: -10.254 flat angles P-C4'-P energy: -2.853 tors. eta vs tors. theta energy: -4.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -69.776878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.776878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.776878 (E_RNA) where: Base-Base interactions energy: -21.398 where: short stacking energy: -21.398 Base-Backbone interact. energy: -0.274 local terms energy: -48.105450 where: bonds (distance) C4'-P energy: -12.502 bonds (distance) P-C4' energy: -13.834 flat angles C4'-P-C4' energy: -15.190 flat angles P-C4'-P energy: -3.040 tors. eta vs tors. theta energy: -3.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -71.082185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.082185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.082185 (E_RNA) where: Base-Base interactions energy: -25.355 where: short stacking energy: -25.355 Base-Backbone interact. energy: -0.005 local terms energy: -45.722781 where: bonds (distance) C4'-P energy: -12.644 bonds (distance) P-C4' energy: -12.465 flat angles C4'-P-C4' energy: -12.432 flat angles P-C4'-P energy: -7.513 tors. eta vs tors. theta energy: -0.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -195.229851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -195.229851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -195.229851 (E_RNA) where: Base-Base interactions energy: -118.632 where: short stacking energy: -53.581 Base-Backbone interact. energy: 0.440 local terms energy: -77.037414 where: bonds (distance) C4'-P energy: -12.133 bonds (distance) P-C4' energy: -15.364 flat angles C4'-P-C4' energy: -17.084 flat angles P-C4'-P energy: -13.822 tors. eta vs tors. theta energy: -18.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -160.222805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.222805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.222805 (E_RNA) where: Base-Base interactions energy: -97.035 where: short stacking energy: -43.539 Base-Backbone interact. energy: -0.131 local terms energy: -63.056756 where: bonds (distance) C4'-P energy: -12.571 bonds (distance) P-C4' energy: -12.409 flat angles C4'-P-C4' energy: -16.411 flat angles P-C4'-P energy: -8.319 tors. eta vs tors. theta energy: -13.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -162.589269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -162.589269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -162.589269 (E_RNA) where: Base-Base interactions energy: -91.481 where: short stacking energy: -48.466 Base-Backbone interact. energy: -0.048 local terms energy: -71.060229 where: bonds (distance) C4'-P energy: -15.569 bonds (distance) P-C4' energy: -14.144 flat angles C4'-P-C4' energy: -14.464 flat angles P-C4'-P energy: -12.999 tors. eta vs tors. theta energy: -13.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -133.118862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.118862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.118862 (E_RNA) where: Base-Base interactions energy: -85.348 where: short stacking energy: -43.476 Base-Backbone interact. energy: -0.136 local terms energy: -47.634773 where: bonds (distance) C4'-P energy: -5.187 bonds (distance) P-C4' energy: -14.265 flat angles C4'-P-C4' energy: -10.612 flat angles P-C4'-P energy: -8.658 tors. eta vs tors. theta energy: -8.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -133.133955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.133955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.133955 (E_RNA) where: Base-Base interactions energy: -77.676 where: short stacking energy: -35.501 Base-Backbone interact. energy: -0.880 local terms energy: -54.578247 where: bonds (distance) C4'-P energy: -12.912 bonds (distance) P-C4' energy: -8.755 flat angles C4'-P-C4' energy: -16.192 flat angles P-C4'-P energy: -8.282 tors. eta vs tors. theta energy: -8.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -124.259884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -124.259884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -124.259884 (E_RNA) where: Base-Base interactions energy: -75.396 where: short stacking energy: -29.926 Base-Backbone interact. energy: -0.894 local terms energy: -47.969910 where: bonds (distance) C4'-P energy: -8.648 bonds (distance) P-C4' energy: -16.532 flat angles C4'-P-C4' energy: -8.681 flat angles P-C4'-P energy: -8.905 tors. eta vs tors. theta energy: -5.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -75.849628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.849628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.849628 (E_RNA) where: Base-Base interactions energy: -19.851 where: short stacking energy: -18.453 Base-Backbone interact. energy: 0.535 local terms energy: -56.533307 where: bonds (distance) C4'-P energy: -14.237 bonds (distance) P-C4' energy: -15.998 flat angles C4'-P-C4' energy: -14.979 flat angles P-C4'-P energy: -9.816 tors. eta vs tors. theta energy: -1.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -114.871455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -114.871455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -114.871455 (E_RNA) where: Base-Base interactions energy: -60.273 where: short stacking energy: -31.821 Base-Backbone interact. energy: -0.280 local terms energy: -54.318365 where: bonds (distance) C4'-P energy: -15.776 bonds (distance) P-C4' energy: -10.526 flat angles C4'-P-C4' energy: -8.739 flat angles P-C4'-P energy: -12.160 tors. eta vs tors. theta energy: -7.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -77.813078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.813078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.813078 (E_RNA) where: Base-Base interactions energy: -25.507 where: short stacking energy: -24.361 Base-Backbone interact. energy: -0.142 local terms energy: -52.163561 where: bonds (distance) C4'-P energy: -9.855 bonds (distance) P-C4' energy: -15.498 flat angles C4'-P-C4' energy: -15.341 flat angles P-C4'-P energy: -9.286 tors. eta vs tors. theta energy: -2.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -69.169644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.169644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.169644 (E_RNA) where: Base-Base interactions energy: -30.121 where: short stacking energy: -30.121 Base-Backbone interact. energy: -0.056 local terms energy: -38.993236 where: bonds (distance) C4'-P energy: -9.699 bonds (distance) P-C4' energy: -6.848 flat angles C4'-P-C4' energy: -11.951 flat angles P-C4'-P energy: -9.155 tors. eta vs tors. theta energy: -1.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -192.994699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.994699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.994699 (E_RNA) where: Base-Base interactions energy: -115.903 where: short stacking energy: -64.674 Base-Backbone interact. energy: -0.026 local terms energy: -77.066099 where: bonds (distance) C4'-P energy: -12.788 bonds (distance) P-C4' energy: -13.765 flat angles C4'-P-C4' energy: -15.989 flat angles P-C4'-P energy: -13.502 tors. eta vs tors. theta energy: -21.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -158.324702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.324702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.324702 (E_RNA) where: Base-Base interactions energy: -89.974 where: short stacking energy: -50.735 Base-Backbone interact. energy: -0.899 local terms energy: -67.451527 where: bonds (distance) C4'-P energy: -14.471 bonds (distance) P-C4' energy: -17.001 flat angles C4'-P-C4' energy: -15.222 flat angles P-C4'-P energy: -8.983 tors. eta vs tors. theta energy: -11.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -155.268162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.268162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.268162 (E_RNA) where: Base-Base interactions energy: -92.161 where: short stacking energy: -39.599 Base-Backbone interact. energy: -0.909 local terms energy: -62.198543 where: bonds (distance) C4'-P energy: -12.260 bonds (distance) P-C4' energy: -16.277 flat angles C4'-P-C4' energy: -15.690 flat angles P-C4'-P energy: -8.565 tors. eta vs tors. theta energy: -9.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -141.965337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.965337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.965337 (E_RNA) where: Base-Base interactions energy: -87.441 where: short stacking energy: -36.255 Base-Backbone interact. energy: -0.340 local terms energy: -54.184467 where: bonds (distance) C4'-P energy: -11.310 bonds (distance) P-C4' energy: -12.750 flat angles C4'-P-C4' energy: -15.052 flat angles P-C4'-P energy: -8.119 tors. eta vs tors. theta energy: -6.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -142.153064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.153064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.153064 (E_RNA) where: Base-Base interactions energy: -86.737 where: short stacking energy: -39.910 Base-Backbone interact. energy: -0.240 local terms energy: -55.176310 where: bonds (distance) C4'-P energy: -14.712 bonds (distance) P-C4' energy: -12.664 flat angles C4'-P-C4' energy: -12.531 flat angles P-C4'-P energy: -6.907 tors. eta vs tors. theta energy: -8.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -121.304225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.304225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.304225 (E_RNA) where: Base-Base interactions energy: -64.549 where: short stacking energy: -39.207 Base-Backbone interact. energy: -0.471 local terms energy: -56.284370 where: bonds (distance) C4'-P energy: -12.834 bonds (distance) P-C4' energy: -13.269 flat angles C4'-P-C4' energy: -10.506 flat angles P-C4'-P energy: -10.833 tors. eta vs tors. theta energy: -8.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -83.866531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.866531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.866531 (E_RNA) where: Base-Base interactions energy: -41.548 where: short stacking energy: -23.032 Base-Backbone interact. energy: -0.100 local terms energy: -42.218643 where: bonds (distance) C4'-P energy: -9.761 bonds (distance) P-C4' energy: -15.122 flat angles C4'-P-C4' energy: -5.888 flat angles P-C4'-P energy: -5.351 tors. eta vs tors. theta energy: -6.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -85.490787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -85.490787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -85.490787 (E_RNA) where: Base-Base interactions energy: -37.961 where: short stacking energy: -27.262 Base-Backbone interact. energy: -0.007 local terms energy: -47.523064 where: bonds (distance) C4'-P energy: -14.091 bonds (distance) P-C4' energy: -10.630 flat angles C4'-P-C4' energy: -8.570 flat angles P-C4'-P energy: -9.505 tors. eta vs tors. theta energy: -4.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -67.005285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.005285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.005285 (E_RNA) where: Base-Base interactions energy: -26.783 where: short stacking energy: -16.575 Base-Backbone interact. energy: 0.192 local terms energy: -40.413572 where: bonds (distance) C4'-P energy: -13.894 bonds (distance) P-C4' energy: -10.291 flat angles C4'-P-C4' energy: -11.258 flat angles P-C4'-P energy: -6.339 tors. eta vs tors. theta energy: 1.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -60.812685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -60.812685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -60.812685 (E_RNA) where: Base-Base interactions energy: -7.253 where: short stacking energy: -5.069 Base-Backbone interact. energy: -0.192 local terms energy: -53.367133 where: bonds (distance) C4'-P energy: -13.520 bonds (distance) P-C4' energy: -15.584 flat angles C4'-P-C4' energy: -14.255 flat angles P-C4'-P energy: -10.990 tors. eta vs tors. theta energy: 0.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -165.898298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.898298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.898298 (E_RNA) where: Base-Base interactions energy: -97.303 where: short stacking energy: -60.353 Base-Backbone interact. energy: -0.001 local terms energy: -68.593427 where: bonds (distance) C4'-P energy: -10.654 bonds (distance) P-C4' energy: -13.239 flat angles C4'-P-C4' energy: -15.121 flat angles P-C4'-P energy: -10.701 tors. eta vs tors. theta energy: -18.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -170.421969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.421969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.421969 (E_RNA) where: Base-Base interactions energy: -108.549 where: short stacking energy: -39.762 Base-Backbone interact. energy: -0.228 local terms energy: -61.645624 where: bonds (distance) C4'-P energy: -16.597 bonds (distance) P-C4' energy: -14.229 flat angles C4'-P-C4' energy: -14.621 flat angles P-C4'-P energy: -9.021 tors. eta vs tors. theta energy: -7.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -151.681798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.681798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.681798 (E_RNA) where: Base-Base interactions energy: -89.759 where: short stacking energy: -38.586 Base-Backbone interact. energy: -0.547 local terms energy: -61.376029 where: bonds (distance) C4'-P energy: -15.453 bonds (distance) P-C4' energy: -15.557 flat angles C4'-P-C4' energy: -11.539 flat angles P-C4'-P energy: -12.000 tors. eta vs tors. theta energy: -6.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -132.218946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.218946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.218946 (E_RNA) where: Base-Base interactions energy: -73.447 where: short stacking energy: -40.880 Base-Backbone interact. energy: -0.019 local terms energy: -58.753032 where: bonds (distance) C4'-P energy: -11.661 bonds (distance) P-C4' energy: -9.395 flat angles C4'-P-C4' energy: -16.407 flat angles P-C4'-P energy: -12.360 tors. eta vs tors. theta energy: -8.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -154.841264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.841264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.841264 (E_RNA) where: Base-Base interactions energy: -97.996 where: short stacking energy: -41.956 Base-Backbone interact. energy: -0.617 local terms energy: -56.227927 where: bonds (distance) C4'-P energy: -9.434 bonds (distance) P-C4' energy: -13.248 flat angles C4'-P-C4' energy: -15.707 flat angles P-C4'-P energy: -5.749 tors. eta vs tors. theta energy: -12.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -115.282430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -115.282430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -115.282430 (E_RNA) where: Base-Base interactions energy: -70.093 where: short stacking energy: -30.324 Base-Backbone interact. energy: -0.149 local terms energy: -45.040453 where: bonds (distance) C4'-P energy: -14.519 bonds (distance) P-C4' energy: -9.983 flat angles C4'-P-C4' energy: -13.358 flat angles P-C4'-P energy: -4.431 tors. eta vs tors. theta energy: -2.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -90.850065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.850065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.850065 (E_RNA) where: Base-Base interactions energy: -33.979 where: short stacking energy: -23.882 Base-Backbone interact. energy: -0.137 local terms energy: -56.734233 where: bonds (distance) C4'-P energy: -12.097 bonds (distance) P-C4' energy: -15.137 flat angles C4'-P-C4' energy: -14.613 flat angles P-C4'-P energy: -11.336 tors. eta vs tors. theta energy: -3.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -79.295639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.295639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.295639 (E_RNA) where: Base-Base interactions energy: -30.670 where: short stacking energy: -22.005 Base-Backbone interact. energy: -0.309 local terms energy: -48.317158 where: bonds (distance) C4'-P energy: -12.800 bonds (distance) P-C4' energy: -13.680 flat angles C4'-P-C4' energy: -10.273 flat angles P-C4'-P energy: -7.147 tors. eta vs tors. theta energy: -4.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -74.067505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.067505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.067505 (E_RNA) where: Base-Base interactions energy: -20.712 where: short stacking energy: -14.533 Base-Backbone interact. energy: -0.245 local terms energy: -53.111103 where: bonds (distance) C4'-P energy: -15.060 bonds (distance) P-C4' energy: -17.009 flat angles C4'-P-C4' energy: -10.586 flat angles P-C4'-P energy: -8.123 tors. eta vs tors. theta energy: -2.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -71.870236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.870236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.870236 (E_RNA) where: Base-Base interactions energy: -20.660 where: short stacking energy: -15.048 Base-Backbone interact. energy: -0.229 local terms energy: -50.981102 where: bonds (distance) C4'-P energy: -15.334 bonds (distance) P-C4' energy: -13.831 flat angles C4'-P-C4' energy: -11.501 flat angles P-C4'-P energy: -8.848 tors. eta vs tors. theta energy: -1.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -173.526787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.526787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.526787 (E_RNA) where: Base-Base interactions energy: -103.979 where: short stacking energy: -56.338 Base-Backbone interact. energy: -0.076 local terms energy: -69.472046 where: bonds (distance) C4'-P energy: -11.918 bonds (distance) P-C4' energy: -13.851 flat angles C4'-P-C4' energy: -16.227 flat angles P-C4'-P energy: -11.148 tors. eta vs tors. theta energy: -16.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -150.143519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.143519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.143519 (E_RNA) where: Base-Base interactions energy: -89.537 where: short stacking energy: -41.236 Base-Backbone interact. energy: -0.382 local terms energy: -60.224394 where: bonds (distance) C4'-P energy: -14.800 bonds (distance) P-C4' energy: -15.455 flat angles C4'-P-C4' energy: -10.478 flat angles P-C4'-P energy: -12.934 tors. eta vs tors. theta energy: -6.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -167.743844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.743844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.743844 (E_RNA) where: Base-Base interactions energy: -102.270 where: short stacking energy: -41.751 Base-Backbone interact. energy: -1.187 local terms energy: -64.287354 where: bonds (distance) C4'-P energy: -13.363 bonds (distance) P-C4' energy: -14.207 flat angles C4'-P-C4' energy: -17.311 flat angles P-C4'-P energy: -8.737 tors. eta vs tors. theta energy: -10.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -147.862260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.862260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.862260 (E_RNA) where: Base-Base interactions energy: -85.703 where: short stacking energy: -35.273 Base-Backbone interact. energy: -0.133 local terms energy: -62.025584 where: bonds (distance) C4'-P energy: -15.760 bonds (distance) P-C4' energy: -13.017 flat angles C4'-P-C4' energy: -11.178 flat angles P-C4'-P energy: -8.833 tors. eta vs tors. theta energy: -13.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -163.018693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.018693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.018693 (E_RNA) where: Base-Base interactions energy: -107.782 where: short stacking energy: -30.766 Base-Backbone interact. energy: -0.387 local terms energy: -54.849199 where: bonds (distance) C4'-P energy: -15.925 bonds (distance) P-C4' energy: -16.196 flat angles C4'-P-C4' energy: -7.114 flat angles P-C4'-P energy: -8.006 tors. eta vs tors. theta energy: -7.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -106.144623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.144623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.144623 (E_RNA) where: Base-Base interactions energy: -59.068 where: short stacking energy: -30.433 Base-Backbone interact. energy: -0.204 local terms energy: -46.872736 where: bonds (distance) C4'-P energy: -4.474 bonds (distance) P-C4' energy: -17.367 flat angles C4'-P-C4' energy: -9.935 flat angles P-C4'-P energy: -6.454 tors. eta vs tors. theta energy: -8.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -78.593184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.593184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.593184 (E_RNA) where: Base-Base interactions energy: -30.184 where: short stacking energy: -30.077 Base-Backbone interact. energy: -0.029 local terms energy: -48.380530 where: bonds (distance) C4'-P energy: -11.038 bonds (distance) P-C4' energy: -16.661 flat angles C4'-P-C4' energy: -10.304 flat angles P-C4'-P energy: -7.751 tors. eta vs tors. theta energy: -2.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -70.586478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.586478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.586478 (E_RNA) where: Base-Base interactions energy: -23.670 where: short stacking energy: -23.670 Base-Backbone interact. energy: -0.325 local terms energy: -46.592132 where: bonds (distance) C4'-P energy: -9.260 bonds (distance) P-C4' energy: -15.953 flat angles C4'-P-C4' energy: -8.215 flat angles P-C4'-P energy: -11.673 tors. eta vs tors. theta energy: -1.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -74.800477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.800477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.800477 (E_RNA) where: Base-Base interactions energy: -27.911 where: short stacking energy: -19.662 Base-Backbone interact. energy: 0.007 local terms energy: -46.895691 where: bonds (distance) C4'-P energy: -12.742 bonds (distance) P-C4' energy: -14.600 flat angles C4'-P-C4' energy: -4.831 flat angles P-C4'-P energy: -11.274 tors. eta vs tors. theta energy: -3.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -72.516829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.516829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.516829 (E_RNA) where: Base-Base interactions energy: -30.560 where: short stacking energy: -23.876 Base-Backbone interact. energy: -0.138 local terms energy: -41.818882 where: bonds (distance) C4'-P energy: -9.029 bonds (distance) P-C4' energy: -10.562 flat angles C4'-P-C4' energy: -7.004 flat angles P-C4'-P energy: -8.470 tors. eta vs tors. theta energy: -6.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -164.370115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -164.370115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -164.370115 (E_RNA) where: Base-Base interactions energy: -103.344 where: short stacking energy: -54.066 Base-Backbone interact. energy: -0.116 local terms energy: -60.910269 where: bonds (distance) C4'-P energy: -15.954 bonds (distance) P-C4' energy: -13.557 flat angles C4'-P-C4' energy: -15.298 flat angles P-C4'-P energy: -3.768 tors. eta vs tors. theta energy: -12.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -177.312979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.312979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.312979 (E_RNA) where: Base-Base interactions energy: -106.429 where: short stacking energy: -58.301 Base-Backbone interact. energy: -0.216 local terms energy: -70.668385 where: bonds (distance) C4'-P energy: -14.722 bonds (distance) P-C4' energy: -12.436 flat angles C4'-P-C4' energy: -14.945 flat angles P-C4'-P energy: -8.694 tors. eta vs tors. theta energy: -19.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -152.692002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.692002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.692002 (E_RNA) where: Base-Base interactions energy: -88.337 where: short stacking energy: -39.333 Base-Backbone interact. energy: -0.119 local terms energy: -64.236326 where: bonds (distance) C4'-P energy: -14.022 bonds (distance) P-C4' energy: -13.807 flat angles C4'-P-C4' energy: -15.914 flat angles P-C4'-P energy: -7.445 tors. eta vs tors. theta energy: -13.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -152.281538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.281538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.281538 (E_RNA) where: Base-Base interactions energy: -78.022 where: short stacking energy: -33.227 Base-Backbone interact. energy: -0.721 local terms energy: -73.538965 where: bonds (distance) C4'-P energy: -16.295 bonds (distance) P-C4' energy: -17.042 flat angles C4'-P-C4' energy: -16.079 flat angles P-C4'-P energy: -12.593 tors. eta vs tors. theta energy: -11.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -147.857388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.857388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.857388 (E_RNA) where: Base-Base interactions energy: -90.059 where: short stacking energy: -36.875 Base-Backbone interact. energy: -0.302 local terms energy: -57.495759 where: bonds (distance) C4'-P energy: -15.328 bonds (distance) P-C4' energy: -14.591 flat angles C4'-P-C4' energy: -10.612 flat angles P-C4'-P energy: -7.640 tors. eta vs tors. theta energy: -9.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -90.723026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.723026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.723026 (E_RNA) where: Base-Base interactions energy: -48.090 where: short stacking energy: -16.785 Base-Backbone interact. energy: -0.308 local terms energy: -42.325108 where: bonds (distance) C4'-P energy: -10.779 bonds (distance) P-C4' energy: -15.435 flat angles C4'-P-C4' energy: -4.929 flat angles P-C4'-P energy: -3.095 tors. eta vs tors. theta energy: -8.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -77.520055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.520055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.520055 (E_RNA) where: Base-Base interactions energy: -31.250 where: short stacking energy: -31.650 Base-Backbone interact. energy: -0.066 local terms energy: -46.204542 where: bonds (distance) C4'-P energy: -12.740 bonds (distance) P-C4' energy: -6.910 flat angles C4'-P-C4' energy: -15.562 flat angles P-C4'-P energy: -6.910 tors. eta vs tors. theta energy: -4.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -72.823260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -72.823260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -72.823260 (E_RNA) where: Base-Base interactions energy: -27.211 where: short stacking energy: -26.603 Base-Backbone interact. energy: -0.268 local terms energy: -45.344920 where: bonds (distance) C4'-P energy: -16.223 bonds (distance) P-C4' energy: -16.085 flat angles C4'-P-C4' energy: -2.109 flat angles P-C4'-P energy: -4.242 tors. eta vs tors. theta energy: -6.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -87.398693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.398693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.398693 (E_RNA) where: Base-Base interactions energy: -40.215 where: short stacking energy: -31.279 Base-Backbone interact. energy: -1.020 local terms energy: -46.163862 where: bonds (distance) C4'-P energy: -9.147 bonds (distance) P-C4' energy: -15.466 flat angles C4'-P-C4' energy: -9.493 flat angles P-C4'-P energy: -7.404 tors. eta vs tors. theta energy: -4.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -71.354740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.354740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.354740 (E_RNA) where: Base-Base interactions energy: -20.752 where: short stacking energy: -18.322 Base-Backbone interact. energy: -0.867 local terms energy: -49.735567 where: bonds (distance) C4'-P energy: -15.114 bonds (distance) P-C4' energy: -13.628 flat angles C4'-P-C4' energy: -12.323 flat angles P-C4'-P energy: -8.783 tors. eta vs tors. theta energy: 0.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -179.859825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.859825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.859825 (E_RNA) where: Base-Base interactions energy: -113.302 where: short stacking energy: -49.437 Base-Backbone interact. energy: -1.129 local terms energy: -65.429565 where: bonds (distance) C4'-P energy: -12.095 bonds (distance) P-C4' energy: -13.809 flat angles C4'-P-C4' energy: -16.626 flat angles P-C4'-P energy: -8.048 tors. eta vs tors. theta energy: -14.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -160.638389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.638389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.638389 (E_RNA) where: Base-Base interactions energy: -91.004 where: short stacking energy: -42.381 Base-Backbone interact. energy: -0.841 local terms energy: -68.793886 where: bonds (distance) C4'-P energy: -13.806 bonds (distance) P-C4' energy: -18.057 flat angles C4'-P-C4' energy: -13.127 flat angles P-C4'-P energy: -10.381 tors. eta vs tors. theta energy: -13.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -161.599329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -161.599329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -161.599329 (E_RNA) where: Base-Base interactions energy: -99.556 where: short stacking energy: -45.045 Base-Backbone interact. energy: -0.117 local terms energy: -61.927052 where: bonds (distance) C4'-P energy: -16.675 bonds (distance) P-C4' energy: -14.591 flat angles C4'-P-C4' energy: -14.317 flat angles P-C4'-P energy: -5.358 tors. eta vs tors. theta energy: -10.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -165.504127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -165.504127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -165.504127 (E_RNA) where: Base-Base interactions energy: -105.745 where: short stacking energy: -44.426 Base-Backbone interact. energy: 0.085 local terms energy: -59.843776 where: bonds (distance) C4'-P energy: -11.739 bonds (distance) P-C4' energy: -15.122 flat angles C4'-P-C4' energy: -14.378 flat angles P-C4'-P energy: -9.819 tors. eta vs tors. theta energy: -8.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -158.307416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.307416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.307416 (E_RNA) where: Base-Base interactions energy: -98.323 where: short stacking energy: -42.170 Base-Backbone interact. energy: -0.132 local terms energy: -59.851684 where: bonds (distance) C4'-P energy: -12.983 bonds (distance) P-C4' energy: -16.575 flat angles C4'-P-C4' energy: -12.939 flat angles P-C4'-P energy: -6.977 tors. eta vs tors. theta energy: -10.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -78.732380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.732380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.732380 (E_RNA) where: Base-Base interactions energy: -24.603 where: short stacking energy: -24.603 Base-Backbone interact. energy: -0.019 local terms energy: -54.110662 where: bonds (distance) C4'-P energy: -12.867 bonds (distance) P-C4' energy: -15.326 flat angles C4'-P-C4' energy: -14.009 flat angles P-C4'-P energy: -7.004 tors. eta vs tors. theta energy: -4.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -78.085345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.085345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.085345 (E_RNA) where: Base-Base interactions energy: -26.021 where: short stacking energy: -25.212 Base-Backbone interact. energy: -0.483 local terms energy: -51.581690 where: bonds (distance) C4'-P energy: -9.079 bonds (distance) P-C4' energy: -14.521 flat angles C4'-P-C4' energy: -8.278 flat angles P-C4'-P energy: -12.210 tors. eta vs tors. theta energy: -7.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -70.941071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.941071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.941071 (E_RNA) where: Base-Base interactions energy: -24.789 where: short stacking energy: -14.592 Base-Backbone interact. energy: 0.431 local terms energy: -46.583226 where: bonds (distance) C4'-P energy: -14.088 bonds (distance) P-C4' energy: -11.542 flat angles C4'-P-C4' energy: -15.647 flat angles P-C4'-P energy: -9.528 tors. eta vs tors. theta energy: 4.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -81.569523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.569523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.569523 (E_RNA) where: Base-Base interactions energy: -29.390 where: short stacking energy: -29.910 Base-Backbone interact. energy: -0.081 local terms energy: -52.098593 where: bonds (distance) C4'-P energy: -15.884 bonds (distance) P-C4' energy: -15.431 flat angles C4'-P-C4' energy: -7.098 flat angles P-C4'-P energy: -11.510 tors. eta vs tors. theta energy: -2.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -68.587119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -68.587119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -68.587119 (E_RNA) where: Base-Base interactions energy: -26.358 where: short stacking energy: -10.575 Base-Backbone interact. energy: -0.263 local terms energy: -41.966555 where: bonds (distance) C4'-P energy: -9.783 bonds (distance) P-C4' energy: -13.483 flat angles C4'-P-C4' energy: -10.099 flat angles P-C4'-P energy: -3.938 tors. eta vs tors. theta energy: -4.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -186.327121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.327121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.327121 (E_RNA) where: Base-Base interactions energy: -123.791 where: short stacking energy: -50.443 Base-Backbone interact. energy: -0.643 local terms energy: -61.893633 where: bonds (distance) C4'-P energy: -10.474 bonds (distance) P-C4' energy: -15.032 flat angles C4'-P-C4' energy: -12.261 flat angles P-C4'-P energy: -4.637 tors. eta vs tors. theta energy: -19.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -157.011200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.011200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.011200 (E_RNA) where: Base-Base interactions energy: -96.622 where: short stacking energy: -35.895 Base-Backbone interact. energy: -0.359 local terms energy: -60.030540 where: bonds (distance) C4'-P energy: -15.591 bonds (distance) P-C4' energy: -15.554 flat angles C4'-P-C4' energy: -12.662 flat angles P-C4'-P energy: -9.070 tors. eta vs tors. theta energy: -7.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -157.122832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.122832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.122832 (E_RNA) where: Base-Base interactions energy: -97.657 where: short stacking energy: -40.031 Base-Backbone interact. energy: -0.225 local terms energy: -59.241411 where: bonds (distance) C4'-P energy: -13.922 bonds (distance) P-C4' energy: -12.859 flat angles C4'-P-C4' energy: -17.159 flat angles P-C4'-P energy: -4.156 tors. eta vs tors. theta energy: -11.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -168.400256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.400256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.400256 (E_RNA) where: Base-Base interactions energy: -101.951 where: short stacking energy: -48.842 Base-Backbone interact. energy: -1.295 local terms energy: -65.154945 where: bonds (distance) C4'-P energy: -14.030 bonds (distance) P-C4' energy: -11.388 flat angles C4'-P-C4' energy: -13.341 flat angles P-C4'-P energy: -9.898 tors. eta vs tors. theta energy: -16.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -146.119217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.119217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.119217 (E_RNA) where: Base-Base interactions energy: -76.408 where: short stacking energy: -32.530 Base-Backbone interact. energy: -0.334 local terms energy: -69.377288 where: bonds (distance) C4'-P energy: -15.716 bonds (distance) P-C4' energy: -15.986 flat angles C4'-P-C4' energy: -15.226 flat angles P-C4'-P energy: -13.141 tors. eta vs tors. theta energy: -9.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -88.409558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.409558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.409558 (E_RNA) where: Base-Base interactions energy: -42.027 where: short stacking energy: -20.494 Base-Backbone interact. energy: -0.256 local terms energy: -46.126688 where: bonds (distance) C4'-P energy: -11.007 bonds (distance) P-C4' energy: -14.891 flat angles C4'-P-C4' energy: -13.331 flat angles P-C4'-P energy: -9.250 tors. eta vs tors. theta energy: 2.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -83.268559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.268559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.268559 (E_RNA) where: Base-Base interactions energy: -33.138 where: short stacking energy: -28.926 Base-Backbone interact. energy: -0.215 local terms energy: -49.915678 where: bonds (distance) C4'-P energy: -8.974 bonds (distance) P-C4' energy: -14.010 flat angles C4'-P-C4' energy: -13.003 flat angles P-C4'-P energy: -9.102 tors. eta vs tors. theta energy: -4.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -73.320791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.320791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.320791 (E_RNA) where: Base-Base interactions energy: -13.916 where: short stacking energy: -15.647 Base-Backbone interact. energy: -0.166 local terms energy: -59.238443 where: bonds (distance) C4'-P energy: -13.991 bonds (distance) P-C4' energy: -15.250 flat angles C4'-P-C4' energy: -15.201 flat angles P-C4'-P energy: -9.118 tors. eta vs tors. theta energy: -5.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -66.870835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.870835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.870835 (E_RNA) where: Base-Base interactions energy: -9.112 where: short stacking energy: -8.885 Base-Backbone interact. energy: -0.541 local terms energy: -57.217864 where: bonds (distance) C4'-P energy: -16.952 bonds (distance) P-C4' energy: -15.064 flat angles C4'-P-C4' energy: -16.949 flat angles P-C4'-P energy: -10.010 tors. eta vs tors. theta energy: 1.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -69.958669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.958669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.958669 (E_RNA) where: Base-Base interactions energy: -24.751 where: short stacking energy: -24.751 Base-Backbone interact. energy: -0.022 local terms energy: -45.185593 where: bonds (distance) C4'-P energy: -13.250 bonds (distance) P-C4' energy: -12.915 flat angles C4'-P-C4' energy: -13.167 flat angles P-C4'-P energy: -3.435 tors. eta vs tors. theta energy: -2.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -184.652300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.652300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.652300 (E_RNA) where: Base-Base interactions energy: -114.143 where: short stacking energy: -47.970 Base-Backbone interact. energy: -0.269 local terms energy: -70.240119 where: bonds (distance) C4'-P energy: -14.196 bonds (distance) P-C4' energy: -16.759 flat angles C4'-P-C4' energy: -16.547 flat angles P-C4'-P energy: -7.607 tors. eta vs tors. theta energy: -15.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -174.237009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -174.237009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -174.237009 (E_RNA) where: Base-Base interactions energy: -106.954 where: short stacking energy: -50.095 Base-Backbone interact. energy: -0.305 local terms energy: -66.977583 where: bonds (distance) C4'-P energy: -12.816 bonds (distance) P-C4' energy: -11.546 flat angles C4'-P-C4' energy: -15.521 flat angles P-C4'-P energy: -11.153 tors. eta vs tors. theta energy: -15.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -152.951818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.951818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.951818 (E_RNA) where: Base-Base interactions energy: -88.492 where: short stacking energy: -44.842 Base-Backbone interact. energy: -0.142 local terms energy: -64.317429 where: bonds (distance) C4'-P energy: -15.300 bonds (distance) P-C4' energy: -15.244 flat angles C4'-P-C4' energy: -14.113 flat angles P-C4'-P energy: -10.000 tors. eta vs tors. theta energy: -9.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -144.835788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.835788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.835788 (E_RNA) where: Base-Base interactions energy: -86.757 where: short stacking energy: -48.276 Base-Backbone interact. energy: -0.343 local terms energy: -57.735928 where: bonds (distance) C4'-P energy: -10.486 bonds (distance) P-C4' energy: -11.283 flat angles C4'-P-C4' energy: -14.311 flat angles P-C4'-P energy: -8.833 tors. eta vs tors. theta energy: -12.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -153.132048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.132048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.132048 (E_RNA) where: Base-Base interactions energy: -91.214 where: short stacking energy: -45.182 Base-Backbone interact. energy: -0.574 local terms energy: -61.344018 where: bonds (distance) C4'-P energy: -12.278 bonds (distance) P-C4' energy: -15.790 flat angles C4'-P-C4' energy: -13.981 flat angles P-C4'-P energy: -4.448 tors. eta vs tors. theta energy: -14.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -88.586470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.586470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.586470 (E_RNA) where: Base-Base interactions energy: -40.514 where: short stacking energy: -40.514 Base-Backbone interact. energy: 0.371 local terms energy: -48.443413 where: bonds (distance) C4'-P energy: -12.762 bonds (distance) P-C4' energy: -13.877 flat angles C4'-P-C4' energy: -12.045 flat angles P-C4'-P energy: -4.172 tors. eta vs tors. theta energy: -5.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -78.988323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.988323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.988323 (E_RNA) where: Base-Base interactions energy: -28.070 where: short stacking energy: -27.630 Base-Backbone interact. energy: -0.489 local terms energy: -50.428987 where: bonds (distance) C4'-P energy: -13.558 bonds (distance) P-C4' energy: -15.424 flat angles C4'-P-C4' energy: -13.726 flat angles P-C4'-P energy: -5.329 tors. eta vs tors. theta energy: -2.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -81.275821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.275821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.275821 (E_RNA) where: Base-Base interactions energy: -30.371 where: short stacking energy: -29.124 Base-Backbone interact. energy: -0.016 local terms energy: -50.889656 where: bonds (distance) C4'-P energy: -10.257 bonds (distance) P-C4' energy: -14.413 flat angles C4'-P-C4' energy: -11.449 flat angles P-C4'-P energy: -6.728 tors. eta vs tors. theta energy: -8.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -69.481527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.481527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.481527 (E_RNA) where: Base-Base interactions energy: -18.844 where: short stacking energy: -17.017 Base-Backbone interact. energy: -0.176 local terms energy: -50.461357 where: bonds (distance) C4'-P energy: -16.107 bonds (distance) P-C4' energy: -14.162 flat angles C4'-P-C4' energy: -9.863 flat angles P-C4'-P energy: -7.471 tors. eta vs tors. theta energy: -2.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -74.130382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.130382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.130382 (E_RNA) where: Base-Base interactions energy: -29.744 where: short stacking energy: -28.006 Base-Backbone interact. energy: -0.170 local terms energy: -44.216670 where: bonds (distance) C4'-P energy: -11.404 bonds (distance) P-C4' energy: -11.502 flat angles C4'-P-C4' energy: -8.437 flat angles P-C4'-P energy: -7.830 tors. eta vs tors. theta energy: -5.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -184.488344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.488344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.488344 (E_RNA) where: Base-Base interactions energy: -113.386 where: short stacking energy: -50.890 Base-Backbone interact. energy: -0.157 local terms energy: -70.945185 where: bonds (distance) C4'-P energy: -15.300 bonds (distance) P-C4' energy: -15.339 flat angles C4'-P-C4' energy: -13.671 flat angles P-C4'-P energy: -10.664 tors. eta vs tors. theta energy: -15.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -153.575731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.575731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.575731 (E_RNA) where: Base-Base interactions energy: -91.089 where: short stacking energy: -43.545 Base-Backbone interact. energy: -0.177 local terms energy: -62.310440 where: bonds (distance) C4'-P energy: -14.116 bonds (distance) P-C4' energy: -17.588 flat angles C4'-P-C4' energy: -12.837 flat angles P-C4'-P energy: -6.214 tors. eta vs tors. theta energy: -11.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -140.282279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.282279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.282279 (E_RNA) where: Base-Base interactions energy: -77.367 where: short stacking energy: -27.132 Base-Backbone interact. energy: -0.886 local terms energy: -62.028930 where: bonds (distance) C4'-P energy: -17.602 bonds (distance) P-C4' energy: -13.753 flat angles C4'-P-C4' energy: -13.593 flat angles P-C4'-P energy: -10.804 tors. eta vs tors. theta energy: -6.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -160.153720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -160.153720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -160.153720 (E_RNA) where: Base-Base interactions energy: -95.806 where: short stacking energy: -47.713 Base-Backbone interact. energy: -0.026 local terms energy: -64.321588 where: bonds (distance) C4'-P energy: -12.981 bonds (distance) P-C4' energy: -10.233 flat angles C4'-P-C4' energy: -14.828 flat angles P-C4'-P energy: -10.454 tors. eta vs tors. theta energy: -15.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -91.773076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.773076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.773076 (E_RNA) where: Base-Base interactions energy: -41.714 where: short stacking energy: -35.248 Base-Backbone interact. energy: -0.044 local terms energy: -50.014675 where: bonds (distance) C4'-P energy: -10.708 bonds (distance) P-C4' energy: -13.523 flat angles C4'-P-C4' energy: -11.534 flat angles P-C4'-P energy: -9.556 tors. eta vs tors. theta energy: -4.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -158.873378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.873378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.873378 (E_RNA) where: Base-Base interactions energy: -104.642 where: short stacking energy: -44.019 Base-Backbone interact. energy: -0.363 local terms energy: -53.868036 where: bonds (distance) C4'-P energy: -13.772 bonds (distance) P-C4' energy: -12.035 flat angles C4'-P-C4' energy: -10.101 flat angles P-C4'-P energy: -7.524 tors. eta vs tors. theta energy: -10.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -77.410900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.410900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.410900 (E_RNA) where: Base-Base interactions energy: -29.861 where: short stacking energy: -24.395 Base-Backbone interact. energy: -0.143 local terms energy: -47.406719 where: bonds (distance) C4'-P energy: -13.682 bonds (distance) P-C4' energy: -14.656 flat angles C4'-P-C4' energy: -12.691 flat angles P-C4'-P energy: -8.006 tors. eta vs tors. theta energy: 1.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -87.078720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.078720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.078720 (E_RNA) where: Base-Base interactions energy: -45.717 where: short stacking energy: -24.519 Base-Backbone interact. energy: -0.331 local terms energy: -41.031557 where: bonds (distance) C4'-P energy: -8.982 bonds (distance) P-C4' energy: -15.290 flat angles C4'-P-C4' energy: -10.202 flat angles P-C4'-P energy: -4.483 tors. eta vs tors. theta energy: -2.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -69.012527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.012527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.012527 (E_RNA) where: Base-Base interactions energy: -26.468 where: short stacking energy: -16.224 Base-Backbone interact. energy: -0.310 local terms energy: -42.233702 where: bonds (distance) C4'-P energy: -15.218 bonds (distance) P-C4' energy: -17.241 flat angles C4'-P-C4' energy: -9.352 flat angles P-C4'-P energy: -5.759 tors. eta vs tors. theta energy: 5.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -77.379656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.379656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.379656 (E_RNA) where: Base-Base interactions energy: -36.434 where: short stacking energy: -21.053 Base-Backbone interact. energy: 0.269 local terms energy: -41.214560 where: bonds (distance) C4'-P energy: -12.580 bonds (distance) P-C4' energy: -12.318 flat angles C4'-P-C4' energy: -9.098 flat angles P-C4'-P energy: -7.095 tors. eta vs tors. theta energy: -0.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -187.172903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.172903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.172903 (E_RNA) where: Base-Base interactions energy: -113.676 where: short stacking energy: -42.903 Base-Backbone interact. energy: -0.082 local terms energy: -73.414762 where: bonds (distance) C4'-P energy: -16.348 bonds (distance) P-C4' energy: -16.876 flat angles C4'-P-C4' energy: -16.391 flat angles P-C4'-P energy: -9.508 tors. eta vs tors. theta energy: -14.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -180.826371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -180.826371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -180.826371 (E_RNA) where: Base-Base interactions energy: -122.070 where: short stacking energy: -50.518 Base-Backbone interact. energy: -0.288 local terms energy: -58.468285 where: bonds (distance) C4'-P energy: -12.225 bonds (distance) P-C4' energy: -15.521 flat angles C4'-P-C4' energy: -9.697 flat angles P-C4'-P energy: -3.626 tors. eta vs tors. theta energy: -17.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -151.528506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.528506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.528506 (E_RNA) where: Base-Base interactions energy: -87.676 where: short stacking energy: -43.229 Base-Backbone interact. energy: 0.254 local terms energy: -64.106104 where: bonds (distance) C4'-P energy: -15.801 bonds (distance) P-C4' energy: -14.008 flat angles C4'-P-C4' energy: -14.985 flat angles P-C4'-P energy: -9.564 tors. eta vs tors. theta energy: -9.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -170.625147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.625147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.625147 (E_RNA) where: Base-Base interactions energy: -106.213 where: short stacking energy: -50.061 Base-Backbone interact. energy: 0.508 local terms energy: -64.920316 where: bonds (distance) C4'-P energy: -13.756 bonds (distance) P-C4' energy: -16.030 flat angles C4'-P-C4' energy: -9.876 flat angles P-C4'-P energy: -7.989 tors. eta vs tors. theta energy: -17.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -86.365216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.365216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.365216 (E_RNA) where: Base-Base interactions energy: -39.185 where: short stacking energy: -34.885 Base-Backbone interact. energy: 0.271 local terms energy: -47.450883 where: bonds (distance) C4'-P energy: -9.471 bonds (distance) P-C4' energy: -14.505 flat angles C4'-P-C4' energy: -11.557 flat angles P-C4'-P energy: -5.784 tors. eta vs tors. theta energy: -6.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -142.966923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.966923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.966923 (E_RNA) where: Base-Base interactions energy: -93.226 where: short stacking energy: -38.556 Base-Backbone interact. energy: -0.041 local terms energy: -49.699439 where: bonds (distance) C4'-P energy: -7.409 bonds (distance) P-C4' energy: -12.225 flat angles C4'-P-C4' energy: -10.056 flat angles P-C4'-P energy: -7.039 tors. eta vs tors. theta energy: -12.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -78.432001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.432001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.432001 (E_RNA) where: Base-Base interactions energy: -28.543 where: short stacking energy: -28.543 Base-Backbone interact. energy: 0.156 local terms energy: -50.045673 where: bonds (distance) C4'-P energy: -12.377 bonds (distance) P-C4' energy: -13.571 flat angles C4'-P-C4' energy: -10.915 flat angles P-C4'-P energy: -9.579 tors. eta vs tors. theta energy: -3.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -86.323586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -86.323586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -86.323586 (E_RNA) where: Base-Base interactions energy: -36.010 where: short stacking energy: -19.297 Base-Backbone interact. energy: -0.171 local terms energy: -50.142101 where: bonds (distance) C4'-P energy: -14.899 bonds (distance) P-C4' energy: -14.147 flat angles C4'-P-C4' energy: -11.748 flat angles P-C4'-P energy: -7.090 tors. eta vs tors. theta energy: -2.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -75.321705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.321705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.321705 (E_RNA) where: Base-Base interactions energy: -36.182 where: short stacking energy: -16.530 Base-Backbone interact. energy: -0.297 local terms energy: -38.842604 where: bonds (distance) C4'-P energy: -11.981 bonds (distance) P-C4' energy: -14.681 flat angles C4'-P-C4' energy: -13.083 flat angles P-C4'-P energy: -5.039 tors. eta vs tors. theta energy: 5.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -66.102153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -66.102153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -66.102153 (E_RNA) where: Base-Base interactions energy: -18.106 where: short stacking energy: -14.691 Base-Backbone interact. energy: -0.580 local terms energy: -47.416032 where: bonds (distance) C4'-P energy: -13.816 bonds (distance) P-C4' energy: -11.737 flat angles C4'-P-C4' energy: -12.188 flat angles P-C4'-P energy: -8.621 tors. eta vs tors. theta energy: -1.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -185.370068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.370068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.370068 (E_RNA) where: Base-Base interactions energy: -112.160 where: short stacking energy: -49.302 Base-Backbone interact. energy: -1.001 local terms energy: -72.208894 where: bonds (distance) C4'-P energy: -12.639 bonds (distance) P-C4' energy: -16.459 flat angles C4'-P-C4' energy: -15.760 flat angles P-C4'-P energy: -10.208 tors. eta vs tors. theta energy: -17.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -182.279678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.279678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.279678 (E_RNA) where: Base-Base interactions energy: -118.140 where: short stacking energy: -51.684 Base-Backbone interact. energy: -0.452 local terms energy: -63.687260 where: bonds (distance) C4'-P energy: -12.132 bonds (distance) P-C4' energy: -12.275 flat angles C4'-P-C4' energy: -16.436 flat angles P-C4'-P energy: -7.037 tors. eta vs tors. theta energy: -15.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -177.512101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.512101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.512101 (E_RNA) where: Base-Base interactions energy: -110.465 where: short stacking energy: -47.466 Base-Backbone interact. energy: -2.004 local terms energy: -65.042461 where: bonds (distance) C4'-P energy: -14.071 bonds (distance) P-C4' energy: -16.121 flat angles C4'-P-C4' energy: -11.745 flat angles P-C4'-P energy: -10.382 tors. eta vs tors. theta energy: -12.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -145.797379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.797379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.797379 (E_RNA) where: Base-Base interactions energy: -80.267 where: short stacking energy: -39.006 Base-Backbone interact. energy: -0.084 local terms energy: -65.446172 where: bonds (distance) C4'-P energy: -13.922 bonds (distance) P-C4' energy: -16.858 flat angles C4'-P-C4' energy: -15.457 flat angles P-C4'-P energy: -9.520 tors. eta vs tors. theta energy: -9.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -152.561243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.561243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.561243 (E_RNA) where: Base-Base interactions energy: -95.042 where: short stacking energy: -42.660 Base-Backbone interact. energy: -0.158 local terms energy: -57.361107 where: bonds (distance) C4'-P energy: -14.712 bonds (distance) P-C4' energy: -14.011 flat angles C4'-P-C4' energy: -11.289 flat angles P-C4'-P energy: -7.956 tors. eta vs tors. theta energy: -9.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -92.523099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.523099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.523099 (E_RNA) where: Base-Base interactions energy: -41.751 where: short stacking energy: -24.126 Base-Backbone interact. energy: -0.215 local terms energy: -50.556397 where: bonds (distance) C4'-P energy: -11.596 bonds (distance) P-C4' energy: -13.932 flat angles C4'-P-C4' energy: -10.109 flat angles P-C4'-P energy: -7.122 tors. eta vs tors. theta energy: -7.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -88.946092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.946092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.946092 (E_RNA) where: Base-Base interactions energy: -41.926 where: short stacking energy: -31.660 Base-Backbone interact. energy: -0.160 local terms energy: -46.860936 where: bonds (distance) C4'-P energy: -11.851 bonds (distance) P-C4' energy: -14.459 flat angles C4'-P-C4' energy: -6.995 flat angles P-C4'-P energy: -8.432 tors. eta vs tors. theta energy: -5.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -87.052468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.052468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.052468 (E_RNA) where: Base-Base interactions energy: -33.394 where: short stacking energy: -32.605 Base-Backbone interact. energy: -0.009 local terms energy: -53.650151 where: bonds (distance) C4'-P energy: -15.276 bonds (distance) P-C4' energy: -15.536 flat angles C4'-P-C4' energy: -7.620 flat angles P-C4'-P energy: -5.412 tors. eta vs tors. theta energy: -9.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -75.343802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -75.343802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -75.343802 (E_RNA) where: Base-Base interactions energy: -28.768 where: short stacking energy: -16.172 Base-Backbone interact. energy: -0.271 local terms energy: -46.305664 where: bonds (distance) C4'-P energy: -13.114 bonds (distance) P-C4' energy: -13.259 flat angles C4'-P-C4' energy: -13.978 flat angles P-C4'-P energy: -8.233 tors. eta vs tors. theta energy: 2.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -69.754054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.754054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.754054 (E_RNA) where: Base-Base interactions energy: -21.750 where: short stacking energy: -19.822 Base-Backbone interact. energy: 1.003 local terms energy: -49.007085 where: bonds (distance) C4'-P energy: -12.663 bonds (distance) P-C4' energy: -13.517 flat angles C4'-P-C4' energy: -12.543 flat angles P-C4'-P energy: -8.125 tors. eta vs tors. theta energy: -2.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -186.829108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.829108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.829108 (E_RNA) where: Base-Base interactions energy: -114.881 where: short stacking energy: -53.628 Base-Backbone interact. energy: -0.615 local terms energy: -71.333374 where: bonds (distance) C4'-P energy: -16.012 bonds (distance) P-C4' energy: -16.271 flat angles C4'-P-C4' energy: -15.033 flat angles P-C4'-P energy: -8.870 tors. eta vs tors. theta energy: -15.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -179.477142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.477142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.477142 (E_RNA) where: Base-Base interactions energy: -110.870 where: short stacking energy: -41.448 Base-Backbone interact. energy: -0.034 local terms energy: -68.572472 where: bonds (distance) C4'-P energy: -16.571 bonds (distance) P-C4' energy: -15.237 flat angles C4'-P-C4' energy: -12.415 flat angles P-C4'-P energy: -10.715 tors. eta vs tors. theta energy: -13.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -171.436121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.436121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.436121 (E_RNA) where: Base-Base interactions energy: -110.928 where: short stacking energy: -45.465 Base-Backbone interact. energy: 0.289 local terms energy: -60.797109 where: bonds (distance) C4'-P energy: -9.951 bonds (distance) P-C4' energy: -13.353 flat angles C4'-P-C4' energy: -14.457 flat angles P-C4'-P energy: -11.077 tors. eta vs tors. theta energy: -11.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -149.470034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -149.470034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -149.470034 (E_RNA) where: Base-Base interactions energy: -93.454 where: short stacking energy: -39.701 Base-Backbone interact. energy: -0.200 local terms energy: -55.816131 where: bonds (distance) C4'-P energy: -11.943 bonds (distance) P-C4' energy: -16.821 flat angles C4'-P-C4' energy: -11.640 flat angles P-C4'-P energy: -9.945 tors. eta vs tors. theta energy: -5.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -125.887307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -125.887307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.887307 (E_RNA) where: Base-Base interactions energy: -69.701 where: short stacking energy: -32.986 Base-Backbone interact. energy: 0.183 local terms energy: -56.369228 where: bonds (distance) C4'-P energy: -13.343 bonds (distance) P-C4' energy: -13.422 flat angles C4'-P-C4' energy: -15.126 flat angles P-C4'-P energy: -7.856 tors. eta vs tors. theta energy: -6.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -91.308461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -91.308461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -91.308461 (E_RNA) where: Base-Base interactions energy: -36.138 where: short stacking energy: -15.757 Base-Backbone interact. energy: -0.153 local terms energy: -55.017347 where: bonds (distance) C4'-P energy: -15.744 bonds (distance) P-C4' energy: -12.864 flat angles C4'-P-C4' energy: -11.381 flat angles P-C4'-P energy: -7.021 tors. eta vs tors. theta energy: -8.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -106.885196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -106.885196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -106.885196 (E_RNA) where: Base-Base interactions energy: -59.124 where: short stacking energy: -31.418 Base-Backbone interact. energy: -0.411 local terms energy: -47.349660 where: bonds (distance) C4'-P energy: -8.460 bonds (distance) P-C4' energy: -11.133 flat angles C4'-P-C4' energy: -14.680 flat angles P-C4'-P energy: -9.167 tors. eta vs tors. theta energy: -3.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -70.460904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.460904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.460904 (E_RNA) where: Base-Base interactions energy: -24.942 where: short stacking energy: -19.544 Base-Backbone interact. energy: -0.047 local terms energy: -45.471527 where: bonds (distance) C4'-P energy: -10.756 bonds (distance) P-C4' energy: -14.491 flat angles C4'-P-C4' energy: -12.661 flat angles P-C4'-P energy: -4.983 tors. eta vs tors. theta energy: -2.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -77.943050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.943050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.943050 (E_RNA) where: Base-Base interactions energy: -30.004 where: short stacking energy: -30.004 Base-Backbone interact. energy: -0.075 local terms energy: -47.864437 where: bonds (distance) C4'-P energy: -5.640 bonds (distance) P-C4' energy: -14.438 flat angles C4'-P-C4' energy: -12.481 flat angles P-C4'-P energy: -11.250 tors. eta vs tors. theta energy: -4.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -64.716380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -64.716380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -64.716380 (E_RNA) where: Base-Base interactions energy: -17.128 where: short stacking energy: -11.468 Base-Backbone interact. energy: -0.189 local terms energy: -47.399498 where: bonds (distance) C4'-P energy: -13.628 bonds (distance) P-C4' energy: -16.808 flat angles C4'-P-C4' energy: -10.706 flat angles P-C4'-P energy: -9.245 tors. eta vs tors. theta energy: 2.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -183.541413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.541413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.541413 (E_RNA) where: Base-Base interactions energy: -110.262 where: short stacking energy: -53.155 Base-Backbone interact. energy: -0.040 local terms energy: -73.239227 where: bonds (distance) C4'-P energy: -14.178 bonds (distance) P-C4' energy: -14.867 flat angles C4'-P-C4' energy: -12.727 flat angles P-C4'-P energy: -11.485 tors. eta vs tors. theta energy: -19.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -173.844976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.844976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.844976 (E_RNA) where: Base-Base interactions energy: -104.440 where: short stacking energy: -47.700 Base-Backbone interact. energy: -0.841 local terms energy: -68.564260 where: bonds (distance) C4'-P energy: -15.789 bonds (distance) P-C4' energy: -16.146 flat angles C4'-P-C4' energy: -13.596 flat angles P-C4'-P energy: -8.902 tors. eta vs tors. theta energy: -14.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -163.785179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.785179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.785179 (E_RNA) where: Base-Base interactions energy: -92.584 where: short stacking energy: -55.634 Base-Backbone interact. energy: -0.062 local terms energy: -71.139679 where: bonds (distance) C4'-P energy: -12.933 bonds (distance) P-C4' energy: -14.458 flat angles C4'-P-C4' energy: -15.129 flat angles P-C4'-P energy: -13.890 tors. eta vs tors. theta energy: -14.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -142.545157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.545157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.545157 (E_RNA) where: Base-Base interactions energy: -89.066 where: short stacking energy: -47.426 Base-Backbone interact. energy: -0.190 local terms energy: -53.289738 where: bonds (distance) C4'-P energy: -10.717 bonds (distance) P-C4' energy: -9.828 flat angles C4'-P-C4' energy: -12.499 flat angles P-C4'-P energy: -9.534 tors. eta vs tors. theta energy: -10.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -143.584292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.584292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.584292 (E_RNA) where: Base-Base interactions energy: -91.501 where: short stacking energy: -46.706 Base-Backbone interact. energy: -0.145 local terms energy: -51.938287 where: bonds (distance) C4'-P energy: -14.635 bonds (distance) P-C4' energy: -10.190 flat angles C4'-P-C4' energy: -14.222 flat angles P-C4'-P energy: -6.222 tors. eta vs tors. theta energy: -6.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -93.091500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -93.091500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -93.091500 (E_RNA) where: Base-Base interactions energy: -44.011 where: short stacking energy: -30.606 Base-Backbone interact. energy: -0.061 local terms energy: -49.019970 where: bonds (distance) C4'-P energy: -10.195 bonds (distance) P-C4' energy: -13.481 flat angles C4'-P-C4' energy: -11.995 flat angles P-C4'-P energy: -11.711 tors. eta vs tors. theta energy: -1.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -84.791815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.791815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.791815 (E_RNA) where: Base-Base interactions energy: -34.684 where: short stacking energy: -24.905 Base-Backbone interact. energy: -0.228 local terms energy: -49.879340 where: bonds (distance) C4'-P energy: -11.979 bonds (distance) P-C4' energy: -13.902 flat angles C4'-P-C4' energy: -12.247 flat angles P-C4'-P energy: -7.332 tors. eta vs tors. theta energy: -4.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -73.650502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -73.650502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -73.650502 (E_RNA) where: Base-Base interactions energy: -29.086 where: short stacking energy: -18.938 Base-Backbone interact. energy: -0.083 local terms energy: -44.481764 where: bonds (distance) C4'-P energy: -10.142 bonds (distance) P-C4' energy: -12.251 flat angles C4'-P-C4' energy: -10.719 flat angles P-C4'-P energy: -7.307 tors. eta vs tors. theta energy: -4.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -69.955798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.955798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.955798 (E_RNA) where: Base-Base interactions energy: -23.453 where: short stacking energy: -22.161 Base-Backbone interact. energy: -0.144 local terms energy: -46.359205 where: bonds (distance) C4'-P energy: -12.342 bonds (distance) P-C4' energy: -11.676 flat angles C4'-P-C4' energy: -9.826 flat angles P-C4'-P energy: -9.349 tors. eta vs tors. theta energy: -3.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -112.822039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -112.822039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -112.822039 (E_RNA) where: Base-Base interactions energy: -56.627 where: short stacking energy: -31.040 Base-Backbone interact. energy: -0.277 local terms energy: -55.917897 where: bonds (distance) C4'-P energy: -15.305 bonds (distance) P-C4' energy: -15.199 flat angles C4'-P-C4' energy: -14.855 flat angles P-C4'-P energy: -6.103 tors. eta vs tors. theta energy: -4.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -183.643818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.643818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.643818 (E_RNA) where: Base-Base interactions energy: -107.934 where: short stacking energy: -55.729 Base-Backbone interact. energy: -0.004 local terms energy: -75.705431 where: bonds (distance) C4'-P energy: -13.114 bonds (distance) P-C4' energy: -16.033 flat angles C4'-P-C4' energy: -16.867 flat angles P-C4'-P energy: -9.409 tors. eta vs tors. theta energy: -20.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -183.879890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -183.879890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -183.879890 (E_RNA) where: Base-Base interactions energy: -112.197 where: short stacking energy: -54.383 Base-Backbone interact. energy: -2.896 local terms energy: -68.787013 where: bonds (distance) C4'-P energy: -12.652 bonds (distance) P-C4' energy: -13.983 flat angles C4'-P-C4' energy: -15.645 flat angles P-C4'-P energy: -8.140 tors. eta vs tors. theta energy: -18.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -155.282539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.282539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.282539 (E_RNA) where: Base-Base interactions energy: -99.680 where: short stacking energy: -33.961 Base-Backbone interact. energy: -0.276 local terms energy: -55.326235 where: bonds (distance) C4'-P energy: -10.826 bonds (distance) P-C4' energy: -15.547 flat angles C4'-P-C4' energy: -14.272 flat angles P-C4'-P energy: -8.043 tors. eta vs tors. theta energy: -6.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -145.675292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.675292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.675292 (E_RNA) where: Base-Base interactions energy: -81.225 where: short stacking energy: -40.425 Base-Backbone interact. energy: -1.164 local terms energy: -63.286842 where: bonds (distance) C4'-P energy: -14.633 bonds (distance) P-C4' energy: -16.563 flat angles C4'-P-C4' energy: -14.673 flat angles P-C4'-P energy: -6.023 tors. eta vs tors. theta energy: -11.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -121.723931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.723931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.723931 (E_RNA) where: Base-Base interactions energy: -68.381 where: short stacking energy: -38.099 Base-Backbone interact. energy: -0.118 local terms energy: -53.225094 where: bonds (distance) C4'-P energy: -15.512 bonds (distance) P-C4' energy: -13.591 flat angles C4'-P-C4' energy: -11.277 flat angles P-C4'-P energy: -3.019 tors. eta vs tors. theta energy: -9.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -90.915003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -90.915003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -90.915003 (E_RNA) where: Base-Base interactions energy: -33.743 where: short stacking energy: -31.064 Base-Backbone interact. energy: 0.134 local terms energy: -57.306100 where: bonds (distance) C4'-P energy: -15.075 bonds (distance) P-C4' energy: -14.910 flat angles C4'-P-C4' energy: -13.709 flat angles P-C4'-P energy: -9.988 tors. eta vs tors. theta energy: -3.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -94.198841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.198841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.198841 (E_RNA) where: Base-Base interactions energy: -42.022 where: short stacking energy: -23.097 Base-Backbone interact. energy: 0.672 local terms energy: -52.848524 where: bonds (distance) C4'-P energy: -14.518 bonds (distance) P-C4' energy: -11.446 flat angles C4'-P-C4' energy: -11.753 flat angles P-C4'-P energy: -11.318 tors. eta vs tors. theta energy: -3.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -83.170442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -83.170442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -83.170442 (E_RNA) where: Base-Base interactions energy: -39.589 where: short stacking energy: -21.078 Base-Backbone interact. energy: -0.687 local terms energy: -42.894600 where: bonds (distance) C4'-P energy: -13.139 bonds (distance) P-C4' energy: -14.917 flat angles C4'-P-C4' energy: -10.670 flat angles P-C4'-P energy: -3.350 tors. eta vs tors. theta energy: -0.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -69.000429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.000429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.000429 (E_RNA) where: Base-Base interactions energy: -22.180 where: short stacking energy: -16.026 Base-Backbone interact. energy: 2.451 local terms energy: -49.271450 where: bonds (distance) C4'-P energy: -9.934 bonds (distance) P-C4' energy: -17.516 flat angles C4'-P-C4' energy: -9.054 flat angles P-C4'-P energy: -4.845 tors. eta vs tors. theta energy: -7.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -70.112697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.112697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.112697 (E_RNA) where: Base-Base interactions energy: -25.603 where: short stacking energy: -24.608 Base-Backbone interact. energy: -0.074 local terms energy: -44.435668 where: bonds (distance) C4'-P energy: -9.979 bonds (distance) P-C4' energy: -13.652 flat angles C4'-P-C4' energy: -9.141 flat angles P-C4'-P energy: -7.281 tors. eta vs tors. theta energy: -4.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -192.805882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -192.805882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -192.805882 (E_RNA) where: Base-Base interactions energy: -113.999 where: short stacking energy: -57.851 Base-Backbone interact. energy: -0.094 local terms energy: -78.712879 where: bonds (distance) C4'-P energy: -14.402 bonds (distance) P-C4' energy: -16.183 flat angles C4'-P-C4' energy: -14.803 flat angles P-C4'-P energy: -12.067 tors. eta vs tors. theta energy: -21.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -175.200304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -175.200304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -175.200304 (E_RNA) where: Base-Base interactions energy: -105.870 where: short stacking energy: -52.964 Base-Backbone interact. energy: -0.890 local terms energy: -68.440001 where: bonds (distance) C4'-P energy: -11.276 bonds (distance) P-C4' energy: -15.766 flat angles C4'-P-C4' energy: -16.217 flat angles P-C4'-P energy: -8.743 tors. eta vs tors. theta energy: -16.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -166.560911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -166.560911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -166.560911 (E_RNA) where: Base-Base interactions energy: -101.018 where: short stacking energy: -52.931 Base-Backbone interact. energy: -0.734 local terms energy: -64.808298 where: bonds (distance) C4'-P energy: -11.915 bonds (distance) P-C4' energy: -12.805 flat angles C4'-P-C4' energy: -15.829 flat angles P-C4'-P energy: -11.087 tors. eta vs tors. theta energy: -13.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -134.837199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.837199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.837199 (E_RNA) where: Base-Base interactions energy: -72.782 where: short stacking energy: -42.659 Base-Backbone interact. energy: -0.018 local terms energy: -62.037881 where: bonds (distance) C4'-P energy: -16.096 bonds (distance) P-C4' energy: -13.281 flat angles C4'-P-C4' energy: -8.587 flat angles P-C4'-P energy: -12.110 tors. eta vs tors. theta energy: -11.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -140.253644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.253644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.253644 (E_RNA) where: Base-Base interactions energy: -76.525 where: short stacking energy: -43.674 Base-Backbone interact. energy: -0.022 local terms energy: -63.707042 where: bonds (distance) C4'-P energy: -11.489 bonds (distance) P-C4' energy: -13.249 flat angles C4'-P-C4' energy: -17.316 flat angles P-C4'-P energy: -7.078 tors. eta vs tors. theta energy: -14.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -87.765488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.765488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.765488 (E_RNA) where: Base-Base interactions energy: -30.399 where: short stacking energy: -18.208 Base-Backbone interact. energy: -0.239 local terms energy: -57.127975 where: bonds (distance) C4'-P energy: -15.308 bonds (distance) P-C4' energy: -17.348 flat angles C4'-P-C4' energy: -13.071 flat angles P-C4'-P energy: -8.409 tors. eta vs tors. theta energy: -2.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -89.468114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.468114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.468114 (E_RNA) where: Base-Base interactions energy: -37.671 where: short stacking energy: -21.296 Base-Backbone interact. energy: -0.664 local terms energy: -51.133286 where: bonds (distance) C4'-P energy: -12.204 bonds (distance) P-C4' energy: -15.895 flat angles C4'-P-C4' energy: -14.638 flat angles P-C4'-P energy: -7.298 tors. eta vs tors. theta energy: -1.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -87.714634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -87.714634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -87.714634 (E_RNA) where: Base-Base interactions energy: -37.933 where: short stacking energy: -33.096 Base-Backbone interact. energy: -0.086 local terms energy: -49.696366 where: bonds (distance) C4'-P energy: -9.168 bonds (distance) P-C4' energy: -14.227 flat angles C4'-P-C4' energy: -13.026 flat angles P-C4'-P energy: -5.159 tors. eta vs tors. theta energy: -8.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -79.140289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -79.140289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -79.140289 (E_RNA) where: Base-Base interactions energy: -27.893 where: short stacking energy: -22.108 Base-Backbone interact. energy: -0.196 local terms energy: -51.051729 where: bonds (distance) C4'-P energy: -14.013 bonds (distance) P-C4' energy: -15.407 flat angles C4'-P-C4' energy: -9.416 flat angles P-C4'-P energy: -5.836 tors. eta vs tors. theta energy: -6.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -74.787111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.787111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -74.787111 (E_RNA) where: Base-Base interactions energy: -30.474 where: short stacking energy: -17.062 Base-Backbone interact. energy: 0.424 local terms energy: -44.736951 where: bonds (distance) C4'-P energy: -12.946 bonds (distance) P-C4' energy: -11.487 flat angles C4'-P-C4' energy: -13.098 flat angles P-C4'-P energy: -4.750 tors. eta vs tors. theta energy: -2.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -193.147754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -193.147754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -193.147754 (E_RNA) where: Base-Base interactions energy: -115.561 where: short stacking energy: -64.076 Base-Backbone interact. energy: -0.607 local terms energy: -76.980015 where: bonds (distance) C4'-P energy: -13.231 bonds (distance) P-C4' energy: -17.545 flat angles C4'-P-C4' energy: -13.937 flat angles P-C4'-P energy: -12.235 tors. eta vs tors. theta energy: -20.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -177.105430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -177.105430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -177.105430 (E_RNA) where: Base-Base interactions energy: -99.325 where: short stacking energy: -51.993 Base-Backbone interact. energy: -0.060 local terms energy: -77.720976 where: bonds (distance) C4'-P energy: -16.641 bonds (distance) P-C4' energy: -16.404 flat angles C4'-P-C4' energy: -16.225 flat angles P-C4'-P energy: -12.719 tors. eta vs tors. theta energy: -15.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -170.306367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -170.306367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -170.306367 (E_RNA) where: Base-Base interactions energy: -102.884 where: short stacking energy: -47.747 Base-Backbone interact. energy: -1.379 local terms energy: -66.043245 where: bonds (distance) C4'-P energy: -13.608 bonds (distance) P-C4' energy: -17.026 flat angles C4'-P-C4' energy: -12.864 flat angles P-C4'-P energy: -9.132 tors. eta vs tors. theta energy: -13.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -142.234388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.234388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.234388 (E_RNA) where: Base-Base interactions energy: -77.477 where: short stacking energy: -40.805 Base-Backbone interact. energy: -0.057 local terms energy: -64.699968 where: bonds (distance) C4'-P energy: -17.096 bonds (distance) P-C4' energy: -12.913 flat angles C4'-P-C4' energy: -14.633 flat angles P-C4'-P energy: -7.448 tors. eta vs tors. theta energy: -12.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -133.805834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.805834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.805834 (E_RNA) where: Base-Base interactions energy: -72.538 where: short stacking energy: -37.843 Base-Backbone interact. energy: -0.153 local terms energy: -61.114141 where: bonds (distance) C4'-P energy: -14.058 bonds (distance) P-C4' energy: -12.014 flat angles C4'-P-C4' energy: -14.478 flat angles P-C4'-P energy: -10.174 tors. eta vs tors. theta energy: -10.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -82.991828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.991828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.991828 (E_RNA) where: Base-Base interactions energy: -26.930 where: short stacking energy: -26.910 Base-Backbone interact. energy: -0.089 local terms energy: -55.973199 where: bonds (distance) C4'-P energy: -10.756 bonds (distance) P-C4' energy: -17.041 flat angles C4'-P-C4' energy: -11.617 flat angles P-C4'-P energy: -11.490 tors. eta vs tors. theta energy: -5.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -95.593598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -95.593598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -95.593598 (E_RNA) where: Base-Base interactions energy: -37.136 where: short stacking energy: -24.197 Base-Backbone interact. energy: -0.255 local terms energy: -58.202670 where: bonds (distance) C4'-P energy: -11.259 bonds (distance) P-C4' energy: -11.871 flat angles C4'-P-C4' energy: -11.693 flat angles P-C4'-P energy: -13.189 tors. eta vs tors. theta energy: -10.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -80.486274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.486274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.486274 (E_RNA) where: Base-Base interactions energy: -35.932 where: short stacking energy: -26.153 Base-Backbone interact. energy: -0.169 local terms energy: -44.385378 where: bonds (distance) C4'-P energy: -11.761 bonds (distance) P-C4' energy: -9.927 flat angles C4'-P-C4' energy: -10.164 flat angles P-C4'-P energy: -7.209 tors. eta vs tors. theta energy: -5.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -70.052992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.052992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.052992 (E_RNA) where: Base-Base interactions energy: -20.566 where: short stacking energy: -15.757 Base-Backbone interact. energy: -1.291 local terms energy: -48.195862 where: bonds (distance) C4'-P energy: -11.471 bonds (distance) P-C4' energy: -12.812 flat angles C4'-P-C4' energy: -14.012 flat angles P-C4'-P energy: -10.686 tors. eta vs tors. theta energy: 0.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -70.716211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.716211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.716211 (E_RNA) where: Base-Base interactions energy: -15.814 where: short stacking energy: -15.814 Base-Backbone interact. energy: -0.196 local terms energy: -54.706193 where: bonds (distance) C4'-P energy: -14.182 bonds (distance) P-C4' energy: -11.888 flat angles C4'-P-C4' energy: -15.731 flat angles P-C4'-P energy: -12.580 tors. eta vs tors. theta energy: -0.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -187.870058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.870058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.870058 (E_RNA) where: Base-Base interactions energy: -116.430 where: short stacking energy: -58.197 Base-Backbone interact. energy: -0.002 local terms energy: -71.437225 where: bonds (distance) C4'-P energy: -12.360 bonds (distance) P-C4' energy: -15.624 flat angles C4'-P-C4' energy: -14.111 flat angles P-C4'-P energy: -10.901 tors. eta vs tors. theta energy: -18.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -182.826106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.826106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.826106 (E_RNA) where: Base-Base interactions energy: -110.426 where: short stacking energy: -62.771 Base-Backbone interact. energy: -0.218 local terms energy: -72.181643 where: bonds (distance) C4'-P energy: -13.624 bonds (distance) P-C4' energy: -16.156 flat angles C4'-P-C4' energy: -14.227 flat angles P-C4'-P energy: -10.138 tors. eta vs tors. theta energy: -18.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -142.904946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.904946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.904946 (E_RNA) where: Base-Base interactions energy: -79.862 where: short stacking energy: -42.689 Base-Backbone interact. energy: -0.112 local terms energy: -62.931672 where: bonds (distance) C4'-P energy: -11.197 bonds (distance) P-C4' energy: -13.070 flat angles C4'-P-C4' energy: -16.730 flat angles P-C4'-P energy: -12.186 tors. eta vs tors. theta energy: -9.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -133.594508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.594508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.594508 (E_RNA) where: Base-Base interactions energy: -74.232 where: short stacking energy: -37.177 Base-Backbone interact. energy: -0.157 local terms energy: -59.205445 where: bonds (distance) C4'-P energy: -17.130 bonds (distance) P-C4' energy: -14.807 flat angles C4'-P-C4' energy: -12.833 flat angles P-C4'-P energy: -8.401 tors. eta vs tors. theta energy: -6.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -92.918590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -92.918590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -92.918590 (E_RNA) where: Base-Base interactions energy: -32.964 where: short stacking energy: -24.790 Base-Backbone interact. energy: -0.355 local terms energy: -59.600064 where: bonds (distance) C4'-P energy: -11.104 bonds (distance) P-C4' energy: -16.646 flat angles C4'-P-C4' energy: -12.954 flat angles P-C4'-P energy: -11.000 tors. eta vs tors. theta energy: -7.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -127.846867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.846867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.846867 (E_RNA) where: Base-Base interactions energy: -67.213 where: short stacking energy: -35.242 Base-Backbone interact. energy: -0.151 local terms energy: -60.482379 where: bonds (distance) C4'-P energy: -16.898 bonds (distance) P-C4' energy: -16.244 flat angles C4'-P-C4' energy: -12.745 flat angles P-C4'-P energy: -5.634 tors. eta vs tors. theta energy: -8.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -84.183376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.183376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.183376 (E_RNA) where: Base-Base interactions energy: -33.456 where: short stacking energy: -25.348 Base-Backbone interact. energy: 1.899 local terms energy: -52.626675 where: bonds (distance) C4'-P energy: -12.547 bonds (distance) P-C4' energy: -15.935 flat angles C4'-P-C4' energy: -14.233 flat angles P-C4'-P energy: -10.249 tors. eta vs tors. theta energy: 0.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -80.503701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -80.503701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -80.503701 (E_RNA) where: Base-Base interactions energy: -28.885 where: short stacking energy: -28.885 Base-Backbone interact. energy: -0.016 local terms energy: -51.602424 where: bonds (distance) C4'-P energy: -11.558 bonds (distance) P-C4' energy: -14.349 flat angles C4'-P-C4' energy: -11.354 flat angles P-C4'-P energy: -10.104 tors. eta vs tors. theta energy: -4.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -89.296925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.296925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.296925 (E_RNA) where: Base-Base interactions energy: -43.751 where: short stacking energy: -22.597 Base-Backbone interact. energy: -0.264 local terms energy: -45.282291 where: bonds (distance) C4'-P energy: -12.787 bonds (distance) P-C4' energy: -10.142 flat angles C4'-P-C4' energy: -9.978 flat angles P-C4'-P energy: -10.839 tors. eta vs tors. theta energy: -1.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -70.053186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -70.053186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -70.053186 (E_RNA) where: Base-Base interactions energy: -30.241 where: short stacking energy: -22.992 Base-Backbone interact. energy: -0.183 local terms energy: -39.629217 where: bonds (distance) C4'-P energy: -4.888 bonds (distance) P-C4' energy: -10.257 flat angles C4'-P-C4' energy: -14.133 flat angles P-C4'-P energy: -4.837 tors. eta vs tors. theta energy: -5.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -185.340382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -185.340382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -185.340382 (E_RNA) where: Base-Base interactions energy: -117.510 where: short stacking energy: -59.686 Base-Backbone interact. energy: -0.542 local terms energy: -67.287731 where: bonds (distance) C4'-P energy: -11.955 bonds (distance) P-C4' energy: -13.554 flat angles C4'-P-C4' energy: -15.415 flat angles P-C4'-P energy: -7.180 tors. eta vs tors. theta energy: -19.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -155.706835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.706835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.706835 (E_RNA) where: Base-Base interactions energy: -86.654 where: short stacking energy: -44.780 Base-Backbone interact. energy: -1.020 local terms energy: -68.032809 where: bonds (distance) C4'-P energy: -14.298 bonds (distance) P-C4' energy: -17.334 flat angles C4'-P-C4' energy: -14.245 flat angles P-C4'-P energy: -8.116 tors. eta vs tors. theta energy: -14.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -182.633257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -182.633257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -182.633257 (E_RNA) where: Base-Base interactions energy: -113.150 where: short stacking energy: -51.804 Base-Backbone interact. energy: -0.003 local terms energy: -69.480607 where: bonds (distance) C4'-P energy: -13.702 bonds (distance) P-C4' energy: -17.259 flat angles C4'-P-C4' energy: -14.310 flat angles P-C4'-P energy: -7.398 tors. eta vs tors. theta energy: -16.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -133.011361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.011361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.011361 (E_RNA) where: Base-Base interactions energy: -68.448 where: short stacking energy: -40.404 Base-Backbone interact. energy: -0.002 local terms energy: -64.561640 where: bonds (distance) C4'-P energy: -16.856 bonds (distance) P-C4' energy: -14.205 flat angles C4'-P-C4' energy: -16.661 flat angles P-C4'-P energy: -6.319 tors. eta vs tors. theta energy: -10.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -94.464406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -94.464406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -94.464406 (E_RNA) where: Base-Base interactions energy: -35.947 where: short stacking energy: -31.800 Base-Backbone interact. energy: -0.188 local terms energy: -58.329212 where: bonds (distance) C4'-P energy: -16.314 bonds (distance) P-C4' energy: -12.993 flat angles C4'-P-C4' energy: -10.050 flat angles P-C4'-P energy: -10.689 tors. eta vs tors. theta energy: -8.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -123.875950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -123.875950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -123.875950 (E_RNA) where: Base-Base interactions energy: -63.703 where: short stacking energy: -32.924 Base-Backbone interact. energy: -0.102 local terms energy: -60.071415 where: bonds (distance) C4'-P energy: -16.365 bonds (distance) P-C4' energy: -15.480 flat angles C4'-P-C4' energy: -8.762 flat angles P-C4'-P energy: -7.781 tors. eta vs tors. theta energy: -11.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -84.560645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -84.560645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -84.560645 (E_RNA) where: Base-Base interactions energy: -35.734 where: short stacking energy: -24.844 Base-Backbone interact. energy: -0.095 local terms energy: -48.732156 where: bonds (distance) C4'-P energy: -13.089 bonds (distance) P-C4' energy: -12.201 flat angles C4'-P-C4' energy: -13.516 flat angles P-C4'-P energy: -6.920 tors. eta vs tors. theta energy: -3.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -82.886826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -82.886826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -82.886826 (E_RNA) where: Base-Base interactions energy: -32.830 where: short stacking energy: -32.830 Base-Backbone interact. energy: -0.145 local terms energy: -49.911397 where: bonds (distance) C4'-P energy: -9.890 bonds (distance) P-C4' energy: -15.938 flat angles C4'-P-C4' energy: -8.723 flat angles P-C4'-P energy: -9.589 tors. eta vs tors. theta energy: -5.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -81.543051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.543051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.543051 (E_RNA) where: Base-Base interactions energy: -28.186 where: short stacking energy: -28.186 Base-Backbone interact. energy: -0.222 local terms energy: -53.135221 where: bonds (distance) C4'-P energy: -9.141 bonds (distance) P-C4' energy: -15.709 flat angles C4'-P-C4' energy: -16.441 flat angles P-C4'-P energy: -10.701 tors. eta vs tors. theta energy: -1.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -69.471772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -69.471772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -69.471772 (E_RNA) where: Base-Base interactions energy: -20.006 where: short stacking energy: -18.549 Base-Backbone interact. energy: -0.915 local terms energy: -48.550957 where: bonds (distance) C4'-P energy: -14.485 bonds (distance) P-C4' energy: -12.993 flat angles C4'-P-C4' energy: -8.756 flat angles P-C4'-P energy: -9.621 tors. eta vs tors. theta energy: -2.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -189.614953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.614953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.614953 (E_RNA) where: Base-Base interactions energy: -114.814 where: short stacking energy: -57.827 Base-Backbone interact. energy: 0.184 local terms energy: -74.985403 where: bonds (distance) C4'-P energy: -14.315 bonds (distance) P-C4' energy: -12.760 flat angles C4'-P-C4' energy: -17.456 flat angles P-C4'-P energy: -12.167 tors. eta vs tors. theta energy: -18.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -144.961646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.961646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.961646 (E_RNA) where: Base-Base interactions energy: -85.861 where: short stacking energy: -46.533 Base-Backbone interact. energy: -0.067 local terms energy: -59.033299 where: bonds (distance) C4'-P energy: -13.127 bonds (distance) P-C4' energy: -16.220 flat angles C4'-P-C4' energy: -7.858 flat angles P-C4'-P energy: -9.204 tors. eta vs tors. theta energy: -12.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -187.302804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -187.302804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -187.302804 (E_RNA) where: Base-Base interactions energy: -111.618 where: short stacking energy: -60.573 Base-Backbone interact. energy: -0.006 local terms energy: -75.678598 where: bonds (distance) C4'-P energy: -13.707 bonds (distance) P-C4' energy: -16.189 flat angles C4'-P-C4' energy: -15.433 flat angles P-C4'-P energy: -10.427 tors. eta vs tors. theta energy: -19.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -152.139009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -152.139009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -152.139009 (E_RNA) where: Base-Base interactions energy: -95.592 where: short stacking energy: -46.957 Base-Backbone interact. energy: -1.162 local terms energy: -55.385256 where: bonds (distance) C4'-P energy: -10.338 bonds (distance) P-C4' energy: -12.440 flat angles C4'-P-C4' energy: -13.385 flat angles P-C4'-P energy: -8.717 tors. eta vs tors. theta energy: -10.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -136.554018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.554018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.554018 (E_RNA) where: Base-Base interactions energy: -77.457 where: short stacking energy: -47.120 Base-Backbone interact. energy: 0.357 local terms energy: -59.454534 where: bonds (distance) C4'-P energy: -10.932 bonds (distance) P-C4' energy: -12.936 flat angles C4'-P-C4' energy: -14.365 flat angles P-C4'-P energy: -10.605 tors. eta vs tors. theta energy: -10.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -89.457986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -89.457986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -89.457986 (E_RNA) where: Base-Base interactions energy: -37.816 where: short stacking energy: -28.499 Base-Backbone interact. energy: 0.703 local terms energy: -52.345438 where: bonds (distance) C4'-P energy: -13.695 bonds (distance) P-C4' energy: -11.437 flat angles C4'-P-C4' energy: -10.278 flat angles P-C4'-P energy: -8.924 tors. eta vs tors. theta energy: -8.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -78.661050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.661050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.661050 (E_RNA) where: Base-Base interactions energy: -27.976 where: short stacking energy: -27.976 Base-Backbone interact. energy: -0.222 local terms energy: -50.462983 where: bonds (distance) C4'-P energy: -11.255 bonds (distance) P-C4' energy: -11.173 flat angles C4'-P-C4' energy: -14.445 flat angles P-C4'-P energy: -8.547 tors. eta vs tors. theta energy: -5.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -88.906340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -88.906340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -88.906340 (E_RNA) where: Base-Base interactions energy: -35.524 where: short stacking energy: -30.864 Base-Backbone interact. energy: -0.114 local terms energy: -53.268409 where: bonds (distance) C4'-P energy: -13.797 bonds (distance) P-C4' energy: -8.902 flat angles C4'-P-C4' energy: -12.536 flat angles P-C4'-P energy: -7.446 tors. eta vs tors. theta energy: -10.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -76.509243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -76.509243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -76.509243 (E_RNA) where: Base-Base interactions energy: -40.672 where: short stacking energy: -19.849 Base-Backbone interact. energy: 1.132 local terms energy: -36.968975 where: bonds (distance) C4'-P energy: -11.089 bonds (distance) P-C4' energy: -11.993 flat angles C4'-P-C4' energy: -1.029 flat angles P-C4'-P energy: -8.003 tors. eta vs tors. theta energy: -4.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -67.051724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -67.051724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -67.051724 (E_RNA) where: Base-Base interactions energy: -23.126 where: short stacking energy: -22.153 Base-Backbone interact. energy: -0.102 local terms energy: -43.823939 where: bonds (distance) C4'-P energy: -9.680 bonds (distance) P-C4' energy: -16.798 flat angles C4'-P-C4' energy: -11.302 flat angles P-C4'-P energy: -1.120 tors. eta vs tors. theta energy: -4.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -184.144131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -184.144131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -184.144131 (E_RNA) where: Base-Base interactions energy: -116.998 where: short stacking energy: -47.249 Base-Backbone interact. energy: 1.065 local terms energy: -68.210922 where: bonds (distance) C4'-P energy: -13.413 bonds (distance) P-C4' energy: -15.057 flat angles C4'-P-C4' energy: -17.001 flat angles P-C4'-P energy: -9.523 tors. eta vs tors. theta energy: -13.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -191.026677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -191.026677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -191.026677 (E_RNA) where: Base-Base interactions energy: -117.531 where: short stacking energy: -61.953 Base-Backbone interact. energy: -0.012 local terms energy: -73.483491 where: bonds (distance) C4'-P energy: -15.548 bonds (distance) P-C4' energy: -13.648 flat angles C4'-P-C4' energy: -15.863 flat angles P-C4'-P energy: -10.645 tors. eta vs tors. theta energy: -17.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -146.486365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.486365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.486365 (E_RNA) where: Base-Base interactions energy: -88.539 where: short stacking energy: -47.686 Base-Backbone interact. energy: -0.101 local terms energy: -57.846695 where: bonds (distance) C4'-P energy: -13.698 bonds (distance) P-C4' energy: -16.031 flat angles C4'-P-C4' energy: -10.916 flat angles P-C4'-P energy: -6.043 tors. eta vs tors. theta energy: -11.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -135.091604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.091604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.091604 (E_RNA) where: Base-Base interactions energy: -71.750 where: short stacking energy: -28.186 Base-Backbone interact. energy: -0.010 local terms energy: -63.331402 where: bonds (distance) C4'-P energy: -14.474 bonds (distance) P-C4' energy: -15.125 flat angles C4'-P-C4' energy: -14.087 flat angles P-C4'-P energy: -8.555 tors. eta vs tors. theta energy: -11.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -153.512401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.512401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.512401 (E_RNA) where: Base-Base interactions energy: -91.973 where: short stacking energy: -45.155 Base-Backbone interact. energy: -0.852 local terms energy: -60.687185 where: bonds (distance) C4'-P energy: -10.553 bonds (distance) P-C4' energy: -17.122 flat angles C4'-P-C4' energy: -12.073 flat angles P-C4'-P energy: -7.571 tors. eta vs tors. theta energy: -13.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -96.114977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -96.114977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -96.114977 (E_RNA) where: Base-Base interactions energy: -39.884 where: short stacking energy: -33.651 Base-Backbone interact. energy: -0.569 local terms energy: -55.662093 where: bonds (distance) C4'-P energy: -11.534 bonds (distance) P-C4' energy: -16.386 flat angles C4'-P-C4' energy: -14.808 flat angles P-C4'-P energy: -6.841 tors. eta vs tors. theta energy: -6.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -81.676382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -81.676382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -81.676382 (E_RNA) where: Base-Base interactions energy: -32.946 where: short stacking energy: -18.858 Base-Backbone interact. energy: -0.011 local terms energy: -48.719469 where: bonds (distance) C4'-P energy: -13.408 bonds (distance) P-C4' energy: -14.321 flat angles C4'-P-C4' energy: -9.233 flat angles P-C4'-P energy: -7.982 tors. eta vs tors. theta energy: -3.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -78.114842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -78.114842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -78.114842 (E_RNA) where: Base-Base interactions energy: -32.155 where: short stacking energy: -31.073 Base-Backbone interact. energy: -0.035 local terms energy: -45.925268 where: bonds (distance) C4'-P energy: -9.131 bonds (distance) P-C4' energy: -9.454 flat angles C4'-P-C4' energy: -14.690 flat angles P-C4'-P energy: -6.804 tors. eta vs tors. theta energy: -5.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -77.946094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -77.946094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -77.946094 (E_RNA) where: Base-Base interactions energy: -21.658 where: short stacking energy: -15.296 Base-Backbone interact. energy: -0.356 local terms energy: -55.932297 where: bonds (distance) C4'-P energy: -8.916 bonds (distance) P-C4' energy: -15.128 flat angles C4'-P-C4' energy: -12.766 flat angles P-C4'-P energy: -8.616 tors. eta vs tors. theta energy: -10.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -71.832879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -71.832879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -71.832879 (E_RNA) where: Base-Base interactions energy: -34.927 where: short stacking energy: -20.110 Base-Backbone interact. energy: -0.679 local terms energy: -36.227735 where: bonds (distance) C4'-P energy: -12.084 bonds (distance) P-C4' energy: -13.688 flat angles C4'-P-C4' energy: -10.006 flat angles P-C4'-P energy: -5.436 tors. eta vs tors. theta energy: 4.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 2 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 3667130 moves confirmed later: 4384652 all moves confirmed: 8051782 percent of confirmed moves: 5.032364 current total energy: -151.041712 recalc. total energy: -151.041712 replica 6 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 2745033 moves confirmed later: 3095314 all moves confirmed: 5840347 percent of confirmed moves: 3.650217 current total energy: -129.493014 recalc. total energy: -129.493014 replica 1 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 3190470 moves confirmed later: 3770096 all moves confirmed: 6960566 percent of confirmed moves: 4.350354 current total energy: -110.747092 recalc. total energy: -110.747092 replica 7 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 4458341 moves confirmed later: 5508581 all moves confirmed: 9966922 percent of confirmed moves: 6.229326 current total energy: -99.224811 recalc. total energy: -99.224811 replica 8 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 4983662 moves confirmed later: 6198165 all moves confirmed: 11181827 percent of confirmed moves: 6.988642 current total energy: -48.864915 recalc. total energy: -48.864915 replica 5 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 3516861 moves confirmed later: 4220127 all moves confirmed: 7736988 percent of confirmed moves: 4.835617 current total energy: -70.658360 recalc. total energy: -70.658360 replica 10 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 4908944 moves confirmed later: 6077211 all moves confirmed: 10986155 percent of confirmed moves: 6.866347 current total energy: -41.342983 recalc. total energy: -41.342983 replica 4 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 4650068 moves confirmed later: 5751570 all moves confirmed: 10401638 percent of confirmed moves: 6.501024 current total energy: -41.204876 recalc. total energy: -41.204876 replica 3 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 3860000 moves confirmed later: 4668846 all moves confirmed: 8528846 percent of confirmed moves: 5.330529 current total energy: -35.187509 recalc. total energy: -35.187509 replica 9 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 4970561 moves confirmed later: 6196982 all moves confirmed: 11167543 percent of confirmed moves: 6.979714 current total energy: -27.260357 recalc. total energy: -27.260357 out arg RESULTS//1/1-79e153c5_01 Time of doing 1600000 iterations: 260.665 seconds